Phenotype locking and switching mechanisms in stem cells and stem-cell derived immune cells

By integrating a polarization state-specific promoter and payload into a STAPLR locus in PSCs, the challenge of maintaining therapeutic payload expression in immune cells is addressed, ensuring sustained and environmentally responsive therapy efficacy.

WO2026006316A2PCT designated stage Publication Date: 2026-01-02SENTI BIOSCI INC +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/035053
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-25
Filing Date
2025-06-24
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Existing immune cell-based therapies face challenges in maintaining therapeutic payload expression due to environmental changes, and progenitor cells like iPSCs often experience substantial reduction in transgene expression after differentiation.

Method used

Engineering pluripotent stem cells (PSCs) with targeting constructs that integrate a nucleotide sequence comprising a polarization state-specific promoter and payload into a STAPLR locus, ensuring sustained expression of therapeutic payloads in differentiated immune cells, even in non-permissive environments.

Benefits of technology

The solution allows for persistent and environmentally responsive expression of therapeutic payloads in differentiated immune cells, enhancing the efficacy of immune cell-based therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025035053_02012026_PF_FP_ABST
    Figure US2025035053_02012026_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are compositions and methods for enabling a therapeutic immune cell to respond to polarization state-specific cues.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] PHENOTYPE LOCKING AND SWITCHING MECHANISMS IN STEM CELLS AND

[0002] STEM-CELL DERIVED IMMUNE CELLS

[0003] CROSS REFERENCE TO RELATED APPLICATIONS

[0004] [1] This application claims priority to U.S. Provisional Patent Application No. 63 / 664,135, filed on June 25, 2024, the contents of which are incorporated herein by reference in their entirety for all purposes.

[0005] SEQUENCE LISTING

[0006] [2] The instant application contains a Sequence Listing XML which has been submitted electronically and is hereby incorporated by reference in its entirety. Said Sequence Listing XML, created on Month XX, 20XX, is named XXXXXXX, and is XXX, XXX bytes in size.

[0007] BACKGROUND

[0008] [3] Immune cell-based therapy platforms provide promising avenues for treating a variety of diseases. These diseases include inflammatory diseases, autoimmune diseases, and cancer. However, problems with immune cell-based therapeutic efficacy persist in the field for reasons that include insufficient therapeutic payload delivery, among other things. There is a need for improved technologies in the field of immune cell-based therapy.

[0009] SUMMARY

[0010] [4] The present disclosure encompasses the recognition that while immune cell-based therapies can be engineered to express or deliver a payload (e.g., a therapeutic pay load) to a subject, the milieu or environment in which a cell-based therapy is exposed can cause changes to said cell-based therapy, e.g., render the payload harmful rather than helpful. The present disclosure recognizes that it would be beneficial to express a therapeutic payload in an immune cell-based therapy in such a way that is responsive to the cellular milieu. The present disclosure, among other things, provides for compositions and methods for effectively expressing one or more payloads (e.g., therapeutic payloads) in therapeutic immune cell, even when said immune cell-based therapy is exposed to a non-permissive environment. [5] The present disclosure also provides, among other things, solutions for engineering pluripotent stem cells (PSCs) (e.g., induced pluripotent stem cells (iPSCs)) to express at least one payload (e.g., a therapeutic payload, and / or a pay load that provides an Ml master regulator, an M2 master regulator, an Ml -specific marker, or an M2-specific marker), where expression of said at least one payload persists even when the PSCs are differentiated. The solutions provided herein are unexpected as it has long been a challenge in the field to engineer a progenitor cell, such as a PSC, to express a transgene, where downstream differentiated cells (differentiated from said progenitor cell) maintain sufficient expression of the transgene. In fact, in many cases, a transgene introduced into a progenitor cell (e.g., a PSC, or iPSC) exhibits a substantial reduction in expression after differentiation of said progenitor cell. To the contrary, the provided compositions and methods allow for engineering of a progenitor cell (e.g., a PSC, an iPSCs, etc. to comprise a transgene expression system (e.g., any targeting construct as described herein) capable of expressing at least one payload, such that downstream differentiated cells (differentiated from said progenitor cell) not only maintain the ability to express said at least one payload, but do so in environmentally specific contexts.

[0011] [6] In some embodiments of the present disclosure, iPSCs may be used to make allogeneic forms of cell therapies. In some embodiments, immune cells to be used in accordance with the present disclosure are made from iPSCs via differentiation. In some embodiments, immune cells to be used in accordance with the present disclosure are myeloid cells differentiated from PSCs or iPSCs. In some embodiments, a myeloid cell of the present disclosure is a macrophage. In some embodiments of the present disclosure, a progenitor cells, such as a PSC or iPSC, is modified to comprise at least one targeting construct (e.g., any targeting construct as described herein). In some embodiments, the targeting construct comprises a nucleotide sequence comprising at least one polarization state-specific promoter (e.g., any polarization state-specific promoter described herein) operably linked to at least one payload (e.g., any payload molecule described herein, e.g, a nucleotide sequence encoding an Ml or M2 master regulator, a therapeutic payload, etc.) flanked by homology arms that direct the integration of the fusion polypeptide coding sequences into a STAPLR locus in a target cell genome. In some embodiments, a targeting construct delivers to a target cell (e.g., a progenitor cell, such as a PSC or iPSC) at least one, at least two, at least three, at least four, or more payloads. In some embodiments, a targeting construct delivers to a target cell at least two payloads. In some embodiments, a targeting construct delivers to a target cell a therapeutic payload (e.g., any therapeutic payload described herein), and a payload that substantially drives polarization of a macrophage cell to an Ml or M2 state (e.g., any Ml or M2 master regulator or Ml or M2 cue molecule described herein).

[0012] [7] Provided herein, among other things, are compositions and methods of engineering the genomes of PSCs with nucleotide switches that respond to Ml and / or M2 cues in a cellular environment with expression of a payload, such that a cell that is derived from the engineered PSC has a functional switch that survives that differentiation process.

[0013] [8] In some embodiments, the present disclosure provides for a targeting construct comprising: (a) a first homology arm corresponding to a 5' target sequence comprising a first region of homology to a target genomic locus; (b) a nucleotide construct comprising (i) a polarization state-specific promoter; and (ii) a payload; and (c) a second homology arm corresponding to the 3’ target sequence comprising a second region of homology to the target genomic locus.

[0014] [9] In some embodiments, a target genomic locus is a STAPLR. In some embodiments, a STAPLR is selected from the group consisting of: the intergenic region between the RPL34 gene and the OSTC gene; the intergenic region between the ACTB gene and the FSCN1 gene; the intergenic region between the AKIRIN1 gene and the NDUFS5 gene; the intergenic region between the PRDX1 gene and the AKR1 Al gene; the intergenic region between the PTGES3 gene and the NACA gene; the intergenic region between the MLF2 gene and the PTMS gene; the intergenic region between the RABI 3 gene and the RPS27 gene; the intergenic region between the JTB gene and the RABI 3 gene; the intergenic region between the AKR1 Al gene and the NASP gene; the intergenic region between the NDUFS5 gene and the MACF1 gene; the intergenic region between the SRSF9 gene and the DYNLL1 gene; the intergenic region between the MYL6B gene and the MYL6 gene; the intergenic region between the GPX1 gene and the RHOA gene; the intergenic region between the HNRNPA2B 1 gene and the CBX3 gene; the intergenic region between the ROMO gene and the RBM39 gene; the intergenic region between the PA2G4 gene and the RPL41 gene; and the intergenic region between the NDUFB10 and the RPS2 gene. In some embodiments, a STAPLR is the intergenic region between the PRDX1 gene and the AKR1 Al gene.

[0010] In some embodiments, a first homology arm comprises a sequence of SED ID NO: 1, and a second homology arm comprises a sequence of SED ID NO: 2.

[0015]

[0011] In some embodiments, a polarization state-specific promoter is an Ml -specific promoter. In some embodiments, a polarization state-specific promoter is an M2-specific promoter. In some embodiments, a polarization state-specific promoter is an Ml -specific promoter as well as an M2-specific promoter.

[0016]

[0012] In some embodiments, an Ml -specific promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14. In some embodiments, an Ml -specific promoter comprises a sequence having 100% sequence identity to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14.

[0017]

[0013] In some embodiments, an M2-specific promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23.

[0018]

[0014] In some embodiments, an M2-specific promoter comprises a sequence having 100% sequence identity to SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23.

[0019]

[0015] In some embodiments, a payload comprises one or more Ml -specific genes. In some embodiments, one or more Ml -specific genes are selected from the group consisting of HLA, TNFa, IL-6, IL-8, CD80, PIM1, RTP4, IFNy, SLC11A1, CD38, 1NOS, MCP-1, and pAKT. In some embodiments, one or more Ml -specific genes are one or more of Ml master regulators. In some embodiments, one or more Ml master regulators is IFNy.

[0020]

[0016] In some embodiments, a payload comprises one or more M2-specific genes. In some embodiments, one or more M2-specific genes are selected from the group consisting of CD 163, IL4, IL 10, IL13, CD206, Arg-1, Realm-a, Chi313, and PPARy. In some embodiments, one or more M2-specific genes are one or more of M2 master regulators. In some embodiments, one or more M2 master regulators are one or more of IL4 and IL 10.

[0021]

[0017] The present disclosure further provides for a system comprising: (a) a targeting construct as described herein; (b) a CRISPR-associated endonuclease (“Cas polypeptide”) or a nucleic acid encoding a Cas polypeptide; and (c) a guide RNA (“gRNA”) comprising a scaffold for binding the Cas polypeptide and a spacer sequence corresponding to the target genomic locus, or a nucleic acid encoding the gRNA, optionally wherein the guide RNA is a single guide RNA (“sgRNA”), optionally wherein the system comprises the Cas polypeptide and gRNA, optionally wherein the system is in the form of a ribonucleoprotein particle (“RNP”).

[0022]

[0018] The present disclosure also provides for a method of producing a gene-edited target cell, comprising: (a) introducing a system as described herein into a target cell; and (b) culturing the target cell under conditions in which gene editing occurs; thereby producing gene-edited target cell.

[0023]

[0019] In some embodiments, a cell is a pluripotent stem cell (PSC), optionally an induced PSC (iPSC). In some embodiments, a method of producing a gene-edited target cell further comprises differentiating a PSC to an immune cell. In some embodiments, an immune cell is a myeloid progenitor cell.

[0024]

[0020] The present disclosure provides a gene-edited target cell comprising a STAPLR comprising a nucleotide construct comprising a nucleotide sequence comprising (i) a polarization state-specific promoter; and (ii) a payload; optionally wherein the STAPLR is as described herein; optionally wherein the polarization-specific promoter is as described herein; and / or optionally wherein the payload is as described herein.

[0025]

[0021] The present disclosure provides a pharmaceutical composition comprising a gene-edited target cell as described herein and a pharmaceutically acceptable carrier.

[0026]

[0022] The present disclosure further provides for a method comprising administering a pharmaceutical composition as described herein to a human subject.

[0027] BRIEF DESCRIPTION OF THE DRAWINGS

[0028]

[0023] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application with color drawing(s) will be provided by the Office upon request and payment of the necessary fees.

[0029]

[0024] The following described drawings form part of the present specification. They are included to demonstrate certain aspects of the disclosed compositions and methods, and do not limit the scope of those disclosed compositions and methods.

[0030]

[0025] FIG. 1 provides a schema depicting an exemplary genome engineering approach to insert an Ml or M2 switch (e.g., an Ml or M2 polarization state-specific promoter system) as disclosed herein, e.g., in Table 2 and Table 3, into a STAPLR 1 locus (SHI). HDR: Homology Directed Repair, HA: Homology Arm.

[0031]

[0026] FIGs. 2A-2B provide data showing incorporation of the listed polarization-specific constructs in the SHI in PSC clonal populations. FIG. 2A is a bar graph showing percentages of bi-allelic (orange filled, or top bar portions of Construct 43, Construct 44, Construct 45, Construct 46, Construct 47, Construct 50, Construct 59, Construct 60, Construct 65, and Construct 66) or mono-allelic (teal filled, or bottom bar portions of all data in bar graph) Ml - or M2-specific promoter driven mCherry engineered PSC clones from total number of isolated clones. FIG. 2B provides representative gel image of PCR-based screening of Ml - or M2- promoter engineered PSC clones. Unedited PSC clones show one PCR fragment at lOOObp; mono-allelic engineered PSC clones will show an unedited fragment at lOOObp and an edited fragment running at 2400bp; bi-allelic engineered clones show a single PCR fragment at 2400bp.

[0032]

[0027] FIG. 3A-3C provide a schema and data showing that immunoresponsive cells that express polarization-specific constructs as disclosed herein, e.g., in Table 2, successfully differentiated to myeloid progenitor cells. FIG. 3A depicts a schema for differentiating PSCs to myeloid progenitor cells. WO2023 / 150089, incorporated by reference in its entirety, provides differentiation methods to produce myeloid progenitor cells. FIG. 3B shows CD45 myeloid progenitor marker expression. FIG. 3C shows cells expressing CD45, CX3CR1, and CD 14 myeloid progenitor markers.

[0033]

[0028] FIG. 4 depicts experimental setup to analyze Ml promoter function in engineered PSCs differentiated into myeloid progenitor cells using Ml promoter-driven mCherry expression as read-out.

[0034]

[0029] FIGs. 5A-5B provide data showing mCherry expression in response to MO, Ml or M2 cues in immunoresponsive iPSC-derived myeloid progenitor cells comprising polarizationspecific constructs comprising an Ml -specific promoter operably linked to mCherry as the payload. FIG. 5A shows expression data for cells comprising Ml -specific promoters 2 (Construct 03) and 6 (Construct 07) upon initial Ml polarization for 3 days. The top left panel shows mCherry expression in EFS-mCherry PSCs and their differentiated myeloid progenitor cells. Ml -mCherry engineered PSCs do not show mCherry expression. Middle and bottom panels show both promoters tested with no mCherry expression in the M0 or M2 polarized conditions. FIG. 5B shows expression data for cells comprising Ml -specific promoters 2 (Construct 03) and 6 (Construct 07) transpolarized from and to states as shown for 7 days. Transpolarization from MO or M2 to Ml induced mCherry expression whereas transpolarization from Ml to MO to M2 did not lead to a reduction in mCherry expression. HLA-DR: Ml marker; CD 163: M2 marker.

[0035]

[0030] FIG. 6 provides mCherry expression data in cells comprising either Ml promoter 2 (Construct 03) or Ml promoter 6 (Construct 07) driving mCherry expression. Transpolarization from M0 or M2 to Ml induced mCherry expression whereas transpolarization from Ml to M0 to M2 did not lead to a reduction in mCherry expression.

[0036]

[0031] FIG. 7 provides TNFa expression data in cells comprising either Ml promoter 2 (Construct 03) or 6 (Construct 07) driving mCherry expression upon re- or trans-polarization. Successful re- or transpolarization is measured by increase of TNFa in the Ml state, whereas decrease in TNFa secretion is indicative of successful M0 or M2 transpolarization.

[0037]

[0032] FIG. 8 experimental setup to analyze M2 promoter function in engineered PSCs differentiated into myeloid progenitor cells using M2 promoter-driven mCherry expression as read-out.

[0038]

[0033] FIG. 9 depicts mCherry, M0, Ml, or M2 marker expression in PSC-derived myeloid progenitor cells stimulated by M0, Ml, or M2 cues.

[0039]

[0034] FIGs. 10A- 10F depict the detection of respective effector molecules following insertion of a polarization-specific promoter-payload construct into a STAPLR site of PSCs. FIG. 10A depicts secretion of IL-4. FIG. 10B depicts secretion of IL- 10. FIG. 10C depicts expression of CXCL10. FIG. 10D depicts expression of IL-6. FIG. 10E depicts expression of ILL / ?. FIG. 10F depicts expression of TNF-<z.

[0040] DETAILED DESCRIPTION

[0041] Definitions

[0042]

[0035] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Throughout this specification and embodiments, the words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0043]

[0036] All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.

[0044]

[0037] The term “gene-edited target cell” as used herein refers to a cell engineered to comprise nucleotide construct comprising a polarization-specific promoter and a payload as disclosed herein in a sustained transcriptionally active payload region (STAPLR), e.g., via introduction of a targeting construct of the disclosure, or its descendants and progeny (e.g., a pluripotent stem cell (PSC)-derived immune cell). A gene-edited target cell need not be of the same cell type as the cell into which the targeting construct was initially introduced. For example, the targeting construct may be introduced into a stem cell, such as an induced pluripotent stem cell (iPSC) or a human embryonic stem cell (hESC), upon which the nucleotide sequence flanked by the homology arms of the targeting construct is integrated into the STAPLR of the stem cell. The stem cell can then be differentiated to produce a differentiated cell type. Both the stem cell and the differentiated cell are referred to herein as a “gene-edited target cell”.

[0045]

[0038] The term “induced pluripotent stem cell” or “iPSC” as used herein refers to a type of pluripotent stem cell artificially prepared from a non-pluripotent cell, such as an adult somatic cell, partially differentiated cell or terminally differentiated cell, such as a fibroblast, a cell of hematopoietic lineage, a myocyte, a neuron, an epidermal cell, or the like, by introducing or contacting the cell with one or more reprogramming factors. iPSCs can be derived from multiple different cell types, including terminally differentiated cells. iPSCs have an embryonic stem (ES) cell-like morphology, growing as flat colonies with large nucleo-cytoplasmic ratios, defined borders and prominent nuclei. In addition, iPSCs express one or more key pluripotency markers known by one of ordinary skill in the art, including but not limited to Alkaline Phosphatase, SSEA3, SSEA4, Sox2, Oct3 / 4, Nanog, TRA160, TRA181, TDGF 1, Dnmt3b, Fox03, GDF3, Cyp26al, TERT, and zfp42.

[0046]

[0039] The terms “macrophage-specific,” “polarization-specific,” “state-selective,” and “polarization state-specific” enhancer or promoter are used interchangeably herein to refer to an enhancer or promoter that is determined to have higher activity in one macrophage polarization state over another macrophage polarization state. Macrophages can transition between different polarization states, such as the Ml macrophage or M2 macrophage polarization state. For example, an Ml macrophage-specific enhancer or promoter can have higher activity in a macrophage in the Ml polarization state compared to a macrophage in the M2 polarization state and / or MO polarization state. As another example, an M2 macrophage-specific enhancer or promoter can have higher activity in a macrophage in the M2 polarization state compared to a macrophage in the Ml and / or MO polarization state. Polarization of M2 macrophages can transition M2 macrophages into different M2 macrophage subtypes depending on the stimulatory cues. These can include, but are not limited to, M2a, M2b, or M2c subtypes.

[0047]

[0040] Examples of methods of generating and characterizing iPSCs may be found in, for example, US Patent Publication Nos. US20090047263, US20090068742, US20090191159, US20090227032, US20090246875, and US20090304646, and PCT patent publications WO2013177133 and WO2022204567, the disclosures of which are incorporated herein by reference. Generally, to generate iPSCs, somatic cells are provided with reprogramming factors (e.g., Oct4, SOX2, KLF4, MYC, Nanog, Lin28, etc.) known in the art to reprogram the somatic cells to become pluripotent stem cells.

[0048]

[0041] The terms “linker” or “linker sequence” as used herein in reference to a fusion polypeptide, refers to a part that connects two or more domains, parts, or entities. In some embodiments, the linker may comprise an amino acid or a peptide. Generally, linkers have no specific biological activity other than to join or to preserve some minimum distance or other spatial relationship between the parts.

[0049]

[0042] The terms “nucleic acid” or “oligonucleotide” or “polynucleotide” as used herein means at least two nucleotides covalently linked together. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. A single strand provides a probe that may hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions.

[0050]

[0043] Nucleic acids may be single stranded or double stranded, or may contain portions of both double stranded and single stranded sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods.

[0051]

[0044] The term “operably linked” as used herein refers to a functional relationship between two or more peptide or polypeptide domains or nucleic acid (e.g., DNA) segments. In the context of transcriptional regulation, the term refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence. For example, a promoter or enhancer sequence is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system.

[0052]

[0045] The terms “polypeptide,” “peptide” and “protein” may be used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids.

[0053]

[0046] As used herein, the term “pluripotent” or “pluripotency” refers to the capacity of a cell to self-renew and to differentiate into cells of any of the three germ layers: endoderm, mesoderm, or ectoderm. “Pluripotent stem cells” or “PSCs” include, for example, embryonic stem cells derived from the inner cell mass of a blastocyst or derived by somatic cell nuclear transfer, and iPSCs derived from non-pluripotent cells.

[0054]

[0047] The terms “sustained transcriptionally active payload region” or “STAPLR” refer to an intergenic locus in the genome of a cell that enables persistent and stable expression of a transgene in that cell, e.g., through differentiation of the cell from one state or type to another state or type. A STAPLR comprise an open chromatin landscape for landing genomic payloads. The chromosomal DNA in the STAPLR is in a conformation that is accessible to components of gene editing machinery and that allows integration of genetic material. In some embodiments, a STAPLR is in the vicinity of transcriptionally active genes. In some embodiments, a STAPLR of the present disclosure includes, without limitation (with the NCBI Gene IDs for the human genes shown in parentheses): the intergenic region between the RPL34 gene (Gene ID: 6164) and the OSTC gene (Gene ID: 58505), the intergenic region between the ACTB gene (Gene ID: 60) and the FSCN1 gene (Gene ID: 6624), the intergenic region between the AKIRIN1 gene (Gene ID: 79647) and the NDUFS5 gene (Gene ID: 4725), the intergenic region between the PRDX1 gene (Gene ID: 5052) and the AAR7A7 gene (Gene ID: 10327), the intergenic region between the PTGES3 gene (Gene ID: 10728) and the NACA gene (Gene ID: 4666), the intergenic region between the MLF2 gene (Gene ID: 8079) and the PTMS gene (Gene ID: 5763), the intergenic region between the RAB13 gene (Gene ID: 5872) and the RPS27 gene (Gene ID: 4840565), the intergenic region between the JTB gene (Gene ID: 10899) and the RABI 3 gene (Gene ID: 5872), the intergenic region between the AKR1A1 gene (Gene ID: 10327) and the NASP gene (Gene ID: 4678), the intergenic region between the ND UFS5 gene (Gene ID: 4725) and the MACF1 gene (Gene ID: 23499), the intergenic region between the SRSF9 gene (Gene ID: 8683) and the DYNLL1 gene (Gene ID: 8655), the intergenic region between the MYL6B gene (Gene ID: 140465) and the MYL6 gene (Gene ID: 4637), the intergenic region between the GPX1 gene (Gene ID: 2876) and the RHOA gene (Gene ID: 387), the intergenic region between the HNRNPA2B1 gene (Gene ID : 3181) and the CBX3 gene (Gene ID : 11335), the intergenic region between the ROMO gene (Gene ID: 140823) and the RBM39 gene (Gene ID: 9584), the intergenic region between the PA2G4 gene (Gene ID: 5036) and the RPL41 gene (Gene ID: 6171), and the intergenic region between the NDUFB10 (Gene ID: 4716) and the RPS2 gene (Gene ID: 6187). In some embodiments, the genes herein refer to human genes and the mammalian cells are human cells.

[0055]

[0048] In some embodiments, the start and end genomic coordinates and the sizes of the aforementioned STAPLR intergenic regions in the human genome may include those listed in table 1 of WO2023212722, which is incorporated by reference herein in its entirety.

[0056]

[0049] The term “intergenic region” as used herein may refer to a nucleotide sequence located between two neighboring genes. An intergenic region can be of various sizes. In some embodiments, an intergenic region in accordance with the present disclosure can be at least 30, 40, 50, 75, or 100 base pairs in length. In some embodiments, the intergenic region can be at least 150, 200, 300, 400, 500, 750, or 1000 base pairs length. In some embodiments, the intergenic region can be at least 1500, 2000, 2500, 3000, 3500, 5000, or 10000 base pairs in length. In some embodiments, the intergenic region can be at least 15000, 20000, 30000, 40000, 50000, 75000, or 100000 base pairs in length. In some embodiments, the intergenic region is 30 base pairs to 100000 base pairs in length. In some embodiments, the intergenic region is 50 base pairs to 75000 base pairs in length. In some embodiments, the intergenic region is 75 base pairs to 70000 in length.

[0057]

[0050] The term “target cell” as used herein refers to a host cell into which is introduced a targeting construct that following integration into the host cell genome results in inclusion at a STAPLR site of a nucleotide construct comprising a polarization-specific promoter and a payload as disclosed herein. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Such progeny need not be identical to the parent cell into which the expression vector or targeting construct was initially introduced but include counterparts and progeny of the cell which carry the expression cassette or into which the targeting construct has integrated, as well as cells differentiated therefrom. Such counterparts and progeny are still included within the scope of the term “target cell” as used herein.

[0058]

[0051] The term “targeting construct” as used herein refers to a recombinant nucleic acid molecule that can specifically interact with a STAPLR and which may further comprise nucleotide construct comprising a polarization-specific promoter and a payload as disclosed herein. Recombination of the targeting construct and the STAPLR leads to the modification of the STAPLR, e.g., to introduce nucleotide construct comprising a polarization-specific promoter and a payload as disclosed herein into the STAPLR locus. Typically, a targeting construct comprises homology arms that allow integration of the targeting construct into a particular STAPLR locus.

[0059]

[0052] The term “transfection” as used herein refers to the introduction of nucleic acid molecules, such as targeting constructs, into cells, e.g., into eukaryotic cells. In the context of the present disclosure, the term “transfection” encompasses any method known to the skilled person for introducing nucleic acid molecules into cells, e.g., into eukaryotic cells, such as into mammalian cells. Such methods encompass, for example, electroporation, nucleofection, lipofection, e.g., based on cationic lipids and / or liposomes, calcium phosphate precipitation, nanoparticle-based transfection, virus-based transfection, or transfection based on cationic polymers, such as DEAE-dextran or polyethylenimine.

[0060]

[0053] The term percent "identity," in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.

[0061]

[0054] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are set. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

[0062]

[0055] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).

[0063]

[0056] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0064]

[0057] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

[0065]

[0058] Use of ordinal terms such as “first”, “second”, “third”, etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements. Similarly, the use of these terms in the specification does not by itself connote any required priority, precedence, or order.

[0066] Targeting Constructs

[0067]

[0059] The present disclosure provides targeting constructs comprising a nucleotide sequence comprising a polarization-specific promoter (e.g., any polarization-specific promoter described herein) operably linked to a pay load (e.g., any pay load molecule described herein, e.g., a nucleotide sequence encoding an Ml or M2 master regulator) flanked by homology arms that direct the integration of the fusion polypeptide coding sequences into a STAPLR locus in a target cell genome.

[0068]

[0060] In some embodiments, a targeting construct as described herein comprises at least one, at least two, at least three, at least four, at least five, or more payload encoding sequences. In some embodiments, a targeting construct comprises at least two payload encoding sequences. In some embodiments, a targeting construct comprises a first nucleotide sequence encoding a therapeutic payload and a second nucleotide sequence encoding a payload that substantially drives polarization of a macrophage cell to an Ml or M2 state (e.g., any Ml or M2 master regulator or Ml or M2 cue molecule described herein). In some embodiments, a target cell of the present disclosure receives two or more targeting constructs, wherein each targeting construct comprises a nucleotide sequence encoding a payload molecule (e.g., where at least two or more different payload molecules are delivered).

[0069]

[0061] The targeting constructs may be in the form of vectors. The term “vector” as used herein refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a “plasmid”, which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.

[0070]

[0062] A targeting construct in the form of a vector may be linearized or released from a circular vector prior to its introduction into a target cell.

[0071]

[0063] Alternatively, a targeting construct may be synthesized in vitro, e.g., using a DNA polymerase such as T7 prior to its introduction into a target cell.

[0072]

[0064] Targeting constructs may further comprise one or more ribonucleoprotein (RNP) cut sites that flank the outer sides of the homology arms. These RNP cut sites allow for the endonuclease to cleave the targeting constructs, e.g., to linearize a circular targeting construct. In some embodiments, the targeting construct comprises no RNP cut sites, one RNP cut site, or two RNP cut sites.

[0073]

[0065] In some embodiments, genome editing of a cell with any one of the targeting constructs disclosed herein results in insertion of more than one copies (e.g., 1, 2, 3, 4, or 5 or more copies) of any one of the nucleotide inserts disclosed here that comprise a nucleotide sequence encoding the fusion polypeptides disclosed herein.

[0074] Homology Arms

[0075]

[0066] Targeting constructs that are intended for integration into a STAPLR of a target cell genome typically comprise a heterologous sequence that is not present in the target cell genome, e.g., nucleotide construct comprising a polarization-specific promoter and a payload as disclosed herein.

[0076]

[0067] The targeting constructs typically include one or more regions that are homologous to regions of DNA within or near (e.g, flanking or adjoining) a STAPLR sequence. These homologous regions are referred to here as “homology arms.” For ease of reference, the homology arms are referred to herein as first and second (i.e., 5' and 3', upstream and downstream, or left and right) homology arms. This terminology relates to the relative position of the homology arms to the nucleic acid insert within the targeting construct. The first and second homology arms correspond to regions within or near (e.g., flanking or adjoining) a STAPLR locus sequence, which are referred to herein as “first region of homology” and “second region of homology,” respectively. The regions within or near (e.g., flanking or adjoining) a STAPLR locus sequence are sometimes referred to herein as “target” sequences.

[0068] The current disclosure provides a targeting construct comprising a first homology arm that corresponds to a first region of homology, a nucleic acid insert, and a second homology arm that corresponds to a second region of homology to a STAPLR locus. In some embodiments, a targeting construct of the present disclosure comprises one or more homology arms as shown in Table 3. In some embodiments, a first homology arm and a second homology arm within a targeting construct flank a nucleotide sequence comprising a polarization state-specific promoter (e.g., any polarization state-specific promoter described herein) operably linked to a payload (e.g., any payload described herein). In some embodiments, a first homology arm and a second homology arm within a targeting construct flank a nucleotide sequence comprising at least one polarization state-specific promoter (e.g., any polarization state-specific promoter described herein) operably linked to at least one payload (e.g., any pay load described herein).

[0077]

[0069] A homology arm and a target sequence “correspond” or are “corresponding” to one another when the two regions share a sufficient level of sequence identity to one another to act as substrates for a homologous recombination reaction, whereby the homology arms are suitable for directing recombination of a nucleic acid insert with a desired target sequence to facilitate genomic integration and / or replacement of endogenous sequence.

[0078]

[0070] The term “homology” includes DNA sequences that are either identical or share sequence identity to a corresponding sequence. The sequence identity between a given target sequence and the corresponding homology arm found in the exogenous donor nucleic acid can be any degree of sequence identity that allows for homologous recombination to occur. For example, the amount of sequence identity shared by the homology arm of the exogenous donor nucleic acid (or a fragment thereof) and the target sequence (or a fragment thereof) can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, such that the sequences undergo homologous recombination. Moreover, a corresponding region of homology between the homology arm and the corresponding target sequence can be of any length that is sufficient to promote homologous recombination. In some targeting vectors, the intended mutation in the target genomic locus is included in an insert nucleic acid flanked by the homology arms.

[0079]

[0071] In some embodiments, the first homology arm is between 50 to 250 nucleotides in length. In some embodiments, the first homology arm is between 50-2000 nucleotides in length. In some embodiments, the first homology arm is between 50-1500 nucleotides in length. In some embodiments, the first homology arm is between 50-1000 nucleotides in length. In some embodiments, the first homology arm is between 50-500 nucleotides in length. In some embodiments, the first homology arm is between 150 to 250 nucleotides in length. In some embodiments, the first homology arm is 2000 nucleotides or less in length. In some embodiments, the first homology arm is 1500 nucleotides or less in length. In some embodiments, the first homology arm is 1000 nucleotides or less in length. In some embodiments, the first homology arm is 700 nucleotides or less in length. In some embodiments, the first homology arm is 650 nucleotides or less in length. In some embodiments, the first homology arm is 600 nucleotides or less in length. In some embodiments, the first homology arm is 550 nucleotides or less in length. In some embodiments, the first homology arm is 500 nucleotides or less in length. In some embodiments, the first homology arm is 400 nucleotides or less in length. In some embodiments, the first homology arm is 300 nucleotides or less in length. In some embodiments, the first homology arm is 250 nucleotides or less in length. In some embodiments, the first homology arm is 200 nucleotides or less in length. In some embodiments, the first homology arm is 150 nucleotides or less in length. In some embodiments, the first homology arm is less than 100 nucleotides in length. In some embodiments, the first homology arm is 50 nucleotides in length or less. In some embodiments, the first homology arm is 250, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, or 20 nucleotides in length. In some embodiments, the first homology arm is at least 20 nucleotides in length. In some embodiments, the first homology arm is at least 40 nucleotides in length. In some embodiments, the first homology arm is at least 50 nucleotides in length. In some embodiments, the first homology arm is at least 70 nucleotides in length. In some embodiments, the first homology arm is at least 100 nucleotides in length. In some embodiments, the first homology arm is at least 200 nucleotides in length. In some embodiments, the first homology arm is at least 300 nucleotides in length. In some embodiments, the first homology arm is at least 400 nucleotides in length. In some embodiments, the first homology arm is at least 500 nucleotides in length. In some embodiments, the first homology arm is at least 600 nucleotides in length. In some embodiments, the first homology arm is at least 700 nucleotides in length. In some embodiments, the first homology arm is at least 1000 nucleotides in length. In some embodiments, the first homology arm is at least 1500 nucleotides in length. In some embodiments, the first homology arm is at least 2000 nucleotides in length. In some embodiments, the first homology arm is about 20 nucleotides in length. In some embodiments, the first homology arm is about 40 nucleotides in length. In some embodiments, the first homology arm is 250 nucleotides in length or less. In some embodiments, the first homology arm is about 100 nucleotides in length. In some embodiments, the first homology arm is about 200 nucleotides in length.

[0080]

[0072] In some embodiments, the second homology arm is between 50 to 250 nucleotides in length. In some embodiments, the second homology arm is between 50-2000 nucleotides in length. In some embodiments, the second homology arm is between 50-1500 nucleotides in length. In some embodiments, the second homology arm is between 50-1000 nucleotides in length. In some embodiments, the second homology arm is between 50-500 nucleotides in length. In some embodiments, the second homology arm is between 150 to 250 nucleotides in length. In some embodiments, the second homology arm is 2000 nucleotides or less in length. In some embodiments, the second homology arm is 1500 nucleotides or less in length. In some embodiments, the second homology arm is 1000 nucleotides or less in length. In some embodiments, the second homology arm is 700 nucleotides or less in length. In some embodiments, the second homology arm is 650 nucleotides or less in length. In some embodiments, the second homology arm is 600 nucleotides or less in length. In some embodiments, the second homology arm is 550 nucleotides or less in length. In some embodiments, the second homology arm is 500 nucleotides or less in length. In some embodiments, the second homology arm is 400 nucleotides or less in length. In some embodiments, the second homology arm is 300 nucleotides or less in length. In some embodiments, the second homology arm is 200 nucleotides in length or less. In some embodiments, the second homology arm is 150 nucleotides in length or less. In some embodiments, the second homology arm is 100 nucleotides in length or less. In some embodiments, the second homology arm is 50 nucleotides in length or less. In some embodiments, the second homology arm is 250, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, or 20 nucleotides in length. In some embodiments, the second homology arm is at least 20 nucleotides in length. In some embodiments, the second homology arm is at least 40 nucleotides in length. In some embodiments, the second homology arm is at least 50 nucleotides in length. In some embodiments, the second homology arm is at least 70 nucleotides in length. In some embodiments, the second homology arm is at least 100 nucleotides in length. In some embodiments, the second homology arm is at least 200 nucleotides in length. In some embodiments, the second homology arm is at least 300 nucleotides in length. In some embodiments, the second homology arm is at least 400 nucleotides in length. In some embodiments, the second homology arm is at least 500 nucleotides in length. In some embodiments, the second homology arm is at least 600 nucleotides in length. In some embodiments, the second homology arm is at least 700 nucleotides in length. In some embodiments, the second homology arm is at least 1000 nucleotides in length. In some embodiments, the second homology arm is at least 1500 nucleotides in length. In some embodiments, the second homology arm is at least 2000 nucleotides in length. In some embodiments, the second homology arm is about 20 nucleotides in length. In some embodiments, the second homology arm is about 40 nucleotides in length. In some embodiments, the second homology arm is 250 nucleotides in length or less. In some embodiments, the second homology arm is about 100 nucleotides in length. In some embodiments, the second homology arm is about 200 nucleotides in length.

[0081]

[0073] The first and second homology arms can be of the same length or can differ in length. In some embodiments, the first and second homology arms are amplified to allow for the quantitative assessment of gene editing events, such as targeted integration, at a target nucleic acid. In some embodiments, the assessment of the gene editing events may rely on the amplification of both the 5' junction and 3' junction at the site of targeted integration by amplifying the whole or a part of the homology arm using a single pair of PCR primers in a single amplification reaction. Accordingly, although the length of the first and second homology arms may differ, the length of each homology arm should be capable of amplification (e.g., using PCR), as desired.

[0082]

[0074] In some embodiments, the length of the first and second homology arms does not differ by more than 75 nucleotides. Thus, in some embodiments, when the first and second homology arms differ in length, the length difference between the homology arms is less than 70, 60, 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 nucleotides or base pairs. In some embodiments, the first and second homology arms differ in length by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or 75 nucleotides. In some embodiments, the length difference between the first and second homology arms is less than 70, 60, 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 base pairs. In some embodiments, the first and second homology arms differ in length by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or 75 base pairs.

[0083]

[0075] Homology arms are capable of directing recombination of a nucleic acid insert within or near a desired target STAPLR gene to facilitate genomic integration and / or replacement of endogenous sequence, e.g., integrate nucleotide construct comprising a polarization-specific promoter and a payload as disclosed herein into a STAPLR gene. Regardless of the format used, a donor template can be designed to avoid undesirable sequences. In certain embodiments, one or both homology arms can be shortened to avoid overlap with certain sequence repeat elements, e.g., Alu repeats, LINE elements, etc.

[0084]

[0076] Tables 2 and 3 of WO2023212722, which provide a lists of gRNAs for use with specific types of nucleases, are incorporated herein by reference. Table A of WO2023212722, which provides a list of example nucleases for use in engineering STAPLR sites, are also incorporated herein by reference.

[0085] Separator Sequences

[0086]

[0077] The targeting constructs and recombinant target cell genomes described herein can also comprise a separator sequence. In some embodiments, the payload comprises two or more genes or two or more polypeptide encoding nucleotide sequences, e.g., encoding two or more Ml- or M2-master regulators. Nucleic acid encoding these two or more genes or two or more polypeptide encoding nucleotide sequences may be separated by a separator sequence as described herein.

[0087]

[0078] In some embodiments, the separator sequence is an internal ribosome entry site (IRES). In some embodiments, the separator sequence is a self-cleaving peptide, associated with ribosomal skipping during translation, in which the ribosomes skip the peptide bond between a C-terminal Gly and Pro, resulting in the production of two separate polypeptides. A self-cleaving peptide causes ribosomal skipping during translation. Examples of self-cleaving peptides are 2A peptides, which are viral derived peptides with a typical length of 18-22 amino acids. 2A peptides include T2A, P2A, E2A, F2A, and PQR (Lo et al., 2015, Cell Reports 13:2634-2644). By way of example, P2A is a peptide of 19 amino acids; after the cleavage, a few amino acid residues from the P2A are left on the upstream polypeptide and a proline is left at the beginning of the second polypeptide. In some embodiments, a 2A peptide comprises a P2A peptide. In some embodiments, a P2A amino acid sequence is or comprises ATNFSLLKQAGDVEENPGP (SEQ ID NO: 73). In some embodiments, a P2A nucleic acid sequence is or comprises GCGACGAATTTTAGTCTACTGAAACAAGCGGGAGACGTGGAGGAAAACCCTGGACC T (SEQ ID NO: 74). In some embodiments, a 2A peptide comprises a T2A peptide. In some embodiments, a T2A amino acid sequence is or comprises EGRGSLLTCGDVEENPGP (SEQ ID NO: 75). In some embodiments, a T2A nucleic acid sequence is or comprises GAAGGGCGCGGGTCTCTCCTCACTTGTGGAGATGTTGAGGAAAATCCAGGACCA (SEQ ID NO: 76). In some embodiments, a 2A peptide comprises an E2A G4S T2A (Opt2A) peptide. In some embodiments, an E2A G4S T2A (Opt2A) peptide comprises an amino acid sequence as set forth in SEQ ID NO: 67.

[0088] Macrophage Polarization Logic Circuits

[0089]

[0079] Macrophages can be polarized to Ml or M2 states by various extracellular cues. For example, when encountering inflammatory cues such as LPS, TNFa or IFNy, macrophages can be polarized to a Ml state. Alternatively, when encountering anti-inflammatory cues such as IL- 4, TGF-0, IL- 10, or dexamethasone, macrophages can be polarized to a M2 state. These polarization phenotypes can be plastic depending on what the cell encounters, e.g., can transition between polarization states depending on the surrounding microenvironment. The plasticity of macrophage polarization state can lead to undesired loss of macrophage activity in vivo when the cells encounter an opposing cue. For example, an Ml -polarized cell that is phagocytic may lose its inflammatory or phagocytic ability in the presence of anti-inflammatory cytokines such as IL- 4, TGF-0 or IL- 10. This plasticity can be undesirable when engineered macrophages are being used as a cell therapy with either inflammatory or anti-inflammatory activity.

[0090]

[0080] The Ml and / or M2 phenotype may be “locked” into a desired phenotype or undergo a phenotype switch in a manner that is controlled by a state-specific promoter (e.g., any Ml - and M2-polarization state-specific promoter described herein, such as those described in Table 3). Such lock would prevent the macrophage plasticity and result in regulated expression of the target macrophage activity.

[0091]

[0081] Macrophage polarization state-specific promoters used in accordance with the present disclosure are useful for implementing macrophage polarization logic, e.g., in a macrophage state-selective manner. Such macrophage- specific promoter systems can beneficially provide synthetic macrophage polarization logic, for example, by keeping macrophages in a desired phenotype state (“phenotype lock”) or driving macrophages to switch from an undesired phenotype state to a desired phenotype state (“phenotype switch”).

[0092]

[0082] For example, a promoter system (e.g., a promoter system within a targeting construct as described herein) can include a promoter having greater activity in an M2 macrophage as compared to an Ml or MO macrophage (also referred to herein as an M2 promoter, an M2- specific promoter), operably linked to a polynucleotide encoding an effector or payload molecule that acts as an M2 master regulator, e.g, a payload molecule that controls macrophage polarization state by directing macrophages to an M2 state. The M2 master regulator can be, e.g., an M2 transcription factor or M2 cytokine. Without wishing to be bound by theory, such a promoter system can be used to keep M2 macrophages in a stable M2 state (“M2 Phenotype Lock”), e.g., even in M2 macrophages exposed to opposing cues from the environment.

[0093]

[0083] As another example, a promoter system (e.g, a promoter system within a targeting construct as described herein) can include a promoter having greater activity in an M2 macrophage as compared to an Ml or MO macrophage (also referred to herein as an M2 promoter, an M2-specifc promoter), operably linked to a polynucleotide encoding an effector or payload molecule that act as an Ml master regulator, e.g., an Ml transcription factor or Ml cytokine. Without wishing to be bound by theory, such a promoter system can be used to direct M2 macrophages from an M2 phenotype to a Ml phenotype (“M2 to Ml Phenotype switch”)

[0094] Polarization-Specific Enhancers and Promoters

[0095]

[0084] Macrophages are white blood cells that phagocytose and degrade cellular debris, foreign substances, microbes, cancer cells, etc. In addition to their role in phagocytosis, these cells play an important role in development, tissue maintenance and repair, and in both innate and adaptive immunity in that they recruit and influence other cells including immune cells such as 1 lymphocytes. Macrophages can exist in many phenotypes (also referred to herein as polarization states), including phenotypes that have been referred to as Ml and M2. Macrophages that perform primarily pro-inflammatory functions are called Ml macrophages. Such Ml macrophages can be CD86+ / CD68+. Macrophages that decrease inflammation and encourage and regulate tissue repair are called M2 macrophages. Such macrophages can be CD206+ / CD68+. Engineering of macrophages is described, e.g., in WO2017044487, Brempelis KJ et al. J Immunother Cancer. 2020;8(2):e001356, and Xia et al., Adv. Mater. 2020, 32, 2002054.

[0096]

[0085] In some embodiments, described herein are polarization state-specific promoters (e.g., Ml, M2, M0) for use in engineered cells or target cells of the present disclosure (e.g., progenitor cells such as PSCs, or progeny of said progenitor cells, such as myeloid cells or macrophages). Such state-specific promoters are useful, e.g., in modulating transcriptional activity and inducing expression of desired payloads in a state-selective manner, e.g., when a macrophage is in a desired polarization state. For instance, M2-specific promoters can be useful in selectively inducing expression of a desired payload in M2 macrophages as compared to Ml or M0 macrophages. Alternatively, Ml -specific promoters can be useful in selectively inducing expression of a desired payload in Ml macrophages as compared to M2 or M0 macrophages.

[0097]

[0086] In some embodiments, a polarization state-specific promoter used in accordance with the present disclosure can be any polarization state-specific promoter described herein, e.g., any of those described in Table 2 or Table 3.

[0098]

[0087] In some embodiments, an Ml polarization state-specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 6. In some embodiments, an Ml polarization state- specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 7. In some embodiments, an Ml polarization state-specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 8. In some embodiments, an Ml polarization state-specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 9. In some embodiments, an Ml polarization state-specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 10. In some embodiments, an Ml polarization statespecific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 11 . In some embodiments, an Ml polarization state- specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 12. In some embodiments, an Ml polarization state- specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 13. In some embodiments, an Ml polarization statespecific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 14.

[0099]

[0088] In some embodiments, an M2 polarization state-specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 15. In some embodiments, an M2 polarization state-specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 16. In some embodiments, an M2 polarization state- specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 17. In some embodiments, an M2 polarization state-specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 18. In some embodiments, an M2 polarization state- specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 19. In some embodiments, an M2 polarization statespecific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 20. In some embodiments, an M2 polarization state- specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 21. In some embodiments, an M2 polarization state- specific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 22. In some embodiments, an M2 polarization statespecific promoter used in accordance with the present disclosure comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 23.

[0100]

[0089] In some embodiments, an engineered enhancer or promoter described herein may be operably linked to at least one pay load (e.g., a heterologous pay load, therapeutic pay load, or any other payload described herein). In some embodiments, the payload comprises a polynucleotide. In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a polypeptide. In some embodiments, any promoter described herein (e.g., those shown in Table 3) may be operably linked to any payload (including any cytokine or engineered cytokine) described herein (e.g., those shown in Table 3)

[0101] Payloads

[0102]

[0090] In some embodiments, a payload comprises a nucleotide sequence encoding an Ml- specific gene or an M2-specific gene. In some embodiments, a payload comprises a nucleotide sequence encoding an Ml master regulator. In some embodiments, a payload comprises a nucleotide sequence encoding an M2 master regulator. In some embodiments, a payload comprises a nucleotide sequence encoding an Ml - or M2-specific cue (e.g., a polypeptide, such as a cytokine, that polarizes a cell to an Ml or M2 state). In some embodiments, a payload comprises a nucleotide sequence encoding an Ml -specific cue or variant or derivative thereof. In some embodiments, a payload comprises a nucleotide sequence encoding an M2-specific cue or variant or derivative thereof.

[0103]

[0091] In some embodiments, at least two, at least three, at least four, at least five, or more nucleotide sequences encoding payloads are used in accordance with the present disclosure (i.e., at least two, at least three, at least four, at least five, or more nucleotide sequences encoding payloads are delivered to and expressed in a target cell). In some embodiments, at least two payloads that are expressed in a target cell are different.

[0104]

[0092] In some embodiments, an Ml -specific gene is a gene that is canonically expressed by an Ml cell type. Non-limiting examples of Ml -specific genes include HLA, TNFa, IL-6, IL-8, CD80, PIM1, RTP4, IFNy, SLC11A1, CD38, 1NOS, MCP-1, and pAKT. In some embodiments, an Ml -specific gene is an Ml master regulator. An Ml master regulator is a gene that when expressed in or around a cell, initiates a change in the cell so that it manifests an Ml phenotype. Non-limiting examples of Ml master regulators include IFNy. In some embodiments an Ml- specific gene is a pro-inflammatory gene.

[0105]

[0093] In some embodiments, an M2-specific gene is a gene that is canonically expressed by an M2 cell type. Non-limiting examples of M2-specific genes include CD163, IL4, IL10, IL13, CD206, Arg-1, Realm-a, Chi313, and PPARy. In some embodiments, an M2-specific gene is an M2 master regulator. An M2 master regulator is a gene that when expressed in or around a cell, initiates a change in the cell so that it manifests an M2 phenotype. Non-limiting examples of M2 master regulators include IL4 and IL10. In some embodiments, an M2-specific gene is an antiinflammatory gene. In some embodiments, an IL4 comprises an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 27. In some embodiments, an IL4 comprises an amino acid sequence as set forth in SEQ ID NO: 27. In some embodiments, an IL10 comprises an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 29. In some embodiments, an IL10 comprises an amino acid sequence as set forth in SEQ ID NO: 29. In some embodiments, an M2 master regulator comprises an engineered IL4- IL 10. In some embodiments, an engineered IL4-IL10 comprises an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 31. In some embodiments, an engineered IL4-IL10 comprises an amino acid sequence as set forth in SEQ ID NO: 31. In some embodiments, an engineered IL4-IL10 comprises an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 33. In some embodiments, an engineered IL4-IL10 comprises an amino acid sequence as set forth in SEQ ID NO: 33.

[0106]

[0094] In some embodiments, a payload comprises a nucleotide sequence encoding a cytokine. In some embodiments, a payload comprises a nucleotide sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 26. In some embodiments, a payload comprises a nucleotide sequence as set forth in SEQ ID NO: 26. In some embodiments, a payload comprises a nucleotide sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 28. In some embodiments, a payload comprises a nucleotide sequence as set forth in SEQ ID NO: 28. In some embodiments, a payload comprises a nucleotide sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 30. In some embodiments, a payload comprises a nucleotide sequence as set forth in SEQ ID NO: 30. In some embodiments, a payload comprises a nucleotide sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 32. In some embodiments, a payload comprises a nucleotide sequence as set forth in SEQ ID NO: 32.

[0107]

[0095] In some embodiments, a payload used in accordance with the present disclosure comprises a tethered IL- 10. In some embodiments, a tethered IL- 10 comprises an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 35. In some embodiments, a tethered IL-10 comprises an amino acid sequence as set forth in SEQ ID NO: 35. In some embodiments, a payload used in accordance with the present disclosure comprises a tethered IL-4. In some embodiments, a tethered IL-4 comprises an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 37. In some embodiments, a pay load used in accordance with the present disclosure comprises a tethered IL-4-tethered IL- 10 payload. In some embodiments, a tethered IL-4-tethered IL- 10 pay load comprises an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 39. In some embodiments, a payload used in accordance with the present disclosure comprises a tethered IL-10-tethered IL-4 payload. In some embodiments, a tethered IL-10-tethered IL-4 payload comprises an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 41.

[0108]

[0096] In some embodiments, a payload used in accordance with the present disclosure comprises a tethered IL- 10 payload. In some embodiments, a tethered IL- 10 pay load comprises a nucleotide sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 34. In some embodiments, a tethered IL- 10 pay load comprises a nucleotide sequence as set forth in SEQ ID NO: 34. In some embodiments, a payload used in accordance with the present disclosure comprises a tethered IL-4. In some embodiments, a tethered IL-4 payload comprises a nucleotide sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 36. In some embodiments, a tethered IL-4 payload comprises a nucleotide sequence as set forth in SEQ ID NO: 36. In some embodiments, a payload used in accordance with the present disclosure comprises a tethered IL-4-tethered IL- 10 payload. In some embodiments, a tethered IL-4- tethered IL- 10 payload comprises a nucleotide sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 38. In some embodiments, a tethered IL-4-tethered IL-10 payload comprises a nucleotide sequence as set forth in SEQ ID NO: 38. In some embodiments, a pay load used in accordance with the present disclosure comprises a tethered IL-10-tethered IL- 4 payload. In some embodiments, a tethered IL-10-tethered IL-4 payload comprises a nucleotide sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater sequence identity to SEQ ID NO: 40. In some embodiments, a tethered IL-10-tethered IL-4 payload comprises a nucleotide sequence as set forth in SEQ ID NO: 40.

[0097] In some embodiments, a payload used in accordance with the present disclosure comprises a sequence as shown in Table 3. In some embodiments, a cytokine or engineered cytokine used in a payload in accordance with the present disclosure comprises a cytokine or engineered cytokine portion of a sequence as shown in Table 3 (e.g., the IL-4 or IL-10 portion of SEQ ID NOs: 30-41, and 68). In some embodiments, a payload comprises a transmembrane domain. In some embodiments, a transmembrane domain used in accordance with the present disclosure comprises a transmembrane domain portion of a sequence as shown in Table 3 (e.g., the transmembrane domain portion of SEQ ID NOs: 30-41, and 68).

[0109] Linkers

[0110]

[0098] Suitable linkers for use in a fusion polypeptide of the present disclosure (e.g., a payload polypeptide) are well known to those of skill in the art and include peptide linkers. Preferred peptide linker sequences adopt a flexible extended conformation and do not exhibit a propensity for developing an ordered secondary structure.

[0111]

[0099] Typical amino acids in flexible peptide linkers include Gly, Asn and Ser. Accordingly, in particular embodiments, the linker comprises a combination of one or more of Gly, Asn and Ser amino acids. Other near neutral amino acids, such as Thr and Ala, also may be used in the linker sequence. Exemplary linkers are disclosed in Maratea etal., 1985, Gene 40: 39-46; Murphy et al., 1986, Proc. Nat’l. Acad. Sci. USA 83: 8258-62; U.S. Pat. No. 4,935,233; and U.S. Pat. No. 4,751,180, the contents of which are incorporated herein in their entireties.

[0112]

[0100] Peptide linkers can be one amino acid sequence or repeats of one or more amino acid sequences. In some embodiments, a sequence can be used in repeats of 2. In some embodiments, a sequence can be used in repeats of 3. In some embodiments, a sequence can be used in repeats of 4. In some embodiments, a sequence can be used in repeats of 5 or more.

[0113]

[0101] In some embodiments, the peptide linker is between 1 and 30 amino acids in length. In various aspects, the peptide linker is between 1 and 3 amino acids in length, between 3 and 8 amino acids in length, between 3 and 10 amino acids in length, between 5 and 15 amino acids in length, between 11 and 20 amino acids in length, between 15 and 25 amino acids in length, between 21 and 30 amino acids in length, or is a length range bounded by any pair of the forgoing values (e.g., between 3 and 15 amino acids in length, between 8 and 20 amino acids in length, between 25 and 30 amino acids in length, and so on and so forth).

[0102] In some embodiments, a linker (e.g., any linker described herein) may be used to tether two or more pay load molecules (e.g., any two or more payload polypeptides described herein). In some embodiments, a linker is used to tether two or more cytokines polypeptides or functional fragments thereof. In some embodiments, a linker is used to tether an IL-4 cytokine or functional fragment thereof and an IL- 10 cytokine or functional fragment thereof.

[0114]

[0103] In some embodiments, a linker used in accordance with the present disclosure comprises a linker sequence as shown in Table 3 (e.g., any linker sequence portion shown in Table 3, such as the linker portions of SEQ ID NOs: 30-41, and 68).

[0115]

[0104] Non-limiting examples of linker sequences are set forth in Table 1 below.

[0116] Table 1: Linker Sequences

[0117] Promoter Payload Systems and Combinations

[0118]

[0105] Promoter-payload systems and combinations can comprise promoters and payloads of the present disclosure such that a polarization state promoter can drive expression of at least one payload of the present disclosure.

[0119]

[0106] In some embodiments, the promoter-payload system comprises 1) a promoter, and 2) at least one pay load. In some embodiments, the promoter is any one promoter selected from Table 3, and the at least one payload is selected from the payloads in Table 3. In some embodiments, a promoter may be any promoter described herein, and the at least one payload is selected from any payload described herein. In some embodiments, the promoter is selected from the group consisting of SEQ ID NOs: 20-23, 7, 11, 13, and 14 . In some embodiments, the payload is selected from the group consisting of SEQ ID NOs: 25, 27, 29, 31, 33, 35, 37, 39, 41, 70, and 72.

[0120]

[0107] In some embodiments, the promoter comprises SEQ ID NO: 20 and the payload is selected from the group consisting of SEQ ID NOs: 31, 33, 35, 37, 39, and 41. In some embodiments, the promoter comprises SEQ ID NO: 20 and the payload comprises SEQ ID NO: 35. In some embodiments, the promoter comprises SEQ ID NO: 20 and the payload comprises SEQ ID NO: 37. In some embodiments, the promoter comprises SEQ ID NO: 20 and the payload comprises SEQ ID NO: 39. In some embodiments, the promoter comprises SEQ ID NO: 20 and the payload comprises SEQ ID NO: 41. In some embodiments, the promoter comprises SEQ ID NO: 20 and the payload comprises SEQ ID NO: 31. In some embodiments, the promoter comprises SEQ ID NO: 20 and the payload comprises SEQ ID NO: 33. In some embodiments, the promoter comprises SEQ ID NO: 20 and the payload comprises SEQ ID NO: 70. In some embodiments, the promoter comprises SEQ ID NO: 20 and the payload comprises SEQ ID NO: 72.

[0121]

[0108] In some embodiments, the promoter comprises SEQ ID NO: 21 and the payload is selected from the group consisting of SEQ ID NOs: 31, 33, 35, 37, 39, and 41. In some embodiments, the promoter comprises SEQ ID NO: 21 and the payload comprises SEQ ID NO: 35. In some embodiments, the promoter comprises SEQ ID NO: 21 and the payload comprises SEQ ID NO: 37. In some embodiments, the promoter comprises SEQ ID NO: 21 and the payload comprises SEQ ID NO: 39. In some embodiments, the promoter comprises SEQ ID NO: 21 and the payload comprises SEQ ID NO: 41. In some embodiments, the promoter comprises SEQ ID NO: 21 and the payload comprises SEQ ID NO: 31. In some embodiments, the promoter comprises SEQ ID NO: 21 and the payload comprises SEQ ID NO: 33. In some embodiments, the promoter comprises SEQ ID NO: 20 and the payload comprises SEQ ID NO: 21. In some embodiments, the promoter comprises SEQ ID NO: 21 and the payload comprises SEQ ID NO: 72.

[0122]

[0109] In some embodiments, the promoter comprises SEQ ID NO: 22 and the payload is selected from the group consisting of SEQ ID NOs: 31, 33, 35, 37, 39, and 41. In some embodiments, the promoter comprises SEQ ID NO: 22 and the payload comprises SEQ ID NO: 35. In some embodiments, the promoter comprises SEQ ID NO: 22 and the payload comprises SEQ ID NO: 37. In some embodiments, the promoter comprises SEQ ID NO: 22 and the payload comprises SEQ ID NO: 39. In some embodiments, the promoter comprises SEQ ID NO: 22 and the payload comprises SEQ ID NO: 41. In some embodiments, the promoter comprises SEQ ID NO: 22 and the payload comprises SEQ ID NO: 31. In some embodiments, the promoter comprises SEQ ID NO: 22 and the payload comprises SEQ ID NO: 33. In some embodiments, the promoter comprises SEQ ID NO: 22 and the payload comprises SEQ ID NO: 70. In some embodiments, the promoter comprises SEQ ID NO: 22 and the payload comprises SEQ ID NO: 72.

[0123] [HO] In some embodiments, the promoter comprises SEQ ID NO: 23 and the payload is selected from the group consisting of SEQ ID NOs: 31, 33, 35, 37, 39, and 41. In some embodiments, the promoter comprises SEQ ID NO: 23 and the payload comprises SEQ ID NO: 35. In some embodiments, the promoter comprises SEQ ID NO: 23 and the payload comprises SEQ ID NO: 37. In some embodiments, the promoter comprises SEQ ID NO: 23 and the payload comprises SEQ ID NO: 39. In some embodiments, the promoter comprises SEQ ID NO: 23 and the payload comprises SEQ ID NO: 41. In some embodiments, the promoter comprises SEQ ID NO: 23 and the payload comprises SEQ ID NO: 31. In some embodiments, the promoter comprises SEQ ID NO: 23 and the payload comprises SEQ ID NO: 33. In some embodiments, the promoter comprises SEQ ID NO: 23 and the payload comprises SEQ ID NO: 70. In some embodiments, the promoter comprises SEQ ID NO: 23 and the payload comprises SEQ ID NO: 72.

[0124] [Ill] In some embodiments, the promoter comprises SEQ ID NO: 7 and the payload is selected from the group consisting of SEQ ID NOs: 31, 33, 35, 37, 39, and 41. In some embodiments, the promoter comprises SEQ ID NO: 7 and the payload comprises SEQ ID NO: 35. In some embodiments, the promoter comprises SEQ ID NO: 7 and the payload comprises SEQ ID NO: 37. In some embodiments, the promoter comprises SEQ ID NO: 7 and the payload comprises SEQ ID NO: 39. In some embodiments, the promoter comprises SEQ ID NO: 7 and the payload comprises SEQ ID NO: 41. In some embodiments, the promoter comprises SEQ ID NO: 7 and the payload comprises SEQ ID NO: 31. In some embodiments, the promoter comprises SEQ ID NO: 7 and the payload comprises SEQ ID NO: 33. In some embodiments, the promoter comprises SEQ ID NO: 20 and the payload comprises SEQ ID NO: 7. In some embodiments, the promoter comprises SEQ ID NO: 7 and the payload comprises SEQ ID NO: 72.

[0125]

[0112] In some embodiments, the promoter comprises SEQ ID NO: 11 and the payload is selected from the group consisting of SEQ ID NOs: 31, 33, 35, 37, 39, and 41. In some embodiments, the promoter comprises SEQ ID NO: 11 and the payload comprises SEQ ID NO: 35. In some embodiments, the promoter comprises SEQ ID NO: 11 and the payload comprises SEQ ID NO: 37. In some embodiments, the promoter comprises SEQ ID NO: 11 and the payload comprises SEQ ID NO: 39. In some embodiments, the promoter comprises SEQ ID NO: 11 and the payload comprises SEQ ID NO: 41. In some embodiments, the promoter comprises SEQ ID NO: 11 and the payload comprises SEQ ID NO: 31. In some embodiments, the promoter comprises SEQ ID NO: 11 and the payload comprises SEQ ID NO: 33. In some embodiments, the promoter comprises SEQ ID NO: 11 and the payload comprises SEQ ID NO: 70. In some embodiments, the promoter comprises SEQ ID NO: 11 and the payload comprises SEQ ID NO: 72.

[0126]

[0113] In some embodiments, the promoter comprises SEQ ID NO: 13 and the payload is selected from the group consisting of SEQ ID NOs: 31, 33, 35, 37, 39, and 41. In some embodiments, the promoter comprises SEQ ID NO: 13 and the payload comprises SEQ ID NO: 35. In some embodiments, the promoter comprises SEQ ID NO: 13 and the payload comprises SEQ ID NO: 37. In some embodiments, the promoter comprises SEQ ID NO: 13 and the payload comprises SEQ ID NO: 39. In some embodiments, the promoter comprises SEQ ID NO: 13 and the payload comprises SEQ ID NO: 41. In some embodiments, the promoter comprises SEQ ID NO: 13 and the payload comprises SEQ ID NO: 31. In some embodiments, the promoter comprises SEQ ID NO: 13 and the payload comprises SEQ ID NO: 33. In some embodiments, the promoter comprises SEQ ID NO: 13 and the payload comprises SEQ ID NO: 70. In some embodiments, the promoter comprises SEQ ID NO: 13 and the payload comprises SEQ ID NO: 72.

[0127]

[0114] In some embodiments, the promoter comprises SEQ ID NO: 14 and the payload is selected from the group consisting of SEQ ID NOs: 31, 33, 35, 37, 39, and 41. In some embodiments, the promoter comprises SEQ ID NO: 14 and the payload comprises SEQ ID NO: 35. In some embodiments, the promoter comprises SEQ ID NO: 14 and the payload comprises SEQ ID NO: 37. In some embodiments, the promoter comprises SEQ ID NO: 14 and the payload comprises SEQ ID NO: 39. In some embodiments, the promoter comprises SEQ ID NO: 14 and the payload comprises SEQ ID NO: 41. In some embodiments, the promoter comprises SEQ ID NO: 14 and the payload comprises SEQ ID NO: 31. In some embodiments, the promoter comprises SEQ ID NO: 14 and the payload comprises SEQ ID NO: 33. In some embodiments, the promoter comprises SEQ ID NO: 14 and the payload comprises SEQ ID NO: 70. In some embodiments, the promoter comprises SEQ ID NO: 14 and the payload comprises SEQ ID NO: 72.

[0128] Target Cells

[0129]

[0115] In some embodiments, a targeting construct is introduced into target cells or populations of target cells in order to produce engineered target cells in which a nucleotide construct comprising a polarization-specific promoter and a payload as disclosed herein is integrated into a STAPLR.

[0130]

[0116] In some embodiments, the target cell is a stem cell, e.g., a human embryonic stem cell (hESC), an induced pluripotent stem cell (iPSC). Cells may be from established cell lines, or they may be primary cells, where “primary cells”, “primary cell lines”, and “primary cultures” are used interchangeably herein to refer to cells and cells cultures that have been derived from a subject and allowed to grow in vitro for a limited number of passages, e.g., splittings, of the culture. For example, primary cultures include cultures that may have been passaged 0 times, 1 time, 2 times, 4 times, 5 times, 10 times, or 15 times, but not enough times to go through the crisis stage. Primary cell lines can be maintained for fewer than 10 passages in vitro. Target cells are, in some embodiments, unicellular organisms, or are grown in culture. Preferably, the target cells are of human origin.

[0131]

[0117] In some embodiments, the cell therapy modality is an autologous cell therapy modality. In some embodiments, the cell therapy modality is an allogeneic cell therapy modality.

[0132]

[0118] If the cells are primary cells, such cells may be harvested from an individual by any suitable method. For example, leukocytes may be suitably harvested by apheresis, leukocytapheresis, density gradient separation, etc., while cells from tissues such as skin, muscle, bone marrow, spleen, liver, pancreas, lung, intestine, stomach, etc. are most suitably harvested by biopsy. An appropriate solution may be used for dispersion or suspension of the harvested cells. Such solution will generally be a balanced salt solution, e.g., normal saline, phosphate- buffered saline (PBS), Hank’s balanced salt solution, etc., suitably supplemented with fetal calf serum or other naturally occurring factors, in conjunction with an acceptable buffer at low concentration, e.g., from 5-25 mM. Suitable buffers include HEPES, phosphate buffers, lactate buffers, etc. The cells may be used immediately, or they may be stored, frozen, for long periods of time, being thawed and capable of being reused. In such cases, the cells will generally be frozen in 10% dimethyl sulfoxide (DMSO), 50% serum, 40% buffered medium, or some other such solution as is commonly used in the art to preserve cells at such freezing temperatures and thawed in a manner as commonly known in the art for thawing frozen cultured cells.

[0133]

[0119] In some embodiments, a targeting construct is introduced into a target cell via nucleof ection, as part of a gene editing system (e.g., a CRISPR / Cas-based gene editing system) design to cleave target sequences within or near (e.g., flanking or adjoining) a STAPLR locus to facilitate homologous recombination of the targeting constructs of the target sequences. In some embodiments, the gene editing system comprises an endonuclease (e.g., a Cas nuclease), a guide RNA (e.g., single guide RNA or sgRNA), as well as the targeting construct. In some embodiments, the gene editing system is in the form of a composition known as a ribonucleoprotein or RNP complex. An RNP complex is assembled by combining an endonuclease with a ribonucleic acid.

[0134]

[0120] In some embodiments, a PSC of the disclosure is differentiated into an immune cells. An immune cell may be a T cell, e.g., a regulatory T cell, a myeloid cell, a dendritic cell, a macrophage (e.g., an immunosuppressive macrophage), a myeloid progenitor cell, or a precursor or progenitor cell thereof. Details on differentiation of PSCs into myeloid progenitor cells can be found in International (PCT) Publication Numbers WO 2023 / 150089 Al and WO 2017 / 152081 Al.

[0135] Methods of Administration

[0136]

[0121] The present disclosure provides methods of using the therapeutic cells disclosed herein for treating a patient in need of cell therapy. The methods comprise administering to the patient a gene-edited target cell engineered to comprise a nucleotide construct comprising a polarizationspecific promoter and a payload as disclosed herein in a STAPLR In some embodiments, the gene-edited target cell is comprised a pharmaceutical composition comprising a pharmaceutically acceptable carrier. EXAMPLES

[0137] Example 1: Polarization specific constructs having Ml- or M2-specific promoters driving reporter expression in PSCs and PSC-derived myeloid progenitor cells (MPCs)

[0138]

[0122] Polarization- specific constructs of the disclosure were designed to trigger expression of a payload (e.g., a reporter, an Ml master regulator, an M2 master regulator, an Ml -specific marker, or an M2-specific marker) in response to Ml or M2 cues. However, as discussed herein, implementation of such polarization-specific switches or locks in pluripotent stem cell (PSC)- derived cell products can be difficult because expression of transgenes can be lost after differentiating a PSC to another cell type (e.g., an immune cell such as a T cell or myeloid cell, a CNS cell such as a neuron, microglia, macroglia, or precursor thereof, or a cardiovascular cell). Thus, to implement such polarization-specific switches or locks in pluripotent stem cell (PSC)- derived cell products, constructs were designed such that a polarization-specific switch or lock (comprising a polarization-specific promoter and a payload) was flanked by homology arms complementary to genomic sequences of a sustained transcriptionally active payload region (STAPLR). See e.g, FIG. 1 which illustrates engineering a polarization-specific switch or lock comprising a payload that can be a reporter such as mCherry, into STAPLR site SHI. WO2023212722, which is incorporated herein by reference in its entirety, describes exemplary STAPLRs.

[0139]

[0123] Table 2 provides exemplary Ml -specific polarization-specific constructs (top row, Ml- Prol through Ml-Pro9) and M2-specific polarization constructs (bottom row, M2-Prol through M2-Pro9) that were engineered into PSCs. Payloads for each construct were either mCherry reporter (left column and middle-left column), soluble IL-4 / IL-10 (middle-rightcolumn), or soluble IL10 / IL4 (right column). Some exemplary polarization-specific constructs driving mCherry contained a truncated 3’ UTR, which contained a deletion of a WPRE site within the 3’ UTR as shown in the column labeled “mCherry (truncated 3 ’UTR).”

[0140] Table 2 Examples of polarization-specific constructs

[0141]

[0142] Genome engineering in PSCs

[0143]

[0124] To test Ml -specific and M2-specific promoter-driven payload expression, constructs comprising mCherry as the payload were engineered into STAPLR1 SHI locus PRDX1 - AKR1 Al intergenic region (See Table 3 for homology arm sequences) using a CRISPR / Cas- based genome engineering approach. FIG. 1 shows an overview of this engineering approach. Briefly, 2.5 x 106single cell dissociated PSCs were thawed at 37° C and resuspended in 37° C pre-warmed PSC culture media (Essential 8, Thermo Fisher) supplemented with the Rho kinase inhibitor Y-27632. PSCs were then centrifuged followed by media aspiration and resuspension in PSC culture media to obtain a cell concentration of 2.0 x 106cells / ml. After the PSCs were centrifuged again, media was aspirated and the cells were resuspended in nucleofection buffer supplemented with ribonucleotide-protein (RNP; CRISPR / Cas nuclease complexed with guide RNA [for Casl2a - 5’ AGCCCAGCCTAGGCAGTGCTG 3’ (SEQ ID NO: 3) and for Cas9 - 5’ TGGTTCTTGCAGCACTGCCT ‘3 (SEQ ID NO: 4)]) complex and DNA donor plasmid (either EFS-, Ml-, or M2-specific promoter operably linked to mCherry payload). PSCs resuspended in 100 pl nucleofection buffer with RNP and DNA donor were then transferred to a nucleofection cuvette and nucleofected. After nucleofection, 500 pl of pre-warmed 37° C PSC culture media supplemented with Y-27632 was added to each nucleofection cuvette after which 5x 120 pl nucleofected cell suspension is divided over 5 wells of a Laminin 521 (LN521) pre-coated 6 well-plate. Plated nucleofected cells were then incubated for 4-5 days at 37° C in a 5% CO2 incubator with daily PSC culture media feeding.

[0144]

[0125] After confirmation of genome editing events in the pool of nucleofected cells, any PSC pool nucleofected with RNP and DNA donor plasmid of interest (see Table 2) was plated at clonal density on recombinant vitronectin coated culture vessels and cultured for 7-12 days in PSC culture media at 37° C in a 5% CO2 incubator until single cell-derived PSC colonies were ready to be manually picked. Each single cell-derived PSC colony picked was transferred to one well of a laminin-coated 96-well plate and cultured until 70%-80% confluency. The 96-well plates were then passaged into duplicate plates to allow for continued culture and genomic DNA extraction for screening of successfully edited clones (FIGs. 2A-2B).

[0145] Differentiation of engineered PSCs to myeloid progenitor cells

[0146]

[0126] Successfully engineered clones as determined by genomic DNA PCR screening were subjected to myeloid progenitor cell (MPC) differentiation as described in WO2023212722 (incorporated herein by reference in it’s entirety). To test the polarization-specific response of the myeloid progenitor cells, the cells were analyzed for myeloid progenitor cell specific markers (FIGs. 3B-3C) before cells were subjected to a myeloid cell polarization paradigm to evaluate Ml or M2 promoter function. Analysis of polarization-specific function of immunoresponsive myeloid progenitor cells

[0147]

[0127] Ml - or M2-specific construct engineered PSC-derived myeloid progenitor cells (MPCs) were subjected to polarization cues (MO: resting; Ml : pro-inflammatory; M2: anti-inflammatory) to evaluate mCherry expression in different myeloid progenitor cell polarization states. For evaluation of Ml promoter function, PSC-derived myeloid progenitor cells were plated at 100k per well of a-96-well plate in X-vivo 15 media supplemented with Glutamax and M-CSF. The following day, MPCs were polarized to 1) the MO (“resting”) state, in M-CSF supplemented media, 2) Ml (“pro-inflammatory”) state in M-CSF and IFNy-supplemented media, or 3) M2 (“anti-inflammatory”) state in M-CSF, TGF0, and ILlO-supplemented media. At day 2 postpolarization, MPCs were either harvested for promoter function analysis or repolarized for 4 days switching from an MO to Ml or M2 state, Ml to MO or M2 state, or from an M2 to MO or Ml state (FIG. 4).

[0148]

[0128] Ml promoter engineered PSCs did not express mCherry in an undifferentiated state in contrast to the constitutive EFS promoter engineered PSC line that does express mCherry in an undifferentiated state (FIGs.5A-5B). When polarized to an Ml state, shown by upregulation of HLA-DR expression, Ml promoter engineered PSC-derived MPCs express mCherry (FIG. 5A). Transpolarization of these Ml promoter engineered lines resulted in mCherry expression when MPCs were polarized from an MO or M2 state to Ml , however mCherry expression did not decrease when repolarizing mCherry expressing MPCs from an Ml state to either the MO or M2 state (FIGs. 5A-5B and 6). Successful polarization and re-, or transpolarization of the Ml promoter engineered PSC-derived MPCs was further analyzed using an HTRF-based assay to measure TNFa secretion (FIG. 7).

[0149]

[0129] M2 promoter function was evaluated using a similar polarization experimental setup as described above, except that for the M2 state polarization stimulation with cytokines IL4 and IL10 was used for either a 1-time stimulation 24 hrs. after MPC plating; daily for 2 days 24hrs. post plating; and daily for 7 days 24 hrs. post plating (FIG. 8 and FIG. 9). A one-time initial stimulation or 2 day stimulation with M2-specific anti-inflammatory cues (IL4 and IL10) did induce mCherry expression in the M2 state. MO and Ml stimulated M2 promoter engineered PSC-derived myeloid progenitor cells also induced mCherry but at a slightly lower level compared to M2 stimulated cells. M2 stimulation daily for 7 days did increase the mCherry expression in these engineered cells (FIG. 9).

[0130] In summary, Ml promoters 2 and 6, Construct 3 and Construct 7, respectively, show Ml stimulation induced mCherry expression but not under MO or M2 cues. The engineered M2 promoter 4 (Construct 46) showed weak mCherry expression upon M2 stimulation, but also showed weak mCherry expression when stimulated with MO or Ml -specific cues. Longer M2 stimulation of the M2 promoter 4 engineered PSC-derived MPCs resulted in further increase of mCherry expressing cells.

[0150] Example 2: Polarization specific constructs having Ml- or / and M2- specific promoters driving Ml or M2-specific genes in PSCs and PSC-derived myeloid progenitor cells (MPCs)

[0151]

[0131] Using methodologies described in Example 1, immune-responsive PSC-derived MPCs having constructs with either an Ml -specific promoter (e.g., Ml_pro2) and / or an M2-specific promoter (e.g., M2_pro9) driving either Ml or M2-specific genes, are stimulated with MO, Ml or M2 cues and tested for gene expressions. PSC-derived MPCs engineered with an Ml promoter-driven IL-4 / IL-10 (M2) pay load express IL-4 and IL- 10 upon Ml stimulation with ILNg, or LPS and ILNg. This constitutes a phenoswitch where the immune status of the engineered MPC changes from an Ml (pro-inflammatory) to an M2 (anti-inflammatory) state as measured by up- and down-regulation of polarization specific markers. M2 promoter-driven IL- 4 / IL-10 (M2) pay load engineered PSC-derived MPCs express IL-4 and IL- 10 upon M2 stimulation with TGLb, IL-10, IL4 and IL10, or TGLb and IL10. This constitutes a phenolock where the immune status of the engineered MPC remains in an M2 or anti-inflammatory state as measured by the expression of M2 polarization-specific markers.

[0152] Example 3: Evaluation of polarization specific constructs having Ml - specific promoters driving M2-specific genes in PSCs and PSC-derived myeloid progenitor cells (MPCs) Methodology

[0153]

[0132] PSCs were engineered to insert the Ml_Pro2_IL4-IL10 construct into STAPLR1 (PRDX1-AKR1A1). Engineered PSCs and control PSCs (not engineered to include the Ml_Pro2_IL4-IL10 construct), were cultured to isolate particular clones. The clonal PSC lines where then differentiated to myeloid progenitor cells (MPCs). These MPCs were then plated and rested in culture for 48 h. Then, culture media was replaced, and MPCs were stimulated with 100 ng / mL LPS and 10 ng / mL IFN-y, or were not stimulated (control condition). Secreted cytokines were quantified in the culture supernatant 48 h after stimulation and concentrations were normalized by IGFBP2.

[0154]

[0133] FIG. 10A shows secretion of IL-4 by MPC clones (Clone 475 and Clone 476), which were engineered to include Ml_Pro2_IL4-IL10 construct into STAPLR1 (PRDX1-AKR1A1), in response to stimulation with LPS and IFN-y, indicating that the Ml_Pro2 Promoter induced expression of the Pay load. FIG. 10B shows that secretion of IL- 10 is increased in unedited MPC clone (Clone 353) compared to MPCs having the Ml_Pro2_IL4-IL10 construct in STAPLR1 (PRDX1-AKR1A1). IL-10 is endogenously expressed in response to Ml stimulation and the downregulation of this cytokine in stimulated engineered MPC supernatants suggests that the construct inhibits Ml genes. The analysis of other pro-inflammatory (Ml) cytokines in FIGs. 10C-10F show downregulation of CXCL10, IL-6, IL-10 and TNF-a, respectively, in stimulated MCP that having Ml_Pro2_IL4-IL10 construct in STAPLR1 (PRDX1-AKR1A1), compared to unedited MPCs. This data indicates that the Ml_Pro2_IL4-IL10 construct suppresses Ml polarization. Together, these results show that the stimulation of Ml Promoter by LPS and IFN-y induces expression and secretion of the payload, that acts in an autocrine manner to inhibit Ml polarization and suppress secretion of pro- inflammatory cytokines.

[0155]

[0134] Expression of M2 genes (i.e., MRC1, CD163, CD209, ALOX15, and GAS6) are also analyzed, and expected to be upregulated in stimulated MPC clones having the Ml_Pro2_IL4- IL10 construct compared to unedited MPC.

[0156] Table 3: Example sequences for polarization-specific promoters, payloads, homology arms for engineering into STAPLR sites, and polarization-specific constructs as disclosed herein.

[0157]

[0135] Table 4. Intergenic Distance Between STAPLR Gene Neighbors and STAPLR

[0158] Homology Arm Coordinates

Claims

1. CLAIMSWhat is claimed is:

1. A targeting construct comprising:(a) a first homology arm corresponding to a 5' target sequence comprising a first region of homology to a target genomic locus;(b) a nucleotide construct comprising(i) a polarization state-specific promoter; and(ii) a payload; and(c) a second homology arm corresponding to the 3’ target sequence comprising a second region of homology to the target genomic locus.

2. The targeting construct of claim 1, wherein the target genomic locus is a STAPLR.

3. The targeting construct of claim 2, wherein the STAPLR is selected from the group consisting of: the intergenic region between the RPL34 gene and the OSTC gene; the intergenic region between the ACTB gene and the FSCN1 gene; the intergenic region between the AKIRIN 1 gene and the NDUFS5 gene; the intergenic region between the PRDX1 gene and the AKR1A1 gene; the intergenic region between the PTGES3 gene and the NACA gene; the intergenic region between the MLF2 gene and the PTMS gene; the intergenic region between the RABI 3 gene and the RPS27 gene; the intergenic region between the JTB gene and the RABI 3 gene; the intergenic region between the AKR1A1 gene and the NASP gene; the intergenic region between the NDUFS5 gene and the MACF1 gene; the intergenic region between the SRSF9 gene and the DYNLL1 gene; the intergenic region between the MYL6B gene and the MYL6 gene; the intergenic region between the GPX1 gene and the RHOA gene; the intergenic region between the HNRNPA2B1 gene and the CBX3 gene; the intergenic region between the ROMO gene and the RBM39 gene;the intergenic region between the PA2G4 gene and the RPL41 gene; and the intergenic region between the NDUFB10 and the RPS2 gene.

4. The targeting construct of claim 3, wherein the STAPLR is the intergenic region between th PRDXl gene and the AKR1A1 gene.

5. The targeting construct of claim 4, wherein the first homology arm comprises a sequence of SEQ ID NO: 1, and the second homology arm comprises a sequence of SEQ ID NO: 2.

6. The targeting construct of any one of claims 1-5, wherein the polarization state-specific promoter is an Ml -specific promoter.

7. The targeting construct of any one of claims 1-5, wherein the polarization state-specific promoter is an M2-specific promoter.

8. The targeting construct of any one of claims 1-5, wherein the polarization state-specific promoter is an Ml -specific promoter as well as an M2-specific promoter.

9. The targeting construct of claim 6 or claim 8, wherein the Ml -specific promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:13, or SEQ ID NO: 14.

10. The targeting construct of claim 9, wherein the Ml -specific promoter comprises a sequence having 100% sequence identity to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO:14.

11. The targeting construct of claim 7 or claim 8, wherein the M2-specific promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 15, SEQ ID NO: 16,SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23.

12. The targeting construct of claim 11, wherein the M2-specific promoter comprises a sequence having 100% sequence identity to SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23.

13. The targeting construct of any one of the preceding claims, wherein the pay load comprises one or more Ml -specific genes.

14. The targeting construct of claim 13, wherein the one or more Ml -specific genes are selected from the group consisting of HLA, TNFa, IL-6, IL-8, CD80, PIM1, RTP4, IFNy, SLC11A1, CD38, iNOS, MCP-1, and pAKT.

15. The targeting construct of claim 13, wherein the one or more Ml -specific genes are one or more of Ml master regulators.

16. The targeting construct of claim 15, wherein the one or more Ml master regulators is IFNy.

17. The targeting construct of any one of claims 1-12, wherein the pay load comprises one or more M2-specific genes.

18. The targeting construct of claim 17, wherein the one or more M2-specific genes are selected from the group consisting of CD 163, IL4, IL 10, IL13, CD206, Arg-1, Realm-a, Chi313, and PPARy.

19. The targeting construct of claim 17, wherein the one or more M2-specific genes are one or more of M2 master regulators.

20. The targeting construct of claim 19, wherein the one or more M2 master regulators are one or more of IL4 and IL 10.

21. A system comprising:(a) the targeting construct of any one of claims 1 to 20;(b) a CRISPR-associated endonuclease (“Cas polypeptide”) or a nucleic acid encoding aCas polypeptide; and(c) a guide RNA (“gRNA”) comprising a scaffold for binding the Cas polypeptide and a spacer sequence corresponding to the target genomic locus, or a nucleic acid encoding the gRNA, optionally wherein the guide RNA is a single guide RNA (“sgRNA”), optionally wherein the system comprises the Cas polypeptide and gRNA, optionally wherein the system is in the form of a ribonucleoprotein particle (“RNP”).

22. A method of producing a gene-edited target cell, comprising:(a) introducing the system of claim 21 into a target cells; and(b) culturing the target cell under conditions in which gene editing occurs; thereby producing gene-edited target cell.

23. The method of claim 22, wherein the cells is a pluripotent stem cell (PSC), optionally and induced PSC (iPSC).

24. The method of claim 23, further comprising differentiating the PSC to an immune cells.

25. The method of claim 24, wherein the immune cell is a myeloid progenitor cell.

26. A gene-edited target cell comprising a STAPLR comprising a nucleotide construct comprising a nucleotide sequence comprising(i) a polarization state-specific promoter; and(ii) a payload; optionally wherein STAPLR is as defined as in any one of claims 3 or 4;optionally wherein the polarization-specific promoter is defined as in any one of claims6-12; and / or optionally wherein the payload is defined as in any one of claims 13-20.

27. A pharmaceutical composition comprising the gene-edited target cells of claim 26 and a pharmaceutically acceptable carrier.

28. A method comprising administering the pharmaceutical composition of claim 27 to a human subject.1