Animal model with IDH mutant glioma and use thereof

Abstract

The present invention relates to a brain tumor animal model which accurately reflects phenomena observed in human patients and a method for producing same and, more particularly, to a brain tumor animal model into which an IDH mutant gene has been introduced, a method for producing same, and a use of screening a brain tumor therapeutic agent and predicting the origin of an IDH-mutant glioma using the animal model.

Description

IDH mutant glioma animal model and its use

[0001] The present invention relates to a brain tumor animal model that reflects the phenomenon in human patients and a method for producing the same, and more specifically, to a brain tumor animal model into which an IDH mutant gene has been introduced and a method for producing the same, and to the use of the animal model for screening brain tumor therapeutic agents and predicting the origin of IDH-mutant glioma.

[0002] Gliomas are the most common primary tumors of the adult central nervous system, accounting for about 50% of malignant brain and other central nervous system tumors, and are characterized by high malignancy, rapid progression, and easy recurrence. According to the 2021 WHO classification of tumors of the central nervous system, 5th edition (WHO CNS 5) updated in 2021, gliomas are classified into IDH-wild-type glioblastoma (WHO grade 4), IDH-mutant astrocytoma without chromosome 1p / 19q deletion (WHO grade 2, 3, or 4), and IDH-mutant oligodendroglioma with chromosome 1p / 19q deletion (WHO grade 2, 3) based on molecular genetic characteristics.

[0003] Recent studies on oncogenetics have reported that the IDH (Isocitrate Dehydrogenase) 1 / 2 gene is frequently mutated in malignant glioma tissues, and current clinical data show that approximately 80% of gliomas diagnosed pathologically as grade II or III have IDH1 / 2 gene mutations, and less than 10% of grade IV gliomas have IDH1 / 2 gene mutations.

[0004] This 2021 updated classification system highlights the growing recognition of the importance of IDH mutations in the pathogenesis, prognosis, and treatment of IDH mutant gliomas. Several key studies have previously reported that IDH-mutated diffuse gliomas generally have a better prognosis than IDH-wt glioblastomas and respond differently to treatments such as procarbazine, lomustine, vincristine (collectively referred to as PCV), and temozolomide.

[0005] Isocitrate dehydrogenase (IDH) is a crucial enzyme for normal metabolism and homeostasis, interacting with several other enzymes, including citrate synthase, aconitase, and alpha-ketoglutarate dehydrogenase, to regulate metabolic homeostasis. Glioma-associated IDH mutations disrupt these interactions, leading to reprogramming of central carbon metabolism.

[0006] To develop these treatments, there is an urgent need to develop animal models that can accurately reflect the phenomena observed in human patients. Research in these animal models is expected to play a crucial role in accurately elucidating the mechanisms of glioma and verifying the efficacy of various new therapeutic targets and treatments.

[0007] The purpose of the present invention is to provide an animal model having IDH-mutant glioma and a method for producing the same, and to use the animal model to predict the cell-of-origin of malignant brain tumor tissue or to screen for drugs for the prevention or treatment of IDH-mutant glioma.

[0008] One example of the present invention relates to a gene cassette or a vector comprising the same, which comprises a transcriptional regulatory factor that functions specifically in glial progenitor cells (GPCs) of the brain, for example, oligodendrocyte progenitor cells (OPCs).

[0009] One example of the present invention relates to a transgenic animal that develops IDH-mutant glioma, produced using the above vector, and more specifically, to an IDH-mutant glioma model animal that specifically expresses an IDH mutant gene in glial progenitor cells (GPCs) of the brain, for example, oligodendrocyte progenitor cells, and has a deletion in the function of one or more tumor-causing genes selected from the group consisting of Trp53, Atrx, and Nf1 genes, and a method for producing the same.

[0010] A further example of the present invention relates to the use of an IDH-mutant glioma animal model to observe the evolutionary process of brain tumors and to understand the pathogenesis thereof.

[0011] A further example of the present invention relates to the use of an IDH-mutant glioma model to screen drugs for the prevention, alleviation or treatment of IDH-mutant glioma by testing the efficacy of candidate drugs using an IDH-mutant glioma model animal.

[0012] The present invention relates to a method for predicting the origin of an IDH-mutant glioma of unknown origin by identifying an oncogenic mutation in normal brain tissue, and more specifically, the method comprises measuring the expression level of an oncogenic mutation, including an IDH1 R132H mutation, in normal brain cortex tissue and normal subventricular zone tissue surrounding a tumor of a target individual, and when the IDH1 R132H mutation is shared by the normal brain cortex tissue surrounding the tumor and the brain tumor tissue, the level of the IDH1 R132H mutation in the normal brain cortex tissue surrounding the tumor is lower than that in the brain tumor tissue, and no oncogenic mutations other than the IDH1 R132H mutation are found in the normal brain cortex tissue surrounding the tumor, it is determined that the origin of the IDH-mutant glioma can be identified from the normal brain cortex tissue surrounding the tumor.

[0013] In addition, the present invention relates to a method for determining that the IDH! mutant cells of the normal brain cortex tissue surrounding the tumor and the brain tumor tissue have the same origin by determining how much tumor-specific somatic mutations are shared with the normal brain cortex tissue surrounding the tumor.

[0014] In addition, the present invention relates to a method for predicting the cell of origin of IDH-mutant glioma by dividing normal brain cortex tissue surrounding the tumor into each cell type and measuring the IDH1 mutation level of each.

[0015] The present invention can predict the origin of IDH-mutant glioma of unknown origin by determining whether tumor-specific somatic mutations, including tumor-causing mutations, are shared between normal brain tissue and brain tumor tissue and the cell type thereof, and thereby determine a treatment target capable of maximizing the therapeutic effect of the IDH-mutant glioma, thereby enabling the establishment of an appropriate treatment strategy.

[0016] The present invention relates to an IDH-mutant glioma animal model that directly reflects the phenomenon found in human patients and a method for producing the same, and more particularly, to an IDH-mutant glioma animal model in which mutations have been introduced into the IDH1, Trp53, Atrx, and Nf1 genes, a method for screening a brain tumor treatment agent using the animal model, and a method for preparing the animal model. One example of the present invention relates to a method for predicting the cell of origin of an IDH-mutant glioma and providing information for determining a target site capable of effectively treating a malignant brain tumor.

[0017] One example of the present invention relates to a method for predicting the cell-of-origin of malignant brain tumor tissue by comparing the expression level of a cancer-driver mutation in the subventricular zone (SVZ) or tumor-adjacent normal cortex with the expression level of a cancer-driver mutation in IDH-mutant glioma tissue.

[0018] The present invention can predict the origin of IDH-mutant glioma of unknown origin by determining whether tumor-specific somatic mutations, including tumor-causing mutations, are shared between normal brain tissue and brain tumor tissue and the cell type thereof, and thereby determine a treatment target capable of maximizing the therapeutic effect of the IDH-mutant glioma, thereby enabling the establishment of an appropriate treatment strategy.

[0019] The present invention relates to an IDH-mutant glioma animal model that directly reflects the phenomenon found in human patients and a method for producing the same, and more specifically, to an IDH-mutant glioma animal model in which mutations have been introduced into the IDH1, Trp53, Atrx, and Nf1 genes, a method for screening a brain tumor treatment agent using the animal model, and a method for preparing the animal model.

[0020] Hereinafter, the present invention will be described in more detail.

[0021] The present invention relates to an IDH-mutant glioma model animal that specifically expresses an IDH mutant gene in glial progenitor cells (GPCs) of the brain, such as oligodendrocyte progenitor cells, and has a deletion in the function of one or more oncogenic genes selected from the group consisting of Trp53, Atrx, and Nf1 genes, and a method for producing the same.

[0022] In addition, one example of the present invention relates to a gene cassette or a recombinant vector comprising the same for specifically expressing an IDH mutant gene and / or inducing functional loss of tumor-causing genes in glial progenitor cells (GPCs) of the brain, for example, oligodendrocyte progenitor cells.

[0023] An example of a gene cassette or vector of the present invention is (a) a gene cassette comprising a transcriptional regulatory factor that functions specifically in glial progenitor cells (GPCs) of the brain, for example, oligodendrocyte progenitor cells (OPCs),

[0024] (b) a first gene cassette comprising a gene encoding a site-specific recombinase and a transcriptional regulator that specifically expresses the gene in glial progenitor cells, and a second gene cassette comprising a polynucleotide encoding a guide RNA for functional deletion of at least one gene selected from the group consisting of Trp53, Atrx, and Nf1 genes, or

[0025] (c) a PiggyBac transposon system vector comprising a first gene cassette comprising a gene encoding a site-specific recombinase and a transcriptional regulator that specifically expresses the gene in glial progenitor cells, a second gene cassette comprising a polynucleotide encoding a guide RNA for functional deletion of at least one gene selected from the group consisting of Trp53, Atrx, and Nf1 genes, and a transposase that helps the first gene cassette and the second gene cassette to be integrated into the genome of an animal.

[0026] More specifically, one example of the present invention relates to an animal model having IDH mutant glioma, which has IDH mutant glioma generated from oligodendrocyte precursor cells (OPCs) of the brain, for example, oligodendrocyte precursor cells (OPCs), and wherein the IDH mutant gene is specifically expressed in oligodendrocyte precursor cells (OPCs) differentiated from neural stem cells into which the IDH mutant gene has been introduced, and wherein the function of at least one gene from the group consisting of Trp53, Atrx, and Nf1 genes is deleted.

[0027] The above IDH-mutant glioma may be an IDH-mutant astrocytoma or an IDH-mutant oligodendroglioma, and includes IDH-mutant oligodendroglioma grade 2 and grade 3, and IDH-mutant astrocytoma grade 2, grade 3, and grade 4, according to the 5th edition of the World Health Organization (WHO) Classification of Central Nervous System Tumors updated in 2021. Accordingly, the glioma may be a high-grade glioma with characteristics such as necrosis, microvascular proliferation, intra-tumoral hemorrhage, cellular proliferation, and nuclear atypia in tumor tissue, and may have immunoreactivity for GFAP, Nestin, Olig2, and PDGFRα, or may be a low-grade glioma with characteristics such as nuclear atypia and increased cellularity in tumor tissue.

[0028] The three enzymes that make up the IDH family are IDH1, IDH2, and IDH3. IDH1 and IDH2 catalyze the conversion of isocitrate to α-ketoglutarate (α-KG) and the reduction of nicotinamide adenine dinucleotide phosphate (NADP+) to NADPH. The IDH1 enzyme is encoded by the IDH1 gene on chromosome 2q33, and the IDH2 enzyme is encoded by the IDH2 gene on chromosome 15q26.1,17.

[0029] In IDH1, de novo mutations, such as at amino acid residue R132, contribute to tumorigenesis in several types of cancer, including solid tumors and hematological malignancies. IDH1 mutations can produce high levels of 2-hydroxyglutarate, which inhibits cell differentiation, and inhibitors of mutant IDH1 can reduce 2-hydroxyglutarate levels, which promotes cell differentiation.

[0030] In one embodiment, the IDH mutation is an IDH1 mutation or an IDH2 mutation. In another embodiment, the IDH mutation is an IDH1 mutation. In another embodiment, the IDH1 mutation is an IDH1 R132 mutation. In another embodiment, the IDH1 mutation is R132H, R132C, R132G, R132L, or R132S. In another embodiment, the IDH1 R132 mutation is R132H. In another embodiment, the IDH1 mutation is R132C. In another embodiment, the IDH1 mutation is R132G. In another embodiment, the IDH1 mutation is R132L. In another embodiment, the IDH1 mutation is R132H.

[0031] For example, the IDH mutant gene may be at least one selected from the group consisting of IDH1 R132, IDH2 R140, and IDH2 R172 mutant genes, and more specifically, the IDH mutant gene may be at least one selected from the group consisting of IDH1 R132H, IDH1 R132C, IDH1 R132G, IDH1 R132L, and IDH1 R132S.

[0032] The animal model may be one in which the IDH mutant gene is not expressed in neural stem cells into which the IDH mutant gene has been introduced, or in which functional loss of one or more genes from the group consisting of Trp53, Atrx, and Nf1 genes does not occur. The animal model may be one in which glioma does not develop in neural stem cells of the subventricular zone, but rather in the cerebral cortex.

[0033] The above-mentioned glial progenitor cells (GPCs) may be oligodendrocyte progenitor cells (OPCs). In addition, the animal model may be Idh1 R132H , may have one or more markers selected from the group consisting of Olig2, Ki-67, GFAP, and Nestin.

[0034] In the present invention, “animal” means any mammal other than a human, preferably a rodent such as a mouse, rat, guinea pig, or hamster, and more preferably a mouse.

[0035] In the present invention, "animal model" refers to a non-human animal that exhibits a disease very similar to a human disease. Due to the physiological and genetic similarities between humans and animals, biomedical disease model animals provide valuable research materials for studying the various causes, pathogenesis, and diagnosis of diseases. Research on disease model animals can identify genes associated with diseases, understand the interactions between genes, and provide basic data for assessing the potential for commercialization through actual efficacy and toxicity testing of developed new drug candidates.

[0036] The present invention relates to a method for producing a tumor-causing cell, which specifically expresses an Idh1 mutation in oligodendrocyte precursor cells (OPCs) of an animal, preferably a non-human animal, and may further induce functional loss of one or more tumor-causing genes selected from the group consisting of Trp53, Atrx, and Nf1 genes.

[0037] The animal model according to the present invention has an IDH-mutant glioma, and specifically, a recombinant vector capable of inducing a mutation in oligodendrocyte progenitor cells (OPCs) is injected into normal neural stem cells (NSCs) through electroporation, and when the normal neural stem cells injected with the recombinant vector differentiate into oligodendrocyte progenitor cells, a mutation is induced, and these mutant cells develop IDH-mutant glioma in a specific region of the brain. Similar to the characteristics observed in actual IDH-mutant glioma patients, the normal neural stem cells injected with the recombinant vector exhibit a normal cell structure, and the IDH-mutant glioma is induced through abnormal division and growth of the oligodendrocyte progenitor cells (OPCs) that have acquired the mutation. The IDH-mutant glioma of the above animal model is a high-grade glioma with features such as intra-tumoral hemorrhage, cellular proliferation, and nuclear atypia as shown in the results of hematoxylin and eosin (H&E) staining of tumor tissue, and IDH1 R132H, Olig2, GFAP, Ki-67, and Nestin. Single cell RNA-sequencing analysis also confirmed that the tumor cells of the animal model had transcriptome expression characteristics similar to those of human tumor cells. Somatic oncogenic mutations, for example, mutations in Idh1, Trp53, Atrx, and Nf1, enable oligodendrocyte progenitor cells to progress to IDH-mutant glioma. Therefore, it can be said that the animal model using Idh1, Trp53, Atrx, and Nf1 mutations closely reflects the characteristics of human patients in whom IDH-mutant glioma develops from oligodendrocyte progenitor cells.

[0038] The animal model of the present invention is characterized in that the IDH mutant gene is expressed only in glial progenitor cells (GPCs), for example, oligodendrocyte progenitor cells (OPCs), and the neural stem cells of the subventricular region, into which a vector that induces deletion or expression of one or more genes selected from the group consisting of Trp53, Atrx, and Nf1 mutations is injected, maintain normal genes and a normal phenotype. Therefore, it can be characterized in that a tumor does not occur at the location where the vector that induces mutations is injected. As the neural stem cells into which the vector is injected differentiate and migrate toward the cerebral cortex, oligodendrocyte progenitor cells are generated, and at this time, the Idh1 R132H , Trp53, Atrx, and Nf1 mutations occur.

[0039] The animal model of the present invention is the Idh1 R132H, Trp53, Atrx, and Nf1 mutations may be specific to cells of the oligodendrocyte lineage differentiated from oligodendrocyte progenitor cells, such as electroporated subventricular zone neural stem cells (Fig. 11).

[0040] In the present invention, the “IDH1 p.R132H” mutation refers to a mutation in which C at the 395th base sequence located in exon 4 of the isocitrate dehydrogenase 1 gene is changed to T, and can also be expressed as “IDH1 c.395G(C)>A(T).”

[0041] In the present invention, the tumor-causing mutations include, in addition to the IDH1 p.R132H mutation, TP53 (Tumor protein 53) mutation, ATRX (Alpha-thalassemia / mental retardation X-linked) mutation, TERT (Telomerase reverse transcriptase) C228T, CIC (Capicua) mutation, FUBP1 (Far upstream element binding protein 1) mutation, NF1 (Neurofibromatosis type 1) mutation, PIK3R1 (Phosphoinositide-3-kinase regulatory subunit 1) mutation, etc., and are various mutations, which can be specifically shown in Table 1 below, but are not limited thereto.

[0042] In the present invention, "TP53" is a tumor suppressor known to suppress abnormal cell proliferation and induce cancer cell death. It is also expressed as p53, and in mouse genes, it can be expressed as Trp53. Genetic mutations found in IDH-mutant gliomas are listed in Table 1.

[0043] Gene name Identifiers Mutation Amino acid Chromosome Start End IDH1NM_005896.4(IDH1):c.395G>AArg132HChr2208,248,388 (on Assembly GRCh38)208,248,388 (on Assembly GRCh38)TP53NM_000546.6(TP53):c.817C>TArg273CysChr177,673,803 (on Assembly GRCh38)7,673,803 (on Assembly GRCh38)ATRX-Leu1345*ChrX77,663,468 (on Assembly GRCh38)77,663,468 (on Assembly GRCh38)NF1-Ser2687CysChr1731,358,565 (on Assembly GRCh38)31,358,565 (on Assembly GRCh38)

[0044] The animal model according to the present invention has the advantage that it can be effectively used to conduct research on the development process or screening methods for candidate substances for targeted treatment and / or prevention of IDH-mutant glioma. Since glial cells with mutations similar to those of the IDH-mutant glioma are distributed around the brain tumor derived from the original cell of the IDH-mutant glioma, it can be used for functional research on residual glial cell progenitor cells including mutations in the future, research on mechanisms at the molecular biology level, and search for novel brain tumor preventive or therapeutic agents. The IDH-mutant glioma animal model of the present invention can be effectively used for research on gene functions, research on mechanisms at the molecular biology level of brain tumors, and search for novel anti-brain tumor preventive or therapeutic agents.

[0045]

[0046] An example of the present invention is a method for producing an animal model having an IDH mutant glioma, which may include the following steps (a) to (c):

[0047] (1) A step of preparing an animal containing an IDH mutant gene linked to a recognition site of a site-specific recombinase and a Cas nuclease gene linked to a recognition site of a site-specific recombinase;

[0048] (2) a first gene cassette comprising a gene encoding a site-specific recombinase and a transcriptional regulator that specifically expresses the gene in glial progenitor cells;

[0049] A second gene cassette comprising a polynucleotide encoding a guide RNA for functional deletion of at least one gene selected from the group consisting of Trp53, Atrx, and Nf1 genes, and

[0050] A step of preparing a PiggyBac transposon system vector including a transposase that helps the first gene cassette and the second gene cassette to be integrated into the genome of the animal;

[0051] (3) A step of injecting the piggyBac transposon system vector prepared in step (2) into the subventricular zone of the animal in step (1) by electroporation within 4 days after birth.

[0052] One example of the present invention is a method for producing an animal model having an IDH mutant glioma, wherein the gene of step (2) that is not expressed in electroporated neural stem cells is inserted into a chromosome by a transposase and exists, and when some of the neural stem cells into which the gene has been inserted are differentiated into OPCs, the IDH mutant gene is expressed, and functional deletion of one or more genes selected from the group consisting of Trp53, Atrx, and Nf1 genes occurs (conditional expression).

[0053] The piggyBac transposon system comprises a donor vector containing two inverted terminal repeats (ITRs) that encode the region to be exchanged, and a helper vector encoding a transposase. When the helper plasmid and the transposon plasmid are co-transfected into target cells, the transposase produced from the helper recognizes the two ITRs of the transposon and inserts the flanking region (containing the two ITRs) into the host genome. Insertion typically occurs at a host chromosomal site containing a TTAA sequence, which is replicated on both sides of the inserted fragment.

[0054] The above subventricular zone may be subventricular zone tissue or cells, and preferably refers to neural stem cells (NSCs) of the subventricular zone. The above OPCs are differentiated and developed from neural stem cells of the subventricular zone, and preferably, the vector-injected subventricular zone neural stem cells differentiate and become cells in which mutations occur in the Idh1, Trp53, Atrx, and Nf1 genes. When the method for producing the IDH-mutant glioma animal model was used, IDH-mutant glioma occurred in 62.1% of mice aged 24 to 40 weeks.

[0055] The site-specific recombinase may be selected from the group of tyrosine recombinases including Cre, Flp, XerC / D and FimB / E, or the group of serine recombinases such as hin, gin and cin, and preferably may be Cre recombinase. The site-specific recombinase binds to a DNA binding site or "recombinase recognition site" or "target" at at least two sites, is cleaved by the recombinase at both recombinase recognition sites and rebinds with the DNA ligase. The expression "recombinase recognition site" is also referred to simply as "recombinase site", recombinase target site or recombinase recognition target. An exemplary recombinase and site is Flp (flippase) that binds to a flippase recognition target (frt) site, preferred sites are lox (Cre) and frt (Flp), and a preferred lox site may be loxP, lox 66 or lox 71 derived from the bacteriophage P1 sequence. Accordingly, the recombinase recognition site may be selected from frt, loxP, lox 66 or lox 71.

[0056] Recombinases can be introduced into cells and activated. It is also possible to use existing recombinases within the cell. In any case, it is preferable that the recombinase be inducible and thus be activated by induction. Inducible recombinases are known in the art. For example, an inducible promoter for a recombinase can be used.

[0057] Idh1 of step (1) above R132H The step of preparing an animal capable of expressing a mutation and a Cas nuclease, for example, a CAS 9 nuclease, under specific conditions (conditional knock-in) can utilize the method described in the animal having the target mutation (Zhang, Y. et al. Cancer Research, 2019). In one embodiment of the present invention, IDH1 fl(R132H)Idh1fl(R132H) / +;LoxP-Stop-LoxP-Cas9-EGFP mice (C57BL / 6) (#026175) were crossed with mice (C57BL / 6) (fㅣ / +) A mouse can be manufactured, as shown in Figure 10.

[0058] In the above step (1), the IDH mutant gene and CAS nuclease are each linked to the recognition site of the site-specific recombinase, so that the site-specific recombinase included in the first gene cassette of step (2) prepares an animal including the IDH mutant gene and the Cas nuclease gene, and due to the site-specific recombinase whose expression is controlled by the enhancer and promoter that operate only in the oligodendrocyte precursor cells of step (2), the site-specific recombinase is not expressed in the neural stem cells into which the vector has been introduced, but only in the oligodendrocyte precursor cells differentiated from the neural stem cells, so that not only the IDH mutant gene included in step (1) is specifically expressed only in the oligodendrocyte precursor cells, but also the CAS nuclease is expressed only in the oligodendrocyte precursor cells, so that eventually the CRISPAR / CAS system is operated together with the guide RNA of the tumor-causing gene in the second gene cassette of step (2) to regulate the function of the tumor-causing gene. Conclusion occurs. That is, in step (1), the IDH mutant gene and Cas nuclease gene contained in the animal are not constantly expressed, but conditionally expressed (Conditional CRISPR / CAS expression).

[0059] The enhancer and promoter sequences that operate only in oligodendrocyte precursor cells in the above step (2) may include those that were previously known to operate only in oligodendrocyte precursor cells (Gotoh H, Wood WM, Patel KD, Factor DC, Boshans LL, Nomura T, Tesar PJ, Ono K, Nishiyama A. NG2 expression in NG2 glia is regulated by binding of SoxE and bHLH transcription factors to a Cspg4 intronic enhancer. Glia. 2018 Dec;66(12):2684-2699). Cre recombinase can be produced only in oligodendrocyte precursor cells under the control of the promoter in the above step (Fig. 10).

[0060] It includes a single guide RNA that knocks out the Trp53, Atrx, and Nf1 genes of the above step (2), and if it is a vector, a person skilled in the art can select an appropriate vector as needed regardless of the type, and for example, it can be a system using CRISPR-Cas9 gene editing technology.

[0061] In the above (2), the vector including the first gene cassette and the second gene cassette includes a specific base sequence (ITR, inverted terminal repeat sequence) at the 5' end and the 3' end that helps the enzyme (transposase) of the transposon system (PiggBac transposon system) produced in the vector to integrate the gene of interest of the first gene cassette and the second gene cassette into the genome of the animal.

[0062] In one embodiment of the present invention, a vector for knocking out the Trp53, Atrx, and Nf1 genes is produced by a method of preparing a vector containing an sgRNA targeting Trp53 or Atrx or Nf1 by recombining an sgRNA that has completed a genome-editing test into a CRISPR-Cas9 vector (Fig. 10).

[0063] The vector containing the above sgRNA can be synthesized using methods widely known in the art or purchased commercially. Genome-editing testing of the above sgRNA can be freely performed using methods known in the art, and specifically, the genome-editing efficiency can be calculated through T7E1 analysis or targeted amplicon sequencing after transfection into mouse cells. The genome-editing testing of the above sgRNA can additionally include calculating mutation frequencies.

[0064] The sgRNA targeting the above Trp53 may have the nucleic acid sequence of SEQ ID NO: 1 (ACAGCCATCACCTCACTGCA), the sgRNA targeting Atrx may have the nucleic acid sequence of SEQ ID NO: 2 (AGAAGCCAAGATACAGACAT), and the sgRNA targeting Nf1 may have the sequence of SEQ ID NO: 3 (AGTCAGCACCGAGCACAACA). The sequence of the sgRNA targeting the above Trp53 and the sequence of the sgRNA targeting Nf1 may be sequences reported academically in the art (Zuckermann, M. et al. NatCommun, 2015), and other sequences are not limited thereto as long as they have sufficiently high genome-editing efficiency.

[0065] In step (3), the vector prepared in (2) is injected into neural stem cells located around the mouse ventricle using the electroporation method, thereby integrating the gene of interest into the mouse neural stem cell genome. In the future, when oligodendrocyte precursor cells are differentiated from the neural stem cells, mutations are induced specifically in the Idh1, Trp53, Atrx, and Nf1 genes in these cells.

[0066] The timing of injection of the above vector may be within 4 days from the birth of the animal, and considering the incidence of IDH-mutant glioma, it may be within 3 days, within 2 days, or within 24 hours, and preferably within 24 days. The timing of vector injection is preferably the more active the replication of the neural stem cells into which the vector has been injected.

[0067] In the above step (3), the vector injection amount is 0.1 to 10 ng, 0.1 to 8 ng, 0.1 to 6 ng, 0.1 to 5 ng, 0.1 to 4 ng, 0.1 to 3 ng, 0.1 to 2.7 ng, 0.1 to 2.5 ng, 0.5 to 10 ng, 0.5 to 8 ng, 0.5 to 6 ng, 0.5 to 5 ng, 0.5 to 4 ng, 0.5 to 3 ng, 0.5 to 2.7 ng, 0.5 to 2.5 ng, 1 to 10 ng, 1 to 8 ng, 1 to 6 ng, 1 to 5 ng, 1 to 4 ng, 1 to 3 ng, 1 to 2.7 ng, 1 to 2.5 ng, 1.5 to 10 ng, 1.5 to 8 ng, The injection amount may be 1.5 to 6 ng, 1.5 to 5 ng, 1.5 to 4 ng, 1.5 to 3 ng, 1.5 to 2.7 ng, or 1.5 to 2.5 ng, preferably 2 ng, but is not limited thereto, and the injection amount may be determined by appropriate modification according to the technical common sense of the art as needed.

[0068] In one embodiment of the present invention, Idh1fl(R132H) / +;LoxP-Stop-LoxP Cas9-EGFP (fl / +)Mice were transfected with pU6-sgTrp53-pU6-sgAtrx-pU6-sgNf1_Cspg4e-β globin promoter-Cre plasmid or LoxP-Stop-LoxP Cas9-EGFP (fl / +) When the pU6-sgLacZ_Cspg4e-β globin promoter-Cre plasmid was injected into mice using electroporation, all cells expressing the mutant expression marker, Green Fluorescent Protein (GFP), were confirmed to be oligodendrocyte lineage cells using immunofluorescence staining (IHC) and single-cell transcriptome analysis.

[0069] In one embodiment of the present invention, Idh1fl(R132H) / +;LoxP-Stop-LoxP Cas9-EGFP (fl / +) When the pU6-sgTrp53-pU6-sgAtrx-pU6-sgNf1_Cspg4e-β globin promoter-Cre plasmid was injected into mice using electroporation, IDH-mutant gliomas developed in 62.1% of the mice, whereas LoxP-Stop-LoxP Cas9-EGFP (fl / +) In control mice, where the pU6-sgLacZ_Cspg4e-β globin promoter-Cre plasmid was simply injected via electroporation, no brain tumors developed. This suggests that the brain tumors were not caused by the shock of electroporation, but rather by mutations expressed under specific conditions.

[0070] The present invention relates to a method for producing Idh1 in the brain of an animal, preferably any mammal other than a human. R132H , Trp53, Atrx, and Nf1 genes, a malignant brain tumor animal model is provided. More specifically, an IDH-mutant glioma animal model in which Trp53, Atrx, and Nf1 knockout mutations are induced specifically in oligodendrocytes of an IDH-mutant animal is provided.

[0071] Idh1 above R132H , Trp53, Atrx, and Nf1 mutations may correspond to mutations seen in human patient populations. Preferably, IDH1 R132H , P53, ATRX, and NF1 may be mutated mutations, for example, single nucleotide variation (SNV), insertion or deletion of short nucleotide sequence (indel), or frameshift, but other genes than the IDH1 gene are not limited thereto, and may be freely selected within the scope of achieving the purpose of causing loss of function of the protein encoded by the P53, ATRX, and NF1 genes.

[0072] The loss of function of the above protein includes cases where the protein is not expressed, cases where the protein is expressed but is inactive, and cases where the protein activity is significantly inhibited compared to the normal or wild-type protein.

[0073] The animal model of the present invention may have an incidence of IDH-mutant glioma of 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, or 80% or more, for example, 30 to 100%, 35 to 100%, 40 to 100%, 45 to 100%, 50 to 100%, 55 to 100%, 60 to 100%, 65 to 100%, 70 to 100%, 75 to 100%, 80 to 100%, 80 to 100%, 85 to 100%, 30 to 99%, 35 to 99%, 40 to 99%, 45 to 99%, 50 to 99%, 55 to It can be 99%, 60 to 99%, 65 to 99%, 70 to 99%, 75 to 99%, 80 to 99%, 85 to 99%, 50 to 95%, 60 to 95%, 70 to 95%, 75 to 95%, 80 to 95%, or 85 to 95%.

[0074] In one embodiment of the present invention, 62.1% of mice injected with vectors containing sgRNAs targeting Trp53, Atrx, and Nf1 developed brain tumors, whereas no brain tumors developed in the control group injected with sgRNAs targeting LacZ. Therefore, it can be seen that the animal model provided by the present invention is suitable as an IDH-mutant glioma model. In a specific example, the average lifespan of the mouse model of the present invention may be 34 weeks (Fig. 16).

[0075] The animal model of the present invention is characterized by the fact that the vector-injected cells and the mutation-inducing cells are different. Preferably, the vector-injected cells are neural stem cells of the subventricular zone, the mutation-inducing cells are oligodendrocyte progenitor cells, and the mutation is maintained in cells of the oligodendrocyte lineage.

[0076] The animal model of the present invention is characterized in that neural stem cells in the subventricular zone, into which a vector inducing Idh1R132H, Trp53, Atrx, and Nf1 mutations only in the oligodendrocyte precursor cells is injected, maintain normal genes and a normal phenotype. Therefore, it can be characterized in that tumors do not develop at the location where the vector inducing mutations is injected. As the vector-injected neural stem cells differentiate and migrate toward the cerebral cortex, oligodendrocyte precursor cells are generated, and at this time, the Idh1R132H, Trp53, Atrx, and Nf1 mutations occur.

[0077] The animal model of the present invention may be such that the Idh1R132H, Trp53, Atrx, and Nf1 mutations are specifically present in oligodendrocyte progenitor cells, for example, cells of the oligodendrocyte lineage differentiated from electroporated subventricular zone neural stem cells (Fig. 11).

[0078] In one embodiment of the present invention, as a result of analyzing IDH-mutant glioma in a mouse model, low-grade glioma with characteristics of cellular proliferation was observed, and high-grade glioma with characteristics such as intra-tumoral hemorrhage, cellular proliferation, and nuclear atypia was observed (Figs. 14 and 15), and it was confirmed that human IDH-mutant glioma has immunoreactivity for Idh1R132H, Olig2, Ki-67, Gfap, and Nestin, and more specifically, it has the characteristic of IDH-mutant glioma arising from glial cell progenitor cells (GPCs) including oligodendrocyte progenitor cells (OPCs).

[0079] Specifically, the IDH-mutant glioma animal model provided by the present invention has characteristics that directly reflect the phenomenon of human patients in which IDH-mutant glioma develops from human glial progenitor cells (GPCs) including oligodendrocyte progenitor cells (OPCs).

[0080] In one embodiment of the present invention, it was confirmed that the neural stem cells in the subventricular region where the vector was first injected did not express a mutation and maintained a normal structure, whereas the oligodendrocyte progenitor cells differentiated from the neural stem cells and generated had a mutation through GFP. That is, it was confirmed through immunofluorescence staining that the GFP-positive oligodendrocyte lineage cells were normally differentiated and distributed around the brain tumor even after the development of IDH-mutant glioma. In other words, glial cells with the same mutation as the IDH-mutant glioma are distributed around the brain tumor derived from the originating cell of the IDH-mutant glioma, and thus, it can be used in future functional studies on the remaining glial progenitor cells including mutations, molecular biology-level mechanism studies, and the search for new preventive and therapeutic agents for brain tumors.

[0081] The animal model according to the present invention has a brain tumor or somatic cancer, for example, an IDH-mutant glioma. Specifically, a recombinant vector capable of inducing a mutation in oligodendrocyte progenitor cells (OPCs) is injected into normal neural stem cells (NSCs) through electroporation, and when the normal neural stem cells injected with the recombinant vector differentiate into oligodendrocyte progenitor cells, a mutation is induced, and these mutant cells develop IDH-mutant glioma in a specific region of the brain. Similar to the characteristics observed in actual IDH-mutant glioma patients, normal neural stem cells injected with the recombinant vector exhibit a normal cell structure, and IDH-mutant glioma is induced through abnormal division and growth of oligodendrocyte progenitor cells (OPCs) that have acquired a mutation. The IDH-mutant glioma of the above animal model is a high-grade glioma with characteristics such as intra-tumoral hemorrhage, cellular proliferation, and nuclear atypia as shown in the results of hematoxylin and eosin (H&E) staining of tumor tissue, and IDH1 R132We confirmed that the tumor cells of the animal model had immunoreactivity for H, Olig2, GFAP, Ki-67, and Nestin. Single cell RNA-sequencing analysis also confirmed that the tumor cells of the animal model had transcriptome expression characteristics similar to those of human tumor cells. Somatic oncogenic mutations, for example, mutations in Idh1, Trp53, Atrx, and Nf1, enable oligodendrocyte progenitor cells to progress to IDH-mutant glioma. Therefore, it can be said that the animal model using Idh1, Trp53, Atrx, and Nf1 mutations closely reflects the characteristics of human patients in which IDH-mutant glioma develops from oligodendrocyte progenitor cells.

[0082]

[0083] One example of the present invention relates to the use of an IDH-mutant glioma animal model to observe the evolutionary process of brain tumors and understand the pathogenesis thereof.

[0084] Specifically, the present invention is based on the fact that IDH-mutant glioma is known to start from a mutation in which the 132nd amino acid arginine of the IDH1 gene is changed to histidine (human chromosome 208,248,388 c.395G(C)>A(T) mutation, or IDH1 p.R132H), and more specifically, the expression level of IDH1 p.R132H and other cancer-driver mutations is measured for the subventricular region tissue, the normal cortex tissue around the tumor, and the IDH-mutant glioma tissue of a target individual, and then the IDH1 p.R132H mutation is shared in the subventricular region tissue, the normal cortex tissue around the tumor, and the IDH-mutant glioma tissue, but other mutations are shared in the subventricular region tissue and the normal cortex tissue around the tumor. A method for predicting the cell of origin of an IDH-mutant glioma, when not all tumor-causing mutations are shared.

[0085] One example of the present invention relates to a method for predicting the cell-of-origin of malignant brain tumor tissue by comparing the expression level of a cancer-driver mutation in the subventricular zone (SVZ) or tumor-adjacent normal cortex with the expression level of a cancer-driver mutation in IDH-mutant glioma tissue (see FIG. 2-9).

[0086] Specifically, by using deep panel sequencing, site-specific amplicon sequencing of tumor-specific somatic mutations, and droplet-based digital PCR, normal brain tissues were divided into three groups, and an “IDH1 mutation sharing group” was identified among them (see Example 1). By detecting tumor-specific somatic mutations in the normal brain cortex tissue surrounding the tumor that belonged to the “IDH1 mutation sharing group”, it was inferred that there is a common progenitor cell between the IDH-mutant cells in the tumor and normal brain cortex tissues (see Example 2). It was confirmed that cells with IDH1 mutations in the normal brain cortex tissue surrounding the tumor are glial cell lineage, and that this result is the same for both astrocytomas and oligodendrogliomas. Therefore, the cell of origin of IDH-mutant gliomas is determined to be a glial progenitor cell (GPC) or an oligodendrocyte progenitor cell (OPC), regardless of the type of glioma.

[0087] One example of the present invention relates to a method for identifying an IDH mutant glioma or a method for providing information for diagnosing an IDH mutant glioma,

[0088] A step of extracting DNA from a biological sample of a subject and quantifying the expression level of a glioma marker contained in the extracted DNA.

[0089] Obtain the variant allele frequency (VAF) of the above glioma marker,

[0090] A step of determining that the test sample has a glioma marker is included when the VAF value of the glioma marker for the test sample is higher than the false positive cut-off value obtained from the VAF distribution of the glioma marker for the control sample.

[0091] The false positive cut-off value obtained from the VAF distribution of the glioma marker of the control sample may be obtained by performing the steps of quantifying the expression level of the glioma marker contained in a DNA extract obtained from a normal tissue corresponding to the test sample, obtaining the variant allele frequency (VAF) of the glioma marker, obtaining the VAF distribution of the glioma marker of the control sample, and setting the VAF value corresponding to Z-score 3.0 from the VAF standard normal distribution as the false positive cut-off value. In this regard, an exemplary distribution curve for the VAF distribution of the glioma marker of the control sample is substantially described in FIG. The semester mathematical expression 1 represents the definition of the Z score, and in the standard normal distribution curve, the Z score is a random variable of a normal distribution with a mean of 0 and a standard deviation of 1, that is, a value that evaluates how many times the standard deviation is away from the mean. Accordingly, a Z-score of 3.0 or higher corresponds to a percentage of 0.13% or higher within the standard normal distribution curve. The Z-score can be defined by the following mathematical equation 1.

[0092]

[0093] In the above mathematical expression 1, Z is a standard score, s is a standard deviation, x is a variable, and m is a mean.

[0094] The VAF cutoff point of the glioma marker corresponding to the Z-score 3.0 or higher or the percentage within the standard normal distribution curve in the upper 0.13% or higher is defined as 0.115%, and the VAF value of the glioma marker is set as the false positive cut-off value. Accordingly, if the VAF value of the glioma marker obtained from the test sample of the subject is higher than the false positive cut-off value, the test sample can be determined to be a tissue containing the glioma marker. For example, if the glioma marker is an IDH mutant gene, for example, an IDH1 R132 mutant gene, the false positive cut-off value in the brain tissue of the subject can be 0.115%. False positive results occur for various reasons, such as experimental errors in expression level analysis and sequence analysis errors, and such false positive results mean that a result is produced that is incorrectly detected as present even though the glioma marker does not actually exist in the sample.

[0095] In the present invention, the measurement of the expression level of the glioma marker may include a step of confirming the presence or absence of the mutation and the expression level, and preferably, the variant allele frequency (VAF) may be measured. In the present invention, the "variant allele frequency (VAF)" refers to the allele frequency of a variant, for example, a mutation, in a target site of a tissue, and the "allele frequency" refers to the relative frequency of an allele in a target site, and may be expressed as a %. In the present invention, the "variant allele frequency (VAF)" refers to the allele frequency of a variant, for example, a mutation, in a target site of a tissue, and the "allele frequency" refers to the relative frequency of an allele in a target site, and may be expressed as a %.

[0096] In the present specification, glioma markers include glioma-causing genes such as IDH mutant gene, Trp53, Atrx, and Nf1 gene, and these genes are as described above, and the glioma marker according to the present invention is not limited thereto. The glioma markers include IDH1 mutant gene, glioma-causing genes, etc., and may be, for example, one or more genes from the group consisting of IDH1 mutant gene, Trp53, Atrx, Nf1, CDKN2A, CDKN2B, 1p / 19q co-deletion, TERT promoter, FUBP1, CIC, and NOTCH1 genes.

[0097] In detail, in the present invention, the expression level of the IDH mutant gene, for example, the IDH1 R132 mutant gene, and more specifically, the oncogenic mutation including IDH1 p.R132H, is a process of confirming the presence and expression level of the mutation, and preferably, by using brain tissues of a subject without the IDH mutant gene (control group), the level of artifact or noise in the process of measuring the variant allele frequency (VAF) can be measured to derive a specific value of exactly what percentage (%) of the variant allele frequency (VAF) must be shown to be IDH1-mutated. In other words, it provides a cut-off value for determining whether the target oncogenic gene is present in the target tissue, that is, excluding false positives.

[0098] Measurement of the expression level of the tumor-causing mutant gene may be a process of confirming the presence and expression level of the mutation, and preferably, the variant allele frequency (VAF) may be measured. In the present invention, the tumor-causing mutant gene may be an IDH mutant gene, or a deletion of one or more genes from the group consisting of Trp53, Atrx, and Nf1 genes, as described above.

[0099] In the present invention, the "variant allele frequency (VAF)" refers to the allele frequency of a variant, for example, a mutation, at a target site of a tissue, and the "allele frequency" refers to the relative frequency of an allele at a target site and can be expressed as a %.

[0100] In the present invention, the “subject” or “subject” may refer to a patient who has developed or is suspected of developing a brain tumor, and is in need of or is expected to require appropriate treatment for a brain tumor, but is not limited thereto.

[0101] The expression level of the above tumor-causing gene can be quantified in various ways, for example, quantitative or real-time PCR, Droplet Digital PCR, etc., and preferably Droplet Digital PCR considering sensitivity and ease of target gene analysis.

[0102] In order to confirm the presence of the IDH1 p.R132H mutation in the subventricular region tissue used in the present invention and the normal cerebral cortex tissue surrounding the tumor, the allele frequency (VAF) of the IDH1 p.R132H gene is measured using human cerebral cortex tissue derived from patients who underwent brain surgery for diseases other than IDH-mutant glioma, and the normal distribution curve for the frequency of the IDH1 mutant allele in the human cerebral cortex tissue can be inferred from the measured value. The brain tissue that occurs at a frequency that statistically exceeds the top 0.15% (0.115% in terms of the frequency of the variant allele) on the normal distribution curve obtained here is defined as a tissue containing the IDH1 p.R132H mutation.

[0103] In the present invention, the frequency of variant alleles of various tumor-causing mutations including the IDH1p.R132H mutation can be determined by DNA sequencing analysis or droplet digital PCR. More specifically, the frequency can be expressed by measuring the relative frequency (%) of the allele of the mutation after amplifying a target region of about 200 to 300 bp by PCR using a primer specific for the mutation. At this time, the droplet digital PCR indicates whether DNA with the mutation is contained within the microdroplet using a fluorescent marker.

[0104] The present invention relates to a method for inferring the cell in which the IDH1 p.R132H mutation first occurred by identifying the type of normal cells that acquired the IDH1 mutation found in normal brain cortex tissue surrounding a tumor.

[0105] In the present invention, the differentiation process of neural cells, well known through previous research, was used to infer the cell of origin. This process begins with neural stem cells (NSCs), and passes through various progenitor cell stages including neural progenitor cells (NPCs), glial progenitor cells (GPCs), and oligodendrocyte progenitor cells (OPCs), and then differentiates into various mature cells such as adult neurons, adult astrocytes, and adult oligodendrocytes.

[0106] In the present invention, the target for predicting the tissue origin cell is an IDH-mutant glioma, preferably an IDH-mutant astrocytoma (1p / 19q non-codeleted) in which the p arm of chromosome 1 and the q arm of chromosome 19 are not deleted according to the World Health Organization (WHO) classification, and an IDH-mutant oligodendroglioma (1p / 19q codeleted) in which the short arm (p arm) of chromosome 1 and the long arm (q arm) of chromosome 19 are deleted.

[0107] In the present invention, the “subventricular zone tissue” refers to a region located in a location almost in contact with the ependymal layer on the lateral wall of the lateral ventricle, and neural stem cells that have the ability to proliferate even after reaching adulthood are distributed in the subventricular zone.

[0108] In the present invention, the subventricular region tissue separated from the IDH-mutant glioma may be located at a distance of 1 mm to 5 mm from each other, but is not limited thereto.

[0109] In the present invention, the “tumor-adjacent normal cortex tissue” refers to a tissue located at a site that serves as the entrance of a surgical corridor for accessing a tumor during a neurosurgical operation to remove a brain tumor, and within this tissue, adult neurons, adult astrocytes, adult oligodendrocytes, microglia, and glial progenitor cells including oligodendrocyte progenitor cells are distributed.

[0110] In the present invention, the IDH-mutant glioma and the surrounding normal brain cortex tissue separated from the tumor may be located at a distance of 1 mm to 15 mm from each other, but are not limited thereto.

[0111] The cell-type specific markers used in the present invention are divided into a NEUN (Neuronal nuclei) positive group to distinguish neurons, an OLIG2 (Oligodendrocyte transcription factor 2) positive group to distinguish oligodendrocyte lineage cells, and astrocytes into a group without a cell-type specific marker, but are not limited thereto.

[0112]

[0113] Another embodiment of the present invention relates to the use of an animal model with IDH-mutant glioma to screen for drugs for the prevention, mitigation, or treatment of brain tumors. Specifically, the present invention relates to a method for screening for drugs for the prevention, mitigation, or treatment of brain tumors, comprising administering a candidate drug to the animal model of the present invention and determining whether the drug reduces the brain tumor.

[0114] A method for screening a brain tumor treatment agent, comprising administering a brain tumor treatment candidate to an animal model having an IDH mutant glioma according to the present invention and then determining whether the brain tumor is alleviated or cured. The step of determining whether the brain tumor is alleviated or cured may be performed by measuring the gene expression level or protein activity level of one or more markers selected from the group consisting of NeuN, nestin, GFAP, OliG2, S100b, MBP, and Ki67.

[0115] Specifically, animals harboring IDH-mutant gliomas can be useful for screening brain tumor therapeutics by determining whether the treatment alleviates brain tumor symptoms in the presence and absence of a brain tumor therapeutic candidate. A substance that indirectly or directly alleviates brain tumor symptoms can be selected as a brain tumor therapeutic. That is, by measuring brain tumor symptoms in the absence of a brain tumor therapeutic candidate and measuring brain tumor symptoms in the presence of a brain tumor therapeutic candidate and comparing them, a substance that alleviates brain tumor symptoms in the presence of a brain tumor therapeutic candidate compared to symptoms in the absence of the brain tumor therapeutic candidate can be predicted as a brain tumor therapeutic.

[0116] The step of confirming whether the above brain tumor symptoms are alleviated may be performed by measuring the expression level or protein activity level of an IDH-mutant glioma marker. The IDH-mutant glioma marker may be one or more selected from the group consisting of Idh1R132H, Olig2, Ki-67, GFAP, Nestin, etc., but is not limited thereto, and any brain tumor marker known in the art may be freely selected.

[0117] The step of measuring the expression or activity level of the protein may be performed by a method of measuring the expression or activity level of one or more proteins selected from the group consisting of western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, immunofluorescence, ouchterlony, complement fixation assay, and protein chip, but is not limited thereto.

[0118] The step of measuring the expression or activity level of the above protein may be performed by measuring the level of mRNA transcripts. The mRNA may be mRNA transcribed from a gene encoding the protein or mRNA transcribed from a target gene regulated by the protein.

[0119] In the present invention, “candidate substance” means a substance tested as a drug having preventive, alleviative, or therapeutic activity against brain tumors, preferably IDH-mutant gliomas, and may include any molecule, such as extracts, proteins, oligopeptides, small organic molecules, polysaccharides, polynucleotides, antisense oligonucleotides, RNA of siRNA, and a wide range of compounds. Such candidate substances also include synthetic substances in addition to natural substances.

[0120] The present invention provides an IDH-mutant glioma animal model and a method for producing the same, and more specifically, an animal model that accurately reflects the phenomenon in human patients in which IDH-mutant glioma develops from glial progenitor cells (GPCs) and oligodendrocyte progenitor cells (OPCs) inferred from cells having an IDH1R132H mutation in the tumor-adjacent normal cortex of IDH-mutant glioma patients, and a method for producing the same. The animal model and the method for producing the same can be usefully utilized in diagnosing human IDH-mutant glioma, developing therapeutic agents, developing new drugs, etc.

[0121] In addition, the present invention can predict the tissue origin of an IDH-mutant glioma of unknown primary site, and thereby determine a treatment target site capable of maximizing the therapeutic effect of the IDH-mutant glioma, thereby enabling the establishment of an appropriate treatment strategy.

[0122] Figure 1 is a schematic presentation of an overall experimental summary of the present invention, in which a cell of origin is inferred using a sample isolated from an IDH-mutant glioma patient in one example of the present invention, and the results are verified using a mouse model.

[0123] Figure 2 is a simplified diagram showing the process of collecting a sample from an IDH-mutant glioma patient in an example of the present invention.

[0124] Figure 3 shows an MRI image of the location where a sample was taken from an IDH-mutant glioma patient and the distance to the tumor in an example of the present invention, and the rightmost tissue slide shows the histological status of each tissue.

[0125] Figure 4 is a graph showing a statistically very high (>0.13%) mutation level threshold (VAF) using a droplet-based digital PCR reaction in one embodiment of the present invention. These results were obtained using normal brain cortex tissue derived from 33 patients, not the IDH-mutant glioma patients mentioned in one preparation example of the present invention.

[0126] FIG. 5 is a comparison of the results of droplet-based digital PCR reaction and site-specific amplicon sequencing of tumor-specific somatic mutations in IDH1R132H mutation and TP53R273C in one example of the present invention.

[0127] Figure 6 is a graph showing the results of deep sequencing analysis performed on a case-by-case basis in one embodiment of the present invention. It shows shared tumor-specific somatic mutations between tumor tissue (y-axis) and normal subventricular zone tissue (x-axis, upper left graph) or normal cerebral cortex tissue surrounding the tumor (x-axis, upper right graph and lower left graph).

[0128] Figure 7 is a table summarizing the results of deep sequencing analysis performed in one embodiment of the present invention. The upper two tables show data between tumor tissue and normal subventricular zone tissue, and the lower three tables show data between tumor tissue and normal cerebral cortex tissue surrounding the tumor. As described in one embodiment of the present invention, the "IDH1 mutation sharing group" is observed only in the normal cerebral cortex tissue surrounding the tumor.

[0129] FIG. 8 is a graph showing amplicon sequencing performed targeting tumor-specific somatic mutations in tumor tissue and normal brain cortex tissue surrounding the tumor of four patients in the “IDH1 mutation sharing group” in one embodiment of the present invention.

[0130] Figure 9 is a table showing the distribution of IDH1R132H by classifying normal brain cortex tissue around a tumor of a patient in the “IDH1 mutation sharing group” that was cryopreserved in one embodiment of the present invention into cell nuclei by cell type.

[0131] Figure 10 is a summary of the experiments to be performed in the present invention. The upper figure illustrates the process of preparing mice for an IDH-mutant glioma mouse model, mating them, inserting a plasmid vector, and electroporating them. The lower figure is a vector map schematically depicting the plasmid vector.

[0132] Figure 11 shows the results of an experiment performed in one embodiment of the present invention, in which Ng2 is an OPC-specific marker, Olig2 is an oligodendrocyte lineage cell-specific marker, Gfap is an astrocyte-specific marker, and NeuN is a neuron-specific marker. All GFP-positive cells are either Ng2-positive or Olig2-positive.

[0133] Figure 12 shows the results of an experiment performed in one embodiment of the present invention. This data measures the relative intensity of GFP, and shows that the degree of cell proliferation of OPC-ITAN among the IDH-mutant glioma mouse models of the present invention is stronger than that of other comparative groups (OPC-TAN or OPC-LacZ). That is, when the mouse (OPC-ITAN) was observed for 30-40 weeks after electroporation according to Example 4, it was confirmed that there were more GFP-positive cells (i.e., cells derived from mutant OPC) and their density was higher than that of the mouse generated in Comparative Example 1 (OPC-TAN & OPC-LacZ).

[0134] FIG. 13 is a representative image showing the GFP intensity presented in FIG. 12 in one embodiment of the present invention.

[0135] Figure 14 illustrates the characteristics of a brain tumor generated from the OPC-ITAN model, one of the IDH-mutant glioma mouse models, in one embodiment of the present invention. The characteristics of the H&E staining, immunofluorescence staining, and immunohistochemical staining images all show results identical to those of human IDH-mutant glioma.

[0136] Figure 15 shows that in one embodiment of the present invention, the characteristics of both low-grade glioma (upper photo) and high-grade glioma (lower photo) are observed in the OPC-ITAN model among IDH-mutant glioma mouse models.

[0137] Figure 16 is data showing the brain tumor incidence and survival rate of an IDH-mutant glioma mouse model (OPC-ITAN) in one embodiment of the present invention.

[0138] Figure 17 is a UMAP showing the results of single-cell transcriptome analysis of an IDH-mutant glioma mouse model in one embodiment of the present invention.

[0139] Figure 18 is a dot graph showing cell type markers that serve as the basis for annotation of cell types in single-cell transcriptome analysis of an IDH-mutant glioma mouse model in one embodiment of the present invention.

[0140] Figure 19 is a UMAP showing the distribution of tumor cells among GFP-positive cells during single-cell transcriptome analysis of an IDH-mutant glioma mouse model in one embodiment of the present invention.

[0141] Figure 20 is a graph showing what pattern the single-cell transcriptome data of a brain tumor of an IDH-mutant glioma mouse model and the single-cell transcriptome data of a human IDH-mutant glioma (astrocytoma) show in terms of the glioma cell classification score in one embodiment of the present invention.

[0142] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0143]

[0144] Example 1: Characteristics of IDH-mutant glioma patients

[0145] If somatic mutations exist in the normal brain cortex tissue and normal subventricular region tissue surrounding the tumor collected in Example 1-1 at a certain distance from the tumor, the degree of gene mutation (mutational burden) or the frequency of variant alleles (variant allele frequency, VAF) in the normal brain cortex tissue and normal subventricular region tissue surrounding the tumor is predicted to be much lower than in the tumor, and the following experiment was performed.

[0146]

[0147] 1-1: Sample preparation

[0148] To identify somatic mutations in the normal subventricular zone and the surrounding normal cerebral cortex away from the tumor tissue, we obtained a) normal subventricular zone tissues determined to be pathologically and radiologically normal, b) normal cerebral cortex tissues determined to be pathologically and radiologically normal around the tumor, c) tumor tissues, and d) blood from 29 patients with IDH-mutant glioma. We also obtained normal cerebral cortex from 33 patients who underwent brain surgery for diseases such as epileptic encephalopathy, Alzheimer's disease, metastatic brain tumors, meningiomas, and IDH-wild type glioblastomas, for a total of 127 tissues (Fig. 1).

[0149] The brain tumor patients used in this experiment used a magnetic resonance imaging (MRI)-navigation system to confirm the locations of the normal brain cortex tissue, tumor tissue, and subventricular region tissues surrounding the tumor from which tissue was extracted. The normal brain cortex and subventricular region tissues surrounding the tumor were resected at a safe distance of approximately 4.21 to 15.66 mm from the tumor.

[0150] Hereinafter, to confirm very low levels of somatic mutations in the normal brain cortex tissue surrounding the tumor and normal subventricular zone tissue, deep panel sequencing, site-specific amplicon sequencing of tumor-specific somatic mutations, and droplet-based digital PCR assays were performed on the samples a) to d).

[0151]

[0152] 1-2: Deep panel sequencing of IDH-mutant glioma patient tissues

[0153] DNA was extracted from frozen brain tissue or blood using the Qiamp mini DNA extraction kit. A panel sequencing library was constructed according to the targeted gene hybrid capture sequencing protocol from Celemics targeting a total of 15 tumor-causing mutations (Table 2). Paired-end read sequencing of the library was performed using the Illumina Miseq Dx platform. According to GATK Best Practice, bam files were generated from Fastq files using the human reference genome (GRCh38), and an average read depth of 723.13X was obtained in the normal brain cortex tissue surrounding the tumor, an average read depth of 679.87X in the subventricular zone tissue, and an average read depth of 813.5X in the tumor tissue. Somatic mutations were detected using the MuTect2 and Strelka2 algorithms (Fig. 7).

[0154] Oncogenic mutation genes associated with glioma include IDH1, IDH2, TP53, ATRX, NF1, CIC, RB1, EGFR, PIK3CA, PIK3R1, PDGFRA, TERT promoter, PTEN, SPTA1, and ARID2.

[0155]

[0156] 1-3: Whole genome sequencing of IDH-mutant glioma patient tissues

[0157] DNA was extracted from frozen brain tissue or blood using the Qiamp mini DNA extraction kit. A library for whole-genome sequencing was constructed using the Illumina Truseq DNA PCR-Free library prep kit, and paired-end read sequencing was performed using the Illumina NovaSeq 6000 platform. According to GATK Best Practice, bam files were generated from Fastq files using the human reference genome (GRCh38), and an average read depth of 30X was obtained. Somatic mutations were detected using the MuTect2 and Strelka2 algorithms.

[0158]

[0159] 1-4: Droplet-based digital PCR assays for IDH-mutant glioma patient tissues

[0160] IDH1 R132H Wow TP53 R273C To detect mutations, experiments were conducted using the ddPCR QX200 system (Bio-Rad Laboratories, Inc.). Mutation-specific primers and probes (IDH1 R132H , BR186dHsaMDV2010055; TP53 R273C , BRdHsaMDV2510538; Bio-Rad Laboratories, Inc.) were used to distinguish mutant and wild-type alleles using FAM and HEX markers, respectively.

[0161] ddPCR reactions were performed using ddPCR Supermix for probes (#1863023, Bio-Rad Laboratories, Inc.) according to the manufacturer's protocol. Droplets were generated with an Automatic Droplet Generator QX200 (Bio-Rad Laboratories, Inc.), and data were acquired using a QX200 Droplet Reader (Bio-Rad Laboratories, Inc.). The results were analyzed using the QuantaSoft (Bio-Rad Laboratories, Inc.) program. To ensure sufficient sensitivity, only samples in which wild-type (HEX+) DNA was detected at 100 copies / ㎕ or more were used for analysis (Figs. 6-7).

[0162] In order to confirm very low levels of somatic mutations in the normal brain cortex tissue around the tumor and the normal subventricular zone tissue according to the above Examples 1-2 to 1-4, deep panel sequencing, site-specific amplicon sequencing of tumor-specific somatic mutations, and droplet-based digital PCR assays were performed on the samples of the above a) to d). That is, for 94 samples obtained from IDH-mutant glioma patients, deep panel sequencing analysis (average read depth of 757.5 X) centered on the glioma-related tumor-causing mutant genes in Tables 4 and 5, site-specific amplicon sequencing targeting tumor-specific somatic mutations (average read depth of 391,958 X), and IDH1 R132H Wow TP53 R273C Droplet-based digital PCR reactions were performed.

[0163] IDH1 R132H Wow TP53 R273C ddPCR analysis was performed to determine the mutation level (VAF). Specifically, IDH1 R132H Wow TP53 R273C To detect mutations, experiments were conducted using the ddPCR QX200 system (Bio-Rad Laboratories, Inc.). Mutation-specific primers and probes (IDH1) provided by Bio-Rad Laboratories, Inc. (manufacturer) R132H , BR186dHsaMDV2010055; TP53 R273C , BRdHsaMDV2510538; Bio-Rad Laboratories, Inc.) were used to distinguish mutant and wild-type alleles using FAM and HEX markers, respectively. The sequences containing human-derived primers and probes provided by the manufacturer are listed in Table 3 below.

[0164] SEQ ID NO. Mutant gene primer and probe sequence 182IDH1p.R132HATTATCTGCAAAAATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCTATCATCATAGGTCATCATGCTTATGGGGATCAAGTAAGTCATGTTGGCAATAATGTGATTTTGCATGTTTTTTTT 183TP53p.R273CTTGCTTCTCTTTTCCTATCCTGAGTAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGTGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGG

[0165] ddPCR reactions were performed using ddPCR Supermix for probes (#1863023, Bio-Rad Laboratories, Inc.) according to the manufacturer's protocol. Droplets were generated with an Automatic Droplet Generator QX200 (Bio-Rad Laboratories, Inc.), and data were acquired using a QX200 Droplet Reader (Bio-Rad Laboratories, Inc.). The results were analyzed using the QuantaSoft (Bio-Rad Laboratories, Inc.) program. To ensure sufficient sensitivity, only samples in which wild-type (HEX+) DNA was detected at 100 copies / ㎕ or more were used for analysis.

[0166]

[0167] 1-5: IDH1 distributed at low levels in normal cerebral cortex tissue and normal subventricular zone tissue R132H Detection of mutations (brain tissue samples obtained from a control group that did not have the IHD mutation gene)

[0168] As a control group for the brain tissue of a patient with the IHD mutation gene of Example 1-1, the same experiment was conducted on the brain tissue of a normal person, i.e., a control group without the IHD mutation gene. Accordingly, as a control group without the IHD mutation gene, IDH1, which is distributed at a low level in the normal cerebral cortex tissue around the tumor and the normal subventricular zone tissue, was selected. R132H To detect mutations, normal brain cortex tissue samples were prepared from 33 patients who underwent brain surgery for diseases other than IDH-mutant glioma.

[0169] That is, to detect somatic mutations at a very low level (VAF of less than 1%) in brain cortical tissues without IDH-mutant genes (negative) derived from 33 patients who underwent brain surgery for brain diseases known to be unrelated to IDH-mutations, such as epileptic encephalopathy, Alzheimer's dementia, metastatic brain tumors, meningiomas, and IDH-wild type glioblastomas, we used normal brain cortical tissues to detect somatic mutations at a very low level (VAF of less than 1%). R132H Droplet-based digital PCR reactions were performed to detect mutations.

[0170] IDH1 mutation-negative brain cortex tissue derived from 33 patients who underwent the above brain surgery R132H Wow TP53 R273C ddPCR analysis was performed to determine the mutation level (VAF). Specifically, IDH1 R132H Wow TP53 R273C To detect mutations, experiments were conducted using the ddPCR QX200 system (Bio-Rad Laboratories, Inc.). Mutation-specific primers and probes (IDH1) provided by Bio-Rad Laboratories, Inc. (manufacturer) R132H , BR186dHsaMDV2010055; TP53 R273C , BRdHsaMDV2510538; Bio-Rad Laboratories, Inc.) were used to distinguish mutant and wild-type alleles using FAM and HEX markers, respectively. The droplet-based digital PCR reaction was performed essentially the same as in Examples 1-4.

[0171] Based on the results, IDH1 in IDH-mutant negative brain cortex tissue R132H Wow TP53 R273C The mean (μ) and standard deviation (σ) were calculated by inferring a normal distribution curve for the mutation distribution level (Fig. 4).

[0172] Figure 4 is a graph showing a statistically very high (>0.13%) mutation level threshold (VAF) using a droplet-based digital PCR reaction in one embodiment of the present invention. These results were obtained using normal brain cortex tissue derived from 33 patients, not the IDH-mutant glioma patients.

[0173]

[0174] 1-6: Comparative analysis of mutation levels in normal brain cortex and subventricular zone tissue from patients with DH-mutant glioma.

[0175] IDH1 in normal brain cortex tissue and subventricular zone tissue obtained from 29 IDH-mutant glioma patients obtained in Example 1-1 R132H Wow TP53 R273C The mutation level (VAF) was measured. That is, IDH1 was measured for normal brain cortex tissue and subventricular zone tissue obtained from IDH-mutant glioma patients in Example 1-4. R132H Wow TP53 R273C For the droplet-based digital PCR reaction results of the mutant gene, VAF was obtained in substantially the same manner as in Example 1-5 above.

[0176] For each tissue, we calculated the Z-score and classified normal brain cortex and subventricular zone tissues from IDH-mutant glioma patients with a Z-score ≥3.0, i.e., a statistically very high mutation level (VAF) in the top 0.13%, as tissues containing IDH mutations.

[0177] [Mathematical Formula 1]

[0178]

[0179] In the above mathematical expression 1, Z is a standard score, s is a standard deviation, x is a variable, and m is a mean.

[0180] IDH1 was performed with the same samples used in the above experiment for cross-validation of the result values. R132H Wow TP53R273C Amplicon sequencing was performed for both mutants, and the ddPCR and amplicon sequencing results were very similar (coefficient of determination R 2 = 0.97859).

[0181] The results were normalized and the cutoff point for a statistically significant very high mutation level (VAF), i.e., z-score 3.0 or higher (over 3σ, or > top 0.13%), was defined as 0.115% (Fig. 4).

[0182] As a result, deep panel sequencing analysis revealed that brain tumor tissues had an average of 3.47 tumor-causing mutations, normal cortical tissues surrounding the tumor had an average of 0.88 tumor-causing mutations, and normal subventricular zone tissues had an average of 1.60 tumor-causing mutations.

[0183] In addition, based on the data obtained through the droplet-based digital PCR reaction and site-specific amplicon sequencing of tumor-specific somatic mutations, the peritumoral normal cortex and normal subventricular zone tissues of 29 IDH-mutant glioma patients were divided into three groups (“mutation-nonshared group,” “IDH1 mutation-shared group,” and “tumor cell microinvasion group”). The “mutation-nonshared group” refers to the group in which no tumor-causing mutations were found in the peritumoral normal cortex or normal subventricular zone, and the “IDH1 mutation-shared group” refers to the group in which no tumor-causing mutations were found in the peritumoral normal cortex or normal subventricular zone, respectively. R132H A group in which no other tumor-causing mutations were detected, and the “tumor cell microinvasion group” refers to a group in which all tumor-causing mutations identified in tumor tissue were detected in the normal brain cortex or normal subventricular zone surrounding each tumor (Fig. 7).

[0184] Based on this, when all 29 patients were classified, the “IDH1 mutation sharing group” could not be found in the 10 patients from whom normal subventricular zone tissue was obtained, whereas among the 26 patients from whom normal cerebral cortex tissue around the tumor was obtained, a total of 10 patients (38.5%, 10 out of 26) were confirmed to belong to the “IDH1 mutation sharing group” (Fig. 7).

[0185] The above results suggest that normal brain cortex tissue surrounding tumors of IDH-mutant glioma patients has low levels of IDH1. R132H We confirmed that there exists a “IDH1 mutation sharing group” of normal brain cortical tissue surrounding tumors. We believed that studying this “IDH1 mutation sharing group” would provide clues to infer the cell of origin of IDH-mutant gliomas.

[0186]

[0187] Example 2: IDH-mutant cells in normal brain cortex tissue surrounding the tumor share a common progenitor cell with the tumor cells.

[0188] In the tumor tissues obtained from patients in the “IDH1-mutation sharing group” classified in Example 1 above, 14-18 tumor-specific somatic mutations, including tumor-causing mutations, were identified through whole-genome sequencing (WGS). Targeting these tumor-specific somatic mutations, amplicon sequencing was performed on surrounding normal brain cortex tissue to determine how many tumor-specific somatic mutations were shared with surrounding normal brain cortex tissue.

[0189] Specifically, based on the data obtained by whole-genome sequencing (WGS) of brain tumor tissues and blood from four IDH-mutant glioma patients as described in Examples 1-3, 14 to 18 tumor-specific mutations, including tumor-causing mutations, were selected for each case. Primers (forward and reverse primers) for amplicon sequencing targeting these mutations were designed to determine how many tumor-specific mutations were also detected in normal brain cortex tissue surrounding the tumor (Figs. 6 and 7). The primer pairs used in the above experiments are described in Tables 4 and 5 below.

[0190] As a result, 2-3 tumor-specific somatic mutations were found in each of the peritumoral normal brain cortex tissues of a total of 4 patients in the “IDH1-mutation sharing group.” This can be considered as evidence that the IDH1-mutant cells in the peritumoral normal brain cortex and the tumor cells originated from a common ancestor. In other words, the IDH1-mutant cells found in the peritumoral normal brain cortex and the IDH-mutant glioma cells originated from the same cell (Fig. 8).

[0191]

[0192] Example 3: All IDH-mutant cells in the normal brain cortex tissue surrounding the tumor are glial cells.

[0193] The above-mentioned frozen normal brain cortex tissue surrounding the tumor was divided into cell nuclei and classified by cell type (Example 3-1). DNA was then extracted from the cell nuclei classified by cell type and IDH1 R132H The presence of tumor-causing mutations including (Examples 3-2, 3-3) was confirmed.

[0194]

[0195] 3-1: Classification of cell nuclei by cell type in cryopreserved normal brain cortex tissue surrounding the tumor

[0196] According to the above Example 1-6, among the 29 IDH-mutant glioma patients of Example 1-1, cryopreserved normal brain cortex tissues surrounding tumors obtained from 4 patients out of 10 patients corresponding to the “IDH1 sharing group” were divided into cell nuclei and the cell nuclei were classified by cell type.

[0197] Specifically, the experiment was conducted following a previously reported method for sorting cell nuclei by cell type in cryopreserved human brain tissue (A. Nott, et al., Nat. Protoc., 2021). Human brain tissue was placed in a solution containing 1% formaldehyde in Dulbecco's phosphate-buffered saline and homogenized using a tissue disrupter. After removing impurities, antibodies targeting well-known marker proteins for each cell type were conjugated. To sort neurons, NEUN Alexa Fluor 488 antibody [clone A60] (1:2,500 dilution; #MAB377X, Millipore) was used, and to sort oligodendrocyte lineage cells, OLIG2 Alexa Fluor 647 antibody [clone EPR2673] (1:2,500 dilution; #81886S, Abcam) was used. To identify dead cell nuclei, DAPI (#422801, Biolegend) was stained, and cell nuclei were sorted by cell type using FACSAria Fusion (BD) or MoFlo Astrio EQ cell sorter (Beckman Coulter), and centrifuged at 1,600 g for 5 minutes to obtain cell nuclei.

[0198]

[0199] 3-2: Verification of tumor-causing mutations and tumor-specific somatic mutations using site-specific amplicon sequencing

[0200] To verify several oncogenic mutations and tumor-specific somatic mutations, including IDH1p.R132H, primers were used to amplify the PCR. The experiment was designed so that the target region of approximately 150-250 bp was amplified by PCR by synthesizing the sequences of primers (forward and reverse primers) differently depending on the target gene (Tables 4 and 5). This region was amplified by PCR using target primers containing 6 base pair index sequences. PCR was performed using PrimeSTAR GXL (Takara, Japan) high-fidelity DNA polymerase under appropriate temperature conditions. The completed amplicon sequencing library was sequenced using the Miseq Dx platform (Illumina, USA), and bam files were generated from the Fastq files using the human reference genome (GRCh38) according to GATK Best Practice, obtaining an average read depth of 391,958 X (Figs. 6-7). Tables 3 and 4 below show site-specific amplicon sequencing primer sequences for tumor-specific somatic mutations, and all sequences described are of human origin.

[0201] VariantsForward primer(5' to 3')SEQ ID NOReverse primer(5' to 3')SEQ ID NOIDH1p.R132HGCAAAATCACATTATTGCCAAC4AAATCACCAAATGGCACCATAC5TERTc.1-124C>TGCGCCGCGAGGAGAGGGCGG6TGCCCCTTCACCTTCCAGCT7TP53p.V173GCTGCTCACCATCGCTATCTG8AGTACTCCCCTGCCCTCAAC9TP53p.R175HGCCAGACCTAAGAGCAATCA10CAAGCAGTCACAGCACATGA11TP53p.N259delTGGAAGAAATCGGTAAGAGGTG12CCATCCTCACCATCATCACA13TP53p.R273CTTGCGGAGATTCTCTTCCTC14CAAGGGTGGTTGGGAGTAGA15TP53p.R273HTTGCGGAGATTCTCTTCCTC16CAAGGGTGGTTGGGAGTAGA17TP53p.C275GTTGCGGAGATTCTCTTCCTC18CAAGGGTGGTTGGGAGTAGA19TP53p.D281_R283delTAACTGCACCCTTGGTCTCC20CTTTGAGGTGCGTGTTTGTG21TP53c.993+1G>ATGTCTTTGAGGCATCACTGC22CCAGCCAAAGAAGAAACCAC23TP53c.920-2A>GTCTTCTTTGGCTGGGGAGAG24GGGAGCACTAAGCGAGGTAA25ATRXp.S692Ifs*9TTGGCAATTTATTAGGCTTAGGA26AGGCGACCGACAGAAACTAA27ATRXp.E886Lfs*18AGCACTTGCTTGCTGCTTCT28TGGATAATCAAGGGCACAAA29ATRXp.K1045*TCCCTGTTGACTTCTCAGCAT30TCTTCATCTGATGGCACTGAA31ATRXp.L1140*CATCAGATGATGATGAGCCACT32TTCCATGAAAGAAGATGGTTG33ATRXp.L1345*TTCTGCCTTTGACTTCTTTATGC34CGAGGCATTTTAAAGGCTGA35ATRXp.C1626FATCCCTCTTGCCACTTCTCA36TTTGTGGATATTTAAACGAAGGTG37ATRXp.E1702Sfs*4AAAGGCAAAAACCTGAAGGA38TGCTCAAGGAAGGAATGTGA39ATRXp.S2043Ffs*9CAAGAAAATCTTCAATCAAGTCCA40AAATCCTGCTGGGATTTTTG41ATRXp.N2140TGCTTAGTTTGTCCAAAGCGATAA42AATCTGGTAGCTGCTAATCGAG43ATRXp.K2272Sfs*5CCTGTTTCAAATGTGACCCTTT44TGGACCACAAAGAAGAAGAAGAG45CICc.452+1G>AGGTGGTGGAATCTGGTAAGG46GAGGCAACTGGATCTCAGGA47CICp.R202WCTTTATCCCTGCCTGTCCTG48GTTGTCCTGGTTGGGATGAC49CICp.R202QCTTTATCCCTGCCTGTCCTG50GTTGTCCTGGTTGGGATGAC51NF1p.Y2698HTCATTGTGCCAAGATCCAAA52GCGCATGTTAGCAAGTTCAT53PTENp.M134delTAAAGCTGGAAAGGGACGAA54CAGATCCAGGAAGAGGAAAGG55RB1c.1389+2T>GTGGAGTTCGCTTGTATTACCG56TCTTGATGCCTTGACCTCCT57RB1p.A18Pfs*3TGTAACGGGAGTCGGGAGAG58CTGTCCTGCTCTGGGTCCTC59PDGFRAp.R841_D842delCTTGCAGGGGTGATGCTATT60AGGACGTACACTGCCTTTCG61PDGFRAp.I1050Qfs*3AGGCTTTCGTTTGTCTCTGG62CCGATGTCATCCATCATGTC63PIK3CAp.K111delTGACCTTCGGCTTTTTCAAC64CGAAGGTATTGGTTTAGACAGAAA65NRASp.Q61RTCGCCTGTCCTCATGTATTG66TTGCATTCCCTGTGGTTTTT67PIK3R1p.N564DAAGCAGGCAGCTGAGTATCG68CGCATTAACTCATCCTGAATTG69NOTCH1p.F357SGTGAGGTCACACAGCTCAGG70AGGACTGCAGCGAGAACATT71CASZ1GCAGTGGTAGTGGGTGACCT72AAAAAGCGCTTCTGGATCAT73SPAG17CACTTTCCCACATCGGTTTT74GTTTCAATTTGCATAGAATCTTCA75FBLN2AGGGAGCTACCAGTGTGCAT76TTGGCCATCCTGCATTTATT77GUSBCGCAGGTGGTATCAGTCTTG78ACGAGAGTGCTGGGGAATAA79USH1CTATTCTTACCCCGCCCTGAT80AGGCACGTGTCACATACAGC81OSBPL8GGCAGCTTGTCTTTGAGCTT82CAAGGGATTTGAGGCCTATTC83MYBPC1TGACCTTGCAGTGACACCAT84AGCCAGACCTTACCATGCTC85CDH5ACACATTTGTCGTGCCTGAA86CAAACCTTCATGGGCTTGAT87EFCAB5TTGGCCAAAGAGTGGTTTAAT88ATTGGGTCAAACTTGCTTGG89EGFGGAAAGGAAGTGGTGGACTG90CACTGACATGTGGCATCCTC91TRPS1TGCAGGTGATTTGCTTCTTG92TGCACTCTTGCTTCTGCACT93.

[0202]

[0203]

[0204] 3-3: Validation of tumor-causing mutations and tumor-specific somatic mutations using droplet-based digital PCR assays

[0205] IDH1 R132H Wow TP53 R273C To detect mutations, experiments were conducted using the ddPCR QX200 system (Bio-Rad Laboratories, Inc.). Mutation-specific primers and probes (IDH1 R132H , BR186dHsaMDV2010055; TP53 R273C , BRdHsaMDV2510538; Bio-Rad Laboratories, Inc.) were used to distinguish mutant and wild-type alleles using FAM and HEX markers, respectively. The droplet-based digital PCR reaction was performed essentially the same as in Examples 1-4. To ensure sufficient sensitivity, only samples in which wild-type (HEX+) DNA was detected at 100 copies / ㎕ or more were used for analysis (Figs. 6-7).

[0206] After the experiment of the above Example 3-1, DNA was extracted from the cell nuclei classified by each cell type and IDH1 was extracted as mentioned in the above Examples 3-2 and 3-3. R132H The presence of tumor-causing mutations including IDH1 mutations was confirmed. As a result, IDH1 mutations were detected in the nuclei of “oligodendrocyte lineage cells” or in the nuclei of cells that were neither “neurons” nor “oligodendrocyte lineage cells” in the normal brain cortex tissue surrounding the tumor of a total of five “IDH1 mutation sharing group” (Fig. 9).

[0207] Additionally, IDH1 mutations were detected in cells of the oligodendroglial lineage regardless of the type of IDH-mutant astrocytoma or IDH-mutant oligodendroglioma (Fig. 9).

[0208] That is, the IDH1 mutant cells found in the normal brain cortex tissue surrounding the tumor are glial cells, and since all of these cells originate from glial progenitor cells (GPCs) including oligodendrocyte progenitor cells (OPCs), it can be seen that the originating cells are glial progenitor cells (GPCs) regardless of the type of IDH-mutant glioma (Figure 9).

[0209]

[0210] Example 4: Creation of an IDH-mutant glioma mouse model

[0211] All mouse experiments were approved and performed in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC) of the Korea Advanced Institute of Science and Technology (KAIST).

[0212] This experiment was conducted to verify whether IDH-mutant gliomas actually develop in a mouse model when oncogenic mutations are induced in glial progenitor cells (GPCs), including oligodendrocyte progenitor cells (OPCs), the origin cells of IDH-mutant gliomas.

[0213]

[0214] 4-1: Preparing the Mouse

[0215] Each mouse was housed in an isolated cage with free access to food and water. The cage was maintained at a temperature of 23°C and a 12-hour light-dark cycle with lights off at 7:00 PM. The health of the mice was regularly monitored by a veterinarian and the experimenter.

[0216] Disease-specific survival (DSS) endpoints were determined by mouse death or euthanasia according to IACUC protocols. Euthanasia conditions were as follows:

[0217] (a) Severe weight loss of 20% or more; (b) Severe neurological impairment including paralysis, seizures, and bowed posture with impaired motor skills; (c) Head swelling.

[0218] LoxP-Stop-LoxP-Cas9-EGFP mice (#026175) and IDH1 fl(R13dH) IDH1fl(R13dH) / +;LoxP-Stop-LoxP-Cas9-EGFP mice (Zhang, Y. et al. Cancer Research, 2019) were crossed fl / + I made a mouse.

[0219]

[0220] 4-2: Production of transformation vector

[0221] The plasmid vector required for the creation of an IDH-mutant glioma mouse model utilized the "PiggyBac Transposon system." This vector system is divided into a "donor vector" and a "helper vector." The "helper vector" contains a DNA sequence capable of producing an enzyme called PBase, and was mixed with the "donor vector" at a certain ratio and injected into mice without any special manipulation or preparation.

[0222] The “donor vector” contains three sgRNAs that can create mutations in oncogenic mutant genes (Trp53, Atrx, Nf1) by combining with the Cas9 protein that can create oncogenic mutations. The sgRNA sequences that create mutations in the Trp53 and Nf1 genes were used in a previously published paper (Zuckermann, M. et al. Nat Commun, 2015), and the sgRNA sequence that creates mutations in the Atrx gene was used in CHOPCHOP (https: / chopchop.cbu.uib.no / ). To minimize potential off-target effects, in silico validation was performed through Benchling (https: / www.benchling.com / crispr). The sgRNA base sequences are shown in Table 6 below.

[0223] Tumor-causing mutant gene sequence (5' → 3') SEQ ID NOTrp53ACAGCCATCACCTCACTGCA1AtrxAGAAGCCAAGATACAGACAT2Nf1AGTCAGCACCGAGCACAACA3

[0224] In addition to the sgRNA base sequence, the above “donor vector” contains a base sequence capable of producing Cre recombinase specifically expressed in OPC. That is, it was designed so that Cre recombinase can be produced under the control of Cspg4 enhancer-β globin promoter. To obtain the above “donor vector,” the pPB-(SbfⅠ)_pU6-sgTrp53-pU6-sgAtrx-(SalⅠ)-(AscⅠ)_Cspg4 enhancer-β globin mini promoter-Cre recombinase plasmid was synthesized by Vector Builder. Afterwards, the pU6-sgNf1 sequence was amplified separately and inserted between SalⅠ and AscⅠ, completing the “donor vector” with the sequence of pPB_pU6-sgTrp53-pU6-sgAtrx-pU6-sgNf1_Cspg4 enhancer-βglobin mini promoter-Cre. Additionally, for a control experiment, pU6-sgLacZ was inserted between SbfⅠ and SalⅠ in the pPB-(SbfⅠ)_pU6-sgTrp53-pU6-sgAtrx-(SalⅠ)-(AscⅠ)_Cspg4 enhancer-βglobin mini promoter-Cre plasmid, completing the control donor vector with the sequence of pPB_pU6-sgLacZ_Cspg4 enhancer-βglobin mini promoter-Cre.

[0225]

[0226] 4-3: Postnatal electroporation of mice

[0227] After hypothermia (≥5 min) was performed on newborn mice (P0-P1) at 1 day of age, IDH1fl(R13dH) / +;LoxP-Stop-LoxP-Cas9-EGFP fl / +The plasmid vectors produced in Preparation Example 9 were mixed in a ratio of “donor vector” : “helper vector” = 2 mol:1 mol and injected into the anterior lateral ventricle area of ​​the right cerebral hemisphere of the mouse. At this time, the location for injecting the plasmid was set as an imaginary line connecting the right eye and “lambda,” one of the skull markers, and a microcapillary needle was inserted at 1 / 3 of the point from “lambda” of this line. 1 ㎕ of the plasmid solution (concentration of 2 ug / ㎕ or more, containing 1% (v / v) FastGreen) was injected at a depth of approximately 1-2 mm. The success of the injection was confirmed by staining the right lateral ventricle area with FastGreen.

[0228] Only animals that were successfully injected received five electric pulses (100 V, 50 ms, 950 ms interval) using a 1-mm tweezers electrode (#CUY650P1, Nepagene) and an ECM830 electroporator (BTX-Harvard apparatus). The current was oriented diagonally, with the positive electrode of the tweezers pointing above the right eye and the negative electrode pointing below the left ear. After electroporation, the newborn mice were placed on a 37°C heating plate to fully recover from anesthesia and then returned to their mothers (Fig. 10).

[0229] After injecting the vector by electroporation, the researcher directly monitored the condition of the mice at least three times a week and checked whether any mice met the euthanasia criteria mentioned in 4-1. After raising the mice for approximately 30-40 weeks, IDH mutant mice were obtained, and the IDH-mutant glioma mouse model was named OPC-ITAN.

[0230]

[0231] Comparative Example 1: Production of a Control Mouse Model

[0232] To better characterize the IDH-mutant glioma mouse model established in Example 4, namely OPC-ITAN, two control groups, namely OPC-TAN (a model in which mutations were made in the Trp53, Atrx, and Nf1 genes in oligodendrocyte progenitor cells (OPCs)) and OPC-LacZ (a model in which no mutations were made in oligodendrocyte progenitor cells (OPCs)) were produced using substantially the same method as in Example 4.

[0233] When the GFP intensity of the three models was measured over time, the IDH-mutant glioma model (OPC-ITAN) showed a statistically significant increase in GFP intensity over time compared to the control groups (OPC-TAN and OPC-LcaZ). This indicates that the mutant cells of the OPC-ITAN model proliferate over time and ultimately have the greatest ability to develop into brain tumors around the 30th week (Figs. 12-13).

[0234]

[0235] Example 5: Single cell transcriptomic analysis of mouse tumor tissue

[0236] 5-1: IDH-mutant glioma mouse model

[0237] Brain tissues were obtained from four tumor-bearing mice (26-38 weeks old) in the IDH-mutant glioma mouse model and one 20-week-old mouse used as a control. The brain tissues were placed on ice at 4°C and maintained. Then, brain tumor tissues showing GFP fluorescence were observed under UV light and dissected with a knife while observing under a microscope. After dissociating into single cells using a mouse brain dissociation kit (Adult brain dissociation kit, mouse and rat, Miltenyi Biotec, #130-107-677), debris was removed. Afterwards, immune cells were identified with CD11b-APC antibody (BioLegend, #101212) and CD45-APC-Cy7 antibody (BioLegend, #103116), and live and dead cells were distinguished with DAPI (#422801, Biolegend). Then, GFP-positive, immune-negative live cells were sorted using FACSAria Fusion (BD).

[0238] Cells from five mice were pooled at 7,500 to 10,000 cells each, and libraries were constructed using the Chromium Single Cell 3' kit V3.1 (10X Genomics, #PN-1000268) and 3' CellPlex kit (10X Genomics, #PN-1000261) according to the manufacturer's recommended protocol. The constructed libraries were used to generate fastq files using NovaSeq 6000 (Illumina), and aligned to the mouse reference genome (GRCm39) with the Cas9-EGFP sequence added using the mkrefs function of the CellRanger 10X software package (Version 8.0.0).

[0239] Subsequent analyses were performed using R (v4.3.3), Seurat (v5.1), Python 3.10, and scanpy (v1.9.8). Low-quality cells (<200 genes) were removed, and 5 mad (median absolute deviation) of log1p_total_counts, 5 mad of log1p_n_genes_by_counts, 5 mad of oct_counts_in_top_20_genes, and 3 upper mad of pct_counts_mt were removed. Doublets were also removed using scDblFinder (v1.16.0). The top 3,000 highly variable genes were identified, and data from 5 mice were combined using scVI, and annotation was performed using UMAP and cell-type marker genes.

[0240] As a result, the brains of electroporated mice were obtained and mutations were confirmed in oligodendrocyte progenitor cells (OPCs) using the reporter GFP, and all GFP-positive cells were positive for Ng2, an OPC-specific marker (Fig. 11).

[0241] Furthermore, brain tumors were observed in 18 out of 29 mice (62.1%) in the OPC-ITAN model (i.e., a model in which Idh1, Trp53, Atrx, and Nf1 mutations were induced in oligodendrocyte progenitor cells (OPCs)) up to 40 weeks of age (Fig. 16). These observed brain tumors had both histological and immunochemical characteristics identical to those observed in human IDH-mutant gliomas (Fig. 14).

[0242]

[0243] 5-2: Comparison of human brain tumor transcriptome and mouse brain tumor single-cell transcriptome data.

[0244] Using the IDH-mutant glioma mouse model established in Example 4, four OPC-ITAN (26- to 38-week-old) mice and one OPC-LacZ (20-week-old) control mouse, the transcriptome information obtained from single cells of a total of 21,158 mouse brain tumor tissues was analyzed to compare how similar the transcriptome information of mouse tumors was to that of human tumors using the well-known IDH-mutant glioma cell classification score (Tirosh, I. et al. Nature, 2016; Venteicher, AS et al. Science, 2017).

[0245] As a result, it was confirmed that the single-cell transcriptome data of human IDH-mutant astrocytoma and the single-cell transcriptome data of IDH-mutant glioma mouse tumors showed similar patterns in terms of glioma cell classification scores (Fig. 20).

Claims

1. Has an IDH-mutant glioma that arises from glial progenitor cells (GPCs) in the brain. Specifically, in glial progenitor cells (GPCs) differentiated from neural stem cells into which the IDH mutant gene has been introduced, the IDH mutant gene is expressed, and the function of one or more genes in the group consisting of Trp53, Atrx, and Nf1 genes is deleted. Animal model of IDH mutant glioma.

2. In the first paragraph, the IDH-mutant glioma is an animal model that is an IDH-mutant astrocytoma or an IDH-mutant oligodendroglioma.

3. An animal model in the first paragraph, wherein the glioma is a high-grade glioma having characteristics such as necrosis, microvascular proliferation, and mitosis in tumor tissue, and having immunoreactivity to GFAP, Nestin, Olig2, and PDGFRα.

4. In the first paragraph, the glioma is a low-grade glioma characterized by nuclear atypia and increased cellularity in tumor tissue, an animal model 5. An animal model according to claim 1, wherein the IDH mutant gene is at least one selected from the group consisting of IDH1 R132, IDH2 R140, and IDH2 R172 mutant genes.

6. An animal model in the first paragraph, wherein the IDH mutant gene is at least one selected from the group consisting of IDH1 R132H, IDH1 R132C, IDH1 R132G, IDH1 R132L, and IDH1 R132S.

7. In the first paragraph, the animal model is an animal model in which the IDH mutant gene is not expressed in neural stem cells into which the IDH mutant gene has been introduced, or in which functional loss of one or more genes from the group consisting of Trp53, Atrx, and Nf1 genes does not occur.

8. In the first paragraph, the animal model is an animal model in which glioma does not develop in neural stem cells of the subventricular region, but glioma develops in the cerebral cortex region.

9. An animal model in the first paragraph, wherein the glial progenitor cells (GPCs) are oligodendrocyte progenitor cells (OPCs).

10. In paragraph 1, Idh1 R132H, An animal model having one or more markers selected from the group consisting of Olig2, Ki-67, GFAP, and Nestin.

11. A method for producing an animal model having an IDH mutant glioma, (1) A step of preparing an animal containing an IDH mutant gene and a Cas nuclease gene, each linked to a recognition site of a site-specific recombinase; (2) a first gene cassette comprising a gene encoding a site-specific recombinase and a transcriptional regulator that specifically expresses the gene in glial progenitor cells; A second gene cassette comprising a polynucleotide encoding a guide RNA for functional deletion of at least one gene selected from the group consisting of Trp53, Atrx, and Nf1 genes, and A step of preparing a PiggyBac transposon system vector including a transposase that helps the first gene cassette and the second gene cassette to be integrated into the genome of the animal; (3) A step of injecting the piggyBac transposon system vector prepared in step (2) into the subventricular zone of the animal in step (1) by electroporation within 4 days after birth of the animal.

12. A manufacturing method according to claim 11, wherein the site-specific recombinant enzyme is Cre recombinase or a modified Cre recombinase.

13. A manufacturing method according to claim 11, wherein the first gene cassette and the second gene cassette are included in one vector.

14. A manufacturing method according to claim 11, wherein the transcription regulator specifically expressed in the glial cell precursor cells is Cspg4 enhancer-βglobin mini promoter.

15. A manufacturing method in the second paragraph, wherein the animal of step (1) is obtained by crossing a first animal including an IDH mutant gene and a second animal including a Cas nuclease gene linked to a recognition site of a site-specific recombinant enzyme.

16. A manufacturing method according to claim 11, wherein the IDH-mutant glioma is an IDH-mutant astrocytoma or an IDH-mutant oligodendroglioma.

17. A manufacturing method according to claim 11, wherein the IDH mutant gene is at least one selected from the group consisting of IDH1 R132, IDH2 R140, and IDH2 R172 mutant genes.

18. A manufacturing method in claim 11, wherein the IDH mutant gene is at least one selected from the group consisting of IDH1 R132H, IDH1 R132C, IDH1 R132G, IDH1 R132L, and IDH1 R132S.

19. A method for screening a brain tumor treatment agent, comprising a step of administering a brain tumor treatment candidate to an animal model having an IDH mutant glioma according to any one of claims 1 to 10 and then confirming whether the brain tumor is alleviated or cured.

20. A method for providing information for the diagnosis of glioma, A step of extracting DNA from a biological sample of a subject and quantifying the expression level of a glioma marker contained in the extracted DNA. A step of obtaining the variant allele frequency (VAF) of the above glioma marker, and A step of determining that the test sample has a glioma marker when the VAF value of the glioma marker for the test sample is higher than the false positive cut-off value obtained from the VAF distribution of the glioma marker for the control sample. A method for providing information for the diagnosis of a glioma including:

21. In paragraph 20, the false positive cutoff value obtained from the VAF distribution of the glioma marker of the control sample is quantified by quantifying the expression level of the glioma marker contained in the DNA extract of a sample (control sample) obtained from a normal tissue corresponding to the test sample, Obtain the variant allele frequency (VAF) of the above glioma marker and obtain the VAF distribution of the glioma marker of the control sample, Including a step of setting the VAF value corresponding to Z-score 3.0 in the above VAF standard normal distribution curve as a false positive cutoff value. A method for providing information for the diagnosis of glioma.

22. A method for providing information for diagnosing glioma in claim 20, wherein the glioma marker is at least one gene from the group consisting of IDH1 mutation gene, Trp53, Atrx, Nf1, CDKN2A, CDKN2B, 1p / 19q co-deletion, TERT promoter, FUBP1, CIC, and NOTCH1 genes.

23. In the 20th paragraph, the expression level of the glioma marker is performed using digital droplet PCR (ddPCR).

Images