Guide DNA for enhancing cleavage activity of argonaute protein and use thereof in target detection
By designing guide DNA containing DNase to enhance the cleavage efficiency of mesophilic Argonaute protein, and combining it with fluorescence signal detection methods, the problems of low cleavage efficiency and cumbersome detection steps of Argonaute protein were solved, achieving highly sensitive amplification-free detection and broadening the application of mesophilic Ago.
Patent Information
- Application Number
- PCT/CN2025/094446
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-11
- Filing Date
- 2025-05-13
- Publication Date
- 2026-01-15
AI Technical Summary
Existing technologies have limited cleavage efficiency for Argonaute proteins, and the detection and application procedures are cumbersome and have low sensitivity.
A guide DNA containing a DNase was designed and attached to the 5' end of a single-stranded DNA to enhance the cleavage efficiency of the mesophilic Argonaute protein. The method of detecting target nucleic acids by fluorescence signal utilizes complementary hybridization of hairpin probes and signal probes and endonuclease cleavage to achieve amplification-free, highly sensitive detection.
It significantly improves the cleavage efficiency of mesophilic Argonaute protein, simplifies the detection process, reduces economic and time costs, and achieves high-sensitivity detection of a variety of pathogens with a detection limit of 35 CFU/mL, thus broadening the application of mesophilic Ago in the field of detection.
Smart Images

Figure CN2025094446_15012026_PF_FP_ABST
Abstract
Description
Guide DNA that enhances Argonaute protein cleavage activity and its application in target detection Technical Field
[0001] This invention relates to guide DNA that enhances the cleavage activity of Argonaute protein and its application in target detection, belonging to the field of biochemical analysis technology. Background Technology
[0002] Clustered regularly spaced short palindromic repeats and their associated systems (CRISPR / Cas) are gene editing and bioanalysis tools widely used for detecting various targets such as biomarkers, bacteria, and viruses due to their trans-cutting capabilities. However, their function requires a protospacer motif (PAM) adjacent to the target sequence or a flanking site of the PAM motif. To date, achieving one-pot detection of multiple targets using a single Cas enzyme remains a technical challenge. Argonaute (Ago) is another next-generation gene editing tool with programmable endonuclease activity, primarily derived from prokaryotes and eukaryotes. Guided by guide RNA (gRNA) or DNA (gDNA), the Ago protein cleaves complementary invading targets, effectively acting as an internal immune system to combat foreign genetic material. Notably, Ago's cleavage features precise targeting, programmability, and independence from PAM-sequence-dependent guide DNA (gDNA). Therefore, its application in molecular diagnostics is gaining increasing acceptance. Currently, prominent Ago variants include Pyrococcus furiosus Argonaute (PfAgo) and Thermus thermophilus Argonaute (TtAgo), which have been widely used in nucleic acid detection. PfAgo (87-99.9℃) and TtAgo (65-85℃) are thermophilic Ago variants with a dynamically fluctuating structure, exhibiting a partially melted surface at physiological temperatures. This characteristic has been shown to be beneficial for achieving higher DNA cleavage activity. However, the high-temperature conditions limit their application scenarios.
[0003] In contrast to thermophilic ago proteins, mesophilic ago proteins, such as Clostridium perfringens Argonaute (CpAgo) and CbAgo, have attracted the attention of researchers. CbAgo, with its lower temperature requirements, is currently widely used in scientific research. However, the compact structure of mesophilic ago proteins limits their enzymatic digestion activity. Most current applications involving mesophilic ago proteins rely on various signal amplification strategies, such as polymerase chain reaction (PCR), loop-mediated isothermal amplification (LCA), and recombinase polymerase amplification, to meet sensitivity requirements. This cumbersome amplification process inevitably increases economic and time costs, reduces operational convenience, and significantly limits the application of mesophilic ago proteins. Therefore, studying the key factors affecting the protease digestion activity of mesophilic ago proteins can help significantly improve their digestion efficiency and greatly promote their application in multiplex analyte detection.
[0004] There are two main methods to enhance the cleavage activity of CbAgo in existing technologies. One is to modify the structure of CbAgo, and the other is to design more efficient gDNA. Modifying the structure of CbAgo is challenging, unpredictable, and has limited effects. Therefore, enhancing the cleavage activity of CbAgo by designing gDNA with specific structures has a wider range of applications. However, the influence of polybase mismatches and DNA spatial structure on CbAgo cleavage efficiency has not been fully studied. Summary of the Invention
[0005] [Technical Issues]
[0006] The technical problem to be solved by the present invention is that the cleavage efficiency of Argonaute protein in the prior art is limited, and the detection process is cumbersome and the detection sensitivity is low.
[0007] [Technical Solution]
[0008] To solve the above-mentioned technical problems, the present invention provides the following technical solution:
[0009] In a first aspect, the present invention provides a guide DNA that enhances the cleavage activity of Argonaute protein, the guide DNA comprising:
[0010] (a) DNA enzyme;
[0011] (b) Single-stranded DNA capable of binding to Argonaute proteins;
[0012] The DNase is attached to the 5' end of the single-stranded DNA.
[0013] In one embodiment, the 3' end of the DNA enzyme is connected to the 5' end of the single-stranded DNA via a phosphodiester bond.
[0014] In one embodiment, the DNA enzyme is an 8-17 DNAzyme.
[0015] In one embodiment, the 8-17 DNAzyme has the following nucleotide sequence: 5'TCCGAGCCGGTCGAA 3'.
[0016] In one embodiment, the guide DNA is 25–40 nt in length.
[0017] In one embodiment, the 5' end of the guide DNA is modified with a phosphate group.
[0018] In one embodiment, the Argonaute protein is a mesophilic Argonaute protein.
[0019] In one embodiment, the Argonaute protein is derived from Clostridium butyrium. Optionally, the Argonaute protein has the amino acid sequence shown in NCBI accession number WP_058142162.1.
[0020] In a second aspect, the present invention provides a method for detecting target nucleic acids, the method comprising:
[0021] (a) Provide the guide DNA described in the first aspect;
[0022] (b) Provide Argonaute protein;
[0023] (c) Providing a target nucleic acid; the target nucleic acid is modified with a fluorescent group and a quenching group; the target nucleic acid is at least partially reverse complementary to the guide DNA;
[0024] (a), (b), and (c) are mixed to allow the guide DNA to guide the Argonaute protein to target and cleave the target nucleic acid. The content of cleaved target nucleic acid in the sample is determined by measuring the fluorescence signal released by the fluorescent group.
[0025] In a third aspect, the present invention provides a method for determining a target substance in a sample, the method comprising:
[0026] (1) A system is provided, the system having:
[0027] Nucleic acid aptamers
[0028] cDNA,
[0029] First single-stranded DNA and second single-stranded DNA; wherein:
[0030] The nucleic acid aptamer contains a third complementary fragment that is complementary to cDNA;
[0031] The first ssDNA contains a first complementary fragment that is complementary to the cDNA.
[0032] The second ssDNA contains a second complementary fragment that is complementary to the cDNA;
[0033] The first ssDNA and the second ssDNA are at least partially reverse complementary.
[0034] (2) The sample is brought into contact with the system. When the target substance is present in the sample, the nucleic acid aptamer specifically binds to the target substance and releases cDNA. The cDNA binds complementary to the first ssDNA and the second ssDNA to form a complex.
[0035] (3) Mix the hairpin probe HP, hairpin probe cHP, endonuclease, and signal probe with the complex, wherein:
[0036] The hairpin probe HP comprises a fragment complementary to the first ssDNA, a fragment complementary to the second ssDNA, an endonuclease recognition site, and the guide DNA described in the first aspect;
[0037] The hairpin probe HP comprises a circular region and a stem region. The circular region contains the endonuclease recognition site, and the stem region contains a nucleotide fragment complementary to the hairpin probe cHP.
[0038] The hairpin probe HP contacts and hybridizes with the complex to form a double-stranded region, exposing a nuclease recognition site. The nuclease cleaves the hairpin probe HP at the nuclease recognition site, causing the hairpin probe HP to release the guide DNA.
[0039] (4) Mix Argonaute protein, Zn 2+ And the guide DNA described in step (3), which guides the Argonaute protein to target and cleave the signal probe, wherein:
[0040] The signal probe is connected to a fluorescent group and a quenching group;
[0041] The guide DNA is at least partially reverse complementary to the signal probe.
[0042] In one embodiment, the length of the third complementary segment is greater than the sum of the lengths of the first complementary segment and the second complementary segment.
[0043] In one embodiment, the length of the third complementary segment is 20 nt, and the lengths of the first and second complementary segments are both 8 nt.
[0044] In one embodiment, the nucleic acid aptamer includes an oligonucleotide sequence that binds to a target substance, optionally a single-stranded DNA or RNA, which is capable of specifically binding to the target substance.
[0045] In one embodiment, the hairpin probe HP comprises, from the 5' end to the 3' end, a fragment complementary to the first ssDNA, a fragment complementary to the second ssDNA, and the guide DNA described in the first aspect; the endonuclease recognition site is located on the fragment complementary to the second ssDNA, and the endonuclease recognition site is adjacent to the guide DNA described in the first aspect without any spacer sequence.
[0046] In one embodiment, the hairpin probe cHP is a single-stranded DNA fragment partially complementary to the stem region of the hairpin probe HP. The hairpin probe cHP stabilizes the structure of the hairpin probe HP by binding complementary to the stem region of the hairpin probe HP.
[0047] In one embodiment, the guide DNA of the first aspect is located in the stem region of the hairpin probe HP, and the hairpin probe cHP hybridizes with the 3' end of the guide DNA of the first aspect through base complementarity.
[0048] In one embodiment, the target substance includes microorganisms. The microorganisms may further be pathogenic microorganisms, including but not limited to viruses, bacteria, fungi, chlamydia, and mycoplasma. As an example, without limitation, the pathogenic microorganism may be at least one of Salmonella Typhimurium, Listeria monocytogenes, Staphylococcus aureus, and Escherichia coli.
[0049] In one embodiment, the fluorescent group and the quenching group are each independently located at the 5' end or the 3' end of the signal probe.
[0050] In one embodiment, the fluorescent group includes, but is not limited to: FAM, Alexa fluor 405, HEX, CY3, CY5, ROX, VIC, JOE, TET, Texas Red, or combinations thereof.
[0051] In one embodiment, the quenching group includes, but is not limited to: TAMARA, BHQ, DABSYL, or combinations thereof.
[0052] In one embodiment, the guide DNA is a single-stranded DNA molecule.
[0053] In one embodiment, the signal probe is a single-stranded DNA molecule.
[0054] In one embodiment, the 3' terminal nucleotide of the signal probe is 5'rAG 3'.
[0055] In one embodiment, the nucleic acid aptamer, cDNA, first single-stranded DNA, second single-stranded DNA, hairpin probe HP, hairpin probe cHP, and signal probe are selected from at least one group of the following (a) to (c):
[0056] (a):
[0057] Nucleic acid aptamer: 5'GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCAGCTACGTCAAAAGTGCACGCTACTTTGCTAA 3';
[0058] cDNA: 5'GGGATGACCAGCGAGCGCTA 3';
[0059] First single-stranded DNA: 5'GCGCTCGCCGTCTGTGATCCCCATTCT 3';
[0060] Second single-stranded DNA: 5'CCGGCTCGGAAGTGGACTCTCCCAGCCGGCAGACGTGGTCATC 3';
[0061] Hairpin probe HP: 5'AGAATGGGGATCACCGGCTGGGAGAGTCCACTTCCGAGCCGGTCGAAAACCAGCATAGT 3';
[0062] Hairpin probe cHP: 5'ACTATGCT 3';
[0063] Signal probe: 5' fluorescent group -ACTATGCTGGTTrAG - quencher group 3';
[0064] (b):
[0065] Nucleic acid aptamer: 5'CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG 3';
[0066] cDNA: 5'GCTCTGTAGATGGCAAGGCA 3';
[0067] First single-stranded DNA: 5'CCTTGCCACAATGTGACTGTTGCATGA 3';
[0068] Second single-stranded DNA: 5'CCGGCTCGGAAGTGGACTCTCCGAGCCGGACATTGTCTACAGA 3';
[0069] Hairpin probe HP: 5'TCATGCAACAGTCCCGGCTCGGAGAGTCCACTTCCGAGCCGGTCGAACCTTCAACGTCT 3';
[0070] Hairpin probe cHP: 5'AGACGTTG 3';
[0071] Signal probe: 5' fluorescent group -AGACGTTGAAGGrAG - quencher group 3';
[0072] (c):
[0073] Nucleic acid aptamer: 5'TTTGGTCCTTGTCTTATGTCCAGAATGCGAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAAATTTCTCCTACTGGGATAGGTGGATTAT 3';
[0074] cDNA: 5'CACACATCTCCTCTGCTATA 3';
[0075] First single-stranded DNA: 5'TAGCAGAGAGGACAGAGCTAAGCATCT 3';
[0076] Second single-stranded DNA: 5'CCGGCTCGGAAGTGGACTCAAGCTACCGGTGTCCTGAGATGTG 3';
[0077] Hairpin probe HP: 5'AGATGCTTAGCTCCCGGTAGCTTGAGTCCACTTCCGAGCCGGTCGAACCTCTCGAGTAG 3';
[0078] Hairpin probe cHP: 5'CTACTCGA 3';
[0079] Signal probe: 5' fluorescent group -CTACTCGAGAGGrAG - quenching group 3'.
[0080] In one implementation, the fluorescent groups modified on each group of signal probes are different, and the quenching groups modified on each group of nucleic acid probes are the same or different.
[0081] In one embodiment, the molar ratio of the nucleic acid aptamer to cDNA is not limited and can be (10-1):1, more preferably 1:1. The molar concentration of the nucleic acid aptamer can be not less than 0.05 μM, not less than 0.1 μM, not less than 0.2 μM, not less than 0.5 μM, or not less than 1 μM. Preferably, it is not less than 0.2 μM.
[0082] In one embodiment, the molar concentration ratio of the hairpin probe HP and the hairpin probe cHP is not limited, and can be (10-1):1, more preferably 1:1. The molar concentration of the hairpin probe HP can be not less than 0.05 μM, not less than 0.1 μM, not less than 0.2 μM, not less than 0.5 μM, or not less than 1 μM. Preferably, it is not less than 0.2 μM.
[0083] In one implementation, the method does not involve the diagnosis and / or treatment of a disease.
[0084] In a fourth aspect, the present invention provides a reaction system comprising the guide DNA, signal probe, and Argonaute protein described in the first aspect; wherein the guide DNA and the signal probe are at least partially reverse complementary; wherein the signal probe is attached with a fluorescent group and a quenching group; and wherein the 3' terminal nucleotide of the signal probe is 5'rAG 3'.
[0085] In a fifth aspect, the present invention provides a kit containing the guide DNA described in the first aspect or the reaction system described in the fourth aspect.
[0086] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here.
[0087] Compared with the prior art, the present invention has the following beneficial effects:
[0088] 1. The nonlinear gDNA provided by this invention can significantly enhance the cleavage efficiency of CbAgo. By investigating the length, conformation, and position of the gDNA, this invention screens out the optimal gDNA. zyme (A type of gDNA containing DNAzyme fragments). gDNA zyme When the DNAzyme fragment is located at the 5' end of gDNA, it has a synergistic effect on enhancing the cleavage efficiency of CbAgo. By expanding the cleavage site of CbAgo, the cleavage efficiency of CbAgo is significantly enhanced.
[0089] 2. This invention breaks with the traditional mindset that mesophilic Ago requires a combination of various amplification reactions to achieve high-sensitivity detection. Previous detection methods based on mesophilic Ago involved combining techniques such as polymerase chain reaction (PCR), loop-mediated isothermal amplification (LCM), and recombinase polymerase amplification to meet sensitivity requirements. This invention enables amplification-free, high-sensitivity detection of the target analyte, avoiding the cumbersome amplification process, saving economic and time costs, improving operational convenience, and greatly expanding the applications of mesophilic Ago.
[0090] 3. This invention is based on gDNA zyme To enhance the mechanism of action of CbAgo, a gDNA-based approach was developed. zyme A CbAgo-mediated amplification-free aptamer sensor was designed. Firstly, based on the key point that pathogenic bacteria can recognize and bind to their corresponding aptamer DNA, a sensor containing a cleavage enzyme recognition site and gDNA was further designed. zyme The hairpin-shaped probe fragment serves as a structural transition element; finally, gDNA is released through cleavage by endonucleases. zyme It works in conjunction with CbAgo as a signal probe. This design fully utilizes gDNA. zyme This method enhances the mechanism of action of CbAgo and enables detection in a homogeneous environment, avoiding cumbersome procedures such as solid-phase separation. In the quantitative detection of Staphylococcus aureus alone, the detection limit reached 35 CFU / mL, significantly higher than that achieved using gDNA directly. zyme Group (detection limit 587 CFU / mL) and linear gDNA-guided CbAgo group (detection limit 1.06 × 10⁻⁶). 5 (CFU / mL). Furthermore, the method described in this invention can simultaneously detect multiple pathogenic bacteria with a sensitivity reaching 46 CFU / mL. This broadens the application of CbAgo in the detection field and provides technical support for multiplex detection of target analytes. Attached Figure Description
[0091] Figure 1 is a flowchart of the entire process of this invention, where A represents the investigation of the effect of nonlinear gDNA on CbAgo cleavage activity; B represents gDNA zyme Mechanism for enhancing CbAgo cleavage activity; C represents gDNA zyme Enhance the application of CbAgo's multiple detection.
[0092] Figure 2 illustrates the effect of linear gDNA mutation on CbAgo cleavage activity in Example 1. In the figure, A represents the process of linear gDNA and CbAgo pre-assembling and cleaving tDNA; B represents the sequence of the mutated gDNA; and C represents a comparison of the signal values of gDNA+tDNA and CbAgo+gDNA+tDNA.
[0093] Figure 3 illustrates the effect of nonlinear gDNA on CbAgo cleavage activity in Example 1. In Figure 3, A represents the schematic diagram of nonlinear gDNA and CbAgo pre-assembled cleavage of tDNA; B represents the sequence of nonlinear gDNA; and C represents CbAgo + nonlinear gDNA. C-M +tDNA signal value.
[0094] Figure 4 illustrates the exploration of nonlinear gDNA in Example 1. zyme The effect on CbAgo, where A represents CbAgo+ nonlinear gDNA. C-M14 +tDNA, gDNA zyme +tDNA and gDNA zyme +tDNA+CbAgo diagram; B represents the comparison of the signal values of the three components in A.
[0095] Figure 5 shows the gDNA in Example 2. zyme The mechanism by which DNAzymes at different positions in DNA enhance CbAgo cleavage efficiency, where A represents gDNA. zyme A schematic diagram of the movement of rA (DNAzyme cleavage site) in DNAzyme fragments and tDNA; B represents gDNA of DNAzymes at different locations. zyme The sequences of rA at different positions in tDNA, and the corresponding gDNA at different positions. zyme +tDNA and CbAgo+gDNA zyme Comparison of +tDNA signal values.
[0096] Figure 6 shows the optimal gDNA in Example 2. zyme Enhancing the efficacy of CbAgo, the figure shows gDNA. 1zyme +tDNA and CbAgo+gDNA 1zyme A comparison of the signal values of +tDNA and linear gDNA+tDNA that mismatches two bases with tDNA.
[0097] Figure 7 illustrates the molecular dynamics simulation investigation of gDNA in Example 3. zyme The mechanism for enhancing CbAgo cleavage activity is shown in the following diagrams: A represents the movement of the PIWI domain of CbAgo; B represents rotating the CbAgo structure shown in A by 90°; C represents a magnified schematic diagram of the residues in B; D represents the comparison of Δ values with and without DNAzyme; E represents the density of catalytic residue distribution with DNAzyme; and F represents the density of catalytic residue distribution without DNAzyme.
[0098] Figure 8 shows the fluorescence experiment investigating gDNA in Example 3. zymeThe cleavage site guiding CbAgo, where A represents the quenching group modified at different positions on tDNA; B represents the signal ratio with and without CbAgo; and C represents linear and nonlinear gDNA. 1zyme Comparison of CbAgo cleavage sites.
[0099] Figure 9 illustrates whether the remaining DNAzymes in Example 4 enhance the cleavage activity of CbAgo. In this figure, A represents a schematic diagram of DNAzyme+tDNA and DNAzyme+tDNA+CbAgo; B represents a comparison of the signal values of DNAzyme+tDNA and DNAzyme+tDNA+CbAgo.
[0100] Figure 10 shows the design principles and feasibility verification diagram for the quantitative detection of Staphylococcus aureus in Example 5. In this diagram, A represents the flowchart of the sensor constructed for detecting Staphylococcus aureus; B represents the polyacrylamide gel electrophoresis diagram verifying the binding of Staphylococcus aureus to the aptamer; C represents the polyacrylamide gel electrophoresis diagram verifying the structural transformation in the sensor; and D represents the comparison of detection signals with and without Staphylococcus aureus.
[0101] Figure 11 shows the optimization of conditions for the sensor for quantitative detection of Staphylococcus aureus in Example 5, where A represents the optimization of aptamer and cDNA concentrations; B represents the optimization of HP and cHP concentrations.
[0102] Figure 12 shows the performance evaluation of the sensor for quantitative detection of Staphylococcus aureus in Example 5. In the figure, A represents the detection signal values for negative and different concentrations of Staphylococcus aureus; B represents the linear relationship between the logarithm of Staphylococcus aureus concentration and the difference in fluorescence intensity; and C represents the specificity analysis of the sensor.
[0103] Figure 13 shows the sensitivity of the sensor for quantitative detection of Staphylococcus aureus using other methods in Example 5, where A represents gDNA-based... zyme The detection performance of the sensor; B represents the detection performance of the sensor with linear gDNA-guided CbAgo.
[0104] Figure 14 shows the performance evaluation of quantitative detection of serially diluted mixed Staphylococcus aureus, Escherichia coli and Salmonella in Example 6. In this figure, A represents the detection performance of the sensor in detecting Staphylococcus aureus in multiple targets; B represents the detection performance of the sensor in detecting Escherichia coli in multiple targets; C represents the detection performance of the sensor in detecting Salmonella in multiple targets; and D represents a schematic diagram of the detection process.
[0105] Figure 15 shows the gDNA in Example 6. zymeThe performance evaluation of the constructed sensor for simultaneously detecting mixed Staphylococcus aureus, Escherichia coli, and Salmonella was conducted. Here, A represents the sensor's detection performance for Staphylococcus aureus among multiple targets; B represents the sensor's detection performance for Escherichia coli among multiple targets; and C represents the sensor's detection performance for Salmonella among multiple targets.
[0106] Figure 16 shows the performance evaluation of the sensor constructed by CbAgo guided by linear gDNA in Example 6 for the simultaneous detection of mixed Staphylococcus aureus, Escherichia coli and Salmonella. In the figure, A represents the detection performance of the sensor in detecting Staphylococcus aureus among multiple targets; B represents the detection performance of the sensor in detecting Escherichia coli among multiple targets; and C represents the detection performance of the sensor in detecting Salmonella among multiple targets.
[0107] Figure 17 shows the sensitivity analysis of the detection of Staphylococcus aureus, Escherichia coli and Salmonella using the real-time quantitative polymerase chain reaction (qPCR) method in Example 6. In this figure, A represents the detection performance of qPCR for Staphylococcus aureus; B represents the detection performance of qPCR for Escherichia coli; and C represents the detection performance of the sensor for Salmonella among multiple targets.
[0108] Figure 18 shows the gDNA in Example 6. zyme Evaluation of cross-interference performance of enhanced CbAgo-mediated sensors, where A represents the specificity analysis of the E. coli system and B represents the specificity analysis of the Salmonella system.
[0109] Figure 19 shows the gDNA in Experiment Example 7. zyme Performance evaluation of enhanced CbAgo-mediated sensors in clinical sample detection, where A represents gDNA. zyme A comparison of enhanced CbAgo sensor and plate counting method for clinical sample detection; B indicates gDNA. zyme Enhance the detection results of clinical samples using CbAgo sensors; C represents the significance analysis of the clinical sample detection results. Detailed Implementation
[0110] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation of the invention in any way.
[0111] In this invention, the term "cDNA" refers to a single-stranded DNA fragment capable of base complementary pairing with an aptamer.
[0112] In this invention, the terms "DNAzyme" or "DNAase" have the same meaning and are used interchangeably, both referring to a catalytic molecule composed of deoxyribonucleic acid (DNA). A DNAzyme forms a catalytic core through its specific nucleotide sequence, binds to the target substrate, and catalyzes the hydrolysis of phosphate ester bonds.
[0113] In this invention, the term "signal probe" refers to a nucleic acid sequence labeled with a fluorescent group and a quencher group for detecting the occurrence of a specific nucleic acid reaction. The signal probe is designed such that, when uncuttered, the fluorescent group interacts with the quencher group, quenching the fluorescent signal. When the signal probe is cleaved, the fluorescent group separates from the quencher group, releasing a detectable fluorescent signal.
[0114] In this invention, the term "Argonaute protein cleavage activity" refers to the ability of Argonaute proteins to cleave target nucleic acids or signal probes.
[0115] Example:
[0116] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0117] The CbAgo used in the following examples is a mesophilic Argonaute protein derived from Clostridium butyrium, which has the amino acid sequence shown in NCBI accession number WP_058142162.1.
[0118] Example 1: Effects of gDNA length and conformation on CbAgo cleavage efficiency
[0119] In this embodiment, the length and conformation of the gDNA are gradually optimized based on traditional linear gDNA.
[0120] 1. Effect of linear mutant gDNA sequence on CbAgo cleavage efficiency
[0121] (1) Designing linear mutant gDNA targeting reporter DNA
[0122] Report DNA: tDNA M :FAM-ACTATGCTGGAGTT-BHQ1;
[0123] The mutant gDNA and its sequence are shown in Table 1 below:
[0124] Table 1. Mutant gDNA and its sequence
[0125] (2) Verify the effect of linear mutant gDNA on CbAgo cleavage efficiency.
[0126] First, 100 μg / mL CbAgo and 2 μM gDNA were mixed in 1×BB buffer, and 100 μM Zn(Ac)2 was added. The mixture was incubated at 37°C for 20 min. Then, tDNA was added to a final concentration of 200 nM, followed by 1 μL of ultrapure water, resulting in a final reaction solution volume of 10 μL. The solution was incubated at 37°C for 1 h. Finally, the fluorescence signal was detected using a SpectraMax i3.
[0127] In the presence of gDNA, CbAgo, and tDNA, gDNA is loaded onto CbAgo, which then guides CbAgo to cleave tDNA, thereby generating a fluorescent signal (Figure 2). As the number of bases on gDNA that hybridize with tDNA decreases, the cleavage efficiency of CbAgo gradually decreases.
[0128] 2. The effect of nonlinear gDNA structure on CbAgo cleavage efficiency
[0129] (1) Design of nonlinear gDNA for reporter DNA
[0130] Nonlinear gDNA and its sequences are shown in Table 2 below:
[0131] Table 2 Nonlinear gDNA and its sequence
[0132] (2) Verify the effect of nonlinear gDNA on CbAgo cleavage efficiency
[0133] The reaction system is shown in 1(2) above, and the results are shown in Figure 3. The results show that the structure of nonlinear gDNA has a significant impact on the cleavage efficiency of CbAgo, and the cleavage efficiency of non-complementary sequences (circular protrusions in Figure 3) decreases significantly in the range of 3–9 nt. As the non-complementary sequence continues to increase, the cleavage efficiency of CbAgo increases. When the non-complementary sequence increases to 12–15 nt, the cleavage efficiency of CbAgo increases to the level of gDNA. C-M0 quite.
[0134] 3. gDNA containing a DNA-zyme structure (gDNA) zyme The impact of CbAgo cutting efficiency
[0135] (1) Designing gDNA targeting reporter DNA zyme
[0136] gDNA zyme :5'AATCCGAGCCGGTCGAACCAGCATAGT 3';
[0137] (2) Validation of nonlinear gDNA zyme Impact on CbAgo
[0138] The experimental schematic diagram is shown in Figure 4A.
[0139] Set gDNA separately zyme Group (replacing gDNA with an equal amount of gDNA) zyme DNAzyme group (replacing gDNA with an equal amount of gDNA) zyme ) and gDNA C-M14 Group (using gDNA) C-M14 As gDNA), the reaction system is as shown in 1(2) above, except that CbAgo is not added to the DNAzyme group (replaced by an equal amount of ddH2O).
[0140] The results showed that gDNA zyme Guided CbAgo cleavage is more efficient than gDNA. C-M14 and DNAzyme group (Figure 4B).
[0141] Example 2: gDNA zyme Effect of DNAzymes at different locations on CbAgo cleavage efficiency
[0142] 1. gDNA zyme Effect of DNAzymes at different locations on CbAgo cleavage efficiency
[0143] The experimental schematic diagram is shown in Figure 5A.
[0144] (1) Design corresponding nonlinear gDNAs for reporter DNAs with different catalytic sites zyme Report DNA (tDNA) and the corresponding gDNA zyme The sequences are shown in Table 3 below. In tDNA, "rA" represents adenosine monophosphate, and in gDNA… zyme The underlined part represents the DNAzyme catalytic core.
[0145] Table 3 Report DNA (tDNA) and corresponding gDNA zyme sequences
[0146] (2) Validation of nonlinear gDNA zyme Impact on CbAgo cutting efficiency
[0147] The reaction system is as shown in Example 1, and the results are shown in Figure 5B, gDNA 1zyme The best results can be achieved.
[0148] 2. Validate the optimal gDNA zymeEnhanced CbAgo cutting efficiency
[0149] Design three experimental groups, including gDNA 1zyme And tDNA (i.e., DNAzyme cleavage), tDNA and linear gDNA that has two mismatched bases with tDNA. M2 As well as tDNA, CbAgo, and nonlinear gDNA that mismatches two bases with tDNA. 1zyme Their sequences are as follows:
[0150] gDNA 1zyme :5'-TCCGAGCCGGTCGAAAACCAGCATAGT-3';
[0151] tDNA: 5'-FAM-ACTATGCTGGTTrAG-BHQ1-3';
[0152] gDNA M2 :5'-TAAACCAGCATAGT-3'.
[0153] The reaction system is as shown in Example 1, and the results are shown in Figure 6. The results indicate that gDNA... 1zyme The fluorescence signal of the +CbAgo+tDNA group (F) was higher than that of the gDNA group. 1zyme +tDNA group (F1) and linear gDNA M2 +CbAgo+tDNA group (F2), i.e., F>F1+F2. The above results indicate that gDNA 1zyme Guided CbAgo cleavage is not a simple superposition of the effects of CbAgo and DNAzyme cleavage; gDNA 1zyme Guided CbAgo cleavage exhibits a significant synergistic effect. (Nonlinear gDNA) 1zyme The spatial structure of gDNA makes it easier to form usable binary complexes with CbAgo, or nonlinear gDNA. 1zyme Interaction with CbAgo may increase the number of cleavage sites, thereby improving the cleavage efficiency of CbAgo.
[0154] Example 3: Verification of gDNA zyme Mechanism of enhancing CbAgo cleavage activity
[0155] 1. Molecular dynamics simulation
[0156] The structure of CbAgo (PDB ID: 6QZK) is shown in Figure 7A, and its structure after docking with the substrate is shown in Figures 7B and 7C.
[0157] CbAgo contains four domains: N, PAZ, MID, and PIWI. The PIWI domain contains four catalytic residues (D541, E577, D611, and D727) (Figures 7B and C, red amino acid sites), which possess catalytic endonuclease activity and are crucial for the cleavage activity of CbAgo, relative to gDNA. zyme The movement of the PIWI domain affects the cleavage efficiency of CbAgo. Therefore, in this embodiment, molecular dynamics (MD) simulations were performed on CbAgo guided by DNAzyme and without DNAzyme in gDNA, and the ΔX value (i.e., ΔX = X) along the DNA* double-strand principal axis between the PIWI domain and the centroid coordinates of the DNA* double strand was calculated during the simulation. DNA* -X PIWI ).
[0158] The results, as shown in Figure 7D, indicate that the ΔX value distribution exhibits two peaks in the presence of DNAzyme, suggesting a wider range, while only one narrow peak is observed in the absence of DNAzyme. This suggests that when DNAzyme is present, the PIWI domain extends along the gDNA. zyme There is a clear translational motion in the X direction. The dashed arrow in Figure 7A and the solid arrow in Figure 7D represent the direction of motion, respectively.
[0159] In the presence of DNAzyme, the PIWI domain extends along gDNA. zyme Large-scale global motions can cause rearrangements in the local interactions between catalytic residues in CbAgo and potential cleavage sites in tDNA. To characterize the distribution of CbAgo catalytic residues around the original cleavage sites in tDNA and their neighboring sequences, the atomic number density of CbAgo catalytic residues and phosphate groups from tDNA projected onto the YZ plane was calculated.
[0160] The results are shown in Figure 7E (with DNAzyme) and Figure 7F (without DNAzyme). With DNAzyme, the distribution area of the catalytic residue density is larger than without DNAzyme, indicating that these residues move along the DNA double helix under the influence of DNAzyme. Specifically, in the presence of DNAzyme, there are four nucleotide bases (DA, DT, DG, and DC in the 5'-to-3' direction) near the CbAgo catalytic residue atomic number density distribution region, while there are only three (DT, DG, and DC in the 5'-to-3' direction) without DNAzyme. Therefore, the presence of DNAzyme increases the number of nucleotides near the CbAgo catalytic residues, which helps increase the potential cleavage sites of CbAgo, thereby improving cleavage efficiency.
[0161] The above docking uses gDNA / tDNA double strands as CbAgo docking substrates. Common regions of gDNA / tDNA double strands with and without 8-17 DNAzymes are underlined and labeled as DNA*.
[0162] gDNA / tDNA double strands without 8-17 DNAzyme:
[0163] g-DNA:5'-OH-GCTAACCAGCATAGTA-3';
[0164] t-DNA:3'-GrATTGGTCGTATCA-5'.
[0165] double-stranded gDNA / tDNA containing 8-17 DNAzymes:
[0166] g-DNA:5'-OH-TCCGAGCCGGTCGAAAACCAGCATAGTA-3';
[0167] t-DNA:3'-GrATTGGTCGTATCA-5'.
[0168] 2. Fluorescence experiment
[0169] MD simulation results show that gDNA zyme The presence of DNAzyme leads to the movement of the PIWI domain and an increase in the number of potential CbAgo cleavage sites. CbAgo cleavage sites are located between 10-11 nt in tDNA (Reference 1: Programmable DNA cleavage by Ago nucleases from mesophilic bacteria Clostridium butyricum and Limnothrix rosea; Reference 2: Argonaute integrated single-tube PCR system enables supersensitive detection of rare mutations; Reference 3: Programmable cleavage of linear double-stranded DNA by combined action of Argonaute CbAgo from Clostridium butyricum and nuclease deficient RecBC helicase from E. coli). To further clarify gDNA... 1zyme(The sequence is the same as in Table 3 of Example 2 above) To guide the cleavage site of CbAgo, a series of tDNA sequences were designed, and fluorescent quencher (BHQ1) was labeled on the 4th, 5th, 6th, 7th, 8th, 9th and 10th bases at the 3' end of the tDNA (Figure 8A).
[0170] The sequence is as follows (5'-3'):
[0171] tDNA(S4): FAM-ACTATGCTGGT-BHQ1-TrAG;
[0172] tDNA(S5): FAM-ACTATGCTGT-BHQ1-TTrAG;
[0173] tDNA(S6): FAM-ACTATGCTT-BHQ1-GTTrAG;
[0174] tDNA(S7): FAM-ACTATGC-BHQ1-TGGTTrAG;
[0175] tDNA(S8): FAM-ACTATG-BHQ1-TTGGTTrAG;
[0176] tDNA(S9): FAM-ACTAT-BHQ1-TCTGGTTrAG;
[0177] tDNA(S10): FAM-ACTA-BHQ1-TGCTGGTTrAG.
[0178] Different BHQ1 marker sites will produce different intensities of fluorescence signals in the presence or absence of CbAgo. Since the DNAzyme cleavage site is located between the 2' and 3' sites near the 3' end of tDNA, it can be inferred that the fluorescence signal between the 4' and 14' sites is generated by CbAgo cleavage.
[0179] The experimental results are shown in Figure 8B. When BHQ1 was labeled at bases 4, 5, 6, and 7, a strong fluorescence signal was generated in the presence of CbAgo, recorded as F. on In the absence of CbAgo, there was almost no fluorescence signal, recorded as F. off The ratio of the two signals is R = F on / F off >1. When BHQ1 is labeled on the 8th, 9th, and 10th bases, almost no fluorescent signal is observed regardless of the presence of CbAgo, and the ratio of the two signals is R = F. on / F off<1. Further analysis of the significance of the R values of the signal generated by adjacent bases of the BHQ1 marker showed that the R value between the 7th and 8th bases was the most significant. Therefore, it can be inferred from the R values that when gDNA... 1zyme When CbAgo is guided to cleave tDNA, the CbAgo cleavage site changes from the original site between 10 and 11 nt to multiple potential cleavage sites, and moves 3 to 7 nucleotides toward the 5' end of the gDNA (between the 4' and 8' positions of the tDNA), mainly between the 7' and 8' positions of the tDNA (Figure 8C).
[0180] Example 4: Verifying the universality of DNAzyme in enhancing CbAgo cleavage activity
[0181] To evaluate gDNA zyme In addition to the 8-17 DNAzymes mentioned above, this example also investigated several metal-specific DNAzymes, including Mg, to demonstrate the universality of CbAgo-mediated enhanced activity. 2+ Zn 2+ Pb 2+ Cu 2+ Hg 2+ Co 2+ UO2 2+ In addition, other metal-specific DNAzymes, such as GR-5, 10-23, IR-3, and NaA43 DNAzymes (Figure 9A). The experimental methods are the same as in Example 1, except that 500 nM Pb(Ac)2 was added to the GR-5 system, 100 μM Zn(Ac)2 was added to the 10-23 system, 2 mM Zn(Ac)2 was added to the IR-3 system, and 100 mM NaCl was added to the NaA43 system.
[0182] Experimental results show that, based on GR-5 (gDNA) GR-5 ), 10-23 (gDNA) 10-23 ), IR-3 (gDNA) IR-3 ) and NaA43 (gDNA) NaA43 gDNA zyme All significantly enhanced the cleavage activity of CbAgo (Figure 9B). The results confirm that the gDNA design principles, theories, and potential mechanisms outlined in the above sections of this study have been preliminarily validated and extended.
[0183] Related sequences (5'-3'):
[0184] gDNA GR-5 :ACAGACATCATCTCTGAAGTAGCGCCGCCGTATAGTGAG;
[0185] tDNAGR-5 : CY3-CTCACTATrAGGAAGAGATGATGTCTGT-BHQ2.
[0186] gDNA 10-23 :TAAGTCAGGCTAGCTACAACGACCTCT;
[0187] tDNA 10-23 : CY5-TCGAGAGGrAUGACTTAAAGTCTAAC-BHQ2.
[0188] gDNA IR-3 :CAGGTATCTAGTTGAGCTGTCTA;
[0189] tDNA IR-3 :ROX-TAGACGTTGAAGGATACCTG-BHQ2.
[0190] gDNA NaA43 : CGGCGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCGGTTAGATAGA;
[0191] tDNA NaA43 :ROX-CTCTATCTATrAGGAAGTACCGCCGC-BHQ2.
[0192] Example 5: gDNA zyme Enhanced CbAgo-mediated sensors for quantitative detection of Staphylococcus aureus
[0193] 1. Sensor design feasibility and optimization
[0194] a. Sensor Design
[0195] To evaluate the designed gDNA zyme To enhance the practical application of CbAgo, Staphylococcus aureus was selected as the target bacterium, and a method based on gDNA was developed. zyme The experimental procedure for enhancing the CbAgo-mediated aptamer sensor is shown in Figure 10A. This sensor utilizes gDNA... zyme This enhances the cleavage activity of CbAgo, thereby providing amplification-free and ultrasensitive detection, overcoming the shortcomings of the low cleavage activity of traditional CbAgo.
[0196] The specific experimental method is as follows:
[0197] (1) At room temperature, the aptamer (Apt), cDNA, and two input strands S1 and S2 were first mixed and hybridized in 1×BB buffer at a ratio of 1:1:1:1. Then, negative nucleotides (replaced with an equal amount of ddH2O) and different concentrations (10, 10) were used for hybridization. 2 10 3 10 4 10 5 10 6 10 7 10 8 Staphylococcus aureus (CFU / mL) was incubated at 37°C for 45 min, with Apt, cDNA, S1, and S2 at a final concentration of 200 nM, and the volume of the reaction mixture was 5 μL.
[0198] (2) Add hairpin probe HP (designed to a final concentration of 200 nM based on the target analyte), its complementary cHP, signal probe, 0.1 U / μL Nt.BstNBI cleavage enzyme, NEBuffer, and 100 μM zinc acetate to the reaction mixture obtained in step (1). Incubate at 55 °C for 45 min. The total volume is 10 μL.
[0199] (3) Finally, add 100 μg / mL CbAgo and react at 37℃ for 30 min;
[0200] (4) Add the reaction solution to the enzyme label well and use a multi-functional microplate reader to detect the fluorescence signal.
[0201] The materials used above and their sequences are as follows:
[0202] Apt: 5'GCAATGGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA 3';
[0203] cDNA: 5'GGGATGACCAGCGAGCGCTA 3';
[0204] Strand 1(S1): 5'GCGCTCGCCGTCTGGTGATCCCCATTCT 3';
[0205] Strand 2(S2): 5'CCGGCTCGGAAGTGGACTCTCCCAGCCGGCAGACGTGGTCATC 3';
[0206] HP: 5'AGAATGGGGATCACCGGCTGGGAGAGTCCACTTCCGAGCCGGTCGAAAACCAGCATAGT3';
[0207] cHP: 5'ACTATGCT 3';
[0208] tDNA: 5'FAM-ACTATGCTGGTTrAG-BHQ1 3'.
[0209] In the presence of *S. aureus*, the aptamer preferentially binds to *S. aureus*, and the free cDNA forms a triple-stranded hybridization complex with the tail of the input splitting strand, opening the stem and loop of the hairpin probe HP and achieving a complete hybridization conformation. The formed double strand is recognized by *Nt. BstNBI* at a specific cleavage site, resulting in cleavage and the release of gDNA containing DNAzyme fragments. zyme Sequence. When CbAgo is added, it forms a binary complex with the luciferin (5'-FAM, 3'-BHQ1), which cleaves the tDNA labeled with luciferin (5'-FAM, 3'-BHQ1) to produce a fluorescent signal.
[0210] The binding of different nucleotide chains during the above reaction was verified by gel electrophoresis, and the results are shown in Figures 10B and 10C. After binding with Apt, *S. aureus* releases cDNA (lane 6 in Figure 10B). The cDNA forms a complex with S1 and S2 (lane 4 in Figure 10C). The complex opens the HP and cHP double-stranded structure (lane 3 in Figure 10C), exposing the Nt.BstNBI cleavage site locked in the HP hairpin structure, thus allowing it to be recognized by Nt.BstNBI. Fluorescence signal detection results showed that the presence of the target compound resulted in a stronger characteristic fluorescence absorption peak at 520 nm compared to the absence of the target compound (Figure 10D). The successful construction of the adaptive sensor was preliminarily verified by gel electrophoresis and fluorescence spectroscopy measurements.
[0211] b. Sensor optimization
[0212] The experimental conditions for the constructed aptamer sensor were further optimized, as follows:
[0213] (1) Optimization of aptamer-cDNA complex concentration. The specific experimental method is as above, except that the aptamer and cDNA concentrations are set to final concentrations of 0.05 μM, 0.1 μM, 0.2 μM, 0.5 μM, and 1 μM, respectively.
[0214] (2) Optimization of HP-cHP complex concentration. The specific experimental method is as above, except that the HP and cHP concentrations are set to final concentrations of 0.05 μM, 0.1 μM, 0.2 μM, 0.5 μM, and 1 μM, respectively.
[0215] The results are shown in Figures 11A and 11B, respectively. The optimal aptamer-cDNA complex concentration was 0.2 μM, and the optimal HP-cHP complex concentration was 0.2 μM. Subsequent detections were performed under the optimal conditions.
[0216] 2. Performance Evaluation
[0217] a. Sensitivity determination
[0218] Based on the above optimal conditions, gDNA detection zyme Enhance the sensitivity of CbAgo-mediated sensors, while using gDNA-based... zyme The sensitivity sensor and the sensor for linear gDNA (i.e., cDNA) guided CbAgo were used as controls, as detailed below:
[0219] Experimental methods:
[0220] I. Based on gDNA zyme Sensor sensitivity measurement
[0221] (1) At room temperature, Apt, cDNA, S1, and S2 were hybridized in 1×BB buffer at a ratio of 1:1:1:1, and were compared with negative (replaced with an equal amount of ddH2O) and different concentrations (10, 10). 2 10 3 10 4 xx, 10 5 10 6 10 7 10 8 S. aureus (CFU / mL) was subjected to treatment at 37°C for 45 minutes, with the final concentrations of Apt, cDNA, S1, and S2 being 200 nM, and the volume of the treatment being 5 μL.
[0222] (2) Add HP, cHP, tDNA, 0.1 U / μL Nt.BstNBI and 100 μM Zn to the reaction mixture obtained in step (1) to a final concentration of 200 nM. 2+ The reaction was carried out at 55°C for 45 minutes, and the system volume was 10 μL.
[0223] (3) Add the reaction solution into the enzyme label well and use SpectraMax i3 to monitor the generated fluorescence signal.
[0224] II. Sensitivity Determination of CbAgo Sensor Based on Linear gDNA (i.e., cDNA) Guidance
[0225] (1) At room temperature, Apt and cDNA were subjected to different concentrations of S. aureus at 37°C for 45 minutes, with the final concentration of Apt and cDNA being 200 nM.
[0226] (2) Add 100 μg / mL CbAgo to the above reaction system and react at 37 °C for 30 min;
[0227] (3) After adding tDNA to a final concentration of 200 nM, the reaction solution was added into the enzyme label wells, and the generated fluorescence signal was monitored using SpectraMax i3.
[0228] gDNA zyme The enhanced sensitivity detection results of the CbAgo-mediated sensor are shown in Figures 12A and 12B. With increasing S. aureus concentration, the fluorescence at 520 nm gradually increases, with a linear range of 10⁻¹⁰. 8 The detection limit was 35 CFU / mL (based on a threshold of three standard deviations of a blank sample), and the linear regression equation was y = 332526.83x - 348125.35 (R²). 2 =0.98, where x represents the concentration of *S. aureus*, y = F - F0, where F is the fluorescence value in the presence of *S. aureus* and F0 is the fluorescence value in the absence of *S. aureus*. (Compared to gDNA-based...) zyme Compared to the detection limit of the previous sensor (587 CFU / mL), this sensor's sensitivity is improved by approximately 17 times (Figure 13A); and compared to the detection limit of the linear gDNA-guided CbAgo sensor (1.06 × 10⁻⁶ CFU / mL), the detection limit of this sensor is significantly higher. 5 Compared to CFU / mL, the sensitivity of this sensor is improved by 3000 times (Figure 13B).
[0229] b. Anti-interference performance test
[0230] To evaluate the sensor's anti-interference performance, Escherichia coli, Listeria monocytogenes, and Salmonella were introduced as interference targets. The specific experimental method was the same as above, except that Staphylococcus aureus was replaced with ddH2O, Salmonella, Escherichia coli, Listeria monocytogenes, or a mixture of the above strains for detection.
[0231] The results showed that obvious fluorescence signals were only generated in the presence of Staphylococcus aureus (Figure 12C), indicating that the sensing platform has good anti-interference performance.
[0232] Example 6: gDNA zyme Enhanced CbAgo-mediated sensors for simultaneous quantitative detection of multiple targets
[0233] This embodiment uses Staphylococcus aureus, Escherichia coli and Salmonella as examples to perform simultaneous detection of three targets. Those skilled in the art can make conventional replacements according to the needs of the targets, or further increase the detection targets.
[0234] The experimental schematic diagram is shown in Figure 14A.
[0235] 1. gDNA zyme Enhanced CbAgo-mediated sensors for simultaneous quantitative detection of multiple targets
[0236] Experimental Methods: First, the aptamer (Apt), cDNA, and S1 and S2 (each containing 8 bases that hybridize with cDNA) corresponding to each pathogenic bacterium were mixed in a 1:1:1:1 ratio in 1×BB buffer at room temperature. Then, different concentrations of the three pathogenic bacteria were added, with a final reaction volume of 15 μL, ensuring a final concentration of 200 nM for each DNA strand. The reaction was carried out at 37°C for 45 minutes. Next, three types of HP, cHP, tDNA modified with three different fluorophores, 0.1 U / μL Nt.BstNBI, and 100 μM Zn were added to a final concentration of 200 nM. 2+ Finally, the reaction was carried out at 55°C for 45 minutes in an environment with 1×NEBuffer and a total volume of 30 μL. Then, CbAgo was added to ensure a final concentration of 100 μg / mL, and the reaction was carried out at 37°C for 30 minutes. The resulting fluorescence signal was then recorded using SpectraMax i3.
[0237] The sequence information used for different targets is as follows:
[0238] For the detection of Staphylococcus aureus:
[0239] Apt(S.aureus): 5'GCAATGGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA 3';
[0240] cDNA (S. aureus): 5'GGGATGACCAGCGAGCGCTA 3';
[0241] Strand1(S.aureus): 5'GCGCTCGCCGTCTGGTGATCCCCATTCT 3';
[0242] Strand2(S.aureus): 5'CCGGCTCGGAAGTGGACTCTCCCAGCCGGCAGACGTGGTCATC 3';
[0243] HP(S.aureus): 5'AGAATGGGGATCACCGGCTGGGAGAGTCCACTTCCGAGCCGGTCGAAAACCAGCATAGT 3';
[0244] cHP(S.aureus): 5’ACTATGCT 3’;
[0245] tDNA(S.aureus): 5’FAM-ACTATGCTGGTTrAG-BHQ1 3’.
[0246] For Escherichia coli detection:
[0247] Apt(E.coli): 5’CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG 3’;
[0248] cDNA(E.coli): 5’GCTCTGTAGATGGCAAGGCA 3’;
[0249] Strand1(E.coli): 5’CCTTGCCACAATGTGACTGTTGCATGA 3’;
[0250] Strand2(E.coli): 5’CCGGCTCGGAAGTGGACTCTCCGAGCCGGACATTGTCTACAGA 3’;
[0251] HP(E.coli): 5’TCATGCAACAGTCCCGGCTCGGAGAGTCCACTTCCGAGCCGGTCGAACCTTCAACGTCT 3’;
[0252] cHP(E.coli): 5’AGACGTTG 3’;
[0253] tDNA(E.coli): 5’ROX-AGACGTTGAAGGrAG-BHQ2 3’.
[0254] For Salmonella detection:
[0255] Apt(Salmonella): 5’TTTGGTCCTTGTCTTATGTCCAGAATGCGAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAAATTTCTCCTACTGGGATAGGTGGATTAT 3’;
[0256] cDNA(Salmonella): 5’CACACATCTCCTCTGCTATA 3’;
[0257] Strand1(Salmonella): 5'TAGCAGAGAGGACAGAGCTAAGCATCT 3';
[0258] Strand2(Salmonella): 5'CCGGCTCGGAAGTGGACTCAAGCTACCGGTGTCCTGAGATGTG 3';
[0259] HP (Salmonella): 5'AGATGCTTAGCTCCCGGTAGCTTGAGTCCACTTCCGAGCCGGTCGAACCTCTCGAGTAG 3';
[0260] cHP(Salmonella): 5'CTACTCGA 3';
[0261] tDNA (Salmonella): 5'CY5-CTACTCGAGAGGrAG-BHQ2 3'.
[0262] 2. Using only gDNA zyme A sensor capable of simultaneously detecting multiple targets, a linear gDNA-guided CbAgo sensor, and real-time quantitative polymerase chain reaction (qPCR) were constructed as controls. The specific experimental methods are as follows:
[0263] a. Using only gDNA zyme A sensor designed to detect multiple targets simultaneously:
[0264] (1) At room temperature, the three Apt, cDNA, S1 and S2 corresponding to S. aureus, Escherichia coli and Salmonella were hybridized in 1×BBuffer in a ratio of 1:1:1:1 and hybridized with different concentrations of S. aureus, Escherichia coli and Salmonella at 37°C for 45 minutes. The final concentration of Apt, cDNA, S1 and S2 was 200 nM and the system volume was 5 μL.
[0265] (2) Add HP, cHP, tDNA, 0.1 U / μL Nt.BstNBI and 100 μM Zn to the reaction mixture obtained in step (1) to a final concentration of 200 nM. 2+ The reaction was carried out at 55°C for 45 minutes, and the system volume was 10 μL.
[0266] (3) Add the reaction solution to the enzyme-labeled wells and monitor the generated fluorescence signal using SpectraMax i3. The sequences used for different targets are shown above.
[0267] b. Linear gDNA (i.e. cDNA) guided CbAgo sensor:
[0268] (1) At room temperature, the three Apt and cDNA corresponding to S. aureus, Escherichia coli and Salmonella were subjected to different concentrations of S. aureus, Escherichia coli and Salmonella at 37°C for 45 minutes, with the final concentration of Apt and cDNA being 200 nM.
[0269] (2) Add 100 μg / mL CbAgo to the above reaction system and react at 37 °C for 30 min;
[0270] (3) Subsequently, after adding tDNA to a final concentration of 200 nM, the reaction solution was added to the enzyme-labeled wells, and the resulting fluorescence signal was monitored using a SpectraMax i3. The Apt and cDNA sequences used for different targets are as shown in Example 6, and the tDNA sequences are as follows:
[0271] tDNA (S. aureus): 5'FAM-TCGCTGGTCATCCC-BHQ1 3';
[0272] tDNA (E.coli): 5'ROX-GCCATCTACAGAGC-BHQ2 3';
[0273] tDNA (Salmonella): 5'CY5-AGAGGAGATGTGTG-BHQ2 3'.
[0274] c.qPCR
[0275] (1) 5 μL Mix solution, 1 μL, 15 μM upstream primer, 1 μL, 15 μM downstream primer, 1 μL, 15 μM signal probe, DNA of different concentrations of extracted bacteria, ddH2O, mixed together, the primers are shown in Table 4 below;
[0276] (2) 95℃ for 5 minutes, 95℃ for 10 seconds, 55℃ for 20 seconds, 72℃ for 20 seconds, for 40 cycles, and monitor using a real-time fluorescence quantitative instrument.
[0277] Table 4 Primers used for qPCR
[0278] Experimental results:
[0279] Using gDNA zyme The enhanced CbAgo-mediated sensor results are shown in Figure 14 (14A-C represent the detection ranges of *S. aureus*, *E. coli*, and *Salmonella*, respectively), using only gDNA. zymeThe sensor capable of simultaneously detecting multiple targets is shown in Figure 15 (Figures 15A-C represent the detection ranges of *S. aureus*, *E. coli*, and *Salmonella*, respectively). The linear gDNA-guided CbAgo sensor is shown in Figure 16 (Figures 16A-C represent the detection ranges of *S. aureus*, *E. coli*, and *Salmonella*, respectively). The qPCR detection results are shown in Figure 17 (Figures 17A-C represent the real-time fluorescence kinetics and detection ranges of *S. aureus*, *E. coli*, and *Salmonella*, respectively). gDNA was used... zyme Enhanced CbAgo-mediated sensor detection results showed that, under different excitation wavelengths, the linear range for the three pathogenic bacteria S. aureus, E. coli, and Salmonella was 10 to 10. 6 CFU / mL. Furthermore, based on the 3σ principle, the detection limits for the three pathogenic bacteria S. aureus, E. coli, and Salmonella were calculated to be 46 CFU / mL, 76 CFU / mL, and 75 CFU / mL, respectively (Figure 14A-C). gDNA zyme The linear range of the sensors that detect multiple targets simultaneously is 10. 3 -10 6 Based on the 3σ principle, the detection limits for the three pathogenic bacteria *S. aureus*, *E. coli*, and *Salmonella* were calculated to be 665 CFU / mL, 2050 CFU / mL, and 665 CFU / mL, respectively. The sensor (gDNA) constructed in this embodiment... zyme Enhanced CbAgo-mediated sensors with gDNA zyme Compared to sensors that simultaneously detect multiple targets, the sensitivity (LOD) for *S. aureus*, *E. coli*, and *Salmonella* was improved by 15-fold, 27-fold, and 9-fold, respectively, indicating that the presence of CbAgo enhances gDNA detection. zyme Activating the sensitivity of the CbAgo-mediated aptamer sensor. The linear detection range of the linear gDNA-guided CbAgo sensor when simultaneously detecting multiple targets is 5 × 10⁻⁶. 6 -10 7 CFU / mL, 10 6 -10 7 CFU / mL, 2.5 × 10 5 -5×10 6 Based on the CFU / mL and the 3σ rule, the detection limits for the three pathogenic bacteria S. aureus, E. coli, and Salmonella were calculated to be 4.19 × 10⁻⁶ CFU / mL. 5 CFU / mL, 5.03×10 4CFU / mL and 1.94×10 5 The sensor constructed in this embodiment, with a CFU / mL concentration, showed a 9100-fold, 600-fold, and 2500-fold increase in LOD for S. aureus, E. coli, and Salmonella, respectively, compared to the linear gDNA-guided CbAgo sensor. The method provided in this embodiment also demonstrated higher sensitivity compared to real-time quantitative polymerase chain reaction (qPCR) (Figure 17).
[0280] To evaluate the anti-interference performance of the sensor in multiplex detection, cross-interference experiments were conducted using Staphylococcus aureus, Escherichia coli, Listeria monocytogenes, and Salmonella. The specific method is the same as in Example 5, except that when evaluating the anti-interference performance of Escherichia coli, the detection system of Escherichia coli was used and the other bacteria were used as interfering agents. When evaluating the anti-interference performance of Salmonella, a detection system of Salmonella was used and the other bacteria were used as interfering agents. The results showed that the cross-interference of each sensing channel was minimal, indicating that the sensor has good anti-interference performance (Figure 18).
[0281] Example 7: gDNA zyme Enhancing the application of CbAgo-mediated sensors in clinical testing
[0282] The experimental procedure is shown in Figure 19A.
[0283] To verify gDNA zyme To enhance the effectiveness of the CbAgo-mediated sensor in practical applications, clinical samples from 52 patients and 10 healthy individuals (Central Theater Command General Hospital of the PLA, Wuhan, China) were tested using the plate count method and the method described in Example 6. The sample sources are shown in Table 5, and the specific methods are the same as in Example 6, except that the target analyte was clinical samples. The hospital employed clinical methods (which involved screening and isolating pathogens using selective culture media, followed by identification based on morphological characteristics and physiological and biochemical properties, as well as identification using qPCR).
[0284] The test results showed that 30 samples were positive for Escherichia coli, 20 samples were positive for Staphylococcus aureus, 2 samples were positive for Salmonella, and the remaining samples were negative (Figures 19B-C). gDNA zyme The detection results of enhanced CbAgo-mediated aptamer sensors were very close to those of the plate counting method (Table 6). Compared with clinical methods, gDNA... zymeThe enhanced CbAgo-mediated sensor achieved accuracy rates of 90%, 93%, and 100% in detecting Staphylococcus aureus, Escherichia coli, and Salmonella, respectively, demonstrating extremely high accuracy in analyzing real samples. Compared to plate counting, which requires 40-48 hours and multiple isolation and culturing steps to obtain accurate results, this sensor eliminates the need for DNA extraction and amplification, achieving accurate multiplex detection within 2 hours, thus possessing significant practical application potential.
[0285] Table 5 Sample Sources
[0286] Table 6. Detection results using different detection methods
[0287] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A guide DNA that enhances the cleavage activity of Argonaute protein, characterized in that, The guide DNA includes: (a) DNA enzyme; (b) Single-stranded DNA capable of binding to Argonaute proteins; The DNase is attached to the 5' end of the single-stranded DNA.
2. The guide DNA according to claim 1, characterized in that, The DNA enzyme is 8-17 DNAzyme.
3. The guide DNA according to claim 2, characterized in that, The 8-17 DNAzyme has the following nucleotide sequence: 5'TCCGAGCCGGTCGAA 3'.
4. The guide DNA according to claim 1, characterized in that, The 3' end of the DNA enzyme is connected to the 5' end of the single-stranded DNA via a phosphodiester bond.
5. The guide DNA according to claim 1, characterized in that, The Argonaute protein is a mesophilic Argonaute protein.
6. A method for detecting target nucleic acids, characterized in that, The method includes: (a) Providing the guide DNA according to any one of claims 1 to 5; (b) Provide Argonaute protein; (c) Providing a target nucleic acid; the target nucleic acid is modified with a fluorescent group and a quenching group; the target nucleic acid is at least partially reverse complementary to the guide DNA; Mix (a), (b) and (c) to guide the Argonaute protein to target and cleave the target nucleic acid. The content of cleaved target nucleic acid in the sample is determined by measuring the fluorescence signal released by the fluorescent group. The method described does not involve the diagnosis and / or treatment of disease.
7. A method for determining a target substance in a sample, characterized in that, The method includes: (1) A system is provided, the system having: Nucleic acid aptamers cDNA, First single-stranded DNA and second single-stranded DNA; wherein: The nucleic acid aptamer contains a third complementary fragment that is complementary to cDNA; The first ssDNA contains a first complementary fragment that is complementary to the cDNA. The second ssDNA contains a second complementary fragment that is complementary to the cDNA; The first ssDNA and the second ssDNA are at least partially reverse complementary. (2) The sample is brought into contact with the system. When the target substance is present in the sample, the nucleic acid aptamer specifically binds to the target substance and releases cDNA. The cDNA binds complementary to the first ssDNA and the second ssDNA to form a complex. (3) Mix the hairpin probe HP, hairpin probe cHP, endonuclease, and signal probe with the complex, wherein: The hairpin probe HP comprises a fragment complementary to the first ssDNA, a fragment complementary to the second ssDNA, an endonuclease recognition site, and the guide DNA as described in any one of claims 1 to 3; The hairpin probe HP comprises a circular region and a stem region. The circular region contains the endonuclease recognition site, and the stem region contains a nucleotide fragment complementary to the hairpin probe cHP. The hairpin probe HP contacts and hybridizes with the complex to form a double-stranded region, exposing a nuclease recognition site. The nuclease cleaves the hairpin probe HP at the nuclease recognition site, causing the hairpin probe HP to release the guide DNA. (4) Mix Argonaute protein, Zn 2+ And the guide DNA described in step (3), which guides the Argonaute protein to target and cleave the signal probe, wherein: The signal probe is connected to a fluorescent group and a quenching group; The guide DNA is at least partially reverse complementary to the signal probe; The method described does not involve the diagnosis and / or treatment of disease.
8. The method according to claim 7, characterized in that, The hairpin probe HP comprises, from the 5' end to the 3' end, a fragment complementary to the first ssDNA, a fragment complementary to the second ssDNA, and the guide DNA according to any one of claims 1 to 5; the endonuclease recognition site is located on the fragment complementary to the second ssDNA, and the endonuclease recognition site is adjacent to the guide DNA according to any one of claims 1 to 5 without any spacer sequence.
9. The method according to claim 7, characterized in that, The hairpin probe cHP is a single-stranded DNA fragment that is partially complementary to the stem region of the hairpin probe HP.
10. The method according to claim 7, characterized in that, The guide DNA is located in the stem region of the hairpin probe HP, and the hairpin probe cHP hybridizes with the 3' end of the guide DNA through base complementarity.
11. The method according to claim 7, characterized in that, The 3' terminal nucleotide of the signal probe is 5'rAG 3'.
12. The method according to claim 7, characterized in that, The nucleic acid aptamer, cDNA, first single-stranded DNA, second single-stranded DNA, hairpin probe HP, hairpin probe cHP, and signal probe are selected from at least one group of the following (a) to (c): (a): Nucleic acid aptamer: 5'GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCAGCTACGTCAAAAGTGCACGCTACTTTGCTAA 3'; cDNA: 5'GGGATGACCAGCGAGCGCTA 3'; First single-stranded DNA: 5'GCGCTCGCCGTCTGTGATCCCCATTCT 3'; Second single-stranded DNA: 5'CCGGCTCGGAAGTGGACTCTCCCAGCCGGCAGACGTGGTCATC 3'; Hairpin probe HP: 5'AGAATGGGGATCACCGGCTGGGAGAGTCCACTTCCGAGCCGGTCGAAAACCAGCATAGT 3'; Hairpin probe cHP: 5'ACTATGCT 3'; Signal probe: 5' fluorescent group -ACTATGCTGGTTrAG - quencher group 3'; (b): Nucleic acid aptamer: 5'CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG 3'; cDNA: 5'GCTCTGTAGATGGCAAGGCA 3'; First single-stranded DNA: 5'CCTTGCCACAATGTGACTGTTGCATGA 3'; Second single-stranded DNA: 5'CCGGCTCGGAAGTGGACTCTCCGAGCCGGACATTGTCTACAGA 3'; Hairpin probe HP: 5'TCATGCAACAGTCCCGGCTCGGAGAGTCCACTTCCGAGCCGGTCGAACCTTCAACGTCT 3'; Hairpin probe cHP: 5'AGACGTTG 3'; Signal probe: 5' fluorescent group -AGACGTTGAAGGrAG - quencher group 3'; (c): Nucleic acid aptamer: 5'TTTGGTCCTTGTCTTATGTCCAGAATGCGAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAAATTTCTCCTACTGGGATAGGTGGATTAT 3'; cDNA: 5'CACACATCTCCTCTGCTATA 3'; First single-stranded DNA: 5'TAGCAGAGAGGACAGAGCTAAGCATCT 3'; Second single-stranded DNA: 5'CCGGCTCGGAAGTGGACTCAAGCTACCGGTGTCCTGAGATGTG 3'; Hairpin probe HP: 5'AGATGCTTAGCTCCCGGTAGCTTGAGTCCACTTCCGAGCCGGTCGAACCTCTCGAGTAG 3'; Hairpin probe cHP: 5'CTACTCGA 3'; Signal probe: 5' fluorescent group -CTACTCGAGAGGrAG - quenching group 3'.
13. A reaction system, characterized in that, The reaction system contains the guide DNA, signal probe, and Argonaute protein as described in any one of claims 1 to 5; the guide DNA and the signal probe are at least partially anticomplementary; the signal probe is attached with a fluorescent group and a quenching group; and the 3' terminal nucleotide of the signal probe is 5'rAG 3'.
14. A reagent kit, characterized in that, The kit contains the guide DNA as described in any of claims 15 or the reaction system as described in claim 13.
Citation Information
Patent Citations
Gene editing application of prokaryotic Argonaute protein
CN112941107A
Characterization and application of novel high-temperature Argonaute protein
CN113106087A
Detection method constructed by combining Argonaute and tetrahedral DNA magnetic nanoparticles
CN117646062A
Method for detecting drug-resistant bacteria through Argonaute-mediated DNAzyme series platform and application
CN117646076A
Guiding DNA for enhancing cleavage activity of Argonaute protein and application of guiding DNA in target detection
CN118638791A