Efficient genome editing in microorganisms by targeting an essential gene

Abstract

The invention relates to a method of altering a genome of a microorganism with a non-replicating construct and a regulatable inhibitor of RNA or protein synthesis that targets an essential gene of the microorganism. The invention further relates to a non-replicating targeting construct comprising a regulatable inhibitor of RNA or protein synthesis that targets an essential gene of the microorganism.

Description

[0001] P136634PC00 Title: Efficient genome editing in microorganisms by targeting an essential gene FIELD The invention relates to the field of molecular biology and genetic engineering of microorganisms and, more specifically, efficient selection of genomic altered microorganisms. 1. INTRODUCTION Gene editing in microorganisms predominantly relies on two distinct methods. The traditional method is called homologous recombination (HR) and allows for precise and controlled editing of specific genes or genomic regions. Briefly, a recombinant DNA template aligns with the target DNA sequence in the organism’s genome through regions of similarity, the cellular machinery recognizes this similarity and facilitates the exchange of genetic material between the recombinant template and genomic DNA. This method, though reliable, is laborious and time-consuming due to the extensive screening needed to identify desired genomic altered microorganisms. By integration of a selection marker, the efficiency of the detection of microorganisms with the desired altered genome is increased, thereby preventing unnecessary screening and sequencing of recombinants. A person skilled in the art working with microorganisms has access to a large number of selectable markers (Solis-Escalente et al., 2013. FEMS Yeast Research 13: 126–139; Reyrat et al., 1998. Infect Immun, 66: 4011-4017). However, the presence of auxotrophic markers and antibiotic resistance markers in recombinant microorganisms is often undesired. A second method that has been developed in the past decade is provided by clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR- associated protein (Cas) systems, which have emerged as a powerful tool for genome editing. The Cas9 nuclease allows for the introduction of double-stranded breaks (DSBs) in genomic DNA at specific locations, which can then be repaired through non-homologous end joining (NHEJ) pathway or homologous directed repair (HDR) recombination. Despite its user-friendly and efficient nature, the CRISPR-Cas system faces notable challenges. Foremost is the potential occurrence of associated off-target effects, which can lead to unintended mutations at locations in the genome other than the targeted site. Such off-target mutations can have serious consequences as they might disrupt the function or regulation of non-targeted genes. Another challenge is that the DSBs generated by the Cas9 nuclease may lead to undesirable chromosomal rearrangements, genomic instability and even cell death. Additionally, both the traditional HDR system and the CRISPR-Cas system require a further plasmid curing step and / or additional elimination steps, to remove accessory genome editing elements, such as selectable markers after the genome editing is complete. To date, there is a need for methods that allow efficient genome editing in microorganisms that do not require laborious screening of microorganisms and have a marker-free and scarless genome editing effect. 2. BRIEF DESCRIPTION OF THE INVENTION The invention relates to a novel genome editing method based on a regulatable inhibitor of RNA or protein synthesis, aimed at the efficient, positive selection of progeny. The method provides an inhibitor which targets an essential gene and will subsequently lead to a growth arrest or cell death if not deleted. In embodiments, the inhibitor may be an inducible inhibitor. The inhibitor is provided on a non-replicating construct, for example a suicide plasmid, an unstable plasmid or a temperature sensitive plasmid, which plasmid can therefore only be retained after integration into the genome through double crossover events, which results in deletion of the inhibitor. Hence, microorganisms with a double-crossover event can be positively selected, as single-crossover mutants will be affected by essential gene silencing and, consequently, will not survive. The invention therefore provides a method of selecting a microorganism comprising an altered genome, comprising providing the microorganism with a non-replicating construct, whereby the construct comprises a first and a second region of homology with a genomic target of the microorganism, which first and a second region of homology are separated by a selection marker and an expression cassette including a regulatable inhibitor of RNA or protein synthesis that targets an essential gene of the microorganism and, optionally, a terminator, preferably an Inducible Clustered Regularly Interspaced Short Palindromic Repeats interference (CRISPRi) inhibitor of Essential gene (ICE), and whereby the first and second regions of homology with the target genome each comprises at least 20 base pairs (bp), selecting a first microorganism in which the construct has been inserted by screening for the presence of the selection marker, and selecting a double-crossover mutant after activation of the inhibitor, thereby selecting a microorganism comprising an altered genome. In embodiments, said selectable marker is an antibiotic resistance marker and / or an auxotrophic marker, preferably a broad- spectrum antibiotic resistance marker. In embodiments, the microorganism is a fungus, a bacterium, or an alga. In embodiments, the genome alteration comprises an insertion, deletion and / or alteration such as a point mutation. In embodiments, the regulatable inhibitor of RNA or protein synthesis is activatable by an inducer, such as cumate. In embodiments, the inhibitor comprises a catalytic dead CRISPR Associated (CAS) protein. In embodiments the CAS protein is a catalytic dead Cas9 (dCAS9). The invention further provides a non-replicating targeting construct for altering the genome of a microorganism, comprising a first and a second region of homology with a genomic target of the microorganism, which first and a second region of homology are separated by a selection marker and an expression cassette including a regulatable inhibitor of RNA or protein synthesis that targets an essential gene of the microorganism, preferably an Inducible Clustered Regularly Interspaced Short Palindromic Repeats interference (CRISPRi) inhibitor of Essential gene (ICE), and, optionally, a terminator. In embodiments the selectable marker is an antibiotic resistance marker and / or an auxotrophic marker, preferably a broad-spectrum antibiotic resistance marker. In embodiments, the microorganism is a fungus, a bacterium or an alga. In embodiments, the genome alteration comprises an insertion, deletion and / or alteration such as a point mutation. In embodiments, the inhibitor is activatable by an inducer, preferably cumate. In embodiments, the inhibitor comprises a catalytic dead CRISPR Associated (CAS) protein. In embodiments, the CAS protein is a catalytic dead Cas9 (dCAS9). The invention further provides a kit comprising the non-replicating targeting construct according to the invention and an inducer of the activatable inhibitor. 3. FIGURE LEGENDS Figure 1: Schematic representation of a construct of the invention. with HR = homology region, SM, selection marker; INH, inhibitor of RNA or protein synthesis; ori, origin of replication; and SEQ, optional sequence for genome alteration. An solid line arrow indicates a constitutive promoter, a dotted line arrow indicates an inducible promoter and a ‘T’ indicates an optional terminator. Figure 2: Schematic illustration of constructing pICE-SCO plasmid via Golden Gate assembly. A protospacer is cloned into the pICE plasmid to target an essential gene. Figure 3: Schematic illustration of constructing pICE-SCO_Del_Act plasmid via Gibson assembly. Introduction of two homologous recombination regions (fragment 1 and fragment 2) to introduce a deletion in the Act gene cluster. Figure 4: (A) Schematic illustration of the ICE system in Streptomyces. (B) In brief, single crossover mutants will appear after conjugation or transformation. When spores were streaked on SFM agar with cumate, the delivery vector will be looped out, allowing growth of the cells without a backbone. CUBIC: cumate-based inducible CRISPRi system targeted on essential gene. Figure 5: Knockout of two biosynthetic gene clusters in S. coelicolor. (A) Schematic diagram of the knockout of the actinorhodin BGC. (B) Double cross-over mutants were selected on R5 plates supplemented with 100 μM cumate. Red colonies indicate successful knockout events. Note the extremely high efficiency. (C) Colony PCR evaluation of the act BGC deletion from ten red colonies with wild type control (WT). (D) Schematic diagram of knockout of the red gene cluster for prodiginines. (E) Double crossover mutants were selected on R5 plates supplemented with 100 μM cumate. White colonies indicate successful knockout events. (F) Colony PCR evaluation of the red GC deletion from ten white colonies with wild type control (WT). Figure 6: Introduction of a stop codon in actII-ORF4 in S. coelicolor via single nucleotide editing. (A) Schematic diagram of single nucleotide editing. A stop codon was introduced into actII-ORF4. (B) Double crossover mutants were selected on R5 plates supplemented with 100 μM cumate. Red colonies indicate successful recombination events. (C) Sanger sequencing results of three different colonies. Figure 7: Genomic knock-in in S. coelicolor. (A) Schematic diagram of gene knock-in. (B) Double cross-over mutants were selected on MM plates supplemented with 100 μM cumate. The dark blue colonies indicate successful knock-in events. (C) Sanger sequencing result of knock-in a synthetic regulatory element (SP30- RBS14) in front of actII-ORF4. (D) Actinorhodin production comparison of S. coelicolor WT and a knock-in mutant. Figure 8: Knock-out of prodigiosin BGC using ICE system in non-model Streptomyces roseifaciens MBT76. (A) The antiSMASH tool (8) predicts a 29 kb prodigiosin (Red) BGC in S. roseifaciens MBT76. (B) Phenotype of wild type (left) and the prodigiosin BGC mutant (right). (C) LC-MS profile of wild type (WT) and the prodigiosin BGC mutant (ΔProdigiosin). Figure 9: Knockout of the 3.8 kb type I iterative PKS gene within the isocoumarin BGC using ICE system in non-model Streptomyces roseifaciens MBT76. (A) The antiSMASH tool (8) predicts Isocoumarin (Icm) BGC (9) in S. roseifaciens MBT76. (B) LC-MS profile of wild type (WT) and the isocoumarin BGC mutant (ΔIcm). 4. DETAILED DESCRIPTION OF THE INVENTION Definitions As used herein, the term “microorganism” refers to a bacterium, a fungus or an alga. In addition, the term also provides reference to a cell of a cell line, such as a mammalian cell line, for example a mouse or human cell line. As used herein, the term “construct” refers to an artificially constructed segment of nucleic acid. A preferred construct is a circular construct, preferably a plasmid. As used herein, the term “non-replicating construct”, refers to an artificially constructed segment of nucleic acid, preferably a plasmid, which is replication incompetent in a microorganism of which the genome is to be altered. In embodiments, said plasmid may be a suicide plasmid that comprises an origin of replication that is not recognized by a microorganism of which the genome is to be altered. In embodiments, said plasmid may comprise an origin of replication that may be recognized by a microorganism, but wherein the plasmid may be lost forinstance due to a lack of partition function (Lydiate et al., 1985. Gene 35: 223-235)or due to a temperature sensitive origin of replication. In embodiments, said plasmid may comprise one or more alterations that affect the early steps of DNA replication in that organism (Donato et al., 2006. PLoS Genetics 2; 2006). As such, only by integration into the genome of the microorganism, the construct will be retained. An example of a non-replicating construct is a suicide plasmid, an unstable plasmid or a temperature sensitive plasmid. As used herein, the term “region of homology” refers to a sequence with 70 – 100 % identity, such as 70 %, such as 75 %, such as 80 %, such as 85 %, such as 90 %, such as 95 %, such as 100 %, to a part of the genome of a microorganism. Such region of homology indicates a percentage of similarity on a nucleotide sequence level and does not refer to an evolutionary relationship. Said % sequence identity refers to the sequence identity over the whole length of the region. As used herein, the term “genomic target” refers to any genomic region of a microorganism that is to be altered, preferably a gene. The term “gene”, as used herein, refers to a region on the genome that encodes for one or more expression products such as proteins. On a genomic level, the term gene includes reference to all nucleic acid elements that enable expression of one or more expression products, including a promoter / enhancer sequence, a coding sequence, an intron sequence if present, and a 5’ and 3’ untranslated sequence. On a transcript level, the term gene includes reference to a nucleic acid element such as a coding sequence and a 5’ and 3’ untranslated sequence. As used herein, the term “selection marker” refers to a sequence, preferably a gene, whereby the expression of a gene allows positive selection of a microorganism. Said selection marker is preferably an antibiotic resistance marker and / or an auxotrophic marker. Said selection marker is preferably linked to a promoter, preferably a constitutive promoter, allowing continuous expression of the selection marker. As used herein, the term “expression cassette” refers to a nucleic acid sequence comprising a coding sequence and an operationally linked regulatory sequence, such as a promoter. In embodiments, an expression cassette may comprise a promoter operably linked to a regulatable inhibitor of RNA or protein synthesis or a selection marker, and optionally, a terminator. As used herein, the term “essential gene” refers to a gene that is indispensable for the survival of a microorganism. Preferred genes are involved in DNA replication, transcription and translation, RNA metabolism, protein export, biosynthesis of cofactors and amino acids, cell wall biosynthesis, energy metabolism, fatty acid and phospholipid metabolism, central intermediary metabolism, transport of small molecules, cell division and membrane biogenesis, central carbon metabolism or in the protection against reactive oxygen species. As used herein, the term ‘RNA interference’, abbreviated as ‘RNAi’ refers to a gene silencing mechanism in which gene expression is reduced or inhibited through sequence-specific mRNA targeting. By pairing of a RNAi molecule with a target mRNA, a double-stranded RNA (dsRNA) is formed, which will eventually be cleaved and results in the silencing of the corresponding mRNA target. Examples of RNAi molecules are a microRNA (miRNA), a small interfering RNA (siRNA) or a short-hairpin RNA (shRNA). As used herein, the term ‘microRNA’, abbreviated as ‘miRNA’, refers to a single-stranded, non-coding RNA molecule of approximately 19-25 nucleotides long. Expression of a miRNA from a RNA-coding gene will first result in a pri-miRNA and after processing, will generate a mature miRNA molecule. Said miRNA may bind to a complementary sequence of a target mRNA, causing mRNA silencing or even degradation and in this way reduces or even inhibit its translation. As used herein, the term ‘small interfering RNA’, abbreviated as ‘siRNA’, refers to a double-stranded, non-coding RNA molecule of approximately 20-24 nucleotides long. Said siRNA may bind to a complementary sequence of a target mRNA, causing mRNA silencing or even degradation and in this way reduces or even inhibits its translation. As used herein, the term ‘short hairpin RNA’, abbreviated as ‘shRNA’, refers to an artificial, non-coding RNA molecule of approximately 50-70 nucleotides long comprising a stem-loop structure of 19-29 nucleotides of double-stranded RNA. Said shRNA may bind to a complementary sequence of a target mRNA, causing mRNA silencing or even degradation and in this way reduces or even inhibits its translation. As used herein, the term ‘Zinc finger nuclease” abbreviated as “ZFN”, refers to polypeptide chains comprising DNA-binding motifs. Said motifs in general comprise at least three modular zinc finger domains that may be coupled to an effector activity such as a nuclease. Each zinc finger domain can be engineered to recognize a specific DNA triplet. A combination of three or more domains may result in the recognition of a genomic region. Expressing of one or more of said zinc finger protein-coupled nuclease constructs in a microorganism will result in deletion of a least a part of said genomic region. Via this way, zinc finger nucleases may be used for the alteration of a genome. As used herein, the term “transcription activator-like effector nuclease”, abbreviated as “TALEN”, refers to restriction enzymes comprising DNA binding domains that induce double-strand breaks in DNA. Typically, a transcription activator-like effector (TALE) is designed to recognize a stretch of 15 to 20 DNA base pairs, balancing specificity with potential off targeting, and may be coupled to a nuclease. TALEN may be used for the alteration of a genome when used in combination with homologous recombination. As used herein, the term “clustered regularly interspaced short palindromic repeats - CRISPR-associated protein system”, commonly abbreviated as “CRISPR- Cas system”, refers to a protein that, mediated by a “single guide RNA”, abbreviated as “sgRNA” or “gRNA”, is able to make a single-strand or double- strand break in DNA or RNA as a site-specific nuclease, and as such can be used in the alteration of a nucleic acid. The target specificity of this system originates from the sgRNA:DNA / RNA complementarity, wherein the sgRNA determines the binding site of a Cas nuclease. Said sgRNA comprises a CRISPR RNA (crRNA), also termed “spacer”, and a trans-activating crRNA (tracrRNA). Some CRISPR-Cas systems may comprise one or more Cas proteins, called “CRISPR-associated complex for antiviral defense” abbreviated as “cascade”, and a Cas nuclease, such as a Type I CRISPR-Cas system or Cascade-Cas3 system. As used herein, the term “catalytic dead Cas protein”, abbreviated as “dCas” refers to a mutant of a Cas protein. Said mutant comprises a point mutation in the catalytic domain of a nuclease, resulting in the inhibition of its nuclease activity. Said mutant Cas protein retains its binding capacity to a nucleic acid. In case of a Type I CRISPR-Cas system, such dCas protein refers to a catalytic dead Cas protein in combination with a catalytic active cascade. As used herein, the term “Inducible Clustered Regularly Interspaced Short Palindromic Repeats interference (CRISPRi) of Essential gene inhibitor”, abbreviated as “ICE”, refers to a protein that, mediated by a sgRNA and a dCAS protein, reduces or inhibits the expression of an essential gene. As used herein, the term ‘knockdown’ refers to a phenotypical alteration in a cell, wherein the expression of a gene is temporarily stopped or decreased, such as by interference with RNA molecules. As used herein, the term ‘knockout’, refers to a genomic alteration in a cell, wherein the expression of a gene is permanently and completely stopped, such as by deletion of the gene in the genome. As used herein, the term “inhibitor of RNA or protein synthesis” refers to an inhibitor that interferes with the protein production of a specific gene, such as an essential gene. A preferred inhibitor of RNA or protein synthesis is a translational or a transcriptional inhibitor. A preferred translational or transcriptional inhibitor is a gene knockdown inhibitor. A gene knockdown inhibitor silences the expression of a gene, by the interference of gene transcription or by interference of mRNA translation. Preferred examples of such gene knockdown inhibitors are a RNA interference tool such as RNAi, and a transcriptional repressor such as CRISPRi. A transcriptional inhibitor can also be a gene knockout inhibitor, which inhibits the expression of an active gene product by an irreversible genetic modification in the corresponding target gene. Examples of such gene knockout inhibitors are a CRISPR-Cas system, a TALEN system or a ZFN system. In methods of the invention, a double crossover event will eliminate expression of the regulatable inhibitor of RNA or protein synthesis, such as a translational or a transcriptional inhibitor, thereby allowing expression of the essential gene. As used herein, the term “regulatable inhibitor of RNA or protein synthesis”, refers to an inducible gene expression system of which the activation is regulated by an inducer and in turn regulates the production of an inhibitor of RNA or protein synthesis. In embodiments, said regulatable inhibitor of RNA or protein synthesis refers to transcriptional or translational regulation of the expression of a protein. A preferred transcriptional regulator includes an inducible promoter. A preferred translational regulator includes a RNAi molecule, such as miRNA, siRNA or shRNA. As used herein, the term ‘inducer’ refers to a compound or an environmental trigger. Different types of inducers are known to a person skilled in the art and include chemical inducers, physical inducers such as a cold or / heat pulse, an acoustic signal and / or light, and biological inducers such as hormones and / or specific nutrients. As used herein, the term “constitutive promoter” refers to a promoter that is active under most, preferably all, circumstances in a microorganism. Preferably, a constitutive promoter is a ubiquitous promoter that is active in a wide range of microorganisms. As used herein, the term “genome alteration” refers to a replacement of one or more nucleotides, the insertion of one or more nucleotides, the deletion of one or more nucleotides, and / or a combination thereof, in a genome. As used herein, the term “mutant” refers to a microorganism of which the genome has been altered and whereby the genome differs from the genome sequence prior to genome alteration of the microorganism. As used herein, the term “homologous recombination”, refers to a genetic recombination event wherein a genomic alteration is obtained by recombination between two similar nucleic acid molecules, such as a genome and a recombinant DNA molecule, stimulated by a double-strand break. As used herein, the term “crossover”, refers to a homologous recombination event between a construct, preferably a circular construct, and a genome whereby the construct integrates into the genome. In a single-crossover event, one homologous recombination event results in the integration of the entire construct in the genome, including an expression cassette encoding for a regulatable inhibitor of RNA or protein synthesis. In a double-crossover event, two homologous recombination events have occurred, resulting in the integration of a part of the construct into the genome. Said part of the construct does not comprise an expression construct encoding for a regulatable inhibitor of RNA or protein synthesis. As used herein, the term “scarless”, refers to a mutant microorganism comprising a desired genomic mutation, after genomic alteration, without the presence of accessory gene editing elements, such as a construct, a plasmid, a selection marker, a genome editor and / or another sequence. As is used herein, the terms “transfecting” and “transfection”, refer to the process of introduction of a nucleic acid molecule, such as a DNA molecule, into a cell, preferably an eukaryotic cell. The term "transfection" encompasses any method known to the person skilled in the art for introducing nucleic acid molecules into cells, for example, electroporation, lipofection, e.g., cationic lipid- and / or liposome-based, calcium phosphate precipitation, nanoparticle-based transfection, or transfection based on cationic polymers such as DEAE-dextran or polyethyleneimine, and the like. As is used herein, the terms “transducing” and “transduction”, refer to a process of introduction of a nucleic acid molecule, such as a DNA molecule, into a cell, preferably a eukaryotic cell, by use of a viral vector. Such a viral vector may be a lentiviral vector, adenoviral vector, adeno-associated virus vector, retroviral vector, or any combination thereof. As used herein, the term “multiple cloning site”, abbreviated as “MCS”, refers to a segment of DNA comprising 1-20 unique restriction sites, which are recognized by compatible restriction enzymes. Preferred combinations of restriction sites and restriction enzymes, are known by a person skilled of the art. An alternative term for a MCS is a “polylinker”. As used herein, the term ‘stringent condition’, refers to an environmental condition in which a mixture of nucleic acids is conducted for hybridization. Said condition may be a specific temperature, a potential of hydrogen (pH) and / or a salt concentration. As used herein, the term “photocaged molecule”, refers to a molecule, such as an inducer, that is trapped in an inactive form by chemical modification with a photoremovable protecting group. Irradiation liberates the trapped molecule, permitting targeted perturbation of a biological process. Examples of such photoremovable protecting groups are p-hydroxyphenacyl, 2-nitrobenzyl including [alpha]-carboxy-ortho-nitrobenzyl (CNB), coumarinyl and 7-nitroindoline groups. Invention The present invention relates to a method for altering a genome of a microorganism, such as a bacterium, a fungi or an alga, and the subsequent efficient selection of a desired mutant microorganism by the targeting of an essential gene. A method of the invention may result in scarless alteration of a microorganism’s genome, for example a Streptomyces. A method of the invention involves the creation of a non-replicating construct, preferably a suicide plasmid, an unstable plasmid or a temperature sensitive plasmid. Said non-replicating construct comprises a first and a second homology region, each of which is 90 – 100 % identical to a genome sequence of a microorganism. Said first and a second homology region may encompass a sequence that is altered when compared to the sequence of the genome of the microorganism, before genome alteration, i.e., the original or natural genomic sequence. The construct further comprises an expression cassette, comprising a regulatable inhibitor of RNA or protein synthesis, such as an inducible inhibitor of RNA or protein synthesis, functionally coupled to a promoter sequence and optionally a terminator sequence. In embodiments, a promoter sequence may be an inducible gene expression system, such as a cumate-inducible system. The inhibitor of RNA or protein synthesis is, for example, a CRISPR-dCas9 system and comprises a sgRNA complementary to a part of an essential gene, for example dnaA or divIVA in Streptomyces. A method of the invention involves the transformation of a microorganism with a construct, for example by transformation, conjugation or electroporation, and the selection of successfully transformed microorganisms by making use of a selection marker, such as hygromycin. Upon introduction of a construct in a microorganism, a crossover event may occur. Since the construct is non-replicating plasmid, for instance a suicide plasmid, an unstable plasmid or a temperature sensitive plasmid, selection for the presence of a selection marker will result in integration of the construct in the genome of the microorganism by at least one crossover event. In a single-crossover event, the entire construct is integrated into the genome of a microorganism, including an expression cassette encoding for a regulatable inhibitor of RNA or protein synthesis. In a double-crossover event, an expression cassette encoding for a regulatable inhibitor of RNA or protein synthesis is not integrated, and only a first and second homology region which may encompass an altered sequence, are integrated. In embodiments, a method of the invention involves addition of an inducer, such as cumate, activating the inducible gene expression system and in turn the expression of an inhibitor, in case of the presence of an integrated expression cassette due to a single-crossover event. An activated inducer results in expression of an inhibitor that targets an essential gene, resulting in an inhibited or a reduced production of the corresponding essential protein. A single cross-over mutant microorganism will not survive due to reduction of expression level or even absence of the essential protein, while a double-crossover mutant microorganism will survive, as the essential protein is sufficiently present, due to absence of an expression cassette comprising a regulatable inhibitor of RNA or protein synthesis, such as an inducible inhibitor of RNA or protein synthesis. Hence, a double- crossover mutant may therefore efficiently be selected after the above-mentioned two step selection approach. Targeted nucleases such as clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein (Cas), transcription activator-like effector nucleases, and zinc-finger nucleases, have provided researchers with the ability to manipulate virtually any genomic sequence. Many scientists nowadays use especially CRISPR-Cas for genome editing purpose. However, a major concern in the application of CRISPR / Cas is its off-target effects, namely the deposition of unexpected, unwanted, or even adverse alterations to the genome. In addition, CRISPR-Cas is poorly suited for the generation of single-nucleotide substitutions, due to its tolerance for single-base mismatches. Furthermore, CRISPR-Cas9 remains challenging to implement in certain Streptomyces strains due to Cas9- associated cytotoxicity, low transformation efficiency, and the need for careful single-guide RNA (sgRNA) design to minimize off-target effects. To mitigate these issues, various optimization strategies have been explored, including the use of Cas9 nickase variants, fine-tuning of Cas9 expression, and engineering of Cas9 with polyaspartate tags to reduce cytotoxicity and off-target activity (Kim et al., 2025. Nat Commun 16: 874; Ma et al., 2023. ACS Synth Biol 12: 3114-3123; Je et al., 2023. ACS Synth Biol 12: 61–70; Jiang et al., 2021. ACS Synth Biol 10: 2833-2841). Methods of the invention surprisingly offer a robust and broadly applicable alternative for seamless genetic manipulation, including the generation of single- nucleotide substitutions. Methods of the invention allow the generation of mutants in bacteria that are not easily transformed, including species that never have been transformed before such as Streptomyces synnematoformans. The crux of the technology is that it requires only a single transformant: a second recombination event is subsequently enforced by inducing the expression of an inhibitor that targets an essential gene. The induced toxicity after induction forces the generation of a second recombination event. As is shown in the examples, methods of the invention allow the generation of single nucleotide alterations, and hardly result in off-target effects. In addition, methods of the invention result in a reduction of time that is required for mutant generation. For example, in a model organism Streptomyces coelicolor, methods of the invention will reduce the time required to obtain a mutant from 30–45 days for a routine CRISPR / Cas9 system, to just 15 days. It seems counterintuitive to use CRISPR interference (CRISPRi) for genome editing, rather than an active CRISPR-Cas. However, besides the advantages mentioned herein above, the workflow for methods of the invention is highly streamlined, as a single spacer targeting an essential gene can be reused across different constructs within the same strain, facilitating parallel engineering efforts. Importantly, methods of the invention circumvent the often inefficient plasmid curing step required in CRISPR workflows, thereby improving reliability and reducing editing time. Unlike methods that rely on double-strand breaks or DNA nicks, the methods of the invention utilize a gentler, recombination-based mechanism that proceeds spontaneously and is subsequently selected for, thereby minimizing cellular stress and reducing the risk of off-target genomic alterations. The versatility and efficiency of the methods of the invention are demonstrated in the examples across both model and non-model Streptomyces strains, highlighting its utility as a generalizable genome engineering tool. Moreover, this inducible CRISPRi-based genome editing platform holds promise for application in other organisms where conventional counterselection systems are ineffective or unavailable, thus broadening its potential impact. Microorganism The invention provides a novel biological method for altering a genome of a microorganism and efficiently selecting a double-crossover mutant by targeting of an essential gene. Said microorganism may be a bacterium. Said bacterium may be a Gram-positive or a Gram-negative bacterium. Examples of Gram-negative bacteria are bacteria of the genus Agrobacterium, Alcaligenes, Anabaena, Anacystis, Azobacter, Chromatium, Cupriavidus, Enterobacter, Erwinia, Escherichia, Mesorhizobium, Methylobacterium, Phormidium, Pseudomonas, Rhodobacter, Rhodopseudomonas, Rhodospirillum, Rhodococcus, Salmonella, Serratia, Shigella, Synnecoccus, Xanthomonas and Zymomonas. Examples of species of Gram-negative bacteria are Escherichia coli, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas fluorescence, Pseudomonas chlororaphis, Salmonella enterica and Xanthomonas campestris. Examples of Gram-positive bacteria are Alicyclobacillus, Actinomyces, Arthrobacter, Bacillus, Bifidobacterium, Brevibacterium, Clostridium, Corynebacterium, Deinococcus, Frankia, Gardnerella, Gradnerella, Lactococcus, Lactobacillus, Listeria, Microbacterium, Micrococcus, Mycobacterium, Nocardia, Propionibacterium, Rhodococcus, Staphylococcus, Streptococcus and Streptomyces. Examples of species of Gram-positive bacteria are Bacillus anthracis, Bacillussubtillis, Staphylococcus aureus, Staphylococcus epidermis, Clostridiumbutyclicum, Deinococcus radiorans, Streptomyces coelicolor, Streptomycesroseifaciens, Streptomyces lividans, Streptomyces venezuelae and Corynebacteriumglutamicum. Said microorganism may be a fungus, such as a microorganism of the genus Aspergillus, Chrysosporium, Fusarium, Neotyphodium, Neurospora, Penicillium and Trichoderma. Examples of species of fungi are Aspergillus niger, Fusarium oxysporum and Trichoderma Harzianum. Said fungus may be a yeast, such as amicroorganism of the genus Arxula, Candida, Cryotococcus, Hansenula,Kluyveromyces, Pichia, Saccharomyces, Schizosacchoromyces, Xanthophyllomyces and Yarrowia. Examples of yeast species are Hansenula polymorpha, Saccharomyces cerevisiae, Yarrowia lipolytica, Pichia pastoris and Schizosacchoromyces pombe. Said microorganism may be an alga such as a green algal cell or a microalgal cell. Microalgae include inter alia a species of a genus selected from the group consisting of Achnanthes, Amphiprora, Amphora, Ankistrodesmus, Asteromonas, Boekelovia, Bolidomonas, Borodinella, Botrydium, Botryococcus, Bracteococcus, Chaetoceros, Carteria, Chlamydomonas, Chlorococcum, Chlorogonium, Chlorella, Chroomonas, Chrysosphaera, Cricosphaera, Crypthecodinium, Cryptomonas, Cyanidioschyzon, Cyclotella, Cylindrotheca, Cymatopleura, Dixoniella, Dunaliella, Ellipsoidon, Emiliania, Entomoneis Eremosphaera, Ernodesmius, Euglena, Eustigmatos, Franceia, Fragilaria, Fragilariopsis, Gloeothamnion, Haematococcus, Halocafeteria, Hantzschia, Heterosigma, Hymenomonas, Isochrysis, Lepocinclis, Micractinium, Microchloropsis, Monodus, Monoraphidium, Nannochloris, Nannochloropsis, Navicula, Neochloris, Nephrochloris, Nephroselmis, Nitzschia, Ochromonas, Oedogonium, Oocystis, Ostreococcus, Parachlorella, Parietochloris, Pascheria, Pavlova, Pelagomonas, Phoeodactylum, Phagus, Picochlorum, Platymonas, Pleurochrysis, Pleurococcus, Prototheca, Pseudochlorella, Pseudoneochloris, Pseudostaurastrum, Pyramimonas, Pyrobotrys, Scenedesmus, Schizochlamydella, Schizochytrium, Skeletonema, Spyrogyra, Stichococcus, Tetrachlorella, Tetraselmis, Thalassiosira, Tribonema, Vaucheria, Viridiella, Vischeria and Volvox. For example, the cell may be from a diatom (Bacillariophyte) such as a species of Achnanthes, Amphora, Chaetoceros, Cyclotella, Cylindrotheca, Cymatopleura, Entomoneis, Fragilaria, Fragilariopsis, Navicula, Nitzschia, Phoeodactylum, or Thalassiosira, for example, a species of Eustigmatos, Monodus, Nannochloropsis or Vischeria. Examples of algae species are Chlamydomonas reinhardtii, Thalassiosira pseudonana and Phaeodactylum tricornutum.Said microorganism may be a cell line. Preferably a mammalian cell line, more preferably a human cell line such as a HeLa cell line, a HEK293 cell line, a mammalian embryonic stem cell (ESC) line or a Chinese hamster ovary (CHO) cell line, or mouse cell line such as a MSC-1 cell line. A preferred microorganism is of the class Actinomycetia, including species of the order Streptomycetales, such as species of the family Streptomycetaceae and especially including species of the genus Streptomyces. Examples of such species are Streptomyces aureofaciens, S. griseus, S. laurentii, S. kanamyceticus, S. venezuelae, S. niveus. S. albus, S. tsukubaensis, S. lipmanii, S. microflavus, S. cattleya S. clavuligerus S. lactamdurans, S. chartreusis, S. cinnamonensis, S. fimbriatus, S. halstedii, S. rochei, S. viridochromogenes, S. wadayamensis, S. panayaensis, S. hygroscopicus, S. penemifaciens, S. flavogriseus; S. olivaceus, S. alcalophilus, S. jumonjinesis, S. katsuharamanus, S. heteromorphus, S. pristinaespiralis, S. virginiae, Saccaropolyspora erythraea, Amycolatopsis mediterranei, Amycolatopsis lactamdurans, Nocardia uniformis, Actinosynnema mirum, and Microtetraspora caesia. By targeting of an essential gene of a microorganism by a regulatable inhibitor of RNA or protein synthesis, such as an inducible inhibitor of RNA or protein synthesis, the corresponding essential gene product will not be produced, or only at a reduced level, which may result in growth arrest or even death of the microorganism. As such, only microorganisms will survive whereby the targeting of an essential gene has been overcome and can therefore be efficiently selected. Said essential genes that are indispensable for the survival of the microorganism, are known to a skilled person. Essential genes are known to a person skilled in the art. For example, Peters et al., 2016 (Peters et al., 2016. Cell 165: 1493-1506) provides a detailed analysis of essential genes in bacteria. Preferred targeted essential genes in bacteria include acpP, aroC, cds, AcsrA, dapB, def, divIVA, divIVB, dnaA, dnaE, dnaG, dnaN, dnaX, eno, erpA, fabA, fabI, fmt, frr, ftsA, ftsB, ftsI, ftsK, ftsL, ftsN, ftsQ, ftsQ, ftsW, ftsZ, fusA, gapA, gcaD, glyQ, glyQ, glyS, guaA, guaB, gyrB, gyrA, hbs, holB, hupN, Igt, ileS, imp, infA, ispA, ispE, ispH, lolCD, lpdA, lptD, lysS, metS / metG, mog, msmX, mukB, mukE, mukF, murC, murD, murE, murG, nusB, nusG, hupB, oppC, oppD, oppF, proS, prs, pspE, pyrH, rbfA, recF, rgsA, ribD, ribF, rim, rnhA, rnhB, rnt, rpl, rplI, rpoD, rpoH, rps, rpsB, rpsR, rpsT, secY, spoVC, sucB, surA, tmk, tonB, trmD, tsf, tsf, tusABCDE, uppS and zipA. Preferred targeted essential genes in fungi include PKC1, AAR2, ACS2, ALG14, AME1, BIR1,BN1, BRX1, CDC15, CDC19, CDC24, CDC27, CDC48,CDS1, CDS1, CHS2, DED1, DED81, DSN1, EFB1, EMG1,EMW1,ENP1,ENP2,ERD2, ERG10, ERV1, ERV2, ESF1, ESP1,ESS1,GFA1, GPI18, GUS1, HHF1, HIS3, HTA2, ILS1, IPL1,IPP1, LSM2, LUC7, MAK16, MAK5, MCD1,MCM2, MTW1, NOB1, OLE1, ORC2, PAB1, PDS5,PET9, PKC1, POL12, POP5, POP8, PRE7, PRP45, PRP6, PTA1, RAD53,RER2, RFA1, RFT1, RPG1, RPL32, RRN6, SCO2, SEC17, SEN34, SFT2, SPC105,SPE2, STU1, TFC3, TOM40, TSC3, TUB1, UFE1 and UTP20. Preferred targeted genes in algae include PBSH, CDKA, RECQL4, RIR1, CYCB1, APC2, APC6, APC8, CDC20 and PEPC1. Preferred targeted essential genes in mammalian cells lines include GBAP, MTHFR, ECE1, HSPG2, TGIF1, GLB1, MKKS, DNAH11, PDHA1, SLC37A4, DNMT3B, UBR1, CSFR, FGFR1, EDNRB, ASPA, ARCC5, PCCA, GALT, STAR, CTSD, NR0B1, PAFAH1B1, PTCH2, SMPD1, AR, CYP7B1, TP53, ADA, HEXB, CRH, BMP15, PAX9, ACADVL, CTSA, MGAT2, ARSA, KISS1R, APC, SCNN1B, WT1, RET, NEU1, HSD17B4, HADHA, ACP2, MANBA, POR, ACADM, MPI, ASL, SIX3, SALL1, DCX, FCMD, FAH, CYP11A1 and CYP11B2. Construct A construct, as depicted in Figure 1, comprises a first and a second region of homology with a genomic target of a microorganism and optionally encompasses a genomic sequence that is altered, when compared to the original or natural genomic sequence of the microorganism, in between the first and second region of homology. The regions of homology are separated by a first expression cassette comprising a promoter and optionally a terminator, functionally coupled to a selection marker and a second expression cassette including a promoter and optionally a terminator, functionally coupled to a regulatable inhibitor of RNA or protein synthesis, such as an inducible inhibitor of RNA or protein synthesis that targets an essential gene of a microorganism. The first and second expression cassettes are located outside of the homology regions, at the opposite site of a first and second homology region, in respect to an optionally encompassed sequence that is altered and will thus not be retained in the genome in case of a double-crossover event. A skilled person will understand that a construct is used to alter the genome of a microorganism. In addition, a preferred construct is an non-replicating construct, as this may result in the creation of a marker-free and scarless mutant microorganism. Hence, the invention further comprises a non-replicating construct, preferably a suicide plasmid, or otherwise unstable plasmid, or a temperature sensitive plasmid. Said non-replicating plasmid is a double-stranded DNA molecule that is capable of replicating in a certain microorganism independent of its integration into the chromosomal DNA. A non-replicating plasmid may comprise an origin of replication that is not recognized by a microorganism of which the genome is to be altered. An unstable plasmid has may be easily lost by a microorganism due to the lack of partition function. A temperature sensitive plasmid has impaired or completely inhibited replication starting from a defined temperature in a microorganism of which the genome is to be altered. As such, only by integration into the genome of the microorganism, the construct will be retained. Such non-replicating plasmids, for instance suicide plasmids or unstable plasmids, are known to a skilled person. Examples of non-replicating plasmids, also termed suicide plasmids, in bacteria are a pUC18mini plasmid, a pCVD442 plasmid and a pDS132 plasmid (Philippe et al., 2004, Plasmid, 51: 246-255), a P15a origin plasmid (Addgene #74088), a pJQ200uc1 plasmid, a pJQ200mp19 plasmid, a pJQ200mp18 plasmid, a pJQ210SK plasmid, a pJQ200KS plasmid, a pJQ200SK plasmid, a pJQ200 plasmid (Quandt and Hynes, 1993, Gene, 127: 15-21), a pGNW2 plasmid, a pGNW6 plasmid, a pGNW4 plasmid, a pAOJ15 plasmid, a pKC1132 plasmid. An example of a suicide plasmid in fungi is a pRS306 plasmid (Egecioglu et al., 2014. Methods in Cell Bio 122: 463-485). An example of a suicide plasmid in algae is a pALM30 plasmid (Meslet-Cladière and Vallon, 2011. Eukaryot Cell 10:1670-1678). An example of a suicide plasmid in cell lines is a pEM584 plasmid, a pFRT / lacZeo plasmid (Invitrogen, V601520) and a pSECpgl plasmid (Mauri et al., 2021. Microb Cell 20: 193). Examples of unstable plasmids in bacteria are pWHM3 and SCP2 (Vara et al. 1989. J of Bac 171: 5872-5881; Lydiate et al. 1985. Gene 35:223-235). An example of an unstable construct in fungi is a linear, DNA construct. Examples of temperature sensitive plasmids in bacteria are pKD46 (Datsenko et al., 2000. Proc Nat Aca Sci 97: 6640-6645), pAGD248 (Addgene #219498) and pSG5 (Muth et al., 1994. Plasmid 33: 113-126). Said non-replicating construct further comprises a first and a second region of homology, a sequence homologous to respectively a first part of the genome of a microorganism, preferably an upstream part of a genome that is to be altered (termed genomic target), and a sequence homologous to second part of the genome of a microorganism, preferably a downstream part of the genomic target, adjacent to the first region. The term adjacent is used to indicate that the sequences homologous to the first part of the genome are located on one side of the construct, while sequences homologous to the second part of the genome are located on the other side of the construct. A sequence homologous to a first region of homology of the genome preferably comprises between 15 base pairs (bp) and 100 kilobases (kb), between 20 bp and 20 kb, between 25 bp and 10 kb, between 50 bp and 5 kb, between 100 bp and 2 kb, of sequences that are homologous to a first part of a genome, preferably to an upstream part of a genomic region to be altered or deleted. A sequence homologous to the second region of homology of the genome preferably comprises, independent of the length of the first region of homology, between 15 bp and 100 kb, between 20 bp and 20 kb, between 25 bp and 10 kb, between 50 bp and 5 kb, between 100 bp and 2 kb, of sequences that arehomologous to a second part of the genome, preferably to a downstream part of agenomic region to be altered or deleted. Said sequences that are homologous to a first and / or second part of the genome, preferably a genomic target, may encompass a sequence that is altered, when compared to the sequence of the genome before genome alteration. When the first region of homology and the second region of homology cover adjacent regions of a genomic target, the integration of the homology regions will result in an alteration of a genomic target within the genome. Said alteration may be a replacement, a deletion, an insertion, or a combination thereof such as a deletion and a replacement, an insertion and a replacement, a deletion and an insertion, or a deletion, a replacement and an insertion. Said altered genomic sequence may result in an altered gene product, or altered expression of a gene product, such as an altered coding sequence of a gene, including a deletion of part of a coding sequence or of a complete coding sequence of a gene. A replacement of one or more nucleotides may be accomplished by altering one or more nucleotides in a first and / or a second region of homology. A deletion of one or more nucleotides may be accomplished by deleting one or more nucleotides in a first and / or a second region of homology. An insertion of one or more nucleotides may be accomplished by inserting one or more nucleotides, termed “an encompassed sequence that is altered”, in between a first and / or a second region of homology. Said non-replicating construct further contains an expression cassette, comprising a selection marker. Said expression cassette encoding for a selection marker separates the first and second homology region and is located at the opposite site of a first and second homology region, in respect to an optionally encompassed sequence that is altered. Said expression cassette for example allows growth of a microorganism in the presence of an antibiotic. Said selection marker is preferably an antibiotic resistance marker or an auxotrophic marker, which are known to a skilled person. The antibiotic resistance marker is preferably a broad- spectrum antibiotic. Preferred antibiotic resistance markers include genes conferring for resistance to ampicillin, blasticidin, bleomycin, carbenicillin, cefazolin, ceftazidime, cefdinir, chloramphenicol, ciprofloxacin, clindamycin, co- trimoxazole, gatifloxacin, geneticin, gentamycin, erythromycin, hygromycin, kanamycin, levofloxacin, linezolid, meropenem, neomycin, ofloxacin, oxacillin, penicillin, polymyxin B, puromycin, rifampicin, roxithromycin, spectinomycin, streptomycin, tetracycline, tobramycin, trimethoprim, vancomycin and zeocin. Preferred auxotrophic markers in fungi include URA3, KIURA3, CaURA3,HIS3, HIS5, LEU2, KILEU2, LYS2, TRP1, ADE1, ADE2 and MET15.Said non-replicating construct further comprises a regulatable inhibitor of RNA or protein synthesis, which is preferably a gene knockout inhibitor or a gene knockdown inhibitor. Such gene knockout inhibitor irreversible alters a target gene, which renders it inactive and thereby prevents its transcription. A preferred knockout inhibitor is a Clustered Regulatory Interspaced Palindromic Repeat (CRISPR)-Cas system, a Zinc finger nuclease (ZFN) or a Transcription Activator- like Nuclease (TALEN). Preferred CRIPSR-Cas systems are a Type I CRISPR-Cas3 system, a Type II CRISPR-Cas9 system, a Type III-Cas10 system, a Type V CRISPR-Cas12a system, a Type V CRISPR-Cas12b system, a Type V CRISPR- Cas12c system, a Type VI CRISPR-Cas13a system, a Type VI CRISPR-Cas13b system, a Type VI CRISPR-Cas13c system, a Type VI CRISPR-Cas13d system (Liu et al., 2022. Cell, 82: 333-347; Rahim et al., 2021. Int J Innov Sci Res Tech 6: 829- 836; Becker and Boch, 2021. Gene Genome Editing 2: 100007; Kazi et al., 2021, Progress Mol Biol Translational Science 178: 99-122; Xu and Li, 2020. Comput Struct Biotechnol J 18: 2401-2415). A gene knockdown inhibitor preferably is a translational knockdown inhibitor. The production of the corresponding gene product is prevented by binding of a the translational knockdown inhibitor being a small, RNA fragment to a complementary, target messenger RNA (mRNA) fragment and the subsequent degradation of the formed double-stranded RNA (dsRNA) fragment. A preferred translation knockdown inhibitor is a RNA interference (RNAi) tool. More preferably, a RNAi tool is a microRNA (miRNA), a small interfering RNA (siRNA) or a short-hairpin RNA (shRNA) (Wang et al., 2021. Theranostics 11: 8771-8796; Boettcher and Mcmanus, 2015. Mol Cell 58: 575-585). A gene knockdown inhibitor preferably is a transcriptional knockdown inhibitor. A transcriptional knockdown inhibitor represses the transcription of a target gene either through steric hindrance by the presence of a DNA binding protein, such as a catalytically inactive nuclease, or by the presence of a transcriptional repressor domain. Preferred transcriptional knockdown inhibitors are a Transcription Activator-Like Effector (TALE) system, a Krüppel associated Box (KRAB)-TALE system, a KRAB-ZFN system or a CRISPR interference (CRISPRi) system. More preferably, a CRISPRi system comprises a catalytic dead nuclease such as a catalytic inactive CRISPR Associated (CAS) protein (Boettcher and McManus, 2015. Mol Cell, 58: 575-585). A catalytic dead Cas protein (dCas) protein comprises a catalytic inactive domain which results in the loss of nucleolytic activity of the Cas protein. Expression of a dCas in combination with a sgRNA results in the binding of the complex to a complementary nucleic acid element which causes a steric hindrance, resulting in the prevention of expression of a target gene. Said dCas protein preferably is a dCas3 protein, a dCas9 protein, a dCas10 protein, a dCas12a protein, a dCas12b protein, a dCAS13a protein, a dCas13b protein, a dCAS13c protein, a dCas13d protein. In embodiments, the dCAS protein is a dCas9 protein (Brezgin et al., 2019, Int J Mol Sci 20: 6041; Zheng et al., 2020, Front Bioeng Biotechnol 8: 856; Choi and Woo, 2020, ACS Synth Biol 9: 2351-2361; Ming et al., 2020, Nature Plants, 6: 202-208). In embodiments, the regulatable inhibitor of RNA or protein synthesis is an inducible inhibitor of RNA or protein synthesis such as an inducible gene expression system of which the expression can be regulated by an inducer. In embodiments, an inducer may a chemical inducer, such as isopropyl β-d-1- thiogalactopyranoside (IPTG) or L-mannose, a physical inducer such as a cold or / heat pulse, an acoustic signal and / or light signal, or a biological inducer such as a hormone, for example cyclic diguanylate (c-di-GMP), autoinducer 2 (AI-2) or N- acylhomoserine lactone, or a metabolite, such as salicylaldehyde or lactic acid, or a nutrient, such as glucose or allolactose (Sperandio et al., 2003. Proc Natl Acad Sci USA 100: 8951-8956; Kelly et al., 2016. ACS Synth Biol 5: 1136-1145; Connors and Barnsley, 1980. J Bacteriol 141: 1052-1054). In embodiments, an inducer may be photocaged, by the protection of a photoremovable protecting group (PPG), such as an o-nitrobenzyl derivate, a coumarin derivate, a boron difluoride complex of a dipyrromethene (BODIPY), a xanthene derivate, a quinone and / or a diarylene derivate. Upon light irradiation, said PPG undergoes a photoreaction which results in the release of the inducer. The suitable wavelength for PPG activation depends on the used photocage and preferably is a long wavelength, as this is less damaging for the cell and are amenable to microscopy, such as UV (<400 nm), visible light (400-800 nm), or infrared light (>800 nm) (Li et al., 2023. Smart Mol 1: e20220003). Preferable inducible gene expression systems are known to the skilled person. Inducible gene expression systems may activate an inducer, either directly, such as the activation of transcription, or indirectly, such as the alleviation of a transcriptional repressor. Preferred inducible gene expression systems that have been employed in bacteria for gene knockout and knockdown are, the araBAD system, which is inducible by L-arabinose, the plac system, which is inducible by isopropyl β-D-thiogalactopyranoside (IPTG), the rhaBAD system, which is inducible by L-rhamnose, the ^-butyrolactones-inducible system, which is induced by ^-butyrolactones, the cellobiose-inducible system, which is inducible by cellobiose, the thiostrepton-inducible system, which is inducible by thiostrepton, the Tet system, which is inducible by doxycycline, the cumate-inducible gene system, which is inducible by 4-isopropylbenzoic acid (cumate), the ArgR-inducible system, which is inducible by L-Arginine, the HdnoR-inducible system, which is inducible by 6-Hydrocy nicotine, the Pip-inducible system, which is inducible by pristinamycin, the Rex-regulon, which is inducible by NADH, the RheA-based system, which is inducible by heat, The proU operon, which is inducible by osmolarity, the HexR system, which is inducible by glucose, the LvaR system, which is inducible by levulinic acid, the HpdR system, which is inducible by levulinic acid, the XutR system, which is inducible by xylose, the XylS / Pm system, which is inducible by a benzoate-derived inducer, the AntR / PantA system, which is inducible by anthranilate. In one embodiment, the inducible promoter is the cumate-inducible gene system (Marschall et al., 2016. Appl Microbiol Biotechnol 101: 5719-5728; Bertram et al., 2022. Microb Biotechnol 15: 1101-1119; Horbal et al., 2014. Appl Microbiol Biotechnol 98: 8641-8655; Kiupakis and Reitzer, 2002. J Bacteriol 184: 2940-2950; Sandu et al., 2003. JBC 278; Forti et al., 2009. J Biotechn 140: 270-277; Afzal et al., 2018. Front Microbiol 9: 1300, Servant et al., 2000. Proc Natl Acad Sci USA 97: 3538-3543, Sathesh-Prabu et al., 2021. Scientific Reports 11: 18079 ; Gawin et al., 2017, Microb Biotechnol 10: 702-718; Hoffman et al., 2021, Appl Microbiol Biotechnol 105: 247-258). A RNA Polymerase III (Pol III) and a corresponding RNA Pol III associated promoter may be used for the transcription of small untranslated RNAs like siRNA, shRNA and miRNA in fungi. An example of such a Pol III associated promoter that has been employed in fungi for gene knockdown, include, for example, a GAL1 promoter, which is inducible by galactose. A RNA Polymerase III (Pol III) and a corresponding RNA Pol III associated promoter may be used for the transcription of small untranslated RNAs like siRNA, shRNA and miRNA in algae. A preferred inducible gene expression system for gene knockdown that has been employed in algae, is for example the NIT1 promoter system, which is inducible by nitrate (Schmollinger et al., 2010, Curr Genet, 56: 383-389). A RNA Polymerase III (Pol III) and a corresponding RNA Pol III associated promoter may be used for the transcription of small untranslated RNAs like siRNA, shRNA and miRNA in cell lines. A preferred inducible gene expression system for gene knockdown that has been employed in cell lines, is for example the U6 promoter system, which is inducible by ecdysone (Gupta et al., 2004. Bio Sci 101: 1927-1932) and the Tet system, which is inducible by tetracycline. A RNA Polymerase II (Pol II) and a corresponding RNA Pol II associated promoter, may be used for the transcription of protein-encoding genes in fungi. Examples of such Pol II associated promoter systems that have been employed in fungi for gene knockout are a GAL10 promoter, which is inducible by galactose, a SUC2 promoter, which is inducible by sucrose, a MAL12 promoter, which is inducible by maltose, a CUP1 promoter, which is inducible by copper, a tetO7 and tetO2 promoter, which are both inducible by tetracycline, a PthiA promoter, which is inducible by thiamine (Gari et al., 1997. Yeast 13: 837-48; Yen et al., 2003. Yeast 20: 1255-1262). A RNA Polymerase II (Pol II) and a corresponding RNA Pol II associated promoter, may be used for the transcription of protein-encoding genes in algae. An inducible gene expression system for gene knockout that has been employed in algae is the AlcR-PalcA system, which is induced by alcohol, the CnAFP system, which is inducible by cold, The TPP system, which is induced by thiamine pyrophosphate, the CYC6 system, which is induced by cytochrome c6, the NIT1 system, which is induced by nitrate (Lee et al., 2018. J Appl Phycol 30: 2297-2304; Ramundo et al., 2013. Plant Cell 25: 167-186; Quinn and Merchant, 1995. Plant Cell 7: 623-628; Schmollinger et al., 2010. Curr Genet 56: 383-389). A RNA Polymerase II (Pol II) and a corresponding RNA Pol II associated promoter, may be used for the transcription of protein-encoding genes in cell lines. An inducible gene expression system for gene knockout that has been employed in cell lines is the Tet system, which is induced by tetracycline, the cumate-controlled operator system, which is induced by cumate, the rapamycin-based system, which is induced by rapamycin, the abscisic acid (ABA)-regulated system, which is induced by ABA (Kallunki et al., 2019. Cells 8: 796). Combinations of inducible systems for generation of a regulatable inhibitor of RNA or protein synthesis include a CRISPR-dCas3 system under the control of a cumate-inducible gene system, a CRISPR-dCas9 system under the control of a cumate-inducible gene system, a CRISPR-dCas10 system under the control of a cumate-inducible gene system, a CRISPR-dCas12a system under the control of a cumate-inducible gene system, a CRISPR-dCas12b system under the control of a cumate-inducible gene system, a CRISPR-dCas13a system under the control of a cumate-inducible gene system, a CRISPR-dCas9 system under the control of a plac system, a CRISPR-dCas9 system under the control of an araBAD system, a CRISPR-dCas9 system under the control of a L-rhamnose system, a siRNA system under the control of a cumate-inducible gene system, a siRNA system under the control of a plac system, a siRNA system under the control of an araBAD system, a siRNA system under the control of a L-rhamnose system, a siRNA system under the control of an GAL1 system, a CRISPR-dCas9 system under the control of a GAL10 system, a CRISPR-dCas9 system under the control of a TPP system, a CRISPR-dCas12a system under the control of a TPP system, a siRNA system under the control of a NIT1 system. In embodiments, the inducible inhibitor is a CRISPRi targeting an essential gene (ICE) tool. Said ICE tool comprises a sgRNA, comprising a spacer targeting an essential gene. Spacers corresponding to a region of a target essential gene may be designed by making use of online tools as is known by a person skilled in the art, such as DeepSPCas9, CRISPOR, CCTop, and Find CRISPR sites tool. Only protospacers with a specificity score of > 95% on non-template (NT) strand are retained. Said expression construct comprises an expression cassette including a promoter and optionally a terminator, operationally coupled to a selection marker. A preferred promoter is a constitutive promoter, which is known to a skilled person. Examples of promoters in bacterial cells include a SP11 promoter, a SP30 promoter, a htpG promoter, a dnaK promoter, a htpG promoter, A PliaG promoter, a PlepA promoter, a Pveg promoter, Ctc promoter, a gsiB promoter, a 43 promoter, a Pspv2 promoter, a Pspv promoter, a T7 promoter and a SP6 promoter Examples of promoters in fungi include a pCyc promoter, a pAdh promoter, a pSte5 promoter, a pADH1 promoter, a cyc100 promoter, a cyc28 promoter, a cy16 promoter, a pPGK1 promoter, a pCYC promoter, a TDH3 promoter and a CLB1 promoter. Examples of promoters in algae include a ARG7 promoter, a HSP70A / RBCS2i promoter, a Lhcr5 promoter, a PSAD promoter, a Ptub promoter and a ^2-tubulin promoter (Geisler et al., 2021. Life 11: 109301; Kumar et al., 2020. Front Bioeng Biotechnol 8: 914). Examples of promoter in cell lines include promoter a cytomegalovirus (CMV) promoter, a CMV early enhancer / chicken ^ actin (CAG) promoter, a short variant of CMV early enhancer / chicken ^ actin (sCAG) promoter, a ubiquitin C (UBC) promoter, a chicken ^ actin (CBA) promoter, a p5 promoter, a mouse PGK promoter (mPGK), a peptidoglycan GlcNAc deacetylase EF1843 (PgdA) promoter, and a human synapsin (hSYN) promoter (Nieuwenhuis et al., 2021. Gene Ther 28: 56-74). Examples of optional terminators in bacteria include rrnB T1, His, T7TE, T0 and T7 gene terminators. Examples of optional terminators in fungi include CYC1, TRP1, ADH1, MFl, FLP and D gene terminators. Examples of optional terminators in algae include PSAD, RPL23 and FDX1 gene terminators. Examples of optional terminators in cell lines include a ^-globin gene terminator sequence (^TERM), a mouse serum albumin (MSA) terminator region and an alcohol dehydrogenase (ADH1) terminator sequence. Said construct may be generated via cloning methods that are known by a person skilled in the art. Examples of cloning methods include GoldenGate assembly, Gateway cloning, overlap PCR, Oligonucleotides-linkers-mediated DNA assembly (OLMA) and restriction enzyme cloning. The invention further provides a kit comprising a construct of the invention comprising a MCS, an expression cassette encoding for a regulatable inhibitor of RNA or protein synthesis and an expression cassette encoding for a selection marker. Said construct preferably is present on a non-replicating plasmid. Said kit may further comprise methods and means for growth of a microorganism, and / or an inducer to activate an inducible inhibitor of RNA or protein synthesis. Transformation The invention further provides a method for producing a microorganism comprising a non-replicating construct of the invention, comprising providing a microorganism with a non-replicating construct of the invention and selecting a microorganism having said non-replicating construct. Said construct may be provided to a microorganism by any method known to a person skilled in the art. Examples of methods for the transformation of bacteria are electroporation (Chassy et al., 1988. Trends Biotechnol, 6: 303-309; Choi et al., 2006. J Microbiol Methods 64: 391-397; Dunny et al., 1991. Appl Environ Microbiol 57: 1194-1201), triparental conjugation (Sana et al., 2014. ‘Gene Transfer: Conjugation’ in Filloux and Ramos (eds.) Pseudomonas Methods and Protocols, 17- 22; Keiser et al., 2000. Practical Streptomyces Genetics. John Innes Foundation), chemical transformation (Green and Rogers, 2013. Methods Enzymol: 326-336) and biolistic transformation (Smith et al., 1992. Microbiol 138: 239-248). Examples of methods for the transformation of fungi are chemical transformation (Gietz et al., 1992. Nucleic Acid Res 20: 1425) and electroporation (Suga and Hatakeyama, 2003. Curr Genet 43: 206-211). Examples of methods for the transformation of algae are chemical transformation, microparticle bombardment, silicon carbide-mediated transformation and agitation with glass beads (Ortiz-Matamoros, 2017. Briefings Funct Genomics 17: 26-33). Examples of methods for the transformation of cell lines are via transduction and transfection. A non-replicating construct of the invention can be readily introduced into a cell line by transfection by any procedure useful for the introduction into a particular cell, such as by chemical, for example via cationic polymers, calcium phosphate or cationic lipids, or by physical methods, for example via direct injection, electroporation or biolistic particle delivery. A non- replicating construct of the invention can be readily introduced into a cell line by transduction of a vector. A person skilled in the art knows how to transduce a cell with a construct. A preferred vector for transduction is a retroviral vector, such as a lentiviral vector or an adenoviral vector. Selection Subsequent to the transformation of a microorganism with a construct, the transformed microorganism may be cultured in growth medium and selected for successful transformation based on the expression of a selection marker. The selection of a microorganism expressing a selection marker is known by a person skilled in the art. Suitable growth media may be obtained from for example Sigma-Aldrich, Thermo Fisher and / or Gibco. When a double-crossover event has occurred, the resulting microorganism comprises an alteration or alterations that were present on a construct, such as an insertion into a genomic target or a deletion from a genome, preferably an insertion into a targeted gene or a deletion of a targeted gene or a deletion within a targeted gene. On the other hand, when only a single- crossover event has taken place the resulting microorganism comprises an alteration or alterations that were present on a construct, or that were induced by a construct into a genomic target, such as an insertion into a genomic target or a deletion from a genome, preferably an insertion into a targeted gene or a deletion of a targeted gene or a deletion from within a targeted gene in addition to an expression cassette. Therefore, addition of an inducer to a single-crossover mutant may result in expression of a regulatable inhibitor of RNA or protein synthesis on the expression cassette and subsequently targeting of an essential gene and growth arrest or even death of the microorganism. Hence, only double-crossover mutants will survive as they overcome essential gene targeting and are therefore efficiently selected. The induction of the regulatable inhibitor of RNA or protein synthesis of an essential gene by an inducer may be performed in a suitable growth medium. In embodiments, the inducer is added to a solid growth medium. The addition to a solid medium, such as an agar plate, will allow the selection of single colonies on the solid medium. These clone survive because the regulatable inhibitor of RNA or protein synthesis has been deleted by a double cross-over event. Said biological or chemical inducer, for example IPTG, cumate or N- acylhomoserine lactone may be added to a growth medium, at a concentration of between 1 microM and 10 mM, such as between 10 microM and 1 mM, including 50 microM, 100 microM, 150 microM, or 500 microM. Methods for optionally analyzing a microorganism having a genome alteration are known in the art and include, for example, sequencing, including whole genome sequencing, and amplification and sequencing of a nucleic acid product encompassing the altered region of the target gene, comprising at least a part of the nucleic acid molecule using at least one primer that is specific for the nucleic acid molecule. The term specific, as used herein, refers to a primer or polynucleotide that will hybridize only to its target subsequence, typically in a complex mixture of nucleic acids, but to essentially no other sequences applying stringent conditions as is known to the skilled person. Stringent conditions are sequence-dependent and will be different in different circumstances. An extensive guide to the hybridization of nucleic acids is found in Tijssen (Tijssen, 1993, Hybridization with Nucleic Acid Probes, vol. 2, Laboratory techniques in biochemistry and molecular biology, Volume 24. Elsevier, Amsterdam). Generally, stringent conditions are selected to be about 5-10°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the primers complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 M to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization. 5. EXAMPLESExample 1: Genome editing of Streptomyces strains based on the InducibleCRISPRi targeting on Essential gene (ICE) system Materials and Methods Strains, Media and Growth conditions Escherichia coli was used in this study for all cloning purposes, Streptomyces coelicolor, Streptomyces lividans and Streptomyces roseifaciens (DSM 106196T) were used for genome editing. E. coli strains were cultivated in Luria-Bertani (LB) medium (LB medium (10 g / L Tryptone (Difco), 5 g / L NaCl (VWR), 5 g / L Yeast extract (Oxoid)) at 37 ℃. Soya Flour Mannitol (SFM) medium (20 g / L Soya flour (Do it Organic), 20 g / L Mannitol (BDH), 20 g / L Agar(BD)) was used for sporulation and conjugation. Minimal medium (MM; 0.5 g / L L-asparagine (Duchefa), 0.5 g / L K2HPO4 (Duchefa biochemie), 0.2 g / L MgSO4 (Sigma).7H2O, 0.01 g / L FeSO4.7H2O (Sigma), 10 g / L Glucose (Duchefa biochemie), 10 g / L Agar(BD)) and R5 medium (103 g / L Sucrose (Duchefa biochemie), 0.25 g / L K2SO4 (Duchefa biochemie), 10.12 g / L MgCl2·6H2O (Duchefa biochemie), 10 g / L Glucose (Duchefa biochemie), 0.1 g / L Casamino acids (Difco), 5 g / L yeast extract (Difco), 5.73 g / L TES (ChemCruz), 2 mL / L Trace element solution (40 mg / L ZnCl2 (Sigma), 200 mg / L FeCl3·6H2O (Sigma), 10 mg / L CuCl2·2H2O (Sigma), 10 mg / L MnCl2.4H2O (Sigma), 10 mg / L Na2B4O7.10H2O (Sigma), 10 mg / L (NH4)6Mo7O24.4H2O (Sigma))). 100 mL of the solution was poured into 250 mL Erlenmeyer flasks each containing 2.2 g Bacto agar (Difco) and autoclaved. At time of use, 1 mL 0.5% KH2PO4 (Merck), 0.4 mL 5M CaCl2.2H2O (ROTH), 1.5 mL 20% L-Proline (Sigma), 0.7 mL 1M NaOH (VWR) was added to the flasks, which were used for the studies of antibiotic production in Streptomyces. The medium was supplemented with appropriate antibiotics if necessary (kanamycin at 50 μg / mL, ampicillin at 100 μg / mL, hygromycin at 100 μg / mL, chloramphenicol at μg / mL, apramycin at 100 μg / mL, and nalidixic acid at 20 μg / mL; all from Sigma). Intergeneric transfer of plasmids from E. coli to Streptomyces strains was carried out by triparental conjugation (ET12567 (ATCC) / pUB307 (MacNeil et al., 1992. Gene 111: 61-68) × ET12567 (Neogen) / ICE plasmid × Streptomyces) as previously described (Keiser et al., 2000. “Practical Streptomyces Genetics”, John Innes Foundation). Construct – CUBIC A protospacer target on an essential gene was designed using Geneious Primer software (Biomatters Ltd.). Briefly, the Find CRISPR sites tool in Geneious Prime identifies all potential CRISPR sites within the selected gene, and searches for off-target binding sites in any given genome of interest. Protospacer with high specificity score (>95%) on non-template (NT) strand was chosen (Table 1 and 2). Spacers, as depicted in Table 1, corresponding to the selected protospacers were cloned into ICE plasmid (Constructed based on Addgene plasmid #74088) using modified oligo-linker mediated assembly (OLMA) method (Figure 2).Firstly, two 24 nucleotide (nt) oligonucleotides (final concentration 1 μM) were annealed at 95 ℃ for 5 min and cooled down to 4 ℃ at 0.1 ℃ / s. Secondly, the double-stranded oligonucleotide was diluted to 100 nM for phosphorylation in 10 μL reaction volume containing 3 μL diluted oligonucleotide, 1 μL 10 × T4 DNA ligase buffer and one unit T4 Polynucleotide Kinase (New England BioLabs, M0201L) and incubated at 37 ℃ for 1 hour. Thirdly, set up 10 μL OLMA reaction solution containing 10 fmol ICE plasmid, 1.3 μL phosphorylated oligonucleotide, 1 μL 10 × T4 DNA ligase buffer, 10 units PaqCI, 1 μL PaqCI activator (New England BioLabs, R0745L) and 40 units T4 DNA Ligase (New England BioLabs, R0202L). The OLMA reaction was performed in a thermal cycler for 10 cycles of 5 min at 37 ℃ and 10 min at 16 ℃, then 15 min at 37 ℃, followed by 50 ℃ for 5 min and 80 ℃ for 5 min to inactivated enzyme. Finally, the assembled reaction was treated with 10 units T5 Exonuclease (New England BioLabs, M0663L) at 37 ℃ for 1 hour to remove incomplete ligation products. Table 1: Spacer sequences used in example 1. Name Organism Strain Gene Accession Sequence - Table 2: Sequence of targeted essential genes by the ICE system. The corresponding sgRNA nucleotide sequences are indicated in bold. Essential gene Sequence DivIVA_SCO atgccgttgacccccgaggacgtgcggaacaagcagttcacgaccgtccgcctccgagaaggctatgacgagg acgaggtcgatgccttcctcgatgaggtcgaagccgaactgacccgactgctccgcgagaacgaggacctgcgc gccaagctggccgcggccacgcgtgcggccgcgcagaaccagcagaacatgcgcaagcctccggaacctccgc aggatcagcagcaccagcagggtccgccgcagcaccagcagggcccgccgcagcagggcggtatgccgcagc agggcatgcgaggtcccggcgctccggtgcccgccggcatatcgggcccgccgcagcagcagatgggtggcccc atgggtggtccgccccagctgccgagcggtgccccgcagctgcccgccggccccggcggacagggtggcccgca gggtcccggcccgatgggccagggtcccgggccgatgggtcagggtccgggtccgatgcagggccagatgggtc ccggcccgatgggcggccccatgggcggcccgcagggccccggtggccctggtggtcccggcatgcccggtcag ggcggccccggcggcgacagtgccgcccgcgtgctctcgctggctcagcagaccgccgaccaggcgatcgccga ggcccgttccgaggccaacaagatcgtcggcgaggctcgttcgcgtgccgagggtctggagcgggacgcccgtg ccaaggcggacgccctggagcgggacgcgcaggagaagcaccgtgtcgcgatgggctccctggagtccgcccg cgccacgctggagcgcaaggtcgaggacctgcgcggcttcgagcgcgagtaccggacgcggctgaagtcgtac ctggagtcgcagctgcgccagttggagacccaggccgacgactcgctcgccccgccgcgcacgcccgcgaccgcc tctctgccgccgtccccggcgccctcgatggcaccggccggcgcgagcgctccgtcctacggcggcaaccagtcga tgggcggcggcccgggccagtccggtccgtcctacggcggccagcagcagatgtcgcccgcgatgacccagccg atggcaccggtgcggccgcagggcccgtcgccgatggggcaggcgccttcgccgatgcgcgggttcctgatcgac gaggacgacaactga DivIVA_SLI atgccgttgacccccgaggacgtgcggaacaagcagttcacgaccgtccgcctccgagaaggctatgacgagg acgaggtcgatgccttcctcgatgaggtcgaagccgaactgacccgactgctccgcgagaacgaggacctgcgc gccaagctggccgcggccacgcgtgcggccgcgcagaaccagcagaacatgcgcaagcctccggaacctccgc aggatcagcagcaccagcagggtccgccgcagcaccagcagggcccgccgcagcagggcggtatgccgcagc agggcatgcgaggtcccggcgctccggtgcccgccggcatatcgggcccgccgcagcagcagatgggtggcccc atgggtggtccgccccagctgccgagcggtgccccgcagctgcccgccggccccggcggacagggtggcccgca gggtcccggcccgatgggccagggtcccgggccgatgggtcagggtccgggtccgatgcagggccagatgggtc ccggcccgatgggtggccccatgggcggcccgcagggccccggtggccccggtggtcccggcatgcccggtcag ggcggccccggcggcgacagtgccgcccgcgtgctctcgctggctcagcagaccgccgaccaggcgatcgccga ggcccgttccgaggccaacaagatcgtcggcgaggctcgttcgcgtgccgagggtctggagcgggacgcccgtg ccaaggcggacgccctggagcgggacgcgcaggagaagcaccgtgtcgcgatgggctccctggagtccgcccg cgccacgctggagcgcaaggtcgaggacctgcgcggcttcgagcgcgagtaccggacgcgactgaagtcgtac ctggagtcgcagctgcgccagttggagacccaggccgacgactcgctcgccccgccgcgcacgcccgcgaccgcc tctctgccgccgtccccggcgccctcgatggcaccggccggcgctagcgctccgtcctacggcggcaaccagtcga tgggtggcggcccgggccagtccggtccgtcctacggcggccagcagcagatgtcgcccgcgatgacccagccg atggcaccggtgcggccgcagggcccgtcgccgatggggcaggcgccttcgccgatgcgcgggttcctgatcgac gaggacgacaactga DivIVA_SRO atgccgttgacccccgaggacgtgcggaacaagcagttcacgaccgtccgtctccgagaaggctatgacgaggacg aggtcgatgccttcctggacgaggtcgaggccgaactgacccgtctgctccgcgagaacgaggatctgcgcgccaag ctggccgccgccacgcgtgccgccgcgcagaaccagcagcagggcatgcgcaagcccgagccgcaggaccagcga cccggcggggctccggtgcccgccgccatatccggaccgcagccggtgccgcagcagcagcagatgggcggcccgcc gcagctgccgggcggtgccccgcagcttccggccggccccagcggtcacggccacggtccccagggtccgcacggtcc cggcccgatgggtcagaacggtcccggccccatgggtcagaacggtccgatgggcggccccatgggcggtcccatgg gtcagaacggtccgatgggtcagaacggaatggggcagaacggtcccatggggcagaaccccatgggtcagaacg gccccatgggcggcccgcagctgccgcagccgggccagggcccgggcggtgacagcgccgcccgtgtgctctcgctc gctcagcagaccgccgaccaggcgatcgcggaggcccgttccgaggccaacaagatcgtcggcgaggcgcgcagcc gggccgagggcctggagcgggacgcccgcgccaaggccgacgccctggagcgggacgcgcaggagaagcaccgc gtcgcgatgggctccctggagtccgcccgcgccacgctggagcgcaaggtcgaggacctgcgcggcttcgagcgcga gtaccgcacccgtctgaagtcctacctggagagccagctgcgtcagctggagaaccaggcggacgactcgctggccc cgccccgtaaccccaacaccccgtcgctgcccgcggccccctcgatgagcgggtcgatggctccggcaggtgcgggca tgggcggccacagcatgggcggcaacccgtccatgggtggcaacacctcgatgggcggcaactcctccatgggtgcc ccgtcctacggtggccagcagcagatgtccccggcgatgacccagccgatggcaccggtgcggccgcagggccagc agccgatgcagcaggcgccgtcccccatgcggggcttcctcatcgacgaggacgacaactga Construct – homology arms PCR was employed to amplify the approximately 1 kb homologous arms of upstream and downstream of the target region (Table 3), using primers containing 20 bp overlapping sequences (Table 4). In case of knock-in, such as the insertion of the SP30 promoter sequence (Table 5), the insertion was amplified with primers containing approximately 20 bp overhang of upstream and downstream homologous arms. The PCR products were then purified and assembled into BamHI-linearized ICE plasmids using NEBuilder®HiFi DNA Assembly Master Mix (New England BioLabs, E2621L) (Figure 3, Table 6). The assembled plasmids were transformed into E. coli DH5α strain (NEB) and further confirmed by Sanger sequencing. Table 3: Sequences of the constructed homology arms. Plasmid Sequence of homology arm Length (bp) Left: agcggtacctcgacgatcgccgtggcaccgccgtaccgctggggcgcgcaccaggtggacaggccgatgtcctcggacccggccgccggccgcgcggtgctgcc cggcggcggcaggacatggatgccgggggccggattctcccagtacagggcgtcgtacgtgccgtgctggaccgggacccccagggcggcggcggacgccgc gaagggggcggcgagtccggggaggtcgcgggtcagctgggcccaggtgccgcccgcgtcgacgttgtgcagggagcactggaggacggggcgcaggtcgt cgatcacgtcgaacagggcacggctctccgggagtggccggccgacgatcggggcccactccggctgctccgcggcgaccgggcggaaggcggcacggtagt acgacgccagggacggggcggggccggccgtcgcggtctcgatgccctcgctcagcgcggcgccgtccgggtcgaggcacaggacgatgtcccaggtgacgg cctcggggtcggtcgccggggagcgccggtcgccgcctgcgaccagctccgccagcgccagtgccgtcgcgccgcccaccggctcgtccgggtgcggccgggcc 1035 accaccaggacgtgccggggtccgtggcccaccgacagcatcaggagcggccggcccgcccgggacgtgccgacacgacacaggcggccggtgcccgggaa acgggagaccagccgtcgcgccgactcggtgacctccgcgaccgtggggtatcggttcatcgggcgtgtccggtcaggctccgccgttgccgctctcgtccgccat gccgtctccttccgacggtgcccgtgggtacccgtgggtacctgtgctgcttttcgcgcctgtgctgcctgtggtgtgcgaggcgcgtcgtgccgctgtcagcgtcc pICE- gttcaccggatcaccgctgtcaatggccggtgccgcccgcgcagtcgggggcggcgaagccggcgcgaaggcgagggtgcgcgtcaggccgggaagacgtgg SCO_Del_ tcat Act Right: gcatgccggctgaggccggccgggaaggccgtcagcggcccgtggcaccgtcgatcagctcgcggaggatgtcggcgtggccggcgtggcggccggtctcctc caccatgtgggtgagggcccagcggacactgggcgcggggcggcccggtcgcggccgggggagcggtgcgccgaggtcggtgcaggcgtcgagcacgcggt tcgcccgttcgacggcctcccggtagcgggcgacgacgtcggcgacgccgtcctgggacgcggcccggaacgtcgccggccagcttcgcacctcctccccgagg aagaccgcgcgctcgacgtgggtcaggtggttgagcagcccgagcaggttggtgccggacgccaccgccgccgtgcggacctgcggttcgggggcgtcctcga ccttgccggcgatcgaggtccgcaggtagtcgaggaacccgcgcagggtctcggcctcaccgccgccggttcggggcggcggggtgtcccggcggtgggtgcg 1027 gggggtggtgggcatggtgaccggcctccggaaggtgtggggcgggcgggccgcgggcgcggggcccgtcagtccgcgcggcggacgagcaggacgtggtc gacgacctcggcggtgcgcccgcccgggccggtcgcggtccggcgtggcgcctcggcccgttcgacccgccacgtcgccgggtccagggcgaggtccgccgcga cctcctgcggggccgggtggcgcgcgtcggggtcctggtcccacgaccacggcgccgtcgagccgtggtcgacgaccagcagccgcccgcccgggcgcagcgcg tgcgcggccccgcgcaggaccgacgcgcggtccaggtcgaagggcgtgtggaggtagtgcgcgctgaccaggtcgaaccggccctcggggaaggagtcgcgc aggtcgtgccgcacggcgtcgaccaggtcgccgaggccgtgggtccgtgcgtgccccgcgagccgctcggccgcgaccccggagatgtccacggccgtgacc

[0002] Left: gcgatgaccacgttgcagcgctggagcgccgcctcgtccagggacgtgatctcgcaggcgtcggcgagcagccactccgccatcgggacgcgttcgaccgaga tggcggtcggcgccttgtcgatgagcaggacctcgtggccgttctccagcagctcgcccgcgatcgaacggccgaccgcgccggctccggcaatggcgaccctc atcagtgaccgccctcctcttcgggacccttggcgaacgccgcctcgaccttgtggacctcgtcggtgcgcatcatgacgtgcacgaggtcaccctcctgaaggac ggtctgcgaggacggcaggatcgcctccccgagccgggtgacgaaggccacccgcacgcccgtctcctcctggagccggctgatcttgtggcccacccaggacg aggacgtgtgcacctcggccagctggacgcctccggtggggtcgcgccacagcggctcggcacccgaggggagcagcctgcgcagcatctggtcggccgtcca gcggacggtggccacggtggggatgcccaggcgctggtagacctcggcgcggcgcgggtcgtagatgcgggcggcgacgttctccacaccgaacatctcgcgg 1040 gccacgcgggcggcgatgatgttggagttgtcgccgctggagacggcggcgaaggcgccggcctcctcgatgcccgcctcgcgcagggtgtcctggtcgaagcc gatgccggtgacgcggcggccgccgaaggaggaaccgaggcgacggaaggaggtggggtcccggtcgatcacggcgaccgtgtgcccctgctgctccaggg cctgggcgagcgcggagcccacgcgcccgcagcccatgatgacaatgtgcacggcttacaccactcttcttctctgccctctgaccgcggtgaacatcccgttcat cttcctctttcggctcgacgggcaaacatctgcggcccccaccgagggccgcagccaccatcatgccggtccaccgccgtcgcaccccggtggggtgcttcgtttg pICE- c SCO_Del_ Red Right: ccctccacagaccccctccagagatccacagatcccctccacagatccgagacgaggcacgtatgaccggagacattcccttcggagaggccgaggcgtccctg accgccgaggtgctgcgcgaggtcctggccggcggcgccgaggcgttcgcccggctgacctccgacgagggcgccgtcgacgacttcggcttcgacccggagct gaccgacgactacctgctccccgccctgcgcctgctgtacgagaagtacttccgggtcgacctggagggactggagaacgtgccggccgaggggggcgcactc ctggtcgccaaccactccggcaccctgccgctcgacgccctgatgctccaggtggcgctgcacgaccatcacagcacgcaccgcaggctccggctgctcgccgcc gaccttgccttcgacctccccgtcgtccgtgacctcgcccgcaaggccggccacgtacgcgcctgccccgagaacgcgctgcggttgctcggctccggcgaactgg tcggcgtgatgccggagggctacaaggggctcggcaagcccttcgaggagcgctaccggctgcagcgcttcggccggggaggcttcgcggcggtggcactgcg 1096 gtcgcggcgccccatggtgccgtgctcgatcgtcggcgccgaggagatctacccgatgatcggctcggcccccaccctggcccggatgctgaagctgccgtactt cccgatcaccccgaccttcccgctgctgggcgcgctgggcctgatcccgatgccgaccaagtggaccatccgcttcggtgccccgatccacacggacggcttcccc gaggacgccgcggaggacccgctggtggtcgagaagctcgccggcgaggtgaaggacaccatccagcacacgctcaacgagatgctggagggccgcggctc cccgttcgtctgagggccgcggctcccggttcgcccgagggcggcggctcccggttcgcccgaggaccgtccctctcgtccggggccccgcctcagccccccgccg

[0003] Left: gctccggtgaacccatggtcgtcatcgccaagggcgcctcggcggaccaggtgcacgcagctctggagaccgtgcccggcgtcatcgaggtcgcaccaccaca ggtgaaggacggcctcgcctatgtcgaggcgacgctcggcgccggggcggactcgccggcggccatgcgttcggtcaccgcggcccgcgagacactcgcccgg ctggacggtgcgcaggcacgggtgggcggcagcagcgccgtcgtgcacgacatgcgggaggcgtccagccgcgaccgcggtctgatcattccggtgatcctcg ccgtggtgttctgcatcctcgcgctgctgctgcgagcactggtggcgccgctgctgctgatcgcgagcgtggtgctgtccttcttcaccgcgctcggcctcgccgccc tcttcttcaaccacgtcttcgacttcgcgggagccgattcggccttccccctgtgggtcttcgtcttcctggtcgccctgggcgtcgactacaacatcttcctcgtcac 1030 ccggatcaaggaggagagcgaccggctcggcacccggcagggcgcgctcaagggcctcacctcgaccggtggcgtgatcaccgcggccgggctggtgctggc cgggaccttcgccgcgctggccacgctgccgctggtcttcatcgccgagctcggattcacggtcgcggtgggcgtcctgctcgacaccatgatcgtgcgatcggtc ctggtcaccgcgctcactctcgatgtcggccggtggatgtggtggccgcacccgctcgcccggcgcgaggacccttccgaggacccagccgtatcaggaatgcca gattctattgattcggaagcctcgaccactgcctctcggtaaaatccagcaaaaattaatcagtgcagctcgctgcactgattaatttttgatcaataggagatc pICE- gcttgtgacggcaagcacattgaaatctgttgagtaggcctgttattgtcgcccccaggagacggagaatctcgacgggggcgcag SCO_Ins_ Act Right: atgagattcaacttattgggacgtgtccatgtaatcaccgatgcgggatgtgtaattccgcttaaatcctcgaaggcgacccagctcctggtgctgctgctcctca ggcggcacgaggtggtgggatcgggggtgctcatcgaggagttgtgggcggaccacccgccccgcagcgccatgacgacgctgcagacgtacgtgtaccaca cccgccggctgctgggggagcaccgggtgacgagcgacgaccgggaattggtcctgacccagccgcccggctacttcgccctgatcgacgaggacgaactcga cgtcgcggtcgccgagcgtctgatccgcaccggcggccggctgctcgaggagaaccggctcgaggaggcgctcgcctcgttggacgcgggactggatctctggc gaggcccggcgctgtccaccgtaccgtgcggccgggtgctcgaaagcaatatcgcgcacctggaagagctgcggctttttggaatgcagctccgtatcgacgcg aattggcggctgggcagaatagggccgatgattccggaactccggtccctggtaatttcgcatccgctgaacgagaccctgcacgccaaactgatgggcgcgct 1065 ctgtcagatgggcaggcgcgccgaggcgctggaatcgtatcggaatctccggcggatactgtccgacgaactgggggtggatccgacgccggaaatccagcg tatgcacatggaaattctcaacggtgagaaggtgctcgtgtagcaccggtccgtgaacgcggtggagcccctcgcagcctgcgaggggctccaccgcgttcacg gaccggccggcgtcagtagttccccagcccgccgcagacgttcagcgcctgcgcggtgaccgcggccgcaccgggcccgatcaggtacgccaccatctccgcca cctcggacggctgcacgtaccggccgatcggcacgcgcgcggtgatccggtcgaaggcctcctcggtcgacacctcccagatgtccgagtagtgctcgcgcacg gacgcggccatcggcgtctcgacgaatc Left: gcggaccaggtgcacgcagctctggagaccgtgcccggcgtcatcgaggtcgcaccaccacaggtgaaggacggcctcgcctatgtcgaggcgacgctcggcg pICE- ccggggcggactcgccggcggccatgcgttcggtcaccgcggcccgcgagacactcgcccggctggacggtgcgcaggcacgggtgggcggcagcagcgccgt SCO_PM_ cgtgcacgacatgcgggaggcgtccagccgcgaccgcggtctgatcattccggtgatcctcgccgtggtgttctgcatcctcgcgctgctgctgcgagcactggtg 1004 Act gcgccgctgctgctgatcgcgagcgtggtgctgtccttcttcaccgcgctcggcctcgccgccctcttcttcaaccacgtcttcgacttcgcgggagccgattcggcc ttccccctgtgggtcttcgtcttcctggtcgccctgggcgtcgactacaacatcttcctcgtcacccggatcaaggaggagagcgaccggctcggcacccggcagg gcgcgctcaagggcctcacctcgaccggtggcgtgatcaccgcggccgggctggtgctggccgggaccttcgccgcgctggccacgctgccgctggtcttcatcg

[0004] ccgagctcggattcacggtcgcggtgggcgtcctgctcgacaccatgatcgtgcgatcggtcctggtcaccgcgctcactctcgatgtcggccggtggatgtggtg gccgcacccgctcgcccggcgcgaggacccttccgaggacccagccgtatcaggaatgccagattctattgattcggaagcctcgaccactgcctctcggtaaa atccagcaaaaattaatcagtgcagctcgctgcactgattaatttttgatcaataggagatcgcttgtgacggcaagcacattgaaatctgttgagtaggcctg ttattgtcgcccccaggagacggagaatctcgacgggggcgcagatgagattcaactta Right: ggacgtgtccatgtaatcaccgatgcgggatgtgtaattccgcttaaatcctcgaaggcgacccagctcctggtgctgctgctcctcaggcggcacgaggtggtg ggatcgggggtgctcatcgaggagttgtgggcggaccacccgccccgcagcgccatgacgacgctgcagacgtacgtgtaccacacccgccggctgctggggg agcaccgggtgacgagcgacgaccgggaattggtcctgacccagccgcccggctacttcgccctgatcgacgaggacgaactcgacgtcgcggtcgccgagcg tctgatccgcaccggcggccggctgctcgaggagaaccggctcgaggaggcgctcgcctcgttggacgcgggactggatctctggcgaggcccggcgctgtcca ccgtaccgtgcggccgggtgctcgaaagcaatatcgcgcacctggaagagctgcggctttttggaatgcagctccgtatcgacgcgaattggcggctgggcag 1000 aatagggccgatgattccggaactccggtccctggtaatttcgcatccgctgaacgagaccctgcacgccaaactgatgggcgcgctctgtcagatgggcaggc gcgccgaggcgctggaatcgtatcggaatctccggcggatactgtccgacgaactgggggtggatccgacgccggaaatccagcgtatgcacatggaaattct caacggtgagaaggtgctcgtgtagcaccggtccgtgaacgcggtggagcccctcgcagcctgcgaggggctccaccgcgttcacggaccggccggcgtcagt agttccccagcccgccgcagacgttcagcgcctgcgcggtgaccgcggccgcaccgggcccgatcaggtacgccaccatctccgccacctcggacggctgcacgt accggccgatcggcacgcgcgcggtgatccggtcgaaggcctcctcggtcgacacctcccagatgtc Left: gatccccatgagccgggtggcgtggtgggcggcgtcgggggtgtgctcggccgcgagggacaccgcgttggcgagggagagcagttcgagggcggtcacgtc gtcgcggacggttccgtcttcctgggcgcgggccagcaggtcggcgccggcctccgtcagcagttgctcacagcgcgaatccagcgcggcccccgcgttcgtgcc ggtcgccggcaacagggaacgggcggcgccgcgcgtgacggcaccgaagaccgccagggacgtcagccatcgcgtcagagcggtcgccggcgggtgttcgg ccgccagggaccgggcctcgtcgcacagctgtgccacgcgctcctggaagacggcctggagcaggccccaccgggaggggaagtggcggtgcagggtggccg agccgacgccggcccgccgtgcgatctcctccagggaggcgtcggcaccgtgccgggcgacctcggccgcggcggcctcgatgatccggtcgtagttgcggcgt pICE- gcgtccgcgcgcttgggcgggcccgggttctcccagctcacactcgtggtctccttcctcgccgacgaaacggggtgacaccccattcttgcaccgccgccgggct SLI_Del_ gcgtcgtttgacaggaagtggggggtggccccatattcgaaaaagcggaggggcaccccgtttctgccgcacgacacaggagacgaaggcatgcgcgccgta 1710 Act cagttcgaccgttttggcccgcccgacgttctgcgcgtcaacgacgtccccgcgccccggcccgggccgggagaagtcctcgtcgaggtgcacgccgcgagcgtg gacgccggtgagaccgccttccgggcgggcaggatgcgccgggtgacccgcgtccgcttcccccgcggcctgggcagcgacttcgccggccgggtcgcggccct cggcagcggcgtacgcgcctggagcgtgggggacgcggtgtgggggctgatgccgcacctcaccttcggggcgatcgccgactacgtcgccgtgcccgagcag cggctggcccgggctccgaagaacctggacctgctcgaagccgccgccctgccagtggtgggcaccaccgcgatgacggccctgagcggcaaggcgcgactcc agcccggggaacggctcctggtccgcggcgccaccggcggcgtcggcagcgtcgccgtgcagctgggcaaggcgctgggcgcgcacgtcaccgccctcgccgc cgcccgcaacctcgactggatcacccggctgggggcggacgaggccgtggactaccgcacgacccggcccgaagacctcgaccggttcgacgtgatcgtggac gtcgtcggcaccgacctgggtgcctatcggaagcggctggcccgcggcggacgtctggtcgccctctccttcgactcggaccgcgtcgtctcctccatgctcggca

[0005] tcgccctgcgggcggccgccactccccggcgcgtcaagatgttcagcaacaacccctcggccgaccggatcgccgaactcacccgggccgtcgaggcgggcacg atccggccggtggtcgacaccgtcttccccatgcgggacatagcggcggtccaccagcggctcgaagccggcggcgtccgcggcaagtacgtcgtcgacctgcg gcttccctagctcacggtcggccgatccccaggttcggcgcggcagcgcgtca Right: tcagcggcccgtggcaccgtcgatcagctcgcggaggatgtcggcatggccggcgtggcggccggtctcctccaccatgtgggtgagggcccagcggacactg ggcgcggggcggcccggtcgcggccgggggagcggtgcgccgaggtcggtgcaggcgtcgagcacgcggttcgcccgttcgacggcctcccggtagcgggcg acgacgtcggcgacgccgtcctggggggcggcccggaacgtcgccggccagcttcgcacctcctccccgaggaagaccgcgcgctcgacgtgggtcaggtggtt gagcagcccgagcaggttggtgccggacgccaccgccgccgtacggacctgcggttcgggggcgtcctcgaccttgccggcgatcgaggtccgcaggtagtcg aggaacccgcgcagggtctcggcctcaccgccgccggttcggggcggcggggtgtcccggcggtgggtgcggggagtggtgggcatggtgaccggcctccgga aggtgtggggcgggcgggccgcgggcgcggggcccgtcagtccgcgcggcggacgagcaggacgtggtcgacgacctcggcggtgcgcccgcccgggccggt cgcggtccggcgtggcgcctcggcccgttcgacccgccacgtcgccgggtccagggcgaggtccgccgcgacctcctgcggggccgggtggcgcgcgtcggggt cctggtcccacgaccacggcgccgtcgagccgtggtcgacgaccagcagccgcccgcccgggcgcagcgcgtgcgcggccccgcgcaggaccgacgcgcggtc 1518 caggtcgaagggcgtgtggaggtagtgcgcgctgaccaggtcgaaccggccctcggggaaggagccgcgcaggtcgtgccgcacggcgtcgaccaggtcgcc gaggccgtgggtccgtgcgtgccccgcgagccgctcggccgcgacccccggagatgtccacggccgtgacccgccagccccgccgggcgagccacagcgcgtcg ccgccgctgccgcaccccaggtccagggcgtcgccgggcggcaggccggtgaccgtctcgaccaggcggacgttcgggcggggcgcgtcgggcgccgggcggg cggcgtacacgccgtcccagaacgtgaccgcgtcggtggtgctcatcggaactccttcagtcgtttcggccggcggcgggcgacgagtcgggcaacgcgccgcg agccgtcgatgcgaccagtctcgacaccctccgcccgaaccggcacgaaaacttgcggttgtggcaaggtggcccgatggacgccgcaacggacgacgtgctc gacgccgtgggcccacgcctgcgcacgctgcgccgcgagcgcggcatcaccctcgcccacctctcggcggcgaccggggtgtcggagagcaccctgtcccggct ggagagcgggcagcgccgcgcgaccctggagctgctgctgccgctcgcccggatctacgacgtccccctggacg

[0006] Left: ctcaacgaggccggcaagctgggcgatgcccgctggccgatggtcgccgggctgacggccgtctccgccgtcgccttcgccctgttctggcgcaccgaggaccgc agcggccacccgctggtcgccacccggcacctcaagcagcgcgggacctgggccaccctgctgaccaccacgctcaccatgaccggcgtcttcgccgtcatgaac ggcctcatcccctccctcgcccaggacgccgaggcgggcctggggatgtccgccgaggcctccgcgtggtggacgctcaccccgtacgccctcgcgggcctcgcc atggggccggtcgccggccggctcgcggccaccttcggctacgggcgcgtcctgcgcctgggtctcgtggggtcggcggcgtccgtcgtcctgatgatcctcacca tcccggcgcactcgcgcgtcctgctgctggtggcctcgctgctggtcggcatcacctacgcgggtgtggcgaacatcgtgctcaacggcctgggcatcgtgctgtc gcccaaggagaacccgggcttcctgcccggtctcaacgcgggcgcgttcaacctcggcgcgggcctgagcttcgccctgctgtacgcggtgaagaccgccgtgc agccggccgacccggcctcgtccaccggctacaccgccggcatgatcgcgggtgtcgtgatcatggtcgccgccctcgcgacgtccttcctcatcccgaagccggc cacggcggaggcgcacggctgacgccggtcgagccacagcagcagaaccccggctcctgagccggggttctgctgcatttccgtgcggtaccggacaggcccg pICE- gcctcgcaccggttcagcgcgcggggctcgccggtgccgcccccgtcctcgccgtccggcggccgttcgcagatgccggcttcgctgcaggcgccggctgtgccgc SRO_Del_ ggactcctgcgtggccgccgtcccgggcttctcgcccgccgcaggcgccgtggcctcctggatcagccgcgagcggatcgccaagtacttggcgttcagttcgtcg 2057 Red acggggatgaacttgctgacgccgccctcgctgatcttcggctcctgccgctccatgatgcggacgtcctggacgtcctggatccacttctccatgtagagggagg cccacggcaggatgcgccgcagcttctccgctcggaggagcggcttgaacgccgggtactcgtaccagcgcaggatgtgctcggtgtgcccgtcgtcgacgggg accagccacgacgtcgcctcgaactgctcggtctggacgtggacctggcaggggaaggtgaacgtgatgacgtagtgcgtgctgttcttcgggtccgcctcctcc tggtggtcgaaggagtagcgcagcgtctggccctcggtctccagcttgtggttgacgatcttcgtcgccgcgaggtagcgctccttgccgtccaggcccagcttgc gcgccgtcccgtagaggaacaggtagtcgatgtagttgaaccagtgatcacggtggacgtacgtgacgtggtagaactcgagcaggctttcgatgtagcgggt gtagtggaccgggcgggtccagtgcgtcgtcgagtgggccttggggttgtccgcgacgaccggcgcgatctggatgtccggcaggccggcctcggcccgctcct cgccccaccacagccacaccagcccgtgtgcttcccgcaccgggtgcgtgggcacccgcagcgagcggggtatgcgggcccccgagcccatcgcgggaacggc cttgcacgcgccgtcggggccgtagcggaagccgtggtaggggcactcgacggtgttgcccttcatccggccgtcggcgaggttcgcgcccttgtgcgggcagc gcgcgccctggcagaccaggttgccgtcgaggtcgcgccacagcaccagttcctcgcccatgcggcggacgccggtgggcttgccgttgcctacgtccttcgcctc gagtatcggataccactggttggggatcatcttcgttctctcctcgggcagttgctcctgacgg

[0007] Right: tcaggaagagtacgcaccgcccccggcgggcgggacccccggcacggagcccggcgtcaccagccccgcctcgtacgcggcgatgaccagctggacccggtcg cgggcgcacaacttgccaatgatcctgctgacatgggtcttggcggtgagcgggctgagcccgagcacatcacccacctcggcgttgttcaggcccctggccacc agggtcagcacctggcgctcgcggaccgagagcaccgccaggccgttggtcacgaaggaggccgggatgtccgccctcggcgcccgcagcacccgggcgatc aggcgcgaggtcgggccgggcgacagcagtgcctccccggcggcgatggtccggatcgcctccagcagggccgccgggcgcgtgtccttcaccaggaagcccg aggcgccggcgcgcaacgcgtcgatgacgtactcgtcggtgtcgtacgtcgtcaggacgagcaccttcacgccggccatgtcctcgtcggccgcgatccgctggg tcgcctcgatgccgtccaggtccggcatccggatgtccatcaccaccaggtccgcgcgggagctgcgggccagctcgacggcctgccggcccgtgcccgcctcgc ccacgacctccatgtcgggggcggtgtccaccagcatcgcgaacgcggagcggacgagccgctggtcgtcggcgagcaggacccggatcggctgctgcgcgtt catcggccgcccctccccccgggggagggcggtgctgccggagtcggtgctgatgtcatcggagtcatccttcggggtggggacccgcaccgcgccccgcggcg cgggtcgttcactgatgcgggcacggcacgtacgggcgcacgcgctcgccggcgtctcacggcgcgctcaccggagggcggtcccgtccgcgggggccgacgg caggaccgcggtgaccgcgaacccggcgccaccggcgcggggcccggcctgcagccccccgccgacgctgcgggcccgctcgcgcatcccgacgatgccgtaa ccgccggtgccgttcggctcgttccccggcacggggtcgcgcgcaggcgctcccgaaccgccgtcgtcgagcacggtgacccgcagggcgccgtcgtccccgccg 2134 cgcgccaccgtcacccagacgcggaccgagggaccgccgtggcggaccgcgttggtgagcgcttcctgcacgatacggtacgcagcggccccgactgccgggg ccaggacggccgttgccgcgggatcggctgcgggatcggctgcgagatcgactgcggggtcggccgcggtgccggggcccgccccgttgctccccgccgtcccg ccctgcgcttcctgccccatgtgcacctgcaggctcacccgtgccccggcagcctccgccgcccgcgccaggtcgggcagcccgtcgaggcccggcaggggcccgt agcccgcggaatcgttcccgcggagcacctccagggtcgcgcgcagctccgcccgggcgtcccggcaggtgtcggcgatcccgtccagcgccttggcgagcgcc gcccggtcgagccgctcggggtcggcgaccaggacgtgggccgcgaccgccgtctgcaccccgatcagggtgatgctgtgggccagcaggtcgtggaggtcgc gcgcgatgtgcacccgctcctccgcgaccctgcgcgccgcctcgcgctcgcgcgtcgcctcggcgcgctccgcgcgctccatgatggccccgacgtaattgcggtg caggcgcaccgcctcgccgatcaggacgacgtcggcgatccagccggcgctcaccagcgtcggcacgatctcgtgccccttgccgaacgccagcaggacgacc gtggccacgccgaagatgccgccgagggtgaggaagctgcgcttgggcggtccgaccacggcgagcgtgcacagggccaccaggcccgccggcagcgccgcc gtgcgggggtaacccagcgcgtagaaagggccgttcatgcaggcgacggccagcaccgtgagccacggcgcctggcgccgcgccgtcaggacgagcgcggc gccggtgaggagcacccatcccgggaggtccggcgaccgccgcgtggtgaccacgaagagc

[0008] Left: tcctggtcggcgaggaccgcgaccaggcgcaggtccggcaccgtccacaggcgggcggtgtagtcgctggaggaggtcaccaggtggcgtccgtccggcgag aacgagcactggttggccaggtggtcgtggaaggagcgggcgatggccgttccggtccgctggtcccagcagatgacctggttgtcgtagccggcggtggcga cgtaggcgtcctgccaggccgcgatgccgctgatgggtccccggtgctggatcacgctgttccttccacgagttcgatcgagtggccgccgtactcggccttggcg cgcaggtagtggtcgttgttctcgttacggaagattccggtacggacctgttcgacgacctcgatcccgtacgaggcgagctgctcggccttgtcggggttgttgg tgtgcagcctgatccgcgtcaccccgagagcctgcagcatctgggcggccgagcggtagtcccgcaggtcgtccgagaagttcagctcgcggttggcggcgaac gtgtccaggccctggtcctgcaggcggtaggcgtcgagcttgttgtacagcccgatgccccggccctcctggcgcaggtagagcaggacgccgccggaggcggc gagcagctgcatcgactcggtcagctgagggccgcagtcgcaccgcgcggagccgaagacgtcgccggtcaggcactcggagtgcagccggaccagcgggac gtccgcgatcggtccgaactgcaccgccacgtgctccagcccgtcgccgagcccggtgaacgtcaccatctggccgggcgtccaggccccgtcggcccgctgcac pICE- ggggatctcgacgcgagctctgacgcccacggacccctccggcggttccaccgacgccccgtgcaacggggtgtcctccccattgagtgttttgggcactgcttcc SRO_Del_ tcccgtagaacgagcacgccccgaaccccagggcgcagtcacagcatgggtgtggagggcagcgcggacagcacggtccgtaccggtacgggtaccgagatc atttgaca 2115 Icm gcggtaccgaaccatccggtctgttcgtttggaagcccgaagcttttggcccgtcagttctgccgtgcgatccggacgcttcgggatcttcggtcagg gcccctgtgatcggaaaccgctcgtccggttctgtctctggcgtcccgcagccggatcctcggacggccgctgacgaccaggaacatctcatcggtgtcggcgtg gtggtgccagacgaactcgccggacagcctggccggttcgatcctcctggagcctaggggaggttccggtgccggacctccatttgtgatcaccaatccggcga gcccggtcggtgccggcgccgtgggattcgccctcgagcggcgccagcacggcacgactggtaccggtgcggtcgccctgctgccgcccggccgttgcaccggg ccaccggccggctgagccgccccccggcgtcaccccttcgggctaatctcccggccgccgggaaccgccgccgggcaccgcggtggtactccgcgcaccggtact gcgacctgcgcaaccaccccccgccgagccccccgcgctgctaccgtcgcgcggcatggagcagctcttcagcgacgacgaactcgccctcatcacggcggccgc gcaggagtcggggatggacccgcgcgactgggtccgcgccgtggtcctgcaactcctcaccgacgacgagtacatggaggaggaaccgaccgcctccggcgg ccaccacgcgggggacggccgcccgccgtaccgggccgacatggagcacgccgtgtggccggtcaccacccaccgggggtccggccggaacatgcacgagct gcatcacgccggatgctgggtaccgaaggggggcgagaggaccatgtccaccgcgcaggcccgcgaagagctcctcacgcgcaacgcccacccctgcgaggc ctgccagccggaacggttccttaccccgctggtctagccgtccgccgcaagcgctgccgacccgcacggcggcccgtgcgcggccccgccgggcaccgcgcacgg gccgcctgtgcggtccgtcctcccgccggccgcta

[0009] Right: gccgacgagggctactgattcttgaatacgcatgcgtctcaattccgttcgtccgggcgagtgcggatgcatgacggagcggcggaagtcgggggccgggatg ctttcgcagaaggccgggcacgggtgggtgcgggcgttcgcggagctgccgacgctccgcagggaaatgctcgttgacgagttcccggtgacttcctgacgag atccgctgtccttgtgcaacgttcacacagcatgcgtggttggtccacacaacgccgtggaagttgtcaacttggtaaggggcgcacgctcttcgcggtcgccgg gcagggccgcgagctggccaggaggcggctgttacctgcggtcacctggtgaggtgctccggccaatctcgttccggcccgtttcccgggcccgtactcggggcg gtgctgttcgcggtggcgaacggtgcccggatgtgagctgcaacaccgctgaatcgctgctgtttccagccatccgaacgcgttcgcgggcgaccgattttgcag tacgttcggccgtgttccatcattgtgaccgcgcgtcaggcggaccgccggcgcttcacgagtgcgtggtgcacgcgttctcgttgaacagtcaaccggagggcg gcgagcgcactggccccgcccggccggaacccccatccctcattccctgagctaggcaaaggcagcatgcccgtccatcagctatcggacctcatacgttatgtc cgtcacaactccccgttctatgcggacctctacgcggaccttccgccggatgtggactgcctcaccgatctgccggtggtggaccagagcgctttctgggccgcga ataccctgcacggcaatcgcgtcctgaccgccccgctcgacgaggcctcggtcttcaagaccggcggcacgaccggcgcacccaaattctcctgctacacccgcg aggaatggcgggagttcgtgaccgccttcggccacggcctcgtcgacgccgggctgcgccccggccaccgggtcgcggacctcttctacgcgggcgagctctac gccagcttcctcttcatcctcgactccctctcccacgcccccgtgggcagcgtgcgcctgcccatcggcggcggcgccccgctggagacgaccgtccccacgctgcg 2096 cgacttcgccgcccagatcgtggccggcaccccgaccaccctgtgccgcctggccgagcacctgatcgccgccggcgagcagctcccctccgtcgagctgctgttc ttcggcggcgaggccctcttcgacgaccagcgccgcctgctggcccgcgccttccccaacgccgagccccgcacactcggctacgccagcgtcgacgccggcctcc tcggccgccccgtgcccggtgcggcggacgcccgcacacaccgcgccttcaccccgcacaccgtcgtcgagatcctcgacgacgccacggacgagcccatccgcg aggccggccgacccggacgcgtggtcgtcacccagctcttccgccgcctcatgcccgtcatccgctaccccgcgggcgaccgagccgagtggaccgaccccgag gcgggcgtcttccgcatcctcggccgcgccgaggaaggcgtgcgcgtcggccccgtctccctgtactcccaggacgcccagggcgccgtcgccgcggccgacacc gacggccgcgtcgtgggcatgcagctcgtcgtccgccgctgggacggccgcgacggcctcgtcctgcgcctggccgtatctcctgacgaccccggctccgaggac ccggccgggctcgacgtcctcgccaagtccgtcgtggccgagctcgaagaggcccgccccttctaccccgacgccgtcgccaccggcttcgtccacccgctgtccg tcgagtgggtgcgccaccgcgacctcaccgtcaaccagcgctccggcaagctcgtccgcgtcatcgacgaaaggcccacggcatgaccgccgccccgacggccg gcaccggccgccggctgccgctggtcctgcgcaaccgcgccttcggcgccgtgtggctcggccaggtgctcacccaggccgccgtccgcatgttccaggtcg

[0010] Table 4. Primers used in example 1.Primer Sequence (5' to 3') Plasmid Primer01 gccacctcgtcatagccttctcggPrimer02pICE-SCO Primer03pICE-SLI Primer05 gccactcgttctcgcggagcagacPrimer06 aaacgtctgctccgcgagaacgag Primer07 caggtcgactctagctagcgagcggtacctc gacgatcgc Primer08 tccacgtagaatgaccacgtcttcccggccPrimer09 acgtggtcattctacgtggaccgccggttcpICE- Primer10 ggccttattgttgattctggtcacggccgtgg acatctcc Primer11 tcggttcatcgggcgtgtcc pICE-Primer12 ggccctcacccacatggtgg SCO_Del_Act_Check_PrimerPrimer13 caggtcgactctagctagcgcgatgaccacg ttgcagcgc Primer14 ctgtggaggggcaaacgaagcaccccaccgPrimer15 cttcgtttgcccctccacagaccccctccapICE-SCO_Del_Red Primer16 ggccttattgttgattctggcctcgccgttctg gccttcg Primer17 tcgatcacggcgaccgtgtg pICE-Primer18 gcgtgctgtgatggtcgtgc SCO_Del_Red_Check_PrimerPrimer19 caggtcgactctagctagcggctccggtgaa cccatggtc Primer20 ctgcgcccccgtcgagattcPrimer21 gaatctcgacgggggcgcaggtatgttcaca ttcgaaccg cccaataagttgaatctcatg pICE-SCO_Ins_Act Primer22 aaccgatctcc tcgttagg Primer23 atgagattcaacttattgggacggccttattgttgattctgggattcgtcgaga cgccgatg Primer25 gccgctggtcttcatcgccg pICE-Primer26 cgcgacgtcgagttcgtcct SCO_Ins_Act_Check_PrimerPrimer27 caggtcgactctagctagcgcggaccaggtg cacgcag ggacacgtccctataagttgaatctcatctgc pICE-SCO_PM_Act Primer29 caacttatagggacgtgtccatgtaatcacPrimer30 ggccttattgttgattctgggacatctgggag gtgtcgac Primer31 catcgccgagctcggattca pICE-Primer32 gagttcgtcctcgtcgatca SCO_PM_Act_Check_Primercaggtcgactctagctagcggatccccatga pICE-SLI_Del_ActPrimer34 gggccgctgatgacgcgctgccgcgccgaaPrimer35 cagcgcgtcatcagcggcccgtggcaccgtPrimer36 ggccttattgttgattctggcgtccaggggga cgtcgtag Primer37 cctctccttcgactcggacc pICE-Primer38 ctcgactacctgcggacctc SLI_Del_Act_Check_PrimerPrimer39 caggtcgactctagctagcgctcaacgaggc cggcaagct Primer40 ctcttcctgaccgtcaggagcaactgcccgPrimer41 ctcctgacggtcaggaagagtacgcaccgcpICE-SRO_Del_Red Primer42 ggccttattgttgattctgggctcttcgtggtc accacgc Primer43 gtagcgggtgtagtggaccg pICE- ggtgctgaccctggtggcca SRO_Del_Red_Check_PrimerPrimer45 caggtcgactctagctagcgtcctggtcggc gaggaccgc Primer47 ccggccgctagccgacgagggctactgattpICE-SRO_Del_Icm Primer48 ggccttattgttgattctggcgacctggaaca tgcggacg Primer49 gcggcatggagcagctcttc pICE-Primer50 cgacttccgccgctccgtca SRO_Del_Icm_Check_PrimerTable 5: Sequence of synthetic regulatory element (SP30-RBS14) inserted upstream of actII-ORF4. Sequence (5' to 3') SP30- gtatgttcacattcgaaccgtctctgctttgacatcgtgtggcgcttgggtgtaaagtcgtggccac RBS14 ctaacgaggagatcggttc Streptomyces transformation with the construct Triparental conjugation was used to transfer ICE plasmids containing editing template from E. coli ET12567 to Streptomyces strains as previously described (Keiser et al., 2000. “Practical Streptomyces Genetics: A Laboratory Manual”, John Innes Foundation). Exconjugants were streaked on SFM plates supplemented with 100 μM cumate (Sigma-Aldrich) and nalidixic acid (25 μg / mL) to force the second crossover event to happen. After 3 - 5 days growing at 30 °C, spores of single colonies were picked off and heated in 30 μL 50% DMSO at 95 ℃ for 30 min, the supernatant was used as template for PCR verification and Sanger sequencing. To avoid heterokaryons, spores from correct colonies were re-streaked on SFM agar one more time. Table 6: Plasmids constructed in Example 1 and their corresponding gene editing effect in Streptomyces. Plasmid Organism Strain Accession Editing results S. AL6 elicolor M 45882. Nucleotide deletion from co 145 2 position 5513832 - 5534999 S. M145 AL645882. Nucleotide deletion from Red coelicolor 2 position 6432460 - 6464308 pICE- S. AL645882. Nucleotide insert licolor M1 ion in front coe 45 2 of position 5528094 Quantification of actinorhodin To identify whether the genome editing was successful, a quantification experiment of the gene product of the targeted gene, i.e., actinorhodin, was performed. The S. coelicolor wildtype and mutant strains were grown in 50 mL of R5 medium in 250 mL baffled flasks, and the cultures were kept at 30 ℃ in a shaker with an agitation speed of 200 rpm. To extract actinorhodin, 0.5 mL of 3 N Potassium Hydroxide (KOH; Thermo Fisher) was added to a 1 mL sample. After vortexing and centrifugation, the absorbance of the supernatant was measured at 640 nm. The concentration of actinorhodin and γ-actinorhodin combined was calculated based on Beer-Lambert law: ^^ =^^ ^^^^ wherein A is the absorbance, ε is the molar absorption coefficient of actinorhodin pure compound (^640 = 25320 M-1cm-1), c is the molar concentration of actinorhodin, and l is the pathlength of the cuvette. Results Design of an ICE construct The ICE system comprises an inducible CRISPRi construct designed to target on essential gene and an antibiotic resistant marker for selection of transformants. Since the pICE plasmid is a non-replicating suicide plasmid (or linearized DNA fragment), it can only be integrated into the genome via homologous recombination. A schematic illustration for ICE system based on our previously developed CUBIC system (Bai and van Wezel, 2023. ACS Synth Biol 12: 3143- 3147) is shown in Figure 4. For genome editing in Streptomyces, ex-conjugants were isolated that had undergone a single crossover event, indicated by the presence of hygromycin resistance on the backbone. Subsequently, the spores of the ex-conjugants were streaked again onto plates containing 100 μM cumate, which triggers the knockdown of the essential gene, consequently inhibiting growth. Colonies could only survive via loss of the plasmid backbone. Correct double crossover mutants were further identified by colony PCR and Sanger sequencing. Validation of the ICE construct for seamless genome editing in Streptomyces As a proof-of-concept study, we applied ICE system to edit the genome of model S. coelicolor. First, the biosynthetic gene clusters Act and Red, which are responsible for producing the blue-pigmented antibiotic actinorhodin and the red- pigmented prodigiosin, were knocked out with 100% efficiency (Figure 5). Whole- genome sequencing showed that only the intended deletions had occurred: 21,168 bp in the act mutant, and 31,894 bp in the red mutant (data not shown). Only a very small number of single nucleotide polymorphisms (SNPs) were detected in the knockout strains relative to the wild-type genome, likely reflecting random spontaneous mutations accumulated during the genetic manipulation process (data not shown). Following that, we deactivated the Act regulatory gene actII-ORF4 by introducing a stop codon, consequently leading to the cessation of Act production (Figure 6). Additionally, a synthetic promoter (SP30) was utilized to enhance Act production by inserting it upstream of the actII-ORF4 gene (Figure 7, Table 7). The SP30 knock-in strain showed a 3.2-fold increase in Act production compared to the wild-type strain (Table 7). Furthermore, temporal profiling revealed that the constitutive promoter not only enhanced the final Act titer, but also accelerated the onset of its biosynthesis. Table 7: Data regarding to the assay of actinorhodin. Time Actinorhodin (μM) (h) WT 48 1.03 ± 0.2772 137.64 ± 96 187.80 ± 17.48 598.34 ± 71.69We next chose to target a BGC that does not produce a pigmented natural product. For this, we decided to delete the largest BGC of S. coelicolor, namely the 77 kb cda cluster that specifies the non-ribosomal peptide antibiotic calcium- dependent antibiotic (CDA). A knockdown construct was generated and introduced into S. coelicolor M145 using the same procedure as described hereinabove. Colony PCR screening revealed that 1 out of 6 colonies from cumate- containing plates harbored the correct deletion. The reduced efficiency is likely attributable to lower recombination rates associated with the larger cluster size and the increased likelihood of second crossover events occurring between closely spaced homologous arms. Whole-genome sequencing showed that only the intended deletion had occurred: 77,281 bp in the cda mutant (data not shown). Again, only a very small number of single nucleotide polymorphisms (SNPs) were detected in the knockout strains relative to the wild-type genome, likely reflecting random mutations accumulated during the genetic manipulation process (data not shown). Example 2: Genome editing of Streptomyces strains with limited genetic tractability Materials and Methods LCMS Analysis Liquid chromatography-tandem mass spectrometry (LC-MS / MS) analysis were performed as previously described (van Bergeijk et al., 2022. Commun Chem 5: 14), the dry extracts were dissolved in MeOH (Macron Fine Chemicals ) to a final concentration of 1 mg / mL. LC-MS / MS acquisition was performed using Shimadzu Nexera X2 ultra high-performance liquid chromatography (UPLC) system, with attached photodiode array detector (PDA), coupled to Shimadzu 9030 QTOF mass spectrometer, equipped with a standard electrospray ionization (ESI) source unit, in which a calibrant delivery system (CDS) is installed. A total of 2 µL was injected into a Waters Acquity HSS C18 column (1.8 μm, 100 Å, 2.1 × 100 mm). The column was maintained at 30 °C, and run at a flow rate of 0.5 mL / min, using 0.1% formic acid in H2O (Fisher Chemical), and 0.1% formic acid in acetonitrile (CAN; Biosolve) as solvents A and B, respectively. The gradient used was 5% B for 1 min, 5–85% B for 9 min, 85–100% B for 1 min, and 100% B for 4 min. The column was re- equilibrated to 5% B for 3 min before the next run was started. The PDA acquisition was performed in the range of 200–600 nm, at 4.2 Hz, with 1.2 nm slit width. The flow cell was maintained at 40 °C. All the samples were analyzed in positive polarity, using data-dependent acquisition mode. In this regard, full scan MS spectra (m / z 100–1700, scan rate 10 Hz, ID enabled) were followed by two data-dependent MS / MS spectra (m / z 100– 1700, scan rate 10 Hz, ID disabled) for the two most intense ions per scan. The ions were fragmented using collision-induced dissociation (CID) with fixed collision energy (CE 20 eV), and excluded for 1 s before being re-selected for fragmentation. The parameters used for the ESI source were: interface voltage 4 kV, interface temperature 300 °C, nebulizing gas flow 3 L / min, and drying gas flow 10 L / min. Results Streptomyces roseifaciens is a gifted natural product producer, with antiSMASH predicting the presence of at least 44 BGCs in its genome (Van der Aart et al., 2019. Int J Syst Evol 69: 899-908; Wu et al., 2016. Metabolomics 12: 90). Despite its promising biosynthetic capacity, the strain was not genetically tractable, and therefore not amenable to conventional CRISPR / Cas9-based approaches. S. roseifaciens produces high levels of red-pigmented prodigiosins from a hybrid nonribosomal peptide synthetase–polyketide synthase (NRPS–PKS) gene cluster (Figure 8A). Deletion of the 29 kb prodigiosin (pig) cluster led to a complete loss of red pigmentation (Figure 8B). LC-MS analysis of extracts from the pig mutant and its parent grown on R5 agar further confirmed the absence of two previously identified prodiginine compounds (streptorubin B and undecylprodigiosin) in the mutant background (Figure 8C). Interestingly, several chromatographic peaks were significantly increased in the pig null mutant as compared to the wild-type S. roseifaciens, particularly at a retention time of approximately 11 min (Figure 8C). These markedly overrepresented peaks suggested that the deletion of the pig gene cluster activated one or more different BGCs. To gain better understanding of which specific metabolites were induced as a result of the mutant, and to assess whether these compounds share any structural similarity, we generated a molecular network representing the ions detected in the crude extracts of both the wild-type S. roseifaciens and its pig mutant, grown under identical conditions on R5 agar medium. This was carried out using the Global Natural Products Social (GNPS) molecular networking platform, a web-based tool for visualizing and comparing MS / MS spectral data. The networking analysis clearly indicated a significantly expanded chemical space in the pig mutant compared to the wild-type strain (data not shown). Three compounds were strongly overrepresented within the largest spectral family in the GNPS network. Interestingly, this spectral family did not contain any previously annotated metabolites, suggesting that these compounds may represent novel or uncharacterized chemical entities. Collectively, the results from Examples 1 and 2 demonstrate that the ICE system enables a broad range of genetic modifications, including precise deletions of entire BGCs, targeted insertions such as promoter knock-ins, and single- nucleotide substitutions. The system provides a reliable and versatile platform for genome editing in Streptomycetes.

Claims

CLAIMS1. A method of selecting a microorganism comprising an altered genome,comprising providing the microorganism with a non-replicating construct, whereby the construct comprises a first and a second region of homology with a genomic target of the microorganism, which first and a second region of homology are separated by a selection marker and an expression cassette including a regulatable Inducible Clustered Regularly Interspaced Short Palindromic Repeats interference (CRISPRi)-mediated inhibitor of RNA or protein synthesis that targets an essential gene of the microorganism and, optionally, a terminator, and whereby the first and second regions of homology with the target genome each comprises at least 20 base pairs (bp), selecting a first microorganism in which the construct has been inserted by screening for the presence of the selection marker, and selecting a double-crossover mutant after activation of the inhibitor, thereby selecting a microorganism comprising an altered genome.

2. The method of claim 1, whereby the selectable marker is an antibiotic resistance marker and / or an auxotrophic marker, preferably a broad-spectrum antibiotic resistance marker.

3. The method of claim 1 or claim 2, wherein the microorganism is a fungus, a bacterium, or an alga.

4. The method of any one of claim 1-3, wherein the microorganism is of the class Actinomycetia, preferably of the genus Streptomyces.

5. The method of any one of claims 1-4, wherein the genome alteration comprises an insertion, deletion and / or alteration such as a point mutation.

6. The method of any one of claims 1-5 whereby the regulatable inhibitor of RNA or protein synthesis is activatable by an inducer, such as cumate.

7. The method of any one of claims 1-6, whereby the CRISPRi comprises a catalytic dead CRISPR Associated (CAS) protein.

8. The method of claim 7, whereby the CAS protein is a catalytic dead Cas9 (dCAS9).

9. A non-replicating targeting construct for altering the genome of a microorganism, said construct comprising a first and a second region of homology with a genomic target of the microorganism, which first and second region of homology are separated by a selection marker and an expression cassette including a regulatable Inducible Clustered Regularly Interspaced Short Palindromic Repeats interference (CRISPRi)-mediated inhibitor of RNA or protein synthesis that targets an essential gene of the microorganism and, optionally, a terminator.

10. The non-replicating targeting construct of claim 9, whereby the selectable marker is an antibiotic resistance marker and / or an auxotrophic marker, preferably a broad-spectrum antibiotic resistance marker.

11. The non-replicating targeting construct according to claim 9 or claim 10, wherein the microorganism is a fungus, a bacterium or an algae.

12. The non-replicating targeting construct according to any one of claims 9 - 11, wherein the genome alteration comprises an insertion, deletion and / or alteration such as a point mutation.

13. The non-replicating targeting construct according to any one of claims 9 -12, whereby the CRISPRi-mediated inhibitor is activatable by an inducer, preferably cumate.

14. The non-replicating targeting construct according to any one of claims 9-13, wherein the CRISPRi-mediated inhibitor is a catalytic dead CRISPR Associated (CAS) protein.

15. The non-replicating targeting construct according to claim 14, wherein the CAS protein is a catalytic dead Cas9 (dCAS9).

16. A kit comprising the construct of any one of claims 9 – 15 and an inducer of the activatable inhibitor, preferably cumate.

Images