Mutant HLA-e heavy chain, HLA-e trimer, and use thereof
By modifying the extracellular domain and transmembrane domain of the HLA-E heavy chain, mutant HLA-E heavy chain and trimer were developed, solving the problem of universal allogeneic CAR-T cells being killed by NK cells due to the lack of class I MHC molecules, thus achieving stronger NK cell resistance and better therapeutic effects.
Patent Information
- Application Number
- PCT/CN2025/102476
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-17
- Filing Date
- 2025-06-20
- Publication Date
- 2026-01-22
AI Technical Summary
Universal allogeneic CAR-T cell products are killed by NK cells due to the lack of class I MHC molecules, resulting in unsatisfactory survival time. Existing expression of wild-type HLA-E is insufficient to resist NK cell killing.
By modifying the extracellular and transmembrane domains of wild-type HLA-E heavy chains, mutant HLA-E heavy chains and HLA-E trimers were developed to enhance their ability to resist NK cell killing in cells lacking class I MHC molecules.
Mutated HLA-E heavy chains and HLA-E trimers significantly enhance the cells' immune rejection of NK cells, enabling them to continuously resist NK cell killing and improve the survival rate and therapeutic effect of CAR-T cells.
Smart Images

Figure PCTCN2025102476-FTAPPB-I100001 
Figure PCTCN2025102476-FTAPPB-I100002 
Figure PCTCN2025102476-FTAPPB-I100003
Abstract
Description
A mutant HLA-E heavy chain, HLA-E trimer and their applications
[0001] This invention claims priority to Chinese Patent Application No. 202410962600X, filed on July 17, 2024, entitled "A Mutant HLA-E Heavy Chain, HLA-E Trimer and Its Application", the entire contents of which are incorporated herein by reference. Technical Field
[0002] This invention belongs to the field of genetic engineering technology, specifically relating to a mutant HLA-E heavy chain, an HLA-E trimer, and their applications. Background Technology
[0003] Tumor immunotherapy strategies, including immune checkpoint inhibitors, CAR-T cell therapy, and tumor vaccines, have achieved significant success in cancer treatment. Among these, CAR-T cell therapy involves knocking in genes carrying specific antigen receptors to construct CAR-T cells, enabling them to recognize and attack tumor cells. As an important tumor immunotherapy strategy, CAR-T cell therapy has achieved significant breakthroughs in treating various malignant tumors, and several products have already been launched on the market.
[0004] Currently available CAR-T cell products are all autologous CAR-T cells. This requires collecting the patient's immune cells, modifying and loading them with a CAR using genetic engineering techniques, and then reinfusing them into the patient. This process is costly and time-consuming. Furthermore, not all patient immune cells can be successfully used to prepare CAR-T cell products. Therefore, developing universal allogeneic CAR-T cell products is essential. Universal allogeneic CAR-T cell products use T cells from healthy donors, rather than the patient's own T cells. These donor T cells are genetically engineered to express specific CARs, and then mass-produced and stored so they can be used to treat multiple patients at any time. However, universal allogeneic CAR-T cell products lack class I MHC molecules, making them susceptible to NK cell killing and resulting in less than ideal survival time in the recipient's body.
[0005] To prevent universal allogeneic CAR-T cell products from being killed by NK cells due to the lack of class I MHC molecules, a common strategy is to express HLA-E in CAR-T cells. HLA-E can bind to receptors on the surface of NK cells, such as CD94 / NKG2A, thereby inhibiting the activity and killing function of NK cells, reducing the attack of NK cells on CAR-T cells, and thus improving the survival rate and therapeutic effect of CAR-T cells.
[0006] However, the expression of wild-type HLA-E in CAR-T cells is insufficient to resist NK cell killing of CAR-T cells. Therefore, how to further improve the resistance of CAR-T cells to NK cell killing has become a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0007] Based on this, the purpose of the present invention is to provide a mutant HLA-E heavy chain, an HLA-E trimer and their applications, wherein the HLA-E trimer containing the mutant HLA-E heavy chain is expressed in cells lacking class I MHC molecules, enabling it to continuously resist NK cell killing.
[0008] A first aspect of the present invention is to provide a mutant HLA-E heavy chain, which is obtained by modifying a wild-type HLA-E heavy chain by including an extracellular domain and / or a transmembrane domain.
[0009] In some embodiments, the modification includes replacing or deleting at least one amino acid in the extracellular domain of the wild-type HLA-E heavy chain.
[0010] In some embodiments, the modification includes replacing or deleting at least one amino acid from the 261st to 289th amino acids of the wild-type HLA-E heavy chain; preferably, the modification includes replacing or deleting at least one amino acid from the 266th to 284th amino acids of the wild-type HLA-E heavy chain.
[0011] In some embodiments, the mutant HLA-E heavy chain is obtained through at least one of the following modifications:
[0012] a. Mutate amino acids 266–269 from LPEP to QDEA;
[0013] b. Mutate amino acid position 282 from I to A;
[0014] c. Mutate the 272nd amino acid from L to A;
[0015] d. The 279th amino acid is mutated from Q to A;
[0016] e. Amino acid at position 276 is mutated from P to A;
[0017] f. The 280th amino acid is mutated from P to A;
[0018] g. The amino acid at position 281 is mutated from T to A;
[0019] h. Deletion of amino acids 281-284.
[0020] In some embodiments, the modification includes replacing the wild-type HLA-E heavy chain transmembrane domain with a protein transmembrane domain having more than 24 amino acids.
[0021] In some embodiments, the modification includes replacing the wild-type HLA-E heavy chain transmembrane domain with a PDGFR-β transmembrane domain.
[0022] In some embodiments, the mutant HLA-E heavy chain is obtained by replacing the transmembrane domain of the wild-type HLA-E heavy chain with the PDGFR-β transmembrane domain and mutating amino acid position 272 from L to A.
[0023] In some embodiments, the mutant HLA-E heavy chain is obtained by replacing the transmembrane domain of the wild-type HLA-E heavy chain with the PDGFR-β transmembrane domain and mutating amino acid position 279 from Q to A.
[0024] In some embodiments, the mutant HLA-E heavy chain is obtained by replacing the transmembrane domain of the wild-type HLA-E heavy chain with the PDGFR-β transmembrane domain and mutating amino acid position 276 from P to A.
[0025] In some embodiments, the mutant HLA-E heavy chain is obtained by replacing the transmembrane domain of the wild-type HLA-E heavy chain with the PDGFR-β transmembrane domain and mutating amino acid position 280 from P to A.
[0026] In some embodiments, the mutant HLA-E heavy chain is obtained by replacing the transmembrane domain of the wild-type HLA-E heavy chain with the PDGFR-β transmembrane domain and mutating amino acid position 281 from T to A.
[0027] In some embodiments, the mutant HLA-E heavy chain is obtained by replacing the transmembrane domain of the wild-type HLA-E heavy chain with the PDGFR-β transmembrane domain and mutating amino acid position 282 from I to A.
[0028] In some embodiments, the mutant HLA-E heavy chain is obtained by replacing the transmembrane domain of the wild-type HLA-E heavy chain with the PDGFR-β transmembrane domain and deleting amino acids TIPI from position 281 to 284.
[0029] In some embodiments, the amino acid sequence of the PDGFR-β transmembrane domain is as shown in SEQ ID NO:2, or has ≥80%, ≥83%, ≥85%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7%, ≥99.8%, or ≥99.9% sequence identity with the amino acid sequence shown in SEQ ID NO:2.
[0030] In some embodiments, the amino acid sequence of the mutant HLA-E heavy chain has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity as shown in any of SEQ ID NO:3-12;
[0031] And / or, the amino acid sequence of the mutant HLA-E heavy chain is a conserved amino acid substitution of at least one, at least two, or at least three amino acid sequences shown in any of SEQ ID NO:3-12.
[0032] In some embodiments, the amino acid sequence of the wild-type HLA-E heavy chain is shown in SEQ ID NO:1.
[0033] In a second aspect, the present invention provides an HLA-E trimer comprising a presenting peptide, β2M, and a mutant HLA-E heavy chain as described above.
[0034] In some embodiments, the HLA-E trimer is a single-chain trimer and further includes: a linker sequence for linking the presenting peptide and β2M, and for linking β2M and the mutant HLA-E heavy chain as described above. The linker sequence for linking the presenting peptide and β2M may be the same as or different from the linker sequence for linking β2M and the mutant HLA-E heavy chain.
[0035] In some embodiments, the HLA-E single-chain trimer comprises, from the N-terminus to the C-terminus, the following sequence: presenting peptide-linking sequence-β2M-linking sequence-mutant HLA-E heavy chain.
[0036] In some embodiments, the presenting peptide is a signal peptide of a class I MHC molecule or a fragment thereof, wherein the class I MHC molecule is selected from the group consisting of heavy chains of the following: HLA-A1, HLA-A2, HLA-A*3401, HLA-A*80, HLA-B7, HLA-B*13, HLA-B15, HLA-Cw3, HLA-Cw*2, HLA-Cw*0809, HLA-Cw7, HLA-Cw*1701, HLA-G, and HLA-F.
[0037] In some embodiments, the presenting peptide is a signal peptide fragment of HLA-G, with the amino acid sequence shown in SEQ ID NO:16.
[0038] In some embodiments, the N-terminus of the presenting peptide of the HLA-E single-chain trimer is further linked to a signal peptide, preferably a β2M signal peptide, the amino acid sequence of which is shown in SEQ ID NO:15.
[0039] In some embodiments, the linker sequences between the presenting peptide and β2M and between β2M and the HLA-E heavy chain are G4S linkers. Further, the amino acid sequences of the linker sequence between the presenting peptide and β2M are shown in SEQ ID NO:17, and the amino acid sequences of the linker sequence between β2M and the HLA-E heavy chain are shown in SEQ ID NO:19.
[0040] In a third aspect, the present invention provides an isolated nucleic acid that encodes the mutant HLA-E heavy chain as described above and / or the HLA-E trimer as described above.
[0041] In a fourth aspect, the present invention provides a vector comprising the nucleic acid as described above, and optionally a gene encoding a cis-acting element and / or a trans-acting factor.
[0042] In some of these embodiments, the vector is a plasmid, granule, bacteriophage, or viral vector.
[0043] In some of these embodiments, the cis-acting element is selected from promoters and enhancers.
[0044] In some of these embodiments, the trans-acting factor encoding gene is selected from nucleotides encoding polymerases, transcription factors, and / or transcriptional regulatory factors.
[0045] In a fifth aspect, the present invention provides a gene expression cassette comprising a promoter and nucleic acids as described above.
[0046] In a sixth aspect, the present invention provides a cell expressing the mutant HLA-E heavy chain and / or the HLA-E trimer as described above.
[0047] In some of these embodiments, the cells are immune effector cells and / or their precursor cells.
[0048] Preferably, the immune effector cells are one or more of T cells, NK cells, NKT cells, mast cells, macrophages, dendritic cells, CIK cells, and stem cell-derived immune effector cells;
[0049] More preferably, the immune effector cells express synthetic receptors, the synthetic receptors being selected from the group consisting of CAR, TCR, TruC, TAC, AbTCR and chimeric CD3 receptors;
[0050] Furthermore, the extracellular domain of the CAR targets tumor antigens; preferably, the tumor antigens are selected from GPC3, CLDN18.2, GCC, EGFRvIII, ROR1, CLDN6, MSLN, ALPP, MUC1, LGR5, HER2, OR2H1, DLL-3, C-MET, glyco-cMET, glyco-LAMP1, CD123, CD33, CLL-1, CD70, CD38, FLT3, and GRP78.
[0051] In some embodiments, the cells lack endogenous expression of at least one gene encoding class I MHC molecules or MHC-like molecules on the cell surface.
[0052] In some embodiments, the cells lack endogenous expression of class I MHC molecules on the cell surface, the class I MHC molecules being selected from the group consisting of HLA-A heavy chain, HLA-B heavy chain, HLA-C heavy chain, HLA-E heavy chain, HLA-F heavy chain and HLA-G heavy chain.
[0053] In some embodiments, the cells lack endogenous expression of β2M on the cell surface.
[0054] A seventh aspect of the present invention provides a method for preparing cells as described above, comprising the steps of: introducing the vector or gene expression cassette as described above into the cells.
[0055] An eighth aspect of the present invention provides a method for avoiding cell killing by NK cells, comprising the steps of: expressing, in cells, the mutant HLA-E heavy chain as described above and / or the HLA-E trimer as described above.
[0056] A ninth aspect of the invention provides the use of the mutant HLA-E heavy chain, the HLA-E trimer, the nucleic acid, the vector, the gene expression cassette, and / or the cell as described above in the preparation of allogeneic transplantation drugs. The HLA-E trimer containing the mutant HLA-E heavy chain is expressed in cells lacking class I MHC molecules, enabling them to sustainably resist NK cell killing, thereby reducing the host's rejection response to the graft.
[0057] In a tenth aspect, the present invention provides the use of the mutant HLA-E heavy chain, the HLA-E trimer, the nucleic acid, the vector, the gene expression cassette, and / or the cell as described above in the preparation of a drug for the prevention and / or treatment of tumors.
[0058] For example, the tumor may include solid tumors and non-solid tumors;
[0059] Preferably, the solid tumor is selected from: liver cancer, gastric cancer, lung cancer, breast cancer, head and neck cancer, bladder cancer, ovarian cancer, cervical cancer, kidney cancer, pancreatic cancer, liposarcoma, melanoma, adrenal cancer, schwannoma, malignant fibrous histiocytoma, and esophageal cancer; the non-solid tumor is selected from: B-cell lymphoma, Hodgkin's lymphoma, chronic myeloid leukemia, and acute myeloid leukemia.
[0060] An eleventh aspect of the present invention provides a method for preventing and / or treating tumors in patients in need, the method comprising administering an effective amount of the cells as described above to the patient in need.
[0061] For example, the tumor may include solid tumors and non-solid tumors;
[0062] Preferably, the solid tumor is selected from: liver cancer, gastric cancer, lung cancer, breast cancer, head and neck cancer, bladder cancer, ovarian cancer, cervical cancer, kidney cancer, pancreatic cancer, liposarcoma, melanoma, adrenal cancer, schwannoma, malignant fibrous histiocytoma, and esophageal cancer; the non-solid tumor is selected from: B-cell lymphoma, Hodgkin's lymphoma, chronic myeloid leukemia, and acute myeloid leukemia.
[0063] In a twelfth aspect of the invention, a composition for the prevention and / or treatment of tumors is provided, the composition comprising the mutant HLA-E heavy chain as described above, the HLA-E trimer as described above, the nucleic acid as described above, the vector as described above, the gene expression cassette as described above, and / or the cell as described above.
[0064] For example, the tumor may include solid tumors and non-solid tumors;
[0065] Preferably, the solid tumor is selected from: liver cancer, gastric cancer, lung cancer, breast cancer, head and neck cancer, bladder cancer, ovarian cancer, cervical cancer, kidney cancer, pancreatic cancer, liposarcoma, melanoma, adrenal cancer, schwannoma, malignant fibrous histiocytoma, and esophageal cancer; the non-solid tumor is selected from: B-cell lymphoma, Hodgkin's lymphoma, chronic myeloid leukemia, and acute myeloid leukemia.
[0066] This invention modifies the extracellular domain and / or transmembrane domain of the wild-type HLA-E heavy chain to obtain a mutant HLA-E heavy chain. Cells expressing the HLA-E trimer containing the mutant HLA-E heavy chain and lacking class I MHC molecules show a significantly enhanced immune rejection ability against NK cells and can continuously resist NK cell killing.
[0067] In particular, mutant HLA-E heavy chains obtained by simultaneously modifying the extracellular domain and transmembrane domain of wild-type HLA-E heavy chains result in cells expressing HLA-E trimers containing the mutant HLA-E heavy chains exhibiting stronger immune rejection of NK cells and better resistance to NK cell killing. Attached Figure Description
[0068] Figure 1 shows the C-terminal secondary mass spectrum of the target protein sample after chymotrypsin cleavage in Example 2.
[0069] Figure 2 shows the C-terminal secondary mass spectrum of the target protein sample after trypsin digestion in Example 2.
[0070] Figure 3 shows the flow cytometry diagram of HLA-E trimer expression in 293T cells transfected with different plasmids in Example 4.
[0071] Figure 4 shows the flow cytometry diagram of HLA-E trimer expression in T cells (Mock group, β2M-KO group, HLA-E-WT group, HLA-E-DTB1 group, HLA-E-M6 group) after transfection with lentivirus in Example 5.
[0072] Figure 5 shows the flow cytometry diagram of HLA-E trimer expression in T cells (PDGFR-βTM group, PDGFR-βTM1 group, PDGFR-βTM2 group, PDGFR-βTM3 group, PDGFR-βTM4 group, PDGFR-βTM5 group, PDGFR-βTM6 group, PDGFR-βTM7 group) after transfection with lentivirus in Example 5.
[0073] Figure 6 shows the β2M knockout efficiency of T cells 72 hours after electroporation in Example 5.
[0074] Figure 7 shows the relative expression rate of HLA-E trimer (GFP) in T cells of each group in Example 5 at different time points. + )picture.
[0075] Figure 8 shows the killing ratio of T cells and NK92-MI cells in each group after 48 hours of co-culture in Example 5.
[0076] Figure 9 shows the GFP levels of T cells and NK92-MI cells co-cultured for 48 hours in each group of Example 5. + HLA-E + The graph shows the rate of change in the proportion of positive cells in the total cell population. Detailed Implementation
[0077] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0078] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in the fourth edition of *Molecular Cloning: A Laboratory Manual*, edited by Green and Sambrook, published in 2013, or according to the manufacturer's recommendations. All commonly used chemical reagents used in the examples are commercially available products.
[0079] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items. The term "at least one" as used in this invention means one or more.
[0080] Furthermore, as used herein, the term "or" is an inclusive "or" sign and is equivalent to the term "and / or" unless the context clearly specifies otherwise. The term "based on" is not exclusive and allows for basing on other factors not described unless the context clearly specifies otherwise. Additionally, throughout the specification, the meanings of "an," "a," and "the" include plural indicators. The meaning of "in" includes both "in" and "on."
[0081] To facilitate understanding of this technology, some terms and phrases are defined below.
[0082] In this invention, the letters in the amino acid sequence represent single-letter abbreviations of amino acids known in the art, such as those described in J. Biol. Chem, 243, p3558 (1968): alanine: Ala-A, arginine: Arg-R, aspartic acid: Asp-D, cysteine: Cys-C, glutamine: Gln-Q, glutamic acid: Glu-E, histidine: His-H, glycine: Gly-G, asparagine: Asn-N, tyrosine: Tyr-Y, proline: Pro-P, serine: Ser-S, methionine: Met-M, lysine: Lys-K, valine: Val-V, isoleucine: Ile-I, phenylalanine: Phe-F, leucine: Leu-L, tryptophan: Trp-W, threonine: Thr-T.
[0083] The term "conservative amino acid" in this article generally refers to amino acids that belong to the same class or have similar characteristics (e.g., charge, side chain size, hydrophobicity, hydrophilicity, main chain conformation, and rigidity).
[0084] For example, the following six groups are examples of amino acids that are considered to have conserved substitutions for each other:
[0085] 1) Alanine (A), Serine (S), Threonine (T);
[0086] 2) Aspartic acid (D), glutamic acid (E);
[0087] 3) Asparagine (N), glutamine (Q);
[0088] 4) Arginine (R), Lysine (K), Histidine (H);
[0089] 5) Isoleucine (I), leucine (L), methionine (M), valine (V); and
[0090] 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
[0091] In this invention, the term "identity" (or "percent identity") refers to the sequence matching between two polypeptides or two nucleic acids. When a position in two compared sequences is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared, multiplied by 100%. For example, if six out of ten positions in two sequences match, then the two sequences have 60% sequence identity. Typically, two sequences are compared to produce the maximum sequence identity. Such alignments can be made using publicly available and commercially available alignment algorithms and programs, such as, but not limited to, ClustalΩ, MAFFT, Probcons, T-Coffee, Probalign, and BLAST, which can be reasonably chosen by those skilled in the art. Those skilled in the art can determine suitable parameters for the alignment of sequences, including any algorithm required to achieve a better or better alignment of the entire length of the sequences being compared, and any algorithm required to achieve a better or better alignment of a local portion of the sequences being compared.
[0092] In this invention, sequence comparison and determination of percentage identity between two sequences can be achieved using mathematical algorithms. In some cases, the percentage identity between two amino acid sequences is determined using the Needleman and Wunsch ((1970) J. Mol. Biol. 48: 444-453) algorithm, which uses the Blossum 62 scoring matrix and determines the identity using a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5. This algorithm has been integrated into the GAP program in the GCG software package.
[0093] HLA-E
[0094] Human leukocyte antigen I (HLA-I) genes can be divided into classic HLA-1a genes and non-classical HLA-1b genes. Human leukocyte antigen E (HLA-E) is a member of the non-classical HLA-1b gene group. The HLA-E coding gene is located on the short arm of chromosome 6 (6p21.3). HLA-E is a transmembrane protein composed of a heavy chain (α chain) and a light chain (β2m, which maintains the stability of the spatial conformation of MHC-I molecules), and includes an intracellular region, a transmembrane structural region, and an extracellular region. The α chain is a transmembrane structure with α1, α2, and α3 domains in its extracellular region. The α chain can be divided into four regions: (1) Peptide-binding region: the site where it binds to the antigen polypeptide, which is a polymorphic region and includes the α1 and α2 domains; (2) Ig-like region: the site where it binds to CD8 molecules on the surface of CTL, which is a non-polymorphic region and is located in the α3 domain; (3) Transmembrane region: immobilizes MHC-I molecules on the membrane; (4) Cytoplasmic region: may participate in intracellular signal transduction.
[0095] HLA-E can bind to receptors on the surface of NK cells, such as CD94 / NKG2A, thereby inhibiting the activity and killing function of NK cells and reducing the attack of NK cells on CAR-T cells.
[0096] As used herein, the term "chimeric antigen receptor" or "CAR (Chimeric Antigen Receptor)" generally refers to a fusion protein comprising an extracellular domain capable of binding an antigen and at least one intracellular domain. A CAR is a core component of chimeric antigen receptor T cells (CAR-T cells) and may include an antigen-binding domain (i.e., an extracellular domain), a transmembrane domain, and an intracellular domain. In this application, the chimeric antigen receptor may combine with the T cell receptor-activating intracellular domain based on the antigen specificity of an antibody (e.g., GPC3). Genetically modified T cells expressing CAR can specifically recognize and eliminate malignant cells expressing the target antigen.
[0097] As used herein, the term "tumor antigen" refers to tumor-associated antigens (TAAs) or tumor-specific antigens (TSAs). TAAs or TSAs can be expressed on hematologic malignancies. TAAs or TSAs can be expressed on solid tumor cells. The tumor antigens are selected from one or more of the following: CD19, CD133, CD123, CD20, CD22, CD30, CD33, CD171, CD80 / 86, CA125, C-met, L1CAM, EC, DLL3, CD99, GRP78, 5T4, CD138, CS-1 (also known as CD2 subclass 1, CRACC, SLAMF7, CD319, or 19A24), phosphatidyl proteoglycan-3 (GPC3), and tight junction protein 18.2 (Claudin). 18.2), guanylate cyclized C (GCC / GUCY2C), mesothelin (MSLN), epidermal growth factor receptor (EGFR), prostate-specific membrane antigen (PSMA), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), alpha-fetoprotein (AFP), tyrosine protein kinase receptor UFO (AXL), death receptor 5 (DR5), NKG2D ligand, prostate stem cell antigen (PSCA), macrophage-stimulating protein receptor (MST1R), inhibitory leukocyte immunoglobulin-like receptor (LILRB4), C-type lectin-like molecule-1 (CLL-1 or CLECL1), epidermal growth factor receptor variant III (EGFRvIII), ganglioside G2 (GD2), ganglioside GD3, TNF receptor family member B cell maturation antigen (BCMA), Tn antigen (e.g., Tn Ag, GalNAcα-Ser / Thr), glyco-cMET, glyco-LAMP1, receptor tyrosine kinase-like orphan receptor 1 (ROR1), and Fms-like tyrosine kinase 3 (FLT3);Tumor-associated glycoprotein 72 (TAG72), CD38, CD44v6, B7H3 (CD276), B7-H4, KIT (CD117), interleukin-13 receptor subunit α-2 (IL-13Ra2 or CD213A2), interleukin-11 receptor α (IL-11Ra), prostate stem cell antigen (PSCA), protease serine 21, vascular endothelial growth factor receptor 2 (VEGFR2), Lewis (Y) antigen, CD24, platelet-derived growth factor receptor β (PDGFR-β), stage-specific embryonic antigen-4 (SSEA-4), folate receptor α (FR-α), receptor tyrosine protein kinase ERBB2 (Her2 / neu), cell surface-associated mucin 1 (MUC1), cell surface phase Mucin 16 (MUC16), epidermal growth factor receptor (EGFR), neural cell adhesion molecule (NCAM), Prostase, prostatic acid phosphatase (PAP), mutant elongation factor 2 (ELF2M), hepatin B2, fibroblast activating protein α (FAP), insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX), proteasome (e.g., proteasome, macroprotein factor) subunit B9 (LMP2), glycoprotein 100 (gp100), oncogene fusion protein (bcr-abl) composed of breakpoint cluster region (BCR) and Abelson murine leukemia virus oncogene homolog 1 (Abl), tyrosinase, hepatin A receptor 2 (EphA2), and fucose GM1;Sialyl Lewis adhesion molecule (sLe), transglutaminase 5 (TGS5), high molecular weight melanoma-associated antigen (HMWMAA), o-acetyl-GD2 ganglioside (OAcGD2), folate receptor β, tumor endothelial marker 1 (TEM1 / CD248), tumor endothelial marker 7-associated (TEM7R), tight junction protein 6 (CLDN6), thyroid-stimulating hormone receptor (TSHR), G protein-coupled receptor class C group 5 member D (GPRC5D), chromosome X reading frame 61 (CXORF61), CD97, CD179a, anaplastic lymphoma kinase (ALK), polysialic acid, placenta-specific 1 (PLAC1), globoH The hexose moiety of glycoceramide (GloboH), breast differentiation antigen (NY-BR-1), urothelial differentiation-specific glycoprotein (uroplakin) 2 (UPK2), hepatitis A virus cell receptor 1 (HAVCR1), adrenaline receptor β3 (ADRB3), pannexin 3 (PANX3), G protein-coupled receptor 20 (GPR20), lymphocyte antigen 6 complex locus K9 (LY6K), olfactory receptor 51E2 (OR51E2), TCRγ variable read frame protein (TARP), Wilm tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1), cancer / testis antigen 2 (LAGE-1a), melanoma-associated antigen 1 (MAGE-A1), ETS translocase gene 6 located on chromosome 12p (ETV6-AML), spermin 17 (SPA17), X antigen family member 1A (XAGE1), angiopoietin-binding cell surface receptor 2 (Tie 2) Melanoma cancer testis antigen-1 (MAD-CT-1), melanoma cancer testis antigen-2 (MAD-CT-2), Fos-associated antigen 1, p53, p53 mutant, prostate-specific protein (prostein), prostate cancer tumor antigen-1 (PCTA-1 or galactolectin 8), and T-cell recognized melanoma antigen 1 (MelanA or MART1).Rat sarcoma (Ras) mutant, human telomerase reverse transcriptase (hTERT), melanoma apoptosis inhibitor protein (ML-IAP), ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene), N-acetylglucosamine transferase V (NA17), paired box protein Pax-3 (PAX3), androgen receptor, cyclin B1, v-myc avian myelopathy virus oncogene neuroblastoma-derived homolog (MYCN), Ras homolog family member C (RhoC), tyrosinase-associated protein 2 (TRP-2), cytochrome P450 CYP1B1, Squamous cell carcinoma antigen 3 (SART3) recognized by T cells, paired box protein Pax-5 (PAX5), pro-acromial protein-binding protein sp32 (OY-TES1), lymphocyte-specific protein tyrosine kinase (LCK), A kinase anchoring protein 4 (AKAP-4), synovial sarcoma X breakpoint 2 (SSX2), receptor for advanced glycation end products (RAGE-1), legumain, human papillomavirus E6 (HPV E6), human papillomavirus E7 (HPV E7), intestinal carboxylesterase, mutant heat shock protein 70-2 (mut hsp70-2), CD79a, CD79b, CD72, leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), Fc fragment of IgA receptor (FCAR or CD890), leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2), CD300 molecular-like family member f (CD300LF), C-type lectin domain family 12 member A (CLEC12A), bone marrow stromal cell antigen 2 (BST2), mucin-like hormone receptor-like 2 containing an EGF-like module (EMR2), lymphocyte antigen 75 (LY75), placental alkaline phosphatase (ALPP), Fc receptor-like 5 (FCRL5) and / or immunoglobulin λ-like polypeptide 1, leucine-rich repeat-sequence G-protein-coupled receptor 5 (LGR5), olfactory receptor OR2H.
[0098] As used in this article, the term "isolated" refers to substances obtained artificially from their natural state. If an "isolated" substance or component appears in nature, it may be due to an alteration of its natural environment, the isolation of the substance from its natural environment, or both. For example, a certain unisolated polynucleotide or polypeptide may naturally exist in the body of a living animal, and a high-purity identical polynucleotide or polypeptide isolated from this natural state is called "isolated." The term "isolated" does not exclude the presence of artificial or synthetic substances, nor does it exclude the presence of other impurities that do not affect the substance's activity.
[0099] As used herein, the term "coding" refers to the inherent property of a specific nucleotide sequence in a polynucleotide (such as a gene, cDNA, or mRNA) as a template for the synthesis of other polymers and macromolecules having defined nucleotide sequences (e.g., rRNA, tRNA, and mRNA) or defined amino acid sequences in biological processes, and the resulting biological properties. Therefore, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, then the gene encodes that protein. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is typically provided in the sequence listing) and the non-coding strand (which serves as a template for gene or cDNA transcription) can be referred to as encoding a protein or other product of that gene or cDNA.
[0100] As used herein, the term "vector" refers to a construct capable of delivering one or more genes or sequences of interest into a host cell and preferably expressing said genes or sequences in the host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, granulocytes or phage vectors, DNA or RNA expression vectors associated with cationic condensers, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as production cells. The term "regulatory element" as used herein includes promoters (e.g., constitutive or inducible promoters), enhancers (e.g., 35S promoters or 35S enhanced promoters), internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many cell types and those sequences that direct expression of that nucleotide sequence only in certain cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in the desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or specific cell types (e.g., lymphocytes). In some cases, regulatory elements can also direct expression in a time-dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue- or cell type-specific.
[0101] The term "immune effector cells" as used in this article refers to immune cells that can participate in the clearance of foreign antigens and perform effector functions in the immune response, and can be used as autologous or allogeneic cells in cell therapy for cell immunotherapy.
[0102] The term "effective amount" as used in this article refers to the amount that provides therapeutic or preventative benefits.
[0103] As used in this article, the term "tumor" refers to all proliferative cell growth and proliferation, whether malignant or benign, and all precancerous and cancerous cells and tissues.
[0104] As used in this article, the term "solid tumor" refers to tumors selected from the following group: liver cancer, stomach cancer, lung cancer, breast cancer, colon cancer, renal cell carcinoma, non-small cell lung cancer, small intestine cancer, esophageal cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, malignant melanoma of the skin or eye, liposarcoma, melanoma, uterine cancer, ovarian cancer, rectal cancer, anal cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancers, thyroid cancer, parathyroid cancer, adrenal cancer, schwannoma, malignant fibrous histiocytoma, soft tissue sarcoma, urethral cancer, penile cancer, pediatric solid tumors, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) tumors, spinal axis tumors, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, and squamous cell carcinoma.
[0105] As used in this article, the term "non-solid tumor" refers to tumors selected from the following group: chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoblastic leukemia (ALL), B-cell acute lymphoblastic leukemia (B-ALL), T-cell acute lymphoblastic leukemia (T-ALL), chronic myeloid leukemia (CML), acute myeloid leukemia (AML), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic tumor, Burkitt lymphoma, diffuse large B-cell lymphoma, T-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, spinal dysplasia and myelodystrophy syndrome, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic tumor, B-lymphocytoma, and Waldenstrom macroglobulinemia.
[0106] The present invention will be further described in detail below with reference to specific embodiments.
[0107] Example 1: Preparation of sHLA-E protein
[0108] Collect 50 mL of culture supernatant from activated T cells, centrifuge at 3000×g for 10 min at 4℃, filter the supernatant through a 0.22 μM filter to remove residual cells, and add a protease inhibitor (Tao Shu, C0001). Then transfer the supernatant to an ultrafiltration tube (Millipore, UFC901096), centrifuge at 5000×g for 30-60 min at 4℃ until the volume is concentrated to approximately 400 μl, collect the sample, and incubate 20 μl (10 μg) of Biotin anti-human HLA-E Antibody (BioLegend, 342614) with the concentrated supernatant overnight at 4℃. The next day, use Pierce... TM Streptavidin-coated magnetic beads (Thermo Scientific, 88816) were used for magnetic separation of biotinylated samples, and finally, low pH levels were applied. TM The sample was eluted with IgG elution buffer (Thermo Scientific, 21028) to obtain purified sHLA-E protein.
[0109] Example 2: Protease hydrolysis of sHLA-E was performed to determine the protease hydrolysis sites.
[0110] The purified sHLA-E protein was subjected to SDS-PAGE protein electrophoresis, and the protein gel was stained with Coomassie Brilliant Blue R250 for 30 min, followed by overnight destaining. The target protein band was then visible to the naked eye. The target band was cut into 1 mm pieces. 3 The colloidal particles were decolorized using 50% ACN-50% 50 mmol / L NH4HCO3 solution until they were colorless. The particles were then dehydrated and subjected to reductive alkylation. Subsequently, the samples were enzymatically digested with trypsin and chymotrypsin, respectively, at 37°C overnight (16 h). The digested peptides were desalted using a self-packed desalting column, and the solvent was evaporated in a vacuum centrifuge at 45°C. After dissolution, the peptides were analyzed by LC-MS / MS. The obtained raw mass spectra were retrieved using Byonic to search the target protein database to obtain C-terminal secondary mass spectra. The results are shown in Figures 1 and 2. Figure 1 shows the C-terminal secondary mass spectrum of the target protein sample after chymotrypsin digestion in Example 2 of this invention, and Figure 2 shows the C-terminal secondary mass spectrum of the target protein sample after trypsin digestion in Example 2 of this invention.
[0111] Based on the enrichment of C-terminal peptides after chymotrypsin and trypsin cleavage of the target protein sample, the suspected cleavage sites are located in and around the hinge region of HLA-E, and the corresponding regions are subsequently mutated using vector design.
[0112] Example 3: Construction of different plasmid structures
[0113] Nucleotides encoding the mutant exogenous HLA-E trimer fusion protein (β2M signal peptide-presenting peptide-linker sequence-β2M-linker sequence-mutant HLA-E heavy chain) and the wild-type exogenous HLA-E trimer fusion protein were cloned into a lentiviral vector backbone (double restriction sites Not I and Xba I, pHAGE-EF1αL-eGFP vector, Addgene, catalog number 126686), placed under the EF1α promoter, forming pHAGE-EF1α-HLA-E-IRES-ZsGreen, expressing the mutant exogenous HLA-E trimer and the wild-type exogenous HLA-E trimer (named HLA-E-WT).
[0114] The amino acid sequence of the wild-type exogenous HLA-E trimer fusion protein is shown in SEQ ID NO:14:
[0115] The amino acid sequence of the wild-type HLA-E heavy chain is shown in SEQ ID NO:1:
[0116] Based on this, mutant 1 sequence was obtained by replacing four amino acids in the α3 subunit of the wild-type HLA-E heavy chain, named HLA-E-DTB1 (the amino acid LPEP at positions 266-269 of HLA-E is mutated to QDEA); mutant 2 sequence was obtained by replacing amino acids at the hinge of HLA-E, named HLA-E-M6 (the amino acid I at position 282 of HLA-E is mutated to A); and pHAGE-EF1α-HLA-E-PDGFRβTM-IRES-ZsGreen was obtained by replacing the transmembrane domain of HLA-E with the PDGFR-β transmembrane domain, named PDGFR-βTM.
[0117] Subsequently, based on PDGFR-βTM, seven point mutations were performed at the α3 subunit of the HLA-E heavy chain and / or the HLA-E hinge, resulting in PDGFR-βTM M1 (HLA-E amino acid L at position 272 is mutated to A), PDGFR-βTM M2 (HLA-E amino acid Q at position 279 is mutated to A), PDGFR-βTM M3 (HLA-E amino acid P at position 276 is mutated to A), PDGFR-βTM M4 (HLA-E amino acid P at position 280 is mutated to A), PDGFR-βTM M5 (HLA-E amino acid T at position 281 is mutated to A), PDGFR-βTM M6 (HLA-E amino acid I at position 282 is mutated to A), and PDGFR-βTM M7 (HLA-E amino acid TIPI deletion from positions 281 to 284).
[0118] The amino acid sequence of the PDGFR-β transmembrane domain is shown in SEQ ID NO:2:
[0119] The HLA-E heavy chain modifications and amino acid sequence information for each mutation are shown in Table 1:
[0120] Table 1
[0121] In the table, "-" indicates that the area will not be modified.
[0122] The amino acid sequence information of SEQ ID NO:3~12 is as follows:
[0123] The amino acid sequence of the β2M signal peptide of mutant / wild-type exogenous HLA-E trimer is shown in SEQ ID NO:15:
[0124] The amino acid sequence of the presenting peptide of mutant / wild-type exogenous HLA-E trimer is shown in SEQ ID NO:16:
[0125] The amino acid sequence of the linker between the presenting peptide of mutant / wild-type exogenous HLA-E trimer and β2M is shown in SE Q ID NO:17:
[0126] The amino acid sequence of β2M in mutant / wild-type exogenous HLA-E trimer is shown in SEQ ID NO:18:
[0127] The amino acid sequence of the linker sequence between the β2M of the mutant / wild-type exogenous HLA-E trimer and the mutant HLA-E heavy chain is shown in SEQ ID NO:19:
[0128] Example 4: Detection of the effect of different plasmid structures on HLA-E trimer expression in 293T cells.
[0129] One day in advance, 293T cells in the logarithmic growth phase were seeded into 24-well plates at a density of 1 × 10⁶ cells per well. 5Cell number. On the second day, plasmids with different HLA-E structures (plasmids expressing wild-type HLA-E trimers and mutant HLA-E trimers constructed in Example 3) were transiently transfected using Lipo 2000 transfection reagent (Invitrogen, 11668019-1), with 500 ng of plasmid per well. After transfection for 48-72 h, cells were digested and flow cytometry samples were loaded. The overexpression efficiency of exogenous HLA-E trimers in 293T cells was analyzed by APC anti-human HLA-E Antibody (purchased from Biolegend, catalog number 342606) staining and FITC channel flow cytometry.
[0130] As shown in Figure 3, Figure 3 is a flow cytometry diagram of HLA-E trimer expression in 293T cells after transfection with different plasmids in this embodiment. As shown in Figure 3, compared with the MocK group (without plasmid transfection), the double-positive cell populations of 293T cells in all transfection groups were obvious, and all successfully overexpressed exogenous HLA-E trimer.
[0131] Example 5: Construction of T cells expressing exogenous HLA-E trimer protein
[0132] The second-generation lentiviral packaging system prepared a plasmid mixture according to the following ratio: psPAX2 (Addgene, catalog number 12260): pMD2.G (Addgene, catalog number 12259): target plasmid (the plasmid expressing wild-type HLA-E trimer and mutant HLA-E trimer constructed in Example 3) = 3:1:4. After mixing, the mixture was added dropwise to 293T cell culture dishes. The virus was collected at 48h and 72h, respectively, and concentrated virus solution was obtained by ultrafiltration centrifugation.
[0133] T cells were obtained from PBMCs from healthy human donors via magnetic bead sorting (Stemcell, catalog number 17951). The T cells were activated using TransAct (Medrin, catalog number 130-111-160), and infected with lentivirus one day later. The medium was changed three days later to remove residual TransAct and lentivirus. Subsequently, the cells were electroporated using Cas 12a protein (IDT, 1081069) and β2M-gRNA (synthesized by GenScript, nucleotide sequence information shown in SEQ ID NO:13, SEQ ID NO:13: UAAUUUCUACUCUUGUAGAUUGGCCUGGAGGCUAUCCAGC) (Lonza, 4D-Nucleofector) to knock out the β2M molecule. The electroporation program used was CA-137. Some T cells were left untreated and considered as Mock T cells, while others underwent electroporation knockout only, i.e., β2M knockout T cells (β2M-KO). The remaining experimental groups expressed exogenous natural or mutant HLA-E trimer and underwent β2M knockout, namely: T cells expressing exogenous natural HLA-E trimer (HLA-E-WT) and T cells expressing mutant HLA-E trimer (HLA-E-DTB). 1) There are 13 types of T cells, including those expressing mutant HLA-E trimer (HLA-E-M6), mutant HLA-E trimer (PDGFR-βTM), mutant HLA-E trimer (PDGFR-βTM1), mutant HLA-E trimer (PDGFR-βTM2), mutant HLA-E trimer (PDGFR-βTM3), mutant HLA-E trimer (PDGFR-βTM4), mutant HLA-E trimer (PDGFR-βTM5), mutant HLA-E trimer (PDGFR-βTM6), and mutant HLA-E trimer (PDGFR-βTM7). After 72 hours of electroporation, the overexpression efficiency of exogenous HLA-E in T cells was analyzed by APC anti-human HLA-E Antibody (purchased from Biolegend, catalog number 342606) staining and FITC channel flow cytometry. The β2M knockout efficiency of T cells was analyzed by APC anti-human β2-microglobulin (purchased from Biolegend, catalog number 395712) staining and FITC channel flow cytometry.
[0134] Please refer to Figures 4, 5, and 6 for the results. Figures 4 and 5 are flow cytometry plots of HLA-E trimer expression after T cells were transfected with lentivirus in this embodiment, and Figure 6 is a plot of β2M knockout efficiency 72 h after T cell electroporation in this embodiment. The results show that all experimental groups successfully overexpressed exogenous HLA-E trimer and successfully knocked out β2M molecules (knockout efficiency >85%).
[0135] Example 6: Continuous flow cytometry detection of HLA-E trimer expression in T cells of different groups at different time points in Example 5.
[0136] Example 5: All T cells in all groups were continuously cultured, counted every 2 days, and the density was maintained at 5 × 10⁶ cells / day by replenishing or changing the medium. 5 / mL to 1×10 6 The expression of HLA-E trimer in lentivirally positive (GFP-positive) T cells was detected by flow cytometry on days 4, 8, and 12 after T cell activation.
[0137] Please refer to Figure 7 for the results. Figure 7 shows the relative expression rate of HLA-E trimer (GFP) in T cells of each group at different time points. + Figure 1. The results showed that with prolonged culture time, the expression rate of HLA-E trimer in T cells of the HLA-E-WT and HLA-E-DTB1 groups significantly decreased. Compared with the HLA-E-WT group, the decrease in HLA-E trimer expression rate in the HLA-E-M6, PDGFR-βTM, PDGFR-βTM M1, PDGFR-βTM M2, PDGFR-βTM M3, PDGFR-βTM M4, PDGFR-βTM M5, PDGFR-βTM M6, and PDGFR-βTM M7 groups was significantly less, showing a statistically significant difference compared to the HLA-E-WT group. ** (P < 0.01). The relative expression rates of exogenous HLA-E trimers in the HLA-E-M6 and PDGFR-βTM groups after M6 mutation or PDGFR-β transmembrane region modification remained above 70% on day 12. The relative expression rate of exogenous HLA-E trimers after point mutation at the α3 subunit and / or HLA-Ehinge of the HLA-E heavy chain based on PDGFR-β transmembrane region modification was above 80%. Among them, the exogenous HLA-E structure of the PDGFR-βTM M4, PDGFR-βTM M5, PDGFR-βTM M6, and PDGFR-βTM M7 groups was consistently maintained above 90%. This indicates that the mutation of the wild-type HLA-E heavy chain according to the present invention can improve the expression stability of HLA-E trimers and make the expression of HLA-E trimers more persistent.
[0138] Example 7: Anti-NK immune rejection experiment on T cells from each group in Example 5.
[0139] In Example 5, T cells and NK92-MI cells from each group overexpressing the various mutant exogenous HLA-E trimers were seeded into 96-well U-shaped plates at a 1:1 E:T ratio. The culture medium was RPMI 1640 + 10% FBS, 2 × 10⁶ cells / well. 5 Cells. The expression of GFP, CD3, HLA-E trimer and β2M in the cell population was detected at 0h and 96h, respectively. The proportion of T cells and NK92 cells after co-culturing with different treatments was also detected (NK92 cells, GFP... - CD3 - β2M + GFP in T cells of each experimental group + CD3 + β2M - The changes in HLA-E trimer were investigated to detect the effect of each mutant on the immune rejection of NK cells.
[0140] Please refer to Figures 8 and 9 for the results. Figure 8 shows the killing ratio of T cells and NK92-MI cells in each group after 48 hours of co-culture. Figure 9 shows the GFP content of T cells and NK92-MI cells in each group after 48 hours of co-culture. + HLA-E + The graph shows the change in the proportion of β2M-positive cells in the total cell population. The results indicate that, compared to the β2M-KO group which only underwent β2M knockout without exogenous HLA-E trimer expression, exogenous expression of wild-type HLA-E trimer and various mutant HLA-E trimers all possessed anti-immune rejection function against NK92 cells, reducing the latter's killing rate against β2M-negative cells, and the differences were statistically significant. ## P < 0.01. Compared with the HLA-E-WT group, the kill ratios of the HLA-E-M6 group, PDGFR-βTM group, PDGFR-βTM M1 group, PDGFR-βTM M2 group, PDGFR-βTM M3 group, PDGFR-βTM M4 group, PDGFR-βTM M5 group, PDGFR-βTM M6 group, and PDGFR-βTM M7 group were significantly lower, showing statistically significant differences compared with the HLA-E-WT group. ** P < 0.01 indicates that the above mutation of the wild-type HLA-E heavy chain can enhance the immune rejection function of cells expressing HLA-E trimer against NK cells.
[0141] After co-culturing with NK92 cells for 48 hours, cells that failed to overexpress GFP were killed, and the total cell population showed a decrease in GFP levels. + HLA-E + The proportion of double-positive cells will change, and GFP cells co-cultured for 0 hours will be affected.+ HLA-E + The percentage of positive double-positive cells in the total cell population was used as a reference (set as 100%) to obtain GFP after co-culturing for 48 hours. + HLA-E + The changes in the proportion of double-positive cells in the total cell population are shown in Figure 9. Compared with the HLA-E-WT group, the proportion of GFP in the HLA-E-M6 group, PDGFR-βTM group, PDGFR-βTM M1 group, PDGFR-βTM M2 group, PDGFR-βTM M3 group, PDGFR-βTM M4 group, PDGFR-βTM M5 group, PDGFR-βTM M6 group, and PDGFR-βTM M7 group was significantly higher. + HLA-E + The proportion of double-positive cells in the total cell population was significantly higher, and the difference was statistically significant. ** P < 0.01, further indicating that the above mutation of the wild-type HLA-E heavy chain can enhance the immune rejection function of cells expressing HLA-E trimer against NK cells.
[0142] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A mutant HLA-E heavy chain, characterized in that, The mutant HLA-E heavy chain is obtained by at least one modification of a wild type HLA-E heavy chain.
2. The mutant HLA-E heavy chain of claim 1, wherein The modification comprises substitution or deletion of at least one amino acid of the extracellular domain of the wild type HLA-E heavy chain.
3. The mutant HLA-E heavy chain of claim 2, wherein The modification comprises substitution or deletion of at least one amino acid corresponding to amino acids 261-289 of the wild type HLA-E heavy chain; preferably, the modification comprises substitution or deletion of at least one amino acid corresponding to amino acids 266-284 of the wild type HLA-E heavy chain.
4. The mutant HLA-E heavy chain of claim 3, wherein The mutant HLA-E heavy chain is obtained by at least one modification of a wild type HLA-E heavy chain. a. amino acids 266-269 are mutated from LPEP to QDEA; b. amino acid 282 is mutated from I to A; c. amino acid 272 is mutated from L to A; d. amino acid 279 is mutated from Q to A; e. amino acid 276 is mutated from P to A; f. amino acid 280 is mutated from P to A; g. amino acid 281 is mutated from T to A; h. amino acids 281-284 are deleted.
5. The mutant HLA-E heavy chain of any of claims 1 to 4, wherein, The modification comprises substitution of the transmembrane domain of the wild type HLA-E heavy chain with a transmembrane domain of a protein having more than 24 amino acids.
6. The mutant HLA-E heavy chain of claim 5, wherein The modification comprises substitution of the transmembrane domain of the wild type HLA-E heavy chain with a PDGFR-beta transmembrane domain.
7. The mutant HLA-E heavy chain of claim 6, wherein The mutant HLA-E heavy chain is obtained by at least one modification of a wild type HLA-E heavy chain. (1) substitution of the transmembrane domain of the wild type HLA-E heavy chain with a PDGFR-beta transmembrane domain and mutation of amino acid 272 from L to A; (2) substitution of the transmembrane domain of the wild type HLA-E heavy chain with a PDGFR-beta transmembrane domain and mutation of amino acid 279 from Q to A; (3) substitution of the transmembrane domain of the wild type HLA-E heavy chain with a PDGFR-beta transmembrane domain and mutation of amino acid 276 from P to A; (4) substitution of the transmembrane domain of the wild type HLA-E heavy chain with a PDGFR-beta transmembrane domain and mutation of amino acid 280 from P to A; (5) substitution of the transmembrane domain of the wild type HLA-E heavy chain with a PDGFR-beta transmembrane domain and mutation of amino acid 281 from T to A; (6) substitution of the transmembrane domain of the wild type HLA-E heavy chain with a PDGFR-beta transmembrane domain and mutation of amino acid 282 from I to A; (7) substitution of the transmembrane domain of the wild type HLA-E heavy chain with a PDGFR-beta transmembrane domain and deletion of amino acids 281-284 TIPI.
8. The mutant HLA-E heavy chain of claim 7, wherein The amino acid sequence of the PDGFR-beta transmembrane domain is set forth in SEQ ID NO:
2.
9. The mutant HLA-E heavy chain of claim 7, wherein The amino acid sequence of the mutant HLA-E heavy chain has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOS: 3-12; and / or the amino acid sequence of the mutant HLA-E heavy chain is at least one, at least two, or at least three conservative amino acid substitutions from the amino acid sequence set forth in any one of SEQ ID NOs: 3-12.
10. The mutant HLA-E heavy chain of claim 1, wherein the amino acid sequence of the wild-type HLA-E heavy chain is set forth in SEQ ID NO:
1.
11. An HLA-E trimer, characterized in that, comprises a presentation peptide, a b2M, and the mutant HLA-E heavy chain of any one of claims 1-10.
12. The HLA-E trimer of claim 11, wherein, the HLA-E trimer is a single chain trimer, and further comprises a linker sequence; the linker sequence is for linking the presentation peptide and the b2M, and linking the b2M and the mutant HLA-E heavy chain; Preferably, the HLA-E single chain trimer comprises, in order from N-terminus to C-terminus: a presentation peptide-linker sequence-b2M-linker sequence-mutant HLA-E heavy chain.
13. The HLA-E trimer of claim 11, wherein, the presentation peptide is a signal peptide or a fragment thereof of a class I MHC molecule; the class I MHC molecule is selected from the group consisting of heavy chains of HLA-A1, HLA-A2, HLA-A*3401, HLA-A*80, HLA-B7, HLA-B*13, HLA-B15, HLA-Cw3, HLA-Cw*2, HLA-Cw*0809, HLA-Cw7, HLA-Cw*1701, HLA-G, and HLA-F.
14. An isolated nucleic acid, comprising: the nucleic acid encodes the mutant HLA-E heavy chain of any one of claims 1-10 and / or the HLA-E trimer of any one of claims 11-13.
15. A vector, characterized in that, the vector comprises the nucleic acid of claim 14; Preferably, the vector is a plasmid, cosmid, phage, or viral vector.
16. A gene expression cassette comprising, the genetic expression cassette comprises a promoter and the nucleic acid of claim 14.
17. A cell, comprising: the cell expresses the mutant HLA-E heavy chain of any one of claims 1-10 and / or the HLA-E trimer of any one of claims 11-13.
18. The cell of claim 17, wherein the cell is an immune effector cell and / or a precursor cell thereof; Preferably, the immune effector cell is one or more of a T cell, an NK cell, an NKT cell, a mast cell, a macrophage, a dendritic cell, a CIK cell, and a stem cell-derived immune effector cell; Preferably, the immune effector cell expresses a synthetic receptor selected from the group consisting of a CAR, a TCR, a TRuC, a TAC, an AbTCR, and a chimeric CD3 receptor; Preferably, the extracellular domain of the CAR targets a tumor antigen; more preferably, the tumor antigen is selected from GPC3, CLDN18.2, GCC, EGFRvIII, ROR1, CLDN6, MSLN, ALPP, MUC1, LGR5, HER2, OR2H1, DLL-3, C-MET, glyco-cMET, glyco-LAMP1, CD123, CD33, CLL-1, CD70, CD38, FLT3, and GRP78.
19. The cells of claim 17, wherein the cell lacks endogenous expression of at least one gene encoding a class I MHC molecule or MHC-like molecule on the cell surface; Preferably, the cell lacks endogenous expression of beta2M on the surface of the cell.
20. The method for preparing cells according to any one of claims 17-19, characterized in that, comprising the steps of: introducing into the cell a vector as claimed in claim 15 or a gene expression cassette as claimed in claim 16.
21. A method of avoiding killing of a cell by an NK cell, the method comprising, comprising the step of expressing in a cell a mutant HLA-E heavy chain as claimed in any one of claims 1 to 10 and / or a HLA-E trimer as claimed in any one of claims 11 to 13.
22. Use of a mutant HLA-E heavy chain as claimed in any one of claims 1 to 10, a HLA-E trimer as claimed in any one of claims 11 to 13, a nucleic acid as claimed in claim 14, a vector as claimed in claim 15, a gene expression cassette as claimed in claim 16 and / or a cell as claimed in any one of claims 17 to 19 for the manufacture of a drug for allogenic transplantation.
23. Use of a mutant HLA-E heavy chain as claimed in any one of claims 1 to 10, a HLA-E trimer as claimed in any one of claims 11 to 13, a nucleic acid as claimed in claim 14, a vector as claimed in claim 15, a gene expression cassette as claimed in claim 16 and / or a cell as claimed in any one of claims 17 to 19 for the manufacture of a drug for the prevention and / or treatment of a tumor; Preferably, the tumor comprises a solid tumor and a non-solid tumor; more preferably, the solid tumor is selected from the group consisting of liver cancer, stomach cancer, lung cancer, breast cancer, head and neck cancer, bladder cancer, ovarian cancer, cervical cancer, kidney cancer, pancreatic cancer, cervical cancer, liposarcoma, melanoma, adrenal cancer, schwannoma, malignant fibrous histiocytoma and esophageal cancer; the non-solid tumor is selected from the group consisting of B lymphoma, Hodgkin's lymphoma, chronic myeloid leukemia and acute myeloid leukemia.
24. A method of preventing and / or treating a tumor in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of any one of claims 1-23, or a pharmaceutically acceptable salt thereof. The method comprises administering to a patient in need thereof an effective amount of a cell as claimed in any one of claims 17 to 19; Preferably, the tumor comprises a solid tumor and a non-solid tumor; more preferably, the solid tumor is selected from the group consisting of liver cancer, stomach cancer, lung cancer, breast cancer, head and neck cancer, bladder cancer, ovarian cancer, cervical cancer, kidney cancer, pancreatic cancer, cervical cancer, liposarcoma, melanoma, adrenal cancer, schwannoma, malignant fibrous histiocytoma and esophageal cancer; the non-solid tumor is selected from the group consisting of B lymphoma, Hodgkin's lymphoma, chronic myeloid leukemia and acute myeloid leukemia.
25. A composition for preventing and / or treating a tumor, comprising: a) a compound according to any one of claims 1 to 23; and b) a pharmaceutically acceptable carrier. The composition comprises a mutant HLA-E heavy chain as claimed in any one of claims 1 to 10, a HLA-E trimer as claimed in any one of claims 11 to 13, a nucleic acid as claimed in claim 14, a vector as claimed in claim 15, a gene expression cassette as claimed in claim 16 and / or a cell as claimed in any one of claims 17 to 19; Preferably, the tumor comprises a solid tumor and a non-solid tumor; more preferably, the solid tumor is selected from the group consisting of liver cancer, stomach cancer, lung cancer, breast cancer, head and neck cancer, bladder cancer, ovarian cancer, cervical cancer, kidney cancer, pancreatic cancer, cervical cancer, liposarcoma, melanoma, adrenal cancer, schwannoma, malignant fibrous histiocytoma and esophageal cancer; the non-solid tumor is selected from the group consisting of B lymphoma, Hodgkin's lymphoma, chronic myeloid leukemia and acute myeloid leukemia.
Citation Information
Patent Citations
HLA class i-deficient NK-92 cells with decreased immunogenicity
CN109804064A
Chimeric polypeptides and uses thereof
CN112830973A
Hla-E Chimeric Molecule
US20070259403A1
MHC: peptide complexes
US20240076350A1
HLA-e binding
WO1999028748A2