Ribonucleic acid compound capable of triggering gene silencing
By designing a non-brittle linker for ribonucleic acid compounds, the problem of forming a RISC complex in cells with dual siRNA trigger molecules was solved, achieving multi-target gene silencing effects and long-term stability, while reducing the difficulty and cost of synthesis.
Patent Information
- Application Number
- PCT/CN2025/110712
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-07-24
- Filing Date
- 2025-07-25
- Publication Date
- 2026-01-29
AI Technical Summary
Existing chemically coupled dual siRNA trigger molecules are difficult to form RISC complexes effectively in cells, resulting in poor drug efficacy. Furthermore, their synthesis is difficult and costly, and they cannot achieve synergistic inhibition of multiple targets.
A ribonucleic acid compound was designed to link the sense strand of the first trigger to the antisense strand of the second trigger via a non-fragile linker, thereby enhancing molecular stability and activity, avoiding metabolism by 5' exonuclease, and achieving synergistic pharmacological effects of the dual-trigger siRNA molecule.
It improves the gene silencing effect of ribonucleic acid compounds, with significant safety and long-term efficacy, and is suitable for multi-target gene regulation.
Smart Images

Figure CN2025110712_29012026_PF_FP_ABST
Abstract
Description
Ribonucleic acid compounds capable of triggering gene silencing TECHNICAL FIELD
[0001] The present application relates to a class of ribonucleic acid compounds capable of triggering gene silencing and their use. BACKGROUND
[0002] RNA interference (RNAi) refers to a highly conserved phenomenon in the evolutionary process, which is induced by double-stranded RNA (dsRNA) and is the efficient and specific degradation of homologous mRNA. The biological process of RNA molecules inhibits the expression of a certain gene by destroying specific mRNA. Because the use of RNAi technology can specifically eliminate or close the expression of a specific gene, this technology has rapidly become one of the most concerned research tools in the field of gene function research and gene therapy research, and has been widely used in the field of exploring gene function, metabolic diseases and infectious diseases and the treatment of malignant tumors.
[0003] However, inhibition by a single target sometimes cannot achieve the desired therapeutic effect, and it is necessary to simultaneously regulate two or more pathways in the same cell. In this case, the method of separately administering two siRNA drugs to the same patient usually fails to achieve the desired therapeutic effect. This may be due to the influence of PK, which causes the drug concentrations of the two siRNA drugs in the same cell to be different, and cannot achieve effective simultaneous inhibition of two targets in the same cell to achieve synergistic effect.
[0004] One of the solutions to the above problems is to develop a chemically coupled double-siRNA trigger siRNA drug molecule. The general method of implementation is to connect two siRNA triggers through a linker. When entering the cell, the change in the cell environment (pH) or the enzyme ability (hydrolysis, oxidation reduction, etc.) is used to realize the separation of the two triggers, and then the effect is achieved. This type of scheme is to realize the synergistic drug effect through a degradable linker. However, when the linker cannot be degraded and cracked in the cell in time, the double-trigger coupled molecule as a whole cannot form a RISC complex in the cell, and thus cannot exert the drug effect. As can be seen, the drug effect of this type of double-trigger coupled siRNA molecule is highly dependent on the degradation efficiency of the linker; this puts high requirements on the structure design of the linker. At the same time, this type of double-trigger siRNA molecule chain has a relatively long length, and compared with conventional short interfering sequences, it is difficult to synthesize and has high cost, which increases the obstacle for subsequent drug development.
[0005] Another technical problem derived from the above is how to design the optimal connection mode of the two triggers. Compared with the connection mode of the sense strand and the sense strand in the existing literature, the connection mode of the sense strand of the first trigger and the antisense strand of the second trigger has strong novelty. Moreover, this connection mode can well protect the antisense strand of a trigger from being metabolized by 5' exonuclease, thereby maintaining the stability of the entire molecule and bringing stronger persistence than other technologies. This benefit is obvious. However, a literature published in 2024 (Nucleic Acids Res 2024 Vol. 52 Issue 11 Pages 6099-6113) proposed that simply connecting the sense strand of the first trigger with the antisense strand of the second trigger would cause the molecule to lose activity.
[0006] In the present technology, through special design, the sense strand of the second trigger of the double-trigger siRNA molecule is connected to the antisense strand of the first trigger through a non-fragile linker, and the molecule connected in this way shows good properties in in vivo and in vitro tests, and has broad application prospects. SUMMARY
[0007] The present application provides ribonucleic acid compounds, the structures of which are shown in Tables 1-90, respectively.
[0008] Table 1 S1 structure
[0009] Table 2 S2 structure
[0010] Table 3 S3 structure
[0011] Table 4 S4 structure
[0012] Table 5 S5 structure
[0013] Table 6 S6 structure
[0014] Table 7 S7 structure
[0015] Table 8 S8 structure
[0016] Table 8-1 S9 structure
[0017] Table 8-2 S10 structure
[0018] Table 8-3 S11 structure
[0019] Table 8-4 S12 structure
[0020] Table 8-5 S13 structure
[0021] Table 8-6 S14 structure
[0022] Table 8-7 S15 structure
[0023] Table 8-8 S16 structure
[0024] Table 8-9 S17 structure
[0025] Table 8-10 S18 structure
[0026] Table 8-11 S19 structure
[0027] Table 9 Z1 structure
[0028] Table 10 Z2 structure
[0029] Table 11 Z3 structure
[0030] Table 12 Z4 structure
[0031] Table 13 Z5 structure
[0032] Table 14 Z6 structure
[0033] Table 15 Z7 structure
[0034] The following molecules:
[0035] a: 2'-OMe Adenine Nucleoside; u: 2'-OMe Uracil Nucleoside; c: 2'-OMe Cytosine Nucleoside; g: 2'-OMe Guanine Nucleoside; Af: 2'-F Adenine Nucleoside; Uf: 2'-F Uracil Nucleoside; Cf: 2'-F Cytosine Nucleoside; Gf: 2'-F Guanine Nucleoside; (dT): Thymine Deoxyribonucleoside; (Tgn): GNA-T (GNA-5-Methyl Uracil Nucleoside, GNA-Thymine Ribonucleoside); *: phosphorothioate linkage.
[0036] Table 16 Z8 Structure
[0037] Table 17 Z9 Structure
[0038] Table 18 Z10 Structure
[0039] Table 19 Z11 Structure
[0040] Table 20 Z12 Structure
[0041] Table 21 Z13 Structure
[0042] Table 22 Z14 Structure
[0043] Table 23 Z15 Structure
[0044] Table 24 Structure of Molecule Targeting Multiple Genes
[0045] Table 25 SLN360 Structure
[0046] Table 26 Z17 Structure
[0047] Table 27 Z18 Structure
[0048] Table 28 Z19 Structure
[0049] Table 29 Z20 Structure
[0050] Table 30 Z21 Structure
[0051] Table 31 Z22 Structure
[0052] Table 32 Z23 Structure
[0053] Table 33 Z24 Structure
[0054] Table 34 Z25 Structure
[0055] Table 35 Z26 Structure
[0056] Table 36 Z27 Structure
[0057] Table 37 Z28 Structure
[0058] Table 38 Z29 Structure
[0059] Table 39 Z30 Structure
[0060] Table 40 Z31 Structure
[0061] Table 41 Z32 Structure
[0062] Table 42 Z33 Structure
[0063] Table 43 Z34 Structure
[0064] Table 44 Z35 Structure
[0065] Table 45 Z36 Structure
[0066] Table 46 Z38 Structure
[0067] Table 47 Z39 Structure
[0068] Table 50 Z42 Structure
[0069] Table 51 Z48 Structure
[0070] Table 52 Z50 Structure
[0071] Table 53 Z51 structures
[0072] Table 54 Z52 structures
[0073] Table 55 Z53 structures
[0074] Table 56 Z54 structures
[0075] Table 57 Z55 structures
[0076] Table 58 Z56 structures
[0077] Table 59 Z57 structures
[0078] Table 60 Z58 structures
[0079] Table 61 Z59 structures
[0080] Table 62 Z60 structures
[0081] Table 63 Z61 structures
[0082] Table 64 Z62 structures
[0083] Table 65 Z63 structures
[0084] Table 66 Z64 structures
[0085] Table 67 Z65 structures
[0086] Table 68 Z66 structures
[0087] Table 69 Z67 structures
[0088] Table 70 Z68 structures
[0089] Table 71 Z69 structures
[0090] Table 72 Z70 structure
[0091] Table 73 Z71 structure
[0092] Table 74 Z72 structure
[0093] Table 75 Z73 structure
[0094] Table 76 Z74 structure
[0095] Table 77 Z75 structure
[0096] Table 78 Z92 structure
[0097] Table 79 Z93 structure
[0098] Table 80 Z94 structure
[0099] Table 81 Z95 structure
[0100] Table 82 Z96 structure
[0101] Table 83 Z97 structure
[0102] Table 84 Z98 structure
[0103] Table 85 Z99 structure
[0104] Table 86 Z100 structure
[0105] Table 87 Z103 structure
[0106] Table 88 Z104 structure
[0107] Table 89 Z105 structure
[0108] Table 90 Z200 structure
[0109] The present application also provides a ribonucleic acid compound composition comprising the ribonucleic acid compound and / or the ribonucleic acid compound conjugate as described above and a pharmaceutically acceptable carrier.
[0110] The present application also provides the use of the ribonucleic acid compound, the ribonucleic acid compound conjugate and / or the ribonucleic acid compound composition as described above in the preparation of a medicament for treating a disease associated with a gene silencing mechanism.
[0111] The present application also provides some solutions which are any combination of the above variables or solutions.
[0112] Some of the compounds provided by the present application have a significant gene silencing effect, have a significant safety and long-term effectiveness. BRIEF DESCRIPTION OF DRAWINGS
[0113] Figure 1 shows the results of liver homogenate treatment of the test substance ds99.
[0114] Figure 2 shows the inhibitory activity of the test substance on liver human AGT mRNA.
[0115] Figure 3 shows the inhibitory activity of the test substance on liver human PCSK9 mRNA.
[0116] Figure 4 shows the inhibitory activity of the test substance on liver human AGT mRNA.
[0117] Figure 5 shows the inhibitory activity of the test substance on liver human PCSK9 mRNA.
[0118] Figure 6 shows the long-term inhibitory activity of the test substance on serum PCSK9 of cynomolgus monkeys.
[0119] Figure 7 shows the long-term inhibitory activity of the test substance on serum AGT of cynomolgus monkeys.
[0120] Figure 8 shows the activation of the test substance on PBMC cytokine IL-6.
[0121] Figure 9 shows the activation of the test substance on PBMC cytokine TNF-α.
[0122] Figure 10 shows the activation of the test substance on PBMC cytokine IL-1β.
[0123] Figure 11 shows the activation of the test substance on PBMC cytokine IFN-γ.
[0124] Figure 12 shows the long-term inhibitory activity of the test substance on plasma Lpa of cynomolgus monkeys.
[0125] Figure 13 shows the long-term inhibitory activity of the test substance on plasma PCSK9 of cynomolgus monkeys.
[0126] Figure 14 shows the long-term inhibitory activity of the test substance on LDL-c in cynomolgus monkey plasma.
[0127] Figure 15 shows the long-term inhibitory activity of the test substance on ApoB in cynomolgus monkey plasma.
[0128] Figure 16 shows the inhibitory activity of the test substance on the mouse liver target genes mINHBE+mINHBA.
[0129] Figure 17 shows the inhibitory activity of the test substance on the mouse liver target genes mINHBE+mMRAC1.
[0130] Figure 18 shows the inhibitory activity of the test substance on the mouse retina target genes mSOD-1+mTTR.
[0131] Figure 19 shows the inhibitory activity of the test substance on the mouse RPE layer target genes mSOD-1+mTTR.
[0132] Figure 20 is the identification result of the liver metabolites of the test substance. DETAILED DESCRIPTION
[0133] As known in the art, there are three free hydroxyl groups on the sugar ring of ribonucleosides, which can form three different nucleotides: 2'-ribonucleotide, 3'-ribonucleotide and 5'-ribonucleotide, and there are two free hydroxyl groups on the sugar ring of deoxyribonucleosides, which can form two nucleotides: 3'-deoxyribonucleotide and 5'-deoxyribonucleotide. Based on this, all other embodiments obtained by a person of ordinary skill in the art without making creative efforts according to the embodiments of the present application all belong to the technical solutions of the present application and fall within the protection scope of the present application.
[0134] DEFINITIONS
[0135] The following terms and phrases are intended to have the following meanings unless otherwise specifically indicated. A particular term or phrase should not be construed to be indefinite or unclear if not specifically defined, but should be understood according to the ordinary meaning. When a trade name appears herein, it is intended to refer to the corresponding product or its active ingredient.
[0136] As used herein, "optionally," "optional" or "optionally" mean the event or circumstance that follows the word optionally can or can not occur, and the description includes instances where the event or circumstance occurs and instances where it does not. For example, "optionally substituted alkyl" or "alkyl optionally substituted" includes "alkyl" (H on the alkyl is not replaced / substituted by a non-H substituent) and "substituted alkyl" (H on the alkyl is replaced / substituted by a non-H substituent). As used herein, it will be understood by those skilled in the art that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is sterically impractical, synthetically impractical, and / or unstable in itself. For example, "optionally modified" includes unmodified and modified, further, "nucleotides optionally modified" includes nucleotides unmodified and nucleotides modified.
[0137] As used herein, when any variable (e.g., substituent R, e.g., nucleic acid modification) occurs more than one time in a compound, its definition in each occurrence is independent of its definition at every other occurrence. For example, if a group is substituted with 0-2 R, then the group can optionally be substituted up to two times with R, and the R at each occurrence is selected independently of the R at every other occurrence. As another example, when multiple nucleotides are modified, each nucleotide is independently optionally modified, and the type and number of modifications for each nucleotide can be the same or different.
[0138] As used herein, unless otherwise indicated, "comprising," "including," "at least," "has," "have," "has at least," "including," or "contains" or the like are to be construed as open-ended and to mean that additional unrecited elements, components, or steps can be present in addition to those listed.
[0139] As used herein, "subject" refers to any animal, such as a mammal or a marsupial. Subjects of the present application include, but are not limited to, a human, a non-human primate (e.g., a rhesus or other type of macaque monkey), a mouse, a pig, a horse, a cow, a rat, or any species of poultry.
[0140] As used herein, "treatment" refers to an approach for obtaining beneficial or desired results, including but not limited to therapeutic benefit. "Therapeutic benefit" means eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the subject, notwithstanding the fact that the subject can still be afflicted with the underlying disorder.
[0141] As used herein, the term "nucleotide" refers to a base linked to a sugar, its phosphate group is covalently linked to the sugar moiety, and is intended to include natural (i.e., unmodified) nucleotides and modified nucleotides. In some embodiments, the nucleotide is an unmodified ribonucleotide. In some embodiments, the ribonucleotide is a 3'-ribonucleotide. In some embodiments, the ribonucleotide is a 5'-ribonucleotide. In some embodiments, the modified or unmodified nucleotide can optionally be further modified.
[0142] Natural nucleotides are composed of natural bases, natural ribose, and phosphate. As used herein, natural nucleotides refer to adenine ribonucleotides, adenine deoxyribonucleotides, guanine ribonucleotides, guanine deoxyribonucleotides, cytosine ribonucleotides, cytosine deoxyribonucleotides, uracil ribonucleotides, thymine ribonucleotides, or thymine deoxyribonucleotides. "Ribonucleotides" refer to nucleotides having a hydroxyl group at the 2' position of the sugar moiety of the nucleotide. "Deoxyribonucleotides" refer to nucleotides having a hydrogen at the 2' position of the sugar moiety of the nucleotide.
[0143] Natural bases of RNA include A (adenine), G (guanine), C (cytosine), U (uracil), and T (thymine).
[0144] As used herein, unless otherwise indicated, the nucleotides "G", "C", "A", "T", and "U" each refer to natural or modified nucleotides containing guanine, cytosine, adenine, thymine, and uracil as the base, respectively.
[0145] Nucleotides can be substituted with analogs thereof, including natural and non-natural analogs. Examples of guanosine analogs include 6-thioguanosine, 8-azaguanosine, 8-oxoguanosine, 2-aminopurine nucleosides, and the like. Examples of adenosine analogs include vermiculine (3'-deoxyadenosine), n6-benzyladenosine, 2-chloroadenosine, and the like. Examples of cytidine analogs include gemcitabine (2',2'-difluoro-2'-deoxycytidine), cytarabine (1-β-d-arabinofuranosylcytosine), decitabine (5-aza-2'-deoxycytidine), and the like. Examples of uracil analogs include 5-fluorouracil, pseudouracil, 5-bromouracil, 4-thiouracil, 5-azouracil, and the like.
[0146] As used herein, "ribonucleic acid" (RNA) is a carrier of genetic information found in cells and some viruses and viroids. RNA is composed of ribonucleotides linked by internucleotide bonds to form a chain, including single-stranded RNA and double-stranded RNA. The natural internucleotide bond is a phosphodiester bond.
[0147] As used herein, the term "modified nucleotide" refers to a nucleotide having at least a modified base, a modified sugar, or a modified phosphate group that can form a modified internucleotide linkage. In some embodiments, a modified nucleotide can comprise one, two, three, or more modifications. In some embodiments, a nucleotide can comprise one modification. In some embodiments, a nucleotide can comprise two modifications. In some embodiments, a nucleotide can comprise three modifications.
[0148] As used herein, "double-stranded ribonucleic acid" is a complex comprising two nucleic acid strands comprising anti-parallel and substantially complementary sequences, the substantially meaning that the two nucleic acid strands can comprise a number of base mismatches and non-pairs in their anti- complementary regions on the basis of maintaining function, bonded by natural or unnatural nucleotides. In some aspects of the application, the number refers to 1, 2, or 3.
[0149] As used herein, the term "oligonucleotide" refers to a nucleic acid molecule (RNA or DNA) of, for example, less than 100, 200, 300, or 400 nucleotides in length.
[0150] As used herein, "bonded" refers to the connection between the residues (e.g., nucleotide residues) of two monomers (e.g., nucleotides) by a single bond or a group (e.g., by a phosphodiester bond, a phosphorothioate bond, or a disulfide bond). In some aspects of the application, the bonded refers to the connection between the residues (e.g., nucleotide residues) of two monomers (e.g., nucleotides) by a phosphodiester bond, a phosphorothioate bond, or a disulfide bond. In some aspects of the application, when two nucleotides are connected by a bond or one nucleotide is connected to another nucleotide by a bond, it refers to the residues (nucleosides) of the two nucleotides are connected by a phosphodiester bond, in other words, it refers to the residues (nucleosides) of one nucleotide are connected by a single bond to the residues (nucleosides) of another nucleotide form Further, the phosphodiester bond is optionally modified as a phosphorothioate bond.
[0151] As used herein, "monomer" is a class of compounds that can be assembled into a ribonucleic acid chain and can play a certain role. As used herein, "monomer" includes but is not limited to natural nucleotides, unnatural nucleotides (such as: modified nucleotides, nucleotide analogs, inverted abasic deoxyribonucleotides, GNAs, LNAs, etc.), M06, delivery systems, ligand groups or conjugate groups, structural units (e.g., L).
[0152] Two monomers can be connected by an "internucleosidic linkage," including but not limited to between two nucleosides, between one nucleoside and one ligand, between one nucleoside and one capping group, between one nucleoside and one abasic nucleoside, and between a nucleoside and a structural unit (e.g., L). Each internucleosidic linkage can be, independently, optionally modified or unmodified. Examples of internucleosidic linkages include phosphodiester linkages, phosphorothioate linkages, and phosphorodithioate linkages. In some embodiments, the internucleosidic linkage is not a nuclease-resistant internucleosidic linkage (e.g., phosphorothioate linkage, phosphorodithioate linkage). In some embodiments, the internucleosidic linkage is a nuclease-resistant internucleosidic linkage (e.g., phosphorothioate linkage, phosphorodithioate linkage).
[0153] As used herein, "inhibit" means that expression of a given gene is reduced when a cell, cell population, or tissue is treated with a single / double stranded ribonucleic acid, single / double stranded ribonucleic acid conjugate, single / double stranded ribonucleic acid compound, single / double stranded ribonucleic acid compound conjugate, or pharmaceutical composition comprising one or more of them as described herein, as compared to a cell, cell population, or tissue that has not been so treated. The terms "inhibit," "reduce," "silence," "down-regulate," "suppress," and other similar terms are used interchangeably herein and include inhibition at any level. Preferably, inhibition includes statistically significant inhibition or clinically significant inhibition.
[0154] As used herein, "conjugate" means that two or more chemical moieties, each having a particular function, are connected to each other in a covalent linkage; correspondingly, "conjugate" means a compound formed by the covalent linkage between the individual chemical moieties. For example, "double stranded ribonucleic acid conjugate" means a compound or complex formed by covalent linkage of one or more chemical moieties having a particular function (e.g., a delivery system, a ligand group, or a conjugating group) to a double stranded ribonucleic acid. In some embodiments of the first, second, third, and fourth aspects of the application, the delivery system, ligand group, or conjugating group can be linked to a phosphate group, sugar ring (including covalent linkage of the delivery system, ligand group, or conjugating group to an atom at the 3' or 5' position of the nucleotide via a phosphodiester linkage), 2'-position hydroxyl group, 5'-position hydroxyl group, or base of any nucleotide of the double stranded ribonucleic acid. In some embodiments of the first, second, third, and fourth aspects of the application, the delivery system, ligand group, or conjugating group can also be linked to the 2'-position of a nucleotide, in some embodiments with 2'-5' phosphodiester linkages between nucleotides. In some embodiments of the first, second, third, and fourth aspects of the application, the delivery system, ligand group, or conjugating group can also be linked to the 3'-position of a nucleotide, in some embodiments with 3'-5' phosphodiester linkages between nucleotides.
[0155] As used herein, "complementary" or "reverse complementary" can be used interchangeably to refer to the structural relationship between two nucleotides (e.g., on two opposite nucleic acid strands or on opposite regions of a single nucleic acid strand) that allows the two nucleotides to form base pairs with each other (e.g., purine nucleotides of one nucleic acid complementary to pyrimidine nucleotides of the opposite nucleic acid can form base pairs together by hydrogen bonding to each other). In some aspects of the application, complementary nucleotides can base pair in a Watson-Crick manner or in any other manner that allows for the formation of a stable duplex. In some aspects of the application, two nucleic acid strands can have multiple regions that form complementary duplexes. In some aspects of the application, in DNA, adenine (A) always pairs with thymine (T), and in RNA, adenine (A) pairs with uracil (U); guanine (G) always pairs with cytosine (C). In some aspects of the application, complementary nucleotides can also include or be formed entirely from non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogstein base pairing. In some aspects of the application, nucleotides containing Hypoxanthine as their base can base pair with nucleotides containing adenine, cytosine, or uracil. In some aspects of the application, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of the application with nucleotides containing, for example, inosine (in the application, the capital letter "I" can represent a hypoxanthine base, inosine, or an inosine-containing nucleotide depending on its context) (this replacement is referred to as an I modification). In some aspects of the application, adenine and cytosine anywhere in an oligonucleotide can be replaced with guanine and uracil, respectively, to form G-U wobble base pairs with a target mRNA.
[0156] The degree of complementarity between one oligonucleotide and another oligonucleotide is referred to as complementarity and is measured by the percentage of bases in each strand that can hydrogen bond with one another, according to the standard base pairing rules. An oligonucleotide sequence need not be "perfectly complementary" (i.e., "perfectly complementary") to its corresponding nucleic acid sequence. For example, a first nucleotide sequence can be considered complementary to a second nucleotide sequence if it exhibits some degree of sequence complementarity, such as at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%. In an exemplary embodiment, 18 of 20 nucleobases of a first nucleotide sequence pair with the corresponding region of a second nucleotide sequence, achieving 90% complementarity. Non-complementary nucleobases, also referred to as "mismatches," can be clustered or interspersed with complementary bases, and need not be adjacent to, or next to, complementary nucleobases.
[0157] As used herein, "mismatch" includes, but is not limited to:
[0158] 1) two opposing (independent natural or unnatural) nucleotides pair (other than A-T, A-U or G-C);
[0159] 2) no hydrogen bond is formed between two opposing (independent natural or unnatural) nucleotides;
[0160] 3) absence of a base between two opposing (independent natural or unnatural) nucleotides.
[0161] In some embodiments, a mismatch includes wobble base pairing and Hoogstein base pairing.
[0162] The term "fully complementary" refers to a first nucleotide sequence and a second nucleotide sequence forming a hybrid in a region of complete complementarity consisting only of Watson-Crick base pairs. An oligonucleotide that is "sufficiently complementary" can include an internal region (e.g., at least 7, 8, 9, or 10 nucleotides) that is fully complementary to the target RNA. In some embodiments, a first targeting region contained in a first fragment provided herein is sufficiently complementary to a portion of a target mRNA encoding a first target gene. In some embodiments, the first targeting region has at least 80%, 85%, 90%, or 95% complementarity to a portion of a target mRNA encoding a first target gene. In some embodiments, the first targeting region has 100% complementarity (is fully complementary) to a portion of a target mRNA encoding a first target gene. In some embodiments, a second targeting region contained in a fourth fragment provided herein is sufficiently complementary to a portion of a target mRNA encoding a second target gene. In some embodiments, the second targeting region has at least 80%, 85%, 90%, or 95% complementarity to a portion of a target mRNA encoding a second target gene. In some embodiments, the second targeting region has 100% complementarity (is fully complementary) to a portion of a target mRNA encoding a second target gene.
[0163] As used herein, a "modification" of a nucleotide includes, but is not limited to, a 2'-OMe (2'-O-methyl) modification, a 2'-F (2'-deoxy-2'-fluoro) modification, a 2'-O-MOE (2'-O-methoxyethyl) modification, a 2'-deoxy (2'-d) modification, a 5'-morpholino (5'-Mo) modification, a 2'-O-hexadecyl (C16) modification, an unlocked nucleic acid (UNA) modification, a glycol nucleic acid (GNA) modification, a locked nucleic acid (LNA) modification, a tricyclo-DNA (tcDNA) modification, a (S)-constrained ethyl bicyclic nucleic acid ((S)-cEt-BNA) modification, a phosphorothioate (PS) modification, a phosphorodithioate (PS2) modification, a methylphosphonate (MP) modification, a methoxypropylmethylphosphonate (MOP) modification, a peptide nucleic acid (PNA) modification, a 5'-(E)-vinylphosphonate (VP) modification (VP), a N6-methyladenosine (m6A) modification, a 5-methylcytidine (m5C) modification, a 3-methyluracil nucleoside (m3U) modification, a 5-methyluridine (m5U) modification, a pseudouridine modification, a 2-thiouridine (s2U) modification, a propynyluracil nucleoside (5-pU) modification, an abasic nucleotide with inverted linkage at the 5' or 3' end of the nucleotide (invAB) modification, a nucleotide replaced with an inverted abasic nucleotide (invAb) modification, a nucleotide replaced with a 2,4-difluorophenylribo nucleotide (rF) modification, a nucleotide replaced with a (S)-glycerol nucleic acid modification, a nucleotide replaced with a hypoxanthine nucleotide (I), a M06 modification with inverted linkage at the 5' or 3' end of the nucleotide (M06), and the like. In some aspects of the application, a nucleotide can comprise one, two, three, or more modifications. In some aspects of the application, a nucleotide can comprise one modification. In some aspects of the application, a nucleotide can comprise two modifications. In some aspects of the application, a nucleotide can comprise three modifications.
[0164] As used herein, in some aspects, "G," "A," "C," "U," and "T" refer to guanine ribonucleotides, cytosine ribonucleotides, adenine ribonucleotides, uracil ribonucleotides, and thymine ribonucleotides, respectively. Exemplary structures are as follows:
[0165] In some aspects, the nucleotides are synthesized according to phosphoramidite solid phase synthesis techniques, wherein "G," "A," "C," "U," and "T" are linked at position 1 of the 5' end of the chain
[0166] " G," "A," "C," "U," and "T" are linked at position 1 of the 3' end of the chain
[0167] As used herein, the prefix "d" before a monomer (such as nucleotides A, U, C, G, and T) indicates that the monomer is 2'-deoxy modified. An example nucleotide structure with 2'-deoxy modification is shown below:
[0168] As used herein, the "f" label following a monomer (such as nucleotides A, U, C, G, and T) indicates that the monomer is 2'-deoxy-2'-fluorine modified (2'-F modified). An example nucleotide structure with 2'-F modification is shown below:
[0169] As used herein, the prefix "GNA-" before monomers (such as nucleotides A, U, C, G, and T) indicates that the monomer has been modified with ethylene glycol-based nucleic acids (GNA modification). As used herein, Tgn is the abbreviation for GNA-T, with the same meaning. An example of a GNA-modified nucleotide structure is shown below:
[0170] As used herein, lowercase letters (a, u, c, g, t, etc.) indicate that the nucleotide represented by the corresponding uppercase letters (A, U, C, G, and T, etc.) is modified with 2'-O-methyl (2'-OMe). An example nucleotide structure modified with 2'-OMe is shown below:
[0171] As used herein, invAB modification refers to the attachment of an inverted, baseless deoxynucleotide to a monomer (e.g., at the 5' or 3' end of the nucleotide). For example, The structure modified by invAB:
[0172] As used herein, invAb modification refers to the replacement of a monomer (such as a nucleotide) with an inverted, non-basic nucleotide (invAb). For example, The structure modified by invAb:
[0173] As used herein, VP modification refers to the modification of a monomer by (E)-vinyl phosphate (e.g., modification of the 5' position of a nucleotide by 5'-(E)-vinyl phosphate). For example, the structures of U, u, and dU after modification are as follows:
[0174] As used in this article, M06 modification refers to the bonding of a linker at the 5' or 3' end of a monomer (such as a nucleotide). For example, Structure modified by M06: In some schemes of this application, M06 is through It is bonded to a nucleotide.
[0175] As used herein, Uhd represents a 2'-0-C16alkyl modified uracil ribonucleotide:
[0176] As used herein, the notation "*" between monomers (such as nucleotides A, U, C, G and T, etc.) indicates that the two monomers (residues, i.e., nucleosides) are linked by a phosphorothioate linkage (i.e., a phosphorodithioate linkage), i.e., are modified by a phosphorothioate (PS).
[0177] As used herein, the absence of the notation "*" between nucleotides (A, U, C, G and T, etc.) indicates that the two nucleotides are linked by a phosphate linkage (i.e., a phosphodiester linkage).
[0178] As used herein, indicates a chemical linkage (such as a single bond) between the indicated moieties.
[0179] By way of example, the structural unit combined together indicates the structure is
[0180] By way of example, the structural unit combined together indicates the structure is "ug*cucaac*u*(dT)".
[0181] By way of example, as shown in "5'-AdUgCf*dT-3'", the sequence is from the 5' end, 1 is an adenine ribonucleotide, 2 is a uracil deoxyribonucleotide, 3 is a 2'-methoxy modified guanine ribonucleotide, 4 is a 2'-fluoro modified cytosine ribonucleotide, and 5 is a thymine deoxyribonucleotide linked to 4 by a phosphorothioate linkage.
[0182] By way of example, as shown in "5'-(M06)*AdTgCf*(invAB)-3'", the structure is:
[0183] As used herein, "small interfering RNA," "siRNA," or "iRNA agent" are used interchangeably to refer to a double-stranded ribonucleic acid molecule (e.g., an siRNA agent or a cleavage product thereof can down-regulate a target gene by, for example, inducing RNAi with respect to a target RNA, wherein the target can include an endogenous or pathogen target RNA) that is long enough to trigger an interferon response and enter the RISC (RNAi-induced silencing complex), and short enough that it does not induce a deleterious interferon response in human cells. In some embodiments of the application, the siRNA is at least partially complementary to a coding sequence in a target gene expressed in a cell. In some embodiments of the application, the siRNA is capable of inhibiting or blocking expression of a gene in vitro or in vivo after the siRNA is delivered to a cell expressing the gene. Typically the siRNA comprises a double-stranded region of less than 60, 50, 40, or 30 complementary base pairs; preferably, it comprises a double-stranded region of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 complementary base pairs. In some embodiments of the application, the sense and antisense strands of the siRNA are independently 15-30 nucleotides in length, forming a complementary double-stranded region of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 base pairs in length. In some embodiments of the application, the sense and antisense strands of the siRNA are perfectly complementary, 15-30 base pairs in length. In some embodiments of the application, the sense and antisense strands of the siRNA are perfectly complementary, 17, 18, 19, 20, 21, or 22 base pairs in length.
[0184] In some embodiments of the application, the length of a ribonucleic acid strand is calculated in units of nt (nucleotides), 1 nt (1 nucleotide) includes, but is not limited to, 1 natural nucleotide, 1 modified nucleotide.
[0185] In some embodiments, the compounds disclosed herein (e.g., the first 5' extension and / or the second 5' extension) undergo cleavage mediated by an enzyme (e.g., an endonuclease) prior to mediating RNAi. In some embodiments, the cleavage is mediated by a ribonuclease (RNase). In some embodiments, the cleavage is mediated by a Dicer endonuclease. In some embodiments, the cleavage is specific cleavage.
[0186] As used herein, the term "specific" or "specifically" with respect to cleavage of a compound (e.g., enzyme-mediated cleavage) refers to controlled or selective cleavage at a particular location (i.e., between the two desired nucleotides of the oligonucleotide strand undergoing specific cleavage). The product of specific cleavage can include a plurality of cleavage products, wherein the desired cleavage product (i.e., the product obtained from cleavage at the particular or desired location) is the most predominant (i.e., produced in the highest amount). In some embodiments, the desired cleavage product comprises at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% (by moles or weight) of all cleavage products. In some embodiments, the amount of the desired cleavage product (by moles or weight) is at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold greater than any other cleavage product. While not wishing to be bound by theory, specific cleavage can be based on recognition by the enzyme mediating cleavage of a particular sequence, feature, motif, or combination thereof of the compound (e.g., oligonucleotide strand, specifically the first 5' extension and / or the second 5' extension) undergoing cleavage. Without being bound by any theory, it is reasonable to expect that particular types and modifications of certain nucleotides at certain positions of the cleavage region (e.g., the first cleavage region and / or the second cleavage region) can provide the desired superior effect.
[0187] In certain embodiments, the compound is capable of undergoing specific cleavage within a cell, such that DS1 and DS2 are separated and the first antisense strand and the second antisense strand are allowed to function as RNA interference. In some embodiments, the specific cleavage occurs at an abutment region comprising L and one or more nucleotides (e.g., at least one, at least two, at least three, at least four, at least five, or at least six nucleotides) of the first antisense strand at the 5' end. In some embodiments, the abutment region consists of L and one or more nucleotides (e.g., at least one, at least two, at least three, at least four, at least five, or at least six nucleotides) of the first antisense strand at the 5' end. In some embodiments, the abutment region consists of L and one, two, three, four, five, six, seven, or eight nucleotides of the first antisense strand at the 5' end. In some embodiments, the abutment region further comprises zero, one or more nucleotides (e.g., one nucleotide) of the second sense strand at the 3' end or the 5' end.
[0188] In some embodiments, the abutment region consists of one nucleotide of the second sense strand at the 3' end (at this time, one end of L is connected to the 5' end of the first antisense strand and the other end of L is connected to the 3' end of the second sense strand), one, two, three, four, five, six, seven, or eight nucleotides of the first antisense strand at the 5' end, and L.
[0189] In some embodiments, the abutment region is comprised of 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides of the 5' end of the second sense strand (in this case, one end of L is connected to the 5' end of the first antisense strand, and the other end of L is connected to the 5' end of the second sense strand), 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides of the 5' end of the first antisense strand, and L.
[0190] In certain embodiments, the nucleotide at the site where specific cleavage occurs does not comprise a phosphorothioate linkage modification. In certain embodiments, the nucleotide immediately 3' downstream of the nucleotide at the site where specific cleavage occurs comprises a phosphorothioate linkage modification.
[0191] In certain embodiments, the compound can maintain the DS1 and DS2 connected state extracellularly. In certain embodiments, the compound can resist degrading factors (e.g., enzymes, pH, etc.) in an in vitro or in vivo environment for a sufficient period of time to maintain the DS1 and DS2 connected state. In certain embodiments, the compound has a half-life of no less than 55 hours (e.g., no less than 54 hours, no less than 53 hours, no less than 52 hours) after mixing with human plasma. In certain embodiments, the compound degrades no more than 15% (e.g., no more than 14%, no more than 13%, no more than 12%, no more than 11%, no more than 10%, no more than 9%, or no more than 8%) within 24 hours after mixing with human plasma.
[0192] In some embodiments, a compound provided herein has sufficient stability in a biological or in vitro environment, more optionally L remains unbroken in the corresponding environment (e.g., outside a cell or in blood circulation) for a period of time before the compound contacts a target mRNA (e.g., before entering a cell), for example, no more than 5%, 10%, 20%, 30%, 40%, or 50% of the compound is broken in plasma for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 24, 48, or 72 hours. In some embodiments, a compound provided herein does not comprise a deoxyribonucleoside, a disulfide bond, a pH-sensitive cleavable group, a polypeptide hydrolase substrate, or a sugar. In some embodiments, a compound provided herein does not comprise a deoxyribonucleotide, an abasic ribonucleic acid, an abasic deoxyribonucleic acid, an inverted abasic ribonucleic acid, or an inverted abasic deoxyribonucleic acid. In some embodiments, a compound provided herein does not comprise a deoxyribonucleoside (e.g., dT), a disulfide bond, a pH-sensitive cleavable group, a polypeptide hydrolase substrate, or a sugar at or near an adjoining region (e.g., the first 5’ extension, L, the second 3’ extension, Formula A-1, Formula B-1, Formula B’-1, and one or two nucleotides connected thereto). In some embodiments, a compound provided herein does not comprise a deoxyribonucleotide, an abasic ribonucleic acid, an abasic deoxyribonucleic acid, an inverted abasic ribonucleic acid, or an inverted abasic deoxyribonucleic acid at or near an adjoining region. In some embodiments, L is a bond or a chemical linker.
[0193] In some embodiments, the specific cleavage occurs at the 3’-most nucleotide of the first 5’ extension. In some embodiments, the specific cleavage occurs at the 3’-most nucleotide of the second 5’ extension. In some embodiments, the specific cleavage occurs at the 3’-most nucleotide of the first 5’ extension and at the 3’-most nucleotide of the second 5’ extension.
[0194] In some embodiments, the specific cleavage occurs between X2and Y. In some embodiments, the specific cleavage occurs between X2and Y. In some embodiments, the specific cleavage occurs between X2and Y and between X2and Y.
[0195] Without being bound by any theory, the compounds disclosed herein can be specifically cleaved between X2and Y to remove the first 5' extension and separate from DS2, thereby generating a cleaved DS1 product and a cleaved DS2 product. The cleaved DS1 product and / or the cleaved DS2 product can mediate RNAi. In some embodiments, the first antisense strand comprises a first targeting region capable of silencing a first target RNA or inhibiting the expression of a first target gene by RNA interference. In some embodiments, the first targeting region is within the first segment. In some embodiments, the first targeting region comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides in the first segment. In some embodiments, the second antisense strand comprises a second targeting region capable of silencing a second target RNA or inhibiting the expression of a second target gene by RNA interference. In some embodiments, the second targeting region is within the fourth segment. In some embodiments, the second targeting region comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides in the fourth segment. The first target RNA or first target gene and the second target RNA or second target gene can be selected from, but not limited to, the target mRNAs or target genes provided herein. In some embodiments, the first target RNA or first target gene and the second target RNA or second target gene are the same. In some embodiments, the first target RNA or first target gene and the second target RNA or second target gene are different. In certain embodiments, the sequences of the first targeting region and the second targeting region are different.
[0196] In some embodiments, the cleaved DS1 product has a blunt end at the 5' end of the first antisense strand, wherein the first base pair at the 5' end of the first antisense strand consists of X2and the nucleotide in the first sense strand that is complementary thereto. In some embodiments, the first base pair at the 5' end of the first antisense strand is an AU base pair.
[0197] In some embodiments, the compound in which the first sense strand and the second sense strand are linked by L can also mediate RNA interference of the first target RNA or first target gene and the second target RNA or second target gene. In some embodiments, one end of L is linked to the nucleotide 6 positions from the 5' end of the first sense strand, the other end of L is linked to the 5' end of the second sense strand, and the first sense strand comprises the first 5' extension and the second sense strand comprises the second 5' extension.
[0198] As used herein, the NAG37 monomer and L96 monomer structures are
[0199] [NAG37] and [L96] represent the residues thereof, respectively. For example, the sequence [NAG37]AfGfu*[L96] structure is
[0200] Also provided herein is a delivery system D02, (D02) represents its residue, (D02)* represents its residue linked to a nucleotide through a phosphorothioate bond, the structures of which are shown below, respectively.
[0201] As used herein, the term "carbocyclyl" or "carbocyclic" refers to a radical of a non-aromatic ring system having from 3 to 20 ring carbon atoms ("C3-20 carbocyclyl") and zero heteroatoms in the non-aromatic ring system. In some embodiments of the application, the carbocyclyl group has from 3 to 18 ring carbon atoms ("C3-18 carbocyclyl"). In some embodiments of the application, the carbocyclyl group has from 3 to 16 ring carbon atoms ("C3-16 carbocyclyl"). In some embodiments of the application, the carbocyclyl group has from 3 to 12 ring carbon atoms ("C3-12 carbocyclyl"). In some embodiments of the application, the carbocyclyl group has from 3 to 10 ring carbon atoms ("C3-10 carbocyclyl"). In some embodiments of the application, the carbocyclyl group has from 3 to 8 ring carbon atoms ("C3-8 carbocyclyl"). In some embodiments of the application, the carbocyclyl group has from 3 to 7 ring carbon atoms ("C3-7 carbocyclyl"). In some embodiments of the application, the carbocyclyl group has from 3 to 6 ring carbon atoms ("C3-6 carbocyclyl"). In some embodiments of the application, the carbocyclyl group has from 4 to 6 ring carbon atoms ("C4-6 carbocyclyl"). In some embodiments of the application, the carbocyclyl group has from 5 to 6 ring carbon atoms ("C5-6 carbocyclyl"). In some embodiments of the application, the carbocyclyl group has from 5 to 10 ring carbon atoms ("C5-10 carbocyclyl"). Some exemplary C3-6 carbocyclyl groups include, but are not limited to, cyclopropyl (C3), cyclopropenyl (C3), cyclobutyl (C4), cyclobutenyl (C4), cyclopentyl (C5), cyclopentenyl (C5), cyclohexyl (C6), cyclohexenyl (C6), cyclohexadienyl (C6), and the like. Some exemplary C3-8 carbocyclyl groups include, but are not limited to, the aforementioned C3-6 carbocyclyl groups as well as cycloheptyl (C7), cycloheptenyl (C7), cycloheptadienyl (C7), cycloheptatrienyl (C7), cyclooctyl (C8), cyclooctenyl (C8), bicyclo[2.2.1]heptyl (C7), bicyclo[2.2.2]octyl (C8), and the like. Some exemplary C3-10 carbocyclyl groups include, but are not limited to, the aforementioned C3-8 carbocyclyl groups as well as cyclononyl (C9), cyclononenyl (C9), cyclodecyl (C10), cyclodecenyl (C10), octahydro-lH-indenyl (C9), bicyclo[6.1.0]non-4-enyl (C9), bicyclo[6.1.0]nonyl (C9), bicyclo[6.1.0]non-4-ynyl (C9), decahydronaphthalenyl (C10), spiro[4.5]decyl (C10), and the like. As noted previously, in some embodiments of the application, the carbocyclyl group is monocyclic ("monocyclic carbocyclyl") or polycyclic (e.g., containing a fused, bridged, or spiro ring system such as a bicyclic ring system ("bicyclic carbocyclyl") or a tricyclic ring system ("tricyclic carbocyclyl")) and can be saturated or can contain one or more carbon-carbon double or triple bonds."Cycloalkyl" also includes ring systems in which a cycloalkyl ring as defined above is fused with one or more aryl or heteroaryl groups, where the point of attachment is on the cycloalkyl ring, and in such cases the number of carbons continues to designate the number of carbons in the cycloalkyl ring system. Unless otherwise specified, each instance of a cycloalkyl group is independently unsubstituted ("unsubstituted cycloalkyl") or substituted with one or more substituents ("substituted cycloalkyl"). In some embodiments of the application, a cycloalkyl group is an unsubstituted C3-14 cycloalkyl group. In some embodiments of the application, a cycloalkyl group is a substituted C3-14 cycloalkyl group. In some embodiments of the application, a cycloalkyl group is an unsubstituted C5-16 cycloalkyl group. In some embodiments of the application, a cycloalkyl group is a substituted C5-16 cycloalkyl group. In some embodiments of the application, "cycloalkyl" is a monocyclic saturated carbocyclic ring having from 3 to 14 ring carbon atoms ("C3-14 cycloalkyl"). In some embodiments of the application, a cycloalkyl group has from 3 to 10 ring carbon atoms ("C3-10 cycloalkyl"). In some embodiments of the application, a cycloalkyl group has from 3 to 8 ring carbon atoms ("C3-8 cycloalkyl"). In some embodiments of the application, a cycloalkyl group has from 3 to 6 ring carbon atoms ("C3-6 cycloalkyl"). In some embodiments of the application, a cycloalkyl group has from 4 to 6 ring carbon atoms ("C4-6 cycloalkyl"). In some embodiments of the application, a cycloalkyl group has from 5 to 6 ring carbon atoms ("C5-6 cycloalkyl"). In some embodiments of the application, a cycloalkyl group has from 5 to 10 ring carbon atoms ("C5-10 cycloalkyl"). Some examples of C5-6 cycloalkyl groups include cyclopentyl (C5) and cyclohexyl (C5). Some examples of C3-6 cycloalkyl groups include the aforementioned C5-6 cycloalkyl groups as well as cyclopropyl (C3) and cyclobutyl (C4). Some examples of C3-8 cycloalkyl groups include the aforementioned C3-6 cycloalkyl groups as well as cycloheptyl (C7) and cyclooctyl (C8). Unless otherwise specified, each instance of a cycloalkyl group is independently unsubstituted ("unsubstituted cycloalkyl") or substituted with one or more substituents ("substituted cycloalkyl"). In some embodiments of the application, a cycloalkyl group is an unsubstituted C3-14 cycloalkyl group. In some embodiments of the application, a cycloalkyl group is a substituted C3-14 cycloalkyl group.
[0202] As used herein, the term “heterocyclyl” or “heterocycle” refers to a radical of a 3- to 20-membered nonaromatic ring system having ring carbon atoms and 1 to 8 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“3- to 20-membered heterocyclyl”). When valence permits, in a heterocyclyl group containing one or more nitrogen atoms, the point of attachment can be a carbon or a nitrogen atom. The heterocyclyl group can be monocyclic (“monocyclic heterocyclyl”) or polycyclic (e.g., a fused ring, bridged ring, or spiro ring system, such as a bicyclic ring system (“bicyclic heterocyclyl”), a tricyclic ring system (“tricyclic heterocyclyl”), or a tetracyclic ring system (“tetracyclic heterocyclyl”)) and can be saturated or can contain one or more carbon-carbon double or triple bonds. The ring system of a heterocyclyl polycycle can contain one or more heteroatoms in one, two, or three rings. “Heterocyclyl” also includes ring systems in which a heterocyclyl ring as defined above is fused to one or more carbocyclyl rings, wherein the point of attachment is on either the carbocyclyl ring or the heterocyclyl ring; or includes ring systems in which a heterocyclyl ring as defined above is fused to one or more aryl or heteroaryl groups, wherein the point of attachment is on the heterocyclyl ring, and in such cases the number of ring members continues to indicate the number of ring members in the heterocyclyl ring system. Unless otherwise specified, each instance of a heterocyclyl group is independently unsubstituted (“unsubstituted heterocyclyl”) or substituted with one or more substituents (“substituted heterocyclyl”). In some aspects of the application, the heterocyclyl group is an unsubstituted 3- to 20-membered heterocyclyl group. In some aspects of the application, the heterocyclyl group is a substituted 3- to 20-membered heterocyclyl group. In some aspects of the application, the heterocyclyl group is an unsubstituted 5- to 18-membered heterocyclyl group. In some aspects of the application, the heterocyclyl group is a substituted 5- to 18-membered heterocyclyl group. In some aspects of the application, the heterocyclyl group is an unsubstituted 5- to 16-membered heterocyclyl group. In some aspects of the application, the heterocyclyl group is a substituted 5- to 16-membered heterocyclyl group. In some aspects of the application, the heterocyclyl group is an unsubstituted 5- to 12-membered heterocyclyl group. In some aspects of the application, the heterocyclyl group is a substituted 5- to 12-membered heterocyclyl group. In some embodiments of the application, the heterocyclyl group is a 5- to 10-membered nonaromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 10-membered heterocyclyl”). In some aspects of the application, the heterocyclyl group is a 5- to 8-membered nonaromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 8-membered heterocyclyl”). In some aspects of the application, the heterocyclyl group is a 5- to 6-membered nonaromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 6-membered heterocyclyl”). In some aspects of the application, the 5- to 6-membered heterocyclyl group has 1 to 3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some aspects of the application, the 5- to 6-membered heterocyclyl group has 1 to 2 ring heteroatoms selected from nitrogen, oxygen, and sulfur.In some embodiments of the application, 5- to 6-membered heterocyclyl groups have 1 ring heteroatom selected from the group consisting of nitrogen, oxygen, and sulfur. Exemplary 3-membered heterocyclyl groups containing 1 heteroatom include, but are not limited to, aziridinyl, oxiranyl, and thiiranyl. Exemplary 4-membered heterocyclyl groups containing 1 heteroatom include, but are not limited to, azetidinyl, oxetanyl, and thietanyl. Exemplary 5-membered heterocyclyl groups containing 1 heteroatom include, but are not limited to, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl, and pyrrolyl-2,5-dione. Exemplary 5-membered heterocyclyl groups containing 2 heteroatoms include, but are not limited to, dioxolanyl, oxasulfuranyl, and dithiolanyl. Exemplary 5-membered heterocyclyl groups containing 3 heteroatoms include, but are not limited to, triazolinyl, diazolinyl, and thiadiazolinyl. Exemplary 6-membered heterocyclyl groups containing 1 heteroatom include, but are not limited to, piperidinyl, tetrahydropyranyl, dihydropyridinyl, and thianyl. Exemplary 6-membered heterocyclyl groups containing 2 heteroatoms include, but are not limited to, piperazinyl, morpholinyl, dithianyl, and dioxanyl. Exemplary 6-membered heterocyclyl groups containing 3 heteroatoms include, but are not limited to, triazinyl. Exemplary 7-membered heterocyclyl groups containing 1 heteroatom include, but are not limited to, azepinyl, oxepinyl, and thiepinyl. Exemplary 8-membered heterocyclyl groups containing 1 heteroatom include, but are not limited to, azocinyl, oxocinyl, and thiocinyl. Exemplary bicyclic heterocyclyl groups include, but are not limited to, indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothiophenyl, tetrahydrobenzothiophenyl, tetrahydrobenzofuranyl, tetrahydroindolyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, decahydroisoquinolinyl, octahydrochromenyl, octahydroisochromenyl, decahydronaphthalenyl, decahydro-l,8-naphthyridinyl, octahydropyrrolo[3,2-b]pyrrole, indolinyl, phthalimidyl, naphthalimidyl, chromanyl, chromenyl, lH-benzo[e][l,4]diazepinyl, l,4,5,7-tetrahydropyrano[3,4-b]pyrrolyl, 5,6-dihydro-4H-furo[3,2-b]pyrrolyl, 6,7-dihydro-5H-furo[3,2-b]pyranyl, 5,7-dihydro-4H-thieno[2,3-c]pyranyl, 2,3-dihydro-lH-pyrrolo[2,3-b]pyridinyl, 2,3-dihydrofuro[2,3-b]pyridinyl, 4,5,6,7-tetrahydro-lH-pyrrolo[2,3-b]pyridinyl, 4,5,6,7-tetrahydrofuro[3,2-c]pyridinyl, 4,5,6,7-tetrahydrothieno[3,2-b]pyridinyl, l,2,3,4-tetrahydro-l,6-naphthyridinyl, and the like.
[0203] As used herein, the term“aryl” refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 p-electrons shared in the ring array) having zero heteroatoms and 6 to 14 ring carbon atoms provided in the aromatic ring system (“C6-14 aryl”). In some aspects of the application, the aryl group has 6 ring carbon atoms (“C6 aryl”; e.g., phenyl). In some aspects of the application, the aryl group has 10 ring carbon atoms (“C10 aryl”; e.g., naphthyl such as 1-naphthyl and 2-naphthyl). In some aspects of the application, the aryl group has 14 ring carbon atoms (“C14 aryl”; e.g., anthryl). “Aryl” also includes ring systems in which an aryl ring as defined above is fused to one or more carbocyclyl or heterocyclyl groups, wherein the point of attachment or groups are on the aryl ring, and in such cases the number of carbon atoms continues to indicate the number of carbon atoms in the aryl ring system. Unless otherwise indicated, each instance of an aryl group is independently unsubstituted (“unsubstituted aryl”) or substituted with one or more substituents (“substituted aryl”). In some aspects of the application, the aryl group is an unsubstituted C6-14 aryl. In some aspects of the application, the aryl group is a substituted C6-14 aryl.
[0204] The term “heteroaryl” refers to a radical of a 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic array) that is a 5- to 14-membered monocyclic or polycyclic (e.g., bicyclic, tricyclic) ring system, having from 1 to 4 ring heteroatoms and ring carbon atoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 14-membered heteroaryl”). When valence permits, in heteroaryls containing one or more nitrogen atoms, the point of attachment can be a carbon or a nitrogen atom. Heteroaryl polycyclic ring systems can contain one or more heteroatoms in one or both rings. “Heteroaryl” includes ring systems in which a heteroaryl ring as defined above is fused to one or more carbocyclic or heterocyclic rings, wherein the point of attachment is on the heteroaryl ring, and in such cases the number of ring members continues to designate the number of ring members in the heteroaryl ring system. “Heteroaryl” also includes ring systems in which a heteroaryl ring as defined above is fused to one or more aryl groups, wherein the point of attachment is on the aryl or heteroaryl ring, and in such cases the number of ring members designates the number of ring members in the fused polycyclic (aryl / heteroaryl) ring system. In polycyclic heteroaryls in which one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, etc.), the point of attachment can be on either ring, i.e., the ring having a heteroatom (e.g., 2-indolyl) or the ring not containing a heteroatom (e.g., 5-indolyl). In some embodiments of the application, a heteroaryl is a 5- to 10-membered aromatic ring system having from 1 to 4 ring heteroatoms and ring carbon atoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 10-membered heteroaryl”). In some embodiments of the application, a heteroaryl is a 5- to 8-membered aromatic ring system having from 1 to 4 ring heteroatoms and ring carbon atoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 8-membered heteroaryl”). In some embodiments of the application, a heteroaryl is a 5- to 6-membered aromatic ring system having from 1 to 4 ring heteroatoms and ring carbon atoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 6-membered heteroaryl”). In some embodiments of the application, a 5- to 6-membered heteroaryl has from 1 to 3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments of the application, a 5- to 6-membered heteroaryl has from 1 to 2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments of the application, a 5- to 6-membered heteroaryl has 1 ring heteroatom selected from nitrogen, oxygen, and sulfur. Unless otherwise specified, each instance of a heteroaryl is independently unsubstituted (“unsubstituted heteroaryl”) or substituted with one or more substituents (“substituted heteroaryl”). In some embodiments of the application, a heteroaryl is an unsubstituted 5- to 14-membered heteroaryl. In some embodiments of the application, a heteroaryl is a substituted 5- to 14-membered heteroaryl. Exemplary 5-membered heteroaryls containing 1 heteroatom include, but are not limited to, pyrrolyl, furanyl, and thiophenyl.Exemplary 5-membered heteroaryl groups containing 2 heteroatoms include, but are not limited to, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5-membered heteroaryl groups containing 3 heteroatoms include, but are not limited to, triazolyl, diazolyl, and thiadiazolyl. Exemplary 5-membered heteroaryl groups containing 4 heteroatoms include, but are not limited to, tetrazolyl. Exemplary 6-membered heteroaryl groups containing 1 heteroatom include, but are not limited to, pyridyl. Exemplary 6-membered heteroaryl groups containing 2 heteroatoms include, but are not limited to, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6-membered heteroaryl groups containing 3 or 4 heteroatoms include, but are not limited to, triazinyl and tetrazinyl, respectively. Exemplary 7-membered heteroaryl groups containing 1 heteroatom include, but are not limited to, azepinyl, oxepinyl, and thiepinyl. Exemplary 5,6-bicyclic heteroaryl groups include, but are not limited to, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzoimidazolyl, benzoxazolyl, benzoisoxazolyl, benzodiazolyl, benzothiazolyl, benzoisothiazolyl, benzothiadiazyolyl, indolizinyl, and purinyl. Exemplary 6,6-bicyclic heteroaryl groups include, but are not limited to, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl. Exemplary tricyclic heteroaryl groups include, but are not limited to, phenanthridinyl, phenoxazinyl, phenothiazinyl, phenazinyl, and phenoxazinyl.
[0205] As used herein, unless explicitly provided otherwise, a group is optionally substituted. As used herein, the term "optionally substituted" or "optionally substituted" means substituted or unsubstituted. In some aspects of the application, alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl are optionally substituted. "Optionally substituted" means a group that can be substituted or unsubstituted (e.g., "substituted" or "unsubstituted" alkyl, "substituted" or "unsubstituted" alkenyl, "substituted" or "unsubstituted" alkynyl, "substituted" or "unsubstituted" heteroalkyl, "substituted" or "unsubstituted" heteroalkenyl, "substituted" or "unsubstituted" heteroalkynyl, "substituted" or "unsubstituted" carbocyclyl, "substituted" or "unsubstituted" heterocyclyl, "substituted" or "unsubstituted" aryl, or "substituted" or "unsubstituted" heteroaryl). In general, the term "substituted" means that at least one hydrogen present on the group is replaced with an allowed substituent (e.g., a substituent that results in a stable compound, e.g., a compound that does not spontaneously undergo transformation, e.g., by rearrangement, cyclization, elimination, or other reaction). Unless otherwise indicated, a "substituted" group has a substituent at one or more substitutable positions of the group, and when more than one position in any given structure can be substituted, the substituent is the same or different at each position. The term "substituted" is contemplated to include all allowed substituents of organic compounds and includes substitution with any of the substituents described herein that result in the formation of a stable compound. The disclosure contemplates any and all combinations in order to arrive at a stable compound. For purposes of this disclosure, a heteroatom, e.g., nitrogen, can have a hydrogen substituent and / or any suitable substituent as described herein that satisfies the valence of the heteroatom and results in the formation of a stable moiety. The disclosure is not intended to be limited in any way by the exemplary substituents described herein.
[0206] In the present application, "azide" in the sequence has the following structural unit:
[0207] In the present application, "amine-C6" in the sequence has the following structural unit:
[0208] In the present application, "BCN" in the sequence has the following structural unit:
[0209] In the present application, "M01" in the sequence has the following structural unit:
[0210] As used herein, when a linking group is recited without specifying its direction of attachment, its direction of attachment is arbitrary. For example, in RA-L-RB, where the linking group L has the structure -M-W-, then -M-W- can attach RAand RBin the same direction as the order of reading from left to right, i.e., to form RA-M-W-RB, or in the opposite direction as the order of reading from left to right, i.e., to form RA-M-W-RB. As used herein, when a linking group is recited as absent, it means that the two groups are connected by a single bond. For example, in RA-L-RB, where the linking group L is absent, then the structure is RA-RB.
[0211] As used herein, when a sequence region is 0 nucleotides, it includes the case where the region is absent and the two regions adjacent to it on either side are directly connected.
[0212] As used herein, "pharmaceutically acceptable carrier" can include, but is not limited to, excipients, and / or other components. An "excipient" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle for delivering one or more nucleic acids to an animal. Such agents are well known in the art.
[0213] The compositions of the present application can additionally contain other auxiliary components conventionally found in pharmaceutical compositions, at levels known to those skilled in the art. Thus, for example, the compositions can contain, in addition to the components described above, an additional, compatible pharmaceutical active, such as an antipruritic, an astringent, a local anesthetic, or an anti-inflammatory agent, or can contain additional substances useful in physically formulating the compositions of the present application, such as preservatives, antioxidants, and stabilizers. However, such substances, when added, should not unduly interfere with the biological activities of the components of the compositions of the present application. The preparations can be sterilized and, if desired, mixed with auxiliary agents that do not deleteriously interact with the nucleic acids of the preparations, such as preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, and the like.
[0214] The compounds of the present application can be prepared by a variety of synthetic methods well known to those skilled in the art, including the specific embodiments listed below, embodiments formed by a combination of the embodiments listed below with other chemical or biological synthetic methods well known in the art, and equivalents thereof as appreciated by those skilled in the art, preferred embodiments including but not limited to the examples of the present application.
[0215] The present application provides the following non-limiting embodiments.
[0216] Embodiment 1. A compound of formula (I),
[0217] is capable of silencing a first target RNA or inhibiting expression of a first target gene and silencing a second target RNA or inhibiting expression of a second target gene;
[0218] in:
[0219] L is the structural unit that serves as a connector;
[0220] DS1 is a double-stranded oligonucleotide comprising a first sense strand and a first antisense strand, the first sense strand and the first antisense strand forming a first double-stranded portion of 15 to 27 nucleotide pairs in length, and a first 5' extension in the first antisense strand located upstream of the 5' of the first double-stranded portion, the first 5' extension being at least 3 nucleotides in length; DS2 comprises a single-stranded or double-stranded oligonucleotide.
[0221] One end of L is connected to the 5' end of the first antisense chain, and the other end is connected to DS2;
[0222] The first target RNA or the first target gene is the same as or different from the second target RNA or the second target gene.
[0223] Embodiment 2. The compound according to Embodiment 1, wherein the first antisense strand further comprises a first 3' extension located downstream of the first double-stranded portion; further, the first 3' extension is 100% complementary to the target mRNA encoding the first target gene; and even further, the length of the first 3' extension is 2 nucleotides.
[0224] Embodiment 3. The compound according to Embodiment 1 or 2, wherein the first double-stranded portion is formed by base pairing of a first segment of a first antisense strand and a second segment of a first sense strand, optionally, the first segment and the second segment are of the same length; further, the first segment and the second segment have at least 80%, 85%, 90% or 95% complementarity; even further, the first segment and the second segment have 100% complementarity.
[0225] Embodiment 4. The compound according to any of the foregoing embodiments, wherein the length of the first double-chain portion is:
[0226] a) 15–25 nucleotide pairs, 15–24 nucleotide pairs, 15–23 nucleotide pairs, 16–24 nucleotide pairs, 16–23 nucleotide pairs, 16–22 nucleotide pairs, 16–21 nucleotide pairs, 16–20 nucleotide pairs, 17–23 nucleotide pairs, 17–22 nucleotide pairs, 17–21 nucleotide pairs, 17–20 nucleotide pairs, 18–23 nucleotide pairs, 18–22 nucleotide pairs, 18–21 nucleotide pairs, 18–20 nucleotide pairs, 19–23 nucleotide pairs, 19–22 nucleotide pairs, 19–21 nucleotide pairs, or 19–20 nucleotide pairs; or
[0227] b) 15 nucleotide pairs, 16 nucleotide pairs, 17 nucleotide pairs, 18 nucleotide pairs, 19 nucleotide pairs, 20 nucleotide pairs, 21 nucleotide pairs, 22 nucleotide pairs, or 23 nucleotide pairs.
[0228] Embodiment 5. The compound according to any of the preceding embodiments, wherein the first sense strand is 15-35, 16-35, 16-30, 16-27, 16-26, 16-25, 16-21, 17-35, 17-30, 17-25, 17-21, 18-35, 18-30, 18-25, 18-23, 18-21, 19-35, 19-30, 19-25, 19-21, 20-35, 20-30, 20-25, 20-23, 21-35, 21-30, 21-25, 21-23, e.g., 25, 24, 24, 23, 22, or 21 nucleotides in length.
[0229] Embodiment 6. The compound according to any of the preceding embodiments, wherein the first 5’ extension segment is at least 3, 4, 5, 6, 7, or more nucleotides in length, and / or the first 3’ extension segment is at least 1, 2, or more nucleotides in length. Embodiment 7. The compound according to any of the preceding embodiments, wherein the first segment comprises a first targeting region that is sufficiently complementary to the first target RNA or a target mRNA encoding the first target gene; further, the first targeting region has at least 80%, 85%, 90%, or 95% complementarity to a portion of a target mRNA encoding a first target gene; further still, the first targeting region has 100% complementarity to a portion of a target mRNA encoding a first target gene.
[0230] Embodiment 8. The compound according to any of the preceding embodiments, wherein the first antisense strand comprises a nucleotide sequence according to Formula A-1:
[0231] Formula A-1: (3’-5’) X2-Y-Z,
[0232] wherein X2is the 5’-most nucleotide of the first segment, Y and Z are the 3’-most two nucleotides of the first 5’ extension segment.
[0233] Embodiment 9. The compound according to any of the preceding embodiments, wherein the first antisense strand further comprises a nucleotide (N1), N1is the third nucleotide 3’-most of the first 5’ extension segment, the first antisense strand comprises a nucleotide sequence according to Formula B-1:
[0234] Formula B-1: (3’-5’) X2-Y-Z-N1.
[0235] Embodiment 10. The compound according to any of the preceding embodiments, wherein the first antisense strand further comprises a third segment (N) comprising at least one nucleotide, wherein the 3’-most nucleotide of the third segment is N1, the first antisense strand comprising a nucleotide sequence according to Formula B’-1:
[0236] Formula B’-1: (3’-5’) X2-Y-Z-N.
[0237] Embodiment 11. The compound according to any of the preceding embodiments, wherein Z is selected from G or A, or a natural or non-natural analogue thereof.
[0238] Embodiment 12. The compound according to any of the preceding embodiments, wherein Z is selected from G, or a natural or non-natural analogue thereof.
[0239] Embodiment 13. The compound according to any of the preceding embodiments, wherein X2 is selected from A or U, or a natural or non-natural analogue thereof.
[0240] Embodiment 14. The compound according to any of the preceding embodiments, wherein Formula A-1 has a sequence (3’-5’) selected from the group consisting of: UUG, UAG, AUG, AAG, UUA, UAA, AUA, AAA, UCG, UGG, ACG, AGG, UCA, UGA, ACA, and AGA, or a natural or non-natural analogue thereof.
[0241] Embodiment 15. The compound according to any of the preceding embodiments, wherein Y is selected from A or U, or a natural or non-natural analogue thereof.
[0242] Embodiment 16. The compound according to any of the preceding embodiments, wherein Formula A-1 has a sequence (3’-5’) selected from the group consisting of: UUG, UAG, AUG, AAG, UUA, UAA, AUA, and AAA.
[0243] Embodiment 17. The compound according to any of the preceding embodiments, wherein at least one of the nucleotides in the sequence according to Formula A-1, Formula B-1, or Formula B’-1 is modified, preferably, all of the nucleotides in the sequence according to Formula A-1, Formula B-1, or Formula B’-1 are modified.
[0244] Embodiment 18. The compound according to any of the preceding embodiments, wherein the modified nucleotide comprises a modified base, a modified glycoside, and / or a modified internucleoside linkage; further, the Formula B’-1 has a sequence (5’-3’) selected from the group consisting of: CfGfau or CfGfaa.
[0245] Embodiment 19. The compound according to any of the preceding embodiments, wherein the sequence of Formula A-1, Formula B-1, or Formula B'-1 is not sufficiently complementary to the first target RNA or a target mRNA encoding the first target gene.
[0246] Embodiment 20. The compound according to any of the preceding embodiments, wherein:
[0247] (a) the sequence of Formula A-1, Formula B-1, or Formula B'-1 comprises at least one internucleoside linkage that is not a phosphorothioate linkage;
[0248] (b) the internucleoside linkage between X2and Y is not a phosphorothioate linkage;
[0249] (c) the internucleoside linkage between Y and Z is not a phosphorothioate linkage;
[0250] (d) all of the internucleoside linkages of the sequence of Formula A-1, Formula B-1, or Formula B'-1 are not phosphorothioate linkages;
[0251] (e) the sequence of Formula A-1, Formula B-1, or Formula B'-1 comprises at least one internucleoside linkage that is a phosphodiester linkage;
[0252] (f) the internucleoside linkage between X2and Y is a phosphodiester linkage;
[0253] (g) the internucleoside linkage between Y and Z is a phosphodiester linkage;
[0254] (h) all of the internucleoside linkages of the sequence region of Formula A-1, Formula B-1, or Formula B'-1 are phosphodiester linkages; and / or
[0255] (i) the internucleoside linkage between the sequence of Formula A-1, Formula B-1, or Formula B'-1 and the first segment is a phosphodiester linkage. Embodiment 21. The compound according to any of the preceding embodiments, wherein:
[0256] (a) the sequence of Formula A-1, Formula B-1, or Formula B'-1 comprises at least one nucleotide selected from a nucleotide comprising a 2'-OMe modification or a nucleotide comprising a 2'-F modification;
[0257] (b) each nucleotide of the sequence of Formula A-1, Formula B-1, or Formula B'-1 is a nucleotide comprising a 2'-OMe modification or a nucleotide comprising a 2'-F modification;
[0258] (c) the sequence of Formula A-1, Formula B-1, or Formula B'-1 comprises at least one 2'-F modified nucleotide;
[0259] (d) the sequence of Formula A-1, Formula B-1, or Formula B'-1 comprises no more than two 2'-F modified nucleotides;
[0260] (e) Z in the sequence of Formula A-1, Formula B-1, or Formula B'-1 is a nucleotide comprising a 2'-F modification, and optionally X2in the sequence of Formula A-1, Formula B-1, or Formula B'-1 is a nucleotide comprising a 2'-F modification;
[0261] (f) N1in the sequence of Formula B-1, or Formula B'-1 is a nucleotide comprising a 2'-F modification;
[0262] (g) X2and Y in the sequence of Formula A-1, Formula B-1, or Formula B'-1 are both nucleotides comprising a 2'-OMe modification, and Z is a nucleotide comprising a 2'-F modification, and further N1in the sequence of Formula B-1, or Formula B'-1 is a nucleotide comprising a 2'-F modification; and / or
[0263] (h) X2, Y, and Z in the sequence of Formula A-1, Formula B-1, or Formula B'-1 are all nucleotides comprising a 2'-OMe modification, and further N1in the sequence of Formula B-1, or Formula B'-1 is a nucleotide comprising a 2'-F modification.
[0264] Embodiment 22. The compound according to any of the preceding embodiments, wherein the DS1, or the first double-stranded portion in the DS1, further comprises at least one internucleoside linkage selected from a phosphorothioate linkage or a methylphosphonate linkage.
[0265] Embodiment 23. The compound according to any of the preceding embodiments, wherein:
[0266] (a) the 1st and / or 2nd internucleoside linkage from the 5' end of the first segment is a phosphorothioate linkage or a methylphosphonate linkage; and / or
[0267] (b) the 1st and / or 2nd internucleoside linkage from the 3' end of the first segment is a phosphorothioate linkage or a methylphosphonate linkage. Embodiment 24. The compound according to any of the preceding embodiments, wherein the DS1 comprises a double-stranded oligonucleotide of Formula C-1:
[0268] Formula C-1, wherein the first segment and the second segment form the first double-stranded portion by base pairing, and the first segment and the second segment are the same in length;
[0269] wherein the first 5' extension segment comprises at least 3 nucleotides;
[0270] wherein the first antisense strand comprises a nucleotide sequence of Formula A-1:
[0271] Formula A-1: (3'-5') X2-Y-Z,
[0272] wherein X2is the 5'-most nucleotide of the first segment, Y and Z are the 3'-most two nucleotides of the first 5' extension, and formula A-1 is as defined in any one of embodiments 8 to 24;
[0273] wherein the first sense strand has a length of 15 to 35, 15 to 23, 15 to 22, or 15 to 21 nucleotides;
[0274] wherein the first antisense strand has a length of 25 to 35, 26 to 35, 26 to 30, 25 to 27, or 26 to 27 nucleotides;
[0275] wherein the 5' end of the first 5' extension is connected to one end of L.
[0276] Embodiment 25. The compound according to any one of the preceding embodiments, wherein the first sense strand has a length of 17 to 23, 17 to 22, 21 to 23, or 17 to 21 nucleotides; and the first antisense strand has a length of 25 to 30, 35 to 27, or 26 to 27 nucleotides.
[0277] Embodiment 26. The compound according to any one of the preceding embodiments, wherein the first sense strand and the first antisense strand have lengths of (a) 17 and 20 nucleotides, respectively; (b) 18 and 21 nucleotides, respectively; (c) 19 and 22 nucleotides, respectively; (d) 20 and 23 nucleotides, respectively; or (e) 21 and 24 nucleotides, respectively.
[0278] Embodiment 27. The compound according to any one of the preceding embodiments, wherein the DS1 comprises a double-stranded oligonucleotide of formula D-1:
[0279] Formula D-1, wherein the first segment and the second segment form the first double-stranded portion by base pairing, and the first segment and the second segment are of the same length;
[0280] wherein the first 5' extension comprises at least 3 nucleotides;
[0281] wherein the first antisense strand comprises a nucleotide sequence of formula A-1:
[0282] Formula A-1: (3'-5') X2-Y-Z,
[0283] wherein X2is the 5'-most nucleotide of the first segment, Y and Z are the 3'-most two nucleotides of the first 5' extension, and formula A-1 is as defined in any one of embodiments 8 to 24;
[0284] wherein the first sense strand is 15-35, 15-23, 15-22, 15-21, 16-25, 17-23, 18-23, 19-23, 19-21, 20-23, 20-21, or 21-23, e.g., 17, 18, 19, 20, 21, 22, or 23, nucleotides in length;
[0285] wherein the first antisense strand is 25-35, 25-30, 26-35, 26-30, 25-27, or 26-27, e.g., 25, 26, 27, 28, 29, or 30, nucleotides in length;
[0286] wherein the 5’ end of the first 5’ extension is linked to one end of L.
[0287] Embodiment 28. The compound of any of the preceding embodiments, wherein the first sense strand is 17-23, 17-22, or 17-21, nucleotides in length; and the first antisense strand is 22-28, 22-27, or 22-26, nucleotides in length.
[0288] Embodiment 29. The compound of any of the preceding embodiments, wherein the first sense strand and the first antisense strand are 19 and 25, (b) 20 and 25, (c) 21 and 25, (d) 19 and 26, (e) 20 and 26, (f) 21 and 26, or (g) 21 and 27, nucleotides in length, respectively.
[0289] Embodiment 30. The compound of any of the preceding embodiments, wherein DS2 comprises a single-stranded oligonucleotide, optionally the single-stranded oligonucleotide comprises an antisense oligonucleotide (ASO), a short hairpin RNA (shRNA), or a microRNA (miRNA); or DS2 comprises a double-stranded oligonucleotide, optionally the double-stranded oligonucleotide comprises a double-stranded small interfering RNA (siRNA), or a Dicer substrate RNA.
[0290] Embodiment 31. The compound of any of the preceding embodiments, wherein the DS2 is a double-stranded oligonucleotide comprising a second sense strand and a second antisense strand, optionally the second sense strand and the second antisense strand form a second double-stranded portion that is 15-27, e.g., 15-25, 15-24, 15-23, 15-22, 15-21, 16-21, 16-20, 16-19, 16-18, 16-17, 17-21, 17-20, 17-19, 17-18, 17-17, 18-21, 18-20, 18-19, 18-18, 19-21, 19-20, 19-19, 19-18, 20-21, 20-20, 20-19, 20-18, 20-17, 20-16, 20-15, 20-14, 20-13, 20-12, 20-11, 20-10, 20-9, 20-8, 20-7, 20-6, 20-5, 20-4, 20-3, 20-2, 20-1, or 20-0, nucleotides in length, further optionally the DS2 further comprises a second 5’ extension in the second antisense strand that is 5’ upstream of the second double-stranded portion.
[0291] Embodiment 32. The compound according to any of the preceding embodiments, wherein the DS1 product in a cell of the target tissue is capable of silencing a first target RNA or inhibiting expression of a first target gene by RNA interference, and the DS2 product in a cell of the target tissue is capable of silencing a second target RNA or inhibiting expression of a second target gene by RNA interference.
[0292] Embodiment 33. The compound according to any of the preceding embodiments, wherein the L is linked to the second sense strand or the second antisense strand, optionally linked to the 3’ end of the second sense strand, the 5’ end of the second sense strand, the 3’ end of the second antisense strand, or the 5’ end of the second antisense strand, and optionally, the L is linked to the 5’ end of the second antisense strand, and the second sense strand comprises the second 5’ extension.
[0293] Embodiment 34. The compound according to any of the preceding embodiments, wherein the second double-stranded portion is formed by base pairing of a fourth segment of the second antisense strand and a fifth segment of the second sense strand, and optionally, the fourth segment and the fifth segment are of the same length; further, the fourth segment and the fifth segment have at least 80%, 85%, 90%, or 95% complementarity; and further, the fourth segment and the fifth segment have 100% complementarity.
[0294] Embodiment 35. The compound according to any of the preceding embodiments, wherein the second double-stranded portion has a length of:
[0295] a) 15-25, 15-24, 15-23, 16-24, 16-23, 16-22, 16-21, 16-20, 17-23, 17-22, 17-21, 17-20, 18-23, 18-22, 18-21, 18-20, 19-23, 19-22, 19-21, or 19-20 nucleotide pairs; or
[0296] b) 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide pairs.
[0297] Embodiment 36. The compound according to any of the preceding embodiments, wherein the fourth segment comprises a second targeting region that is sufficiently complementary to the second target RNA or a target mRNA encoding the second target gene; further, the second targeting region has at least 80%, 85%, 90%, or 95% complementarity to a portion of a target mRNA encoding a second target gene; further, the second targeting region has 100% complementarity to a portion of a target mRNA encoding a second target gene.
[0298] Embodiment 37. The compound according to any of the preceding embodiments, wherein the second antisense strand further comprises a second 3’ extension downstream of the 3’ of the second double-stranded portion (or the fourth segment); further, the second 3’ extension has 100% complementarity to a target mRNA encoding a second target gene; further, the second 3’ extension is 2 nucleotides in length.
[0299] Embodiment 38. The compound according to any of the preceding embodiments, wherein the second 3’ extension is at least 1, 2, or more nucleotides in length.
[0300] Embodiment 39. The compound according to any of the preceding embodiments, wherein the second 5’ extension is at least 3 nucleotides in length.
[0301] Embodiment 40. The compound according to any of the preceding embodiments, wherein the second 5’ extension is at least 3, 4, 5, 6, 7, or more nucleotides in length.
[0302] Embodiment 41. The compound according to any of the preceding embodiments, wherein the second antisense strand comprises a nucleotide sequence according to Formula A-2:
[0303] Formula A-2: (3’-5’) X2’-Y’-Z’,
[0304] wherein Formula A-2 is the same as Formula A-1 as defined in any of embodiments 8-24, X2’ is the same as X2 as defined in any of embodiments 8-24, Y’ is the same as Y as defined in any of embodiments 8-24, and Z’ is the same as Z as defined in any of embodiments 8-24.
[0305] Embodiment 42. The compound according to any of the preceding embodiments, wherein the second antisense strand further comprises a nucleotide (N1’), N1 is the third nucleotide from the 3’-most end of the second 5’ extension, the second antisense strand comprises a nucleotide sequence according to Formula B-2:
[0306] Formula B-2: (3’-5’) X2’-Y’-Z’-N1’,
[0307] wherein Formula B-2 is the same as Formula B-1 as defined in any one of embodiments 9 to 24, X2’ is the same as X2 as defined in any one of embodiments 9 to 24, Y’ is the same as Y as defined in any one of embodiments 9 to 24, Z’ is the same as Z as defined in any one of embodiments 9 to 24, N1’ is the same as N1 as defined in any one of embodiments 9 to 24. Embodiment 43. The compound according to any one of the preceding embodiments, wherein the second antisense strand further comprises a sixth segment (N’), the sixth segment comprising at least one nucleotide, wherein the 3’-most nucleotide of the sixth segment is N1’, the second antisense strand comprising a nucleotide sequence according to Formula B’-2:
[0308] Formula B’-2: (3’-5’) X2’-Y’-Z’-N’,
[0309] wherein Formula B’-2 is the same as Formula B’-1 as defined in any one of embodiments 10 to 24, X2’ is the same as X2 as defined in any one of embodiments 10 to 24, Y’ is the same as Y as defined in any one of embodiments 10 to 24, Z’ is the same as Z as defined in any one of embodiments 10 to 24, N’ is the same as N as defined in any one of embodiments 10 to 24, N1’ is the same as N1 as defined in any one of embodiments 10 to 24.
[0310] Embodiment 44. The compound according to any one of the preceding embodiments, wherein the sequence according to Formula A-2, Formula B-2, or Formula B’-2 comprises at least one modified nucleotide, preferably all nucleotides of the sequence according to Formula A-2, Formula B-2, or Formula B’-2 are modified nucleotides.
[0311] Embodiment 45. The compound according to any one of the preceding embodiments, wherein the modified nucleotide comprises a modified base, a modified glycoside, and / or a modified internucleoside linkage.
[0312] Embodiment 46. The compound according to any one of the preceding embodiments, wherein the sequence according to Formula A-2, Formula B-2, or Formula B’-2 is not sufficiently complementary to the second target RNA or to a target mRNA encoding the second target gene.
[0313] Embodiment 47. The compound according to any one of the preceding embodiments, wherein:
[0314] (a) the sequence according to Formula A-2, Formula B-2, or Formula B’-2 comprises at least one internucleoside linkage that is not a phosphorothioate linkage;
[0315] (b) the internucleoside linkage between X2’ and Y’ is not a phosphorothioate linkage.
[0316] (c) the internucleoside linkage between Y’ and Z’ is other than a phosphorothioate linkage;
[0317] (d) all internucleoside linkages of the sequence of Formula A-2, Formula B-2, or Formula B’-2 are other than phosphorothioate linkages;
[0318] (e) the sequence of Formula A-2, Formula B-2, or Formula B’-2 comprises at least one internucleoside linkage that is a phosphodiester linkage;
[0319] (f) the internucleoside linkage between X2’ and Y’ is a phosphodiester linkage;
[0320] (g) the internucleoside linkage between Y’ and Z’ is a phosphodiester linkage;
[0321] (h) all internucleoside linkages of the sequence of Formula A-2, Formula B-2, or Formula B’-2 are phosphodiester linkages; and / or
[0322] (i) the internucleoside linkage between the sequence of Formula A-2, Formula B-2, or Formula B’-2 and the fourth segment is a phosphodiester linkage.
[0323] Embodiment 48. The compound of any of the preceding embodiments, wherein:
[0324] (a) the sequence of Formula A-2, Formula B-2, or Formula B’-2 comprises at least one nucleotide selected from a nucleotide comprising a 2’-OMe modification or a nucleotide comprising a 2’-F modification;
[0325] (b) each nucleotide of the sequence of Formula A-2, Formula B-2, or Formula B’-2 is a nucleotide comprising a 2’-OMe modification or a nucleotide comprising a 2’-F modification;
[0326] (c) the sequence of Formula A-2, Formula B-2, or Formula B’-2 comprises at least one nucleotide comprising a 2’-F modification;
[0327] (d) the sequence of Formula A-2, Formula B-2, or Formula B’-2 comprises no more than two nucleotides comprising a 2’-F modification;
[0328] (e) Z’ in the sequence of Formula A-2, Formula B-2, or Formula B’-2 is a nucleotide comprising a 2’-F modification, and optionally X2’ in Formula A-2, Formula B-2, or Formula B’-2 is a nucleotide comprising a 2’-F modification;
[0329] (f) N1’ in the sequence of Formula B-2 or Formula B’-2 is a nucleotide comprising a 2’-F modification;
[0330] (g) both X2' and Y' in the sequence of Formula A-2, Formula B-2, or Formula B'-2 are nucleotides comprising 2'-OMe modification, and Z' is a nucleotide comprising 2'-F modification, and further N1' in the sequence of Formula B-2 or Formula B'-2 is a nucleotide comprising 2'-F modification; and / or
[0331] (h) X2', Y', and Z' in the sequence of Formula A-2, Formula B-2, or Formula B'-2 are nucleotides comprising 2'-OMe modification, and N1' in the sequence of Formula B-2 or Formula B'-2 is a nucleotide comprising 2'-F modification.
[0332] Embodiment 49. The compound according to any of the preceding embodiments, wherein the DS2 or the second double-stranded portion in the DS2 further comprises at least one internucleoside linkage selected from a phosphorothioate linkage or a methylphosphonate linkage.
[0333] Embodiment 50. The compound according to any of the preceding embodiments, wherein:
[0334] (a) the 1st and / or 2nd internucleoside linkage from the 5' end of the fourth segment is a phosphorothioate linkage or a methylphosphonate linkage; and / or
[0335] (b) the 1st and / or 2nd internucleoside linkage from the 3' end of the fourth segment is a phosphorothioate linkage or a methylphosphonate linkage. Embodiment 51. The compound according to any of the preceding embodiments, wherein the DS2 comprises a double-stranded oligonucleotide of Formula C-2:
[0336] Formula C-2, wherein the fourth segment and the fifth segment form the second double-stranded portion by base pairing, and the fourth segment and the fifth segment are of the same length;
[0337] wherein the second 5' extension segment comprises at least 3 nucleotides;
[0338] wherein the second antisense strand comprises a nucleotide sequence of Formula A-2:
[0339] Formula A-2: (3'-5') X2'-Y'-Z',
[0340] wherein the X2' is the 5'-most nucleotide of the fourth segment, the Y' and Z' are the 3'-most two nucleotides of the second 5' extension segment, and Formula A-2 is as defined in any of Embodiments 41 to 51;
[0341] wherein the second sense strand is 15 to 35, 15 to 23, 15 to 22, or 15 to 21 nucleotides in length;
[0342] wherein the second antisense strand is 25-35, 26-35, 26-30, 25-27, or 26-27 nucleotides in length; and wherein the 5' end of the first 5' extension segment and
[0343] (i) the 5' end of the second 5' extension segment,
[0344] (ii) the 3' or 5' end of the second sense strand, or
[0345] (iii) the 3' end of the second antisense strand, respectively.
[0346] In some embodiments, the DS2 comprises a double-stranded oligonucleotide of formula D-2:
[0347] Formula D-2,
[0348] wherein the fourth segment and the fifth segment form the second double-stranded portion by base pairing, and the fourth segment and the fifth segment are the same in length;
[0349] wherein the second 5' extension segment comprises at least 3 nucleotides;
[0350] wherein the second antisense strand comprises a nucleotide sequence of formula A-2:
[0351] Formula A-2: (3'-5') X2'-Y'-Z',
[0352] wherein X2' is the 5'-most nucleotide of the fourth segment, Y' and Z' are the 3'-most two nucleotides of the second 5' extension segment, and formula A-2 is as defined in any one of embodiments 41-52;
[0353] wherein the second sense strand is 15-35, 15-23, 15-22, 15-21, 16-25, 17-23, 18-23, 19-23, 19-21, 20-23, 20-21, or 21-23, e.g., 17, 18, 19, 20, 21, 22, or 23 nucleotides in length;
[0354] wherein the second antisense strand is 25-35, 25-30, 26-35, 26-30, 25-27, or 26-27, e.g., 25, 26, 27, 28, 29, or 30 nucleotides in length; and
[0355] wherein the 5' end of the first 5' extension segment and
[0356] (i) the 5' end of the second 5' extension segment,
[0357] (ii) the 3' or 5' end of the second sense strand, or
[0358] (iii) the 3' end of the second antisense strand, respectively.
[0359] Embodiment 53. The compound according to any of the preceding embodiments, wherein L is selected from a bond, a degradable linker, or a non-degradable linker.
[0360] Embodiment 54. The compound according to any of the preceding embodiments, wherein L is selected from DNA, RNA, a functionalized monosaccharide, or an oligosaccharide.
[0361] Embodiment 55. The compound according to any of the preceding embodiments, wherein L is a non-degradable linker.
[0362] Embodiment 56. The compound according to any of the preceding embodiments, wherein L has sufficient stability in an in vivo or in vitro environment.
[0363] Embodiment 57. The compound according to any of the preceding embodiments, wherein L remains intact in the respective environment for a period of time before the compound contacts the target mRNA, for example, remains intact in the plasma for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 24, 48, or 72 hours without breaking down by no more than 5%, 10%, 20%, 30%, 40%, or 50%.
[0364] Embodiment 58. The compound according to any of the preceding embodiments, wherein the second sense strand and the second antisense strand are independently from each other 15-25, 15-23, 15-22, 15-21, 16-25, 17-23, 18-23, 19-23, 19-21, 20-23, 20-21, or 21-23, for example, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
[0365] Embodiment 59. The compound according to any of the preceding embodiments, wherein the molar ratio of the DS1 product that acts on the first target RNA or the target mRNA encoding the first target gene and the DS2 product that acts on the second target RNA or the target mRNA encoding the second target gene is about 0.8, 0.9, 1, 1.1, or 1.2.
[0366] Embodiment 60. The compound according to any of the preceding embodiments, wherein L is represented by formula (I-1') or (I-1),
[0367] wherein:
[0368] X is O or S;
[0369] Y is a single bond, -O- or -S-;
[0370] L1is selected from the group consisting of a single bond, -O-, -S-, -S-S-, -(C=O)-, -NH-, -NH-(C=O)-, -CH2-, -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2CH2-, -O-CH2-, -S-CH2-, -O-CH2CH2-, -O-CH2CH2CH2-, -O-CH2CH2CH2CH2-, -O-CH2CH2CH2CH2CH2-, -O-CH2CH2CH2CH2CH2CH2-, -S-CH2CH2-, -CH2-O-CH2CH2-, -CH2CH2-O-CH2CH2-, -CH2CH2-O-CH2CH2-O-, -CH2-O-CH2-O-, -CH2CH2-O-, -CH2CH2CH2-O-, CH2CH2CH2CH2-O-, CH2CH2CH2CH2CH2-O-, CH2CH2CH2CH2CH2CH2-O-, -CH2CH2CH2-S-, -CH2-(C=O)-, -CH2-NH-(C=O)-, -O-(C=O)-NH-, -CH2-NH-, -C(=O)O-, -NHC(=O)O-, -NHC(=O)NH-, -OC(=O)O-, -OC(=O)NH-, -S(O)2NH-, -NHS(O)2-, and L2, L3, L4, L6, L7, L8, and L9are each independently selected from the group consisting of a single bond, -0-, -S-, -S-S-, -(C=0)-, -NH-, -NH-(C=0)-, -CH2-, -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2CH2-, -0-CH2-, -S-CH2-, -0-CH2CH2-, -0-CH2CH2CH2-, -0-CH2CH2CH2CH2-, -0-CH2CH2CH2CH2CH2-, -0-CH2CH2CH2CH2CH2CH2-, -S-CH2CH2-, -CH2-0-CH2CH2-, -CH2CH2-0-CH2CH2-, -CH2CH2-0-CH2CH2-0-, -CH2-0-CH2-0-, -CH2CH2-0-, -CH2CH2CH2-0-, CH2CH2CH2CH2-0-, CH2CH2CH2CH2CH2-0-, CH2CH2CH2CH2CH2CH2-0-, -CH2CH2CH2-S-, -CH2-(C=0)-, -CH2-NH-(C=0)-, -0-(C=0)-NH-, -C(=0)0-, -NHC(=0)0-, -NHC(=0)NH-, -OC(=0)0-, -OC(=0)NH-, -S(0)2NH-, -NHS(0)2-, and -CH2-NH-;
[0371] L5is selected from the group consisting of a single bond, -0-, -S-, -S-S-, -(C=0)-, -NH-, -NH-(C=0)-, -CH2-, -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2CH2-, -0-CH2-, -S-CH2-, -0-CH2CH2-, -0-CH2CH2CH2-, -0-CH2CH2CH2CH2-, -0-CH2CH2CH2CH2CH2-, -0-CH2CH2CH2CH2CH2CH2-, -S-CH2CH2-, -CH2-0-CH2CH2-, -CH2CH2-0-CH2CH2-, -CH2CH2-0-CH2CH2-0-, -CH2-0-CH2-0-, -CH2CH2-0-, -CH2CH2CH2-0-, CH2CH2CH2CH2-0-, CH2CH2CH2CH2CH2-0-, CH2CH2CH2CH2CH2CH2-0-, -CH2CH2CH2-S-, -CH2-(C=0)-, -CH2-NH-(C=0)-, -0-(C=0)-NH-, -CH2-NH-, -C(=0)0-, -NHC(=0)0-, -NHC(=0)NH-, -OC(=0)0-, -OC(=0)NH-, -S(0)2NH-, -NHS(0)2-, carbocycle, and heterocycle;
[0372] said L is connected to the 5' end of the first antisense strand of said DS1. said L is connected to the 5' end of the first antisense strand of said DS1.
[0373] Embodiment 61. The compound according to any of the preceding embodiments, wherein said L is according to formula (I-2') or (I-2),
[0374] wherein:
[0375] ring A is absent and L6is directly connected to the triazole;
[0376] alternatively, ring A is selected from a 5-16 membered heterocycle.
[0377] Embodiment 62. The compound according to any of the preceding embodiments, said L comprises 1, 2, or 3 dT, optionally, said L further comprises a structure according to formula (I-1) or (I-2) as previously described.
[0378] Embodiment 63. The compound according to any of the preceding embodiments, said L is according to (I-3), (I-4), or (I-5):
[0379] Embodiment 64. The compound according to any of the preceding embodiments, wherein the L is represented by Formula (I-6), (I-7), or (I-8):
[0380] Embodiment 65. The compound according to any of the preceding embodiments, wherein one end of the L is connected to a nucleotide 6 positions from the 5’ end of the first sense strand, the other end of the L is connected to the 5’ end of the second sense strand, and the second sense strand comprises the second 5’ extension.
[0381] Embodiment 66. The compound according to any of the preceding embodiments, wherein: the structural unit is selected from optionally substituted
[0382] Embodiment 66A. The compound according to any of the preceding embodiments, wherein the L is represented by Formula (I-9), (I-10), (I-11), (I-12), (I-13), (I-14), (I-15), (I-16), (I-17), or (I-18),
[0383] Embodiment 67. The compound according to any of the preceding embodiments, wherein the L is selected from
[0384] Embodiment 68. The compound according to any of the preceding embodiments, wherein the L is absent, and the 5’ most nucleotide of the first antisense strand is bond connected to
[0385] (i) the 3’ most nucleotide of the second sense strand; or
[0386] (ii) the 5’ most nucleotide of the second sense strand; or
[0387] (ii) the 3’ most nucleotide of the second antisense strand; or
[0388] (iv) the 5’ most nucleotide of the second antisense strand.
[0389] Embodiment 69. The compound according to any of the preceding embodiments, wherein the L is absent, and the 5’ most nucleotide of the first 5’ extension is bond connected to
[0390] (i) the most 3' end nucleotide of the second sense strand; or
[0391] (ii) the most 5' end nucleotide of the second sense strand; or
[0392] (ii) the most 3' end nucleotide of the second antisense strand; or
[0393] (iv) the most 5' end nucleotide of the second antisense strand.
[0394] Optionally, the first 5' extension is 3 nucleotides.
[0395] Embodiment 70. The compound according to any of the preceding embodiments, wherein L is absent and (i) the most 5' end nucleotide of the first 5' extension is bond to the most 3' end nucleotide of the second sense strand or (ii) the most 5' end nucleotide of the first 5' extension is bond to the most 3' end nucleotide of the second antisense strand.
[0396] Embodiment 71. The compound according to any of the preceding embodiments, wherein,
[0397] (i) the second 5' extension is not comprised in the second antisense strand;
[0398] (ii) or, the first antisense strand is 19-21 nucleotides in length and the second antisense strand is 21-23 nucleotides in length.
[0399] Embodiment 72. The compound according to any of the preceding embodiments, wherein at least one nucleotide is a modified nucleotide, preferably all nucleotides are modified nucleotides, the modification comprising one, two or more of the following in combination: 2'-OMe modification, 2'-F modification, 2'-deoxy modification, C16 modification, D02 modification, VP modification, 5'-MP modification, PS modification, PS2 modification, MP modification, MOP modification, invAB modification, invAb modification, modification that enhances the affinity of double stranded ribonucleic acid to ARGO protein.
[0400] Embodiment 73. The compound according to any of the preceding embodiments, further comprising one or more delivery systems, optionally each of the delivery systems is independently linked to DS1, DS2 or L.
[0401] Embodiment 74. The compound according to any of the preceding embodiments, wherein each of the delivery systems is independently a ligand, preferably the ligand alters the distribution, targeting or lifetime of the compound, more preferably the ligand provides enhanced affinity to a target, such as a molecule, a cell or cell type, a compartment, a receptor, such as a cellular or organ compartment, a tissue, an organ or a body region, more preferably the ligand enables delivery of the compound to a target tissue and produces an RNA interference effect.
[0402] Embodiment 75. The compound according to any of the preceding embodiments, wherein the ligands are each independently selected from GalNAc ligands, lipophilic ligands, or other receptor targeting ligands to facilitate endocytosis of the compound, such as TfR targeting ligands, LDL-R targeting ligands, or integrin targeting ligands.
[0403] Embodiment 76. The compound according to any of the preceding embodiments, wherein the first target RNA or first target gene is the same as the second target RNA or second target gene; or the first target RNA or first target gene is a different segment of the same RNA or the same gene as the second target RNA or second target gene; or the first target RNA or first target gene is a different RNA or a different gene than the second target RNA or second target gene.
[0404] Embodiment 77. The compound according to any of the preceding embodiments, wherein the compound is selected from the compounds as shown in Tables 1-90.
[0405] Embodiment 78. A pharmaceutical composition comprising a compound according to any of the preceding embodiments, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
[0406] Embodiment 79. A method of inhibiting expression of a target gene in a subject in need thereof, comprising administering to the subject a pharmaceutically effective amount of a compound according to any one of embodiments 1-77, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to embodiment 78.
[0407] Embodiment 80. A method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a pharmaceutically effective amount of a compound according to any one of embodiments 1-77, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to embodiment 78, optionally the disease or disorder is related to a first target gene and / or a second target gene.
[0408] Embodiment 81. A compound represented by Formula (I),
[0409] wherein:
[0410] L is a linking structural unit;
[0411] DS1 is a double-stranded oligonucleotide comprising a first sense strand and a first antisense strand forming a first double-stranded portion of 15-27 nucleotide pairs, and a first 5’ extension in the first antisense strand upstream of the first double-stranded portion,
[0412] DS2 comprises a single-stranded or double-stranded oligonucleotide;
[0413] one end of L is connected to the 5' end of the first antisense strand, and the other end is connected to the DS2;
[0414] wherein,
[0415] the first 5' extension segment has a length of at least 3 nucleotides, and can be cleaved at the 3'-most nucleotide of the first 5' extension segment to yield a cleaved DS1 product and a cleaved DS2 product, the cleaved DS1 product being capable of silencing a first target RNA or inhibiting expression of a first target gene; and the cleaved DS2 product being capable of silencing a second target RNA or inhibiting expression of a second target gene;
[0416] wherein the first target RNA or first target gene is the same as or different from the second target RNA or second target gene.
[0417] Embodiment 82. The compound of any of the preceding embodiments, wherein the first antisense strand further comprises a first 3' extension segment located 3' downstream of the first double-stranded portion.
[0418] Embodiment 83. The compound of any of the preceding embodiments, wherein the first double-stranded portion is formed by base pairing of a first segment of the first antisense strand and a second segment of the first sense strand, the first segment and the second segment being the same length. Embodiment 84. The compound of any of the preceding embodiments, wherein the first double-stranded portion has a length of:
[0419] a) 15-25 nucleotide pairs, 15-24 nucleotide pairs, 15-23 nucleotide pairs, 16-24 nucleotide pairs, 16-23 nucleotide pairs, 16-22 nucleotide pairs, 16-21 nucleotide pairs, 16-20 nucleotide pairs, 17-23 nucleotide pairs, 17-22 nucleotide pairs, 17-21 nucleotide pairs, 17-20 nucleotide pairs, 18-23 nucleotide pairs, 18-22 nucleotide pairs, 18-21 nucleotide pairs, 18-20 nucleotide pairs, 19-23 nucleotide pairs, 19-22 nucleotide pairs, 19-21 nucleotide pairs, or 19-20 nucleotide pairs; or
[0420] b) 15 nucleotide pairs, 16 nucleotide pairs, 17 nucleotide pairs, 18 nucleotide pairs, 19 nucleotide pairs, 20 nucleotide pairs, 21 nucleotide pairs, 22 nucleotide pairs, or 23 nucleotide pairs.
[0421] Embodiment 85. The compound according to any of the preceding embodiments, wherein the first sense strand is 15-35, 16-35, 16-30, 16-27, 16-26, 16-25, 16-21, 17-35, 17-30, 17-25, 17-21, 18-35, 18-30, 18-25, 18-23, 18-21, 19-35, 19-30, 19-25, 19-21, 20-35, 20-30, 20-25, 20-23, 21-35, 21-30, 21-25, 21-23, e.g., 25, 24, 24, 23, 22, or 21 nucleotides in length.
[0422] Embodiment 86. The compound according to any of the preceding embodiments, wherein the first 5’-extension segment is at least 3, 4, 5, 6, 7, or more nucleotides in length, and / or the first 3’-extension segment is at least 1, 2, or more nucleotides in length.
[0423] Embodiment 88. The compound according to any of the preceding embodiments, wherein the cleavage is an enzyme-catalyzed cleavage, optionally a specific cleavage by an endonuclease, optionally a specific cleavage by a ribonuclease (RNase).
[0424] Embodiment 89. The compound according to any of the preceding embodiments, wherein the first antisense strand comprises a first cleavage region comprising a nucleotide sequence according to Formula A-1:
[0425] Formula A-1: (3’-5’) X2-Y-Z,
[0426] wherein the cleavage occurs between X2and Y, X2is the 5’-most nucleotide of the first segment, and Y and Z are the 3’-most two nucleotides of the first 5’-extension segment.
[0427] Embodiment 90. The compound according to any of the preceding embodiments, wherein the first cleavage region further comprises a nucleotide (N1), N1is the third 3’-most nucleotide of the first 5’-extension segment, the first cleavage region comprising a nucleotide sequence according to Formula B-1:
[0428] Formula B-1: (3’-5’) X2-Y-Z-N1,
[0429] wherein the cleavage occurs between X2and Y.
[0430] Embodiment 91. The compound according to any of the preceding embodiments, wherein the first cleavage region further comprises a third segment (N) comprising at least one nucleotide, wherein the 3’-most nucleotide of the third segment is N1, the first cleavage region comprises a nucleotide sequence according to Formula B’-1:
[0431] Formula B’-1: (3’-5’) X2-Y-Z-N,
[0432] wherein the cleavage occurs between X2and Y, N has a length of 1-10 nucleotides, preferably 1-5 nucleotides, more preferably 1 nucleotide.
[0433] Embodiment 92. The compound according to any of the preceding embodiments, wherein Z is selected from G or A, or a natural or non-natural analogue thereof.
[0434] Embodiment 93. The compound according to any of the preceding embodiments, wherein Z is selected from G, or a natural or non-natural analogue thereof.
[0435] Embodiment 94. The compound according to any of the preceding embodiments, wherein X2is selected from A or U, or a natural or non-natural analogue thereof.
[0436] Embodiment 95. The compound according to any of the preceding embodiments, wherein Formula A has a sequence (3’-5’) selected from the group consisting of: UUG, UAG, AUG, AAG, UUA, UAA, AUA, AAA, UCG, UGG, ACG, AGG, UCA, UGA, ACA, and AGA, or a natural or non-natural analogue thereof.
[0437] Embodiment 96. The compound according to any of the preceding embodiments, wherein Y is selected from A or U, or a natural or non-natural analogue thereof.
[0438] Embodiment 97. The compound according to any of the preceding embodiments, wherein Formula A has a sequence (3’-5’) selected from the group consisting of: UUG, UAG, AUG, AAG, UUA, UAA, AUA, and AAA.
[0439] Embodiment 98. The compound according to any of the preceding embodiments, wherein the first cleavage region comprises at least one modified nucleotide, preferably all nucleotides of the first cleavage region are modified nucleotides.
[0440] Embodiment 99. The compound according to any of the preceding embodiments, wherein the modified nucleotide comprises a modified base, a modified glycoside, and / or a modified internucleoside linkage.
[0441] Embodiment 100. The compound according to any of the preceding embodiments, wherein the first cleavage region is not sufficiently complementary to the first target RNA or a target mRNA encoding the first target gene.
[0442] Embodiment 101. The compound according to any of the preceding embodiments, wherein:
[0443] (a) the first cleavage region comprises at least one internucleoside linkage that is not a phosphorothioate linkage;
[0444] (b) the internucleoside linkage between X2and Y is not a phosphorothioate linkage;
[0445] (c) the internucleoside linkage between Y and Z is not a phosphorothioate linkage;
[0446] (d) all internucleoside linkages of the first cleavage region are not phosphorothioate linkages;
[0447] (e) the first cleavage region comprises at least one internucleoside linkage that is a phosphodiester linkage;
[0448] (f) the internucleoside linkage between X2and Y is a phosphodiester linkage;
[0449] (g) the internucleoside linkage between Y and Z is a phosphodiester linkage;
[0450] (h) all internucleoside linkages of the first cleavage region are phosphodiester linkages; and / or
[0451] (i) the internucleoside linkage between the first cleavage region and the first segment is a phosphodiester linkage.
[0452] Embodiment 102. The compound according to any of the preceding embodiments, wherein:
[0453] (a) the first cleavage region comprises at least one nucleotide selected from a 2’-OMe modified nucleotide or a 2’-F modified nucleotide;
[0454] (b) each nucleotide of the first cleavage region is a 2’-OMe modified nucleotide or a 2’-F modified nucleotide;
[0455] (c) the first cleavage region comprises at least one 2’-F modified nucleotide;
[0456] (d) the first cleavage region comprises no more than two 2’-F modified nucleotides;
[0457] (e) Z in Formula A-1, Formula B-1, or Formula B’-1 is a 2’-F modified nucleotide, and optionally X2in Formula A-1, Formula B-1, or Formula B’-1 is a 2’-F modified nucleotide;
[0458] (f) the N1in Formula B-1 or Formula B-1 is a 2’-F modified nucleotide;
[0459] (g) X2and Y in Formula A-1, Formula B-1, or Formula B’-1 are both 2’-OMe modified nucleotides, and Z is a 2’-F modified nucleotide, and further the N1in Formula B-1 or Formula B’-1 is a 2’-F modified nucleotide; and / or
[0460] (h) X2, Y, and Z in Formula A-1, Formula B-1, or Formula B’-1 are all 2’-OMe modified nucleotides, and further the N1in Formula B-1 or Formula B’-1 is a 2’-F modified nucleotide.
[0461] Embodiment 103. The compound according to any of the preceding embodiments, wherein the DS1 or the first double-stranded portion in the DS1 further comprises at least one internucleoside linkage selected from a phosphorothioate linkage or a methylphosphonate linkage.
[0462] Embodiment 23. The compound according to any of the preceding embodiments, wherein:
[0463] (a) the 1st and / or 2nd internucleoside linkage from the 5’ end of the first segment is a phosphorothioate linkage or a methylphosphonate linkage; and / or
[0464] (b) the 1st and / or 2nd internucleoside linkage from the 3’ end of the first segment is a phosphorothioate linkage or a methylphosphonate linkage. Embodiment 104. The compound according to any of the preceding embodiments, wherein the DS1 comprises a double-stranded oligonucleotide of Formula C-1:
[0465] Formula C-1,
[0466] wherein the first segment and the second segment form the first double-stranded portion by base pairing, and the first segment and the second segment are of the same length;
[0467] wherein the first 5’ extension comprises at least 3 nucleotides;
[0468] wherein the first antisense strand comprises the first cleavage region, the first cleavage region comprising the 5’ most nucleotide of the first segment (X2) and the 3’ most two nucleotides of the first 5’ extension (Y-Z), the first cleavage region comprising a nucleotide sequence of Formula A-1:
[0469] Formula A-1: (3’-5’) X2-Y-Z,
[0470] wherein the cleavage occurs between X2and Y, Formula A-1 being defined as in any one of Embodiments 89 to 103;
[0471] wherein the first sense strand is 15-35, 15-23, 15-22, or 15-21 nucleotides in length;
[0472] wherein the first antisense strand is 25-35, 26-35, 26-30, 25-27, or 26-27 nucleotides in length;
[0473] wherein the 5’ end of the first 5’ extension segment is connected to one end of L.
[0474] Embodiment 105. The compound according to any of the preceding embodiments, wherein the first sense strand is 17-23, 17-22, 21-23, or 17-21 nucleotides in length; and the first antisense strand is 25-30, 35-27, or 26-27 nucleotides in length.
[0475] Embodiment 26. The compound according to any of the preceding embodiments, wherein the first sense strand and the first antisense strand are 17 and 20, 18 and 21, 19 and 22, 20 and 23, or 21 and 24 nucleotides in length, respectively.
[0476] Embodiment 106. The compound according to any of the preceding embodiments, wherein the DS1 comprises a double-stranded oligonucleotide of Formula D-1:
[0477] Formula D-1,
[0478] wherein the first segment and the second segment form the first double-stranded portion by base pairing, and the first segment and the second segment are the same in length;
[0479] wherein the first 5’ extension segment comprises at least 3 nucleotides;
[0480] wherein the first antisense strand comprises a first cleavage region comprising the 5’ most nucleotide (X2) of the first segment and the 3’ most two nucleotides (Y-Z) of the first 5’ extension segment, the first cleavage region comprising a nucleotide sequence of Formula A-1:
[0481] Formula A-1: (3’-5’) X2-Y-Z,
[0482] wherein the cleavage occurs between X2 and Y, Formula A-1 is defined in any one of embodiments 89 to 103;
[0483] wherein the first sense strand is 15-35, 15-23, 15-22, 15-21, 16-25, 17-23, 18-23, 19-23, 19-21, 20-23, 20-21, or 21-23, e.g., 17, 18, 19, 20, 21, 22, or 23, nucleotides in length;
[0484] wherein the first antisense strand is 25-35, 25-30, 26-35, 26-30, 25-27, or 26-27, e.g., 25, 26, 27, 28, 29, or 30, nucleotides in length;
[0485] wherein the 5' end of the first 5' extension is linked to one end of L.
[0486] Embodiment 107. The compound of any of the preceding embodiments, wherein the first sense strand is 17-23, 17-22, or 17-21 nucleotides in length; and the first antisense strand is 22-28, 22-27, or 22-26 nucleotides in length.
[0487] Embodiment 108. The compound of any of the preceding embodiments, wherein the first sense strand and the first antisense strand are 19 and 25 nucleotides in length, respectively; (b) 20 and 25 nucleotides in length, respectively; (c) 21 and 25 nucleotides in length, respectively; (d) 19 and 26 nucleotides in length, respectively; (e) 20 and 26 nucleotides in length, respectively; (f) 21 and 26 nucleotides in length, respectively; or (g) 21 and 27 nucleotides in length, respectively.
[0488] Embodiment 109. The compound of any of the preceding embodiments, wherein DS2 comprises a single-stranded oligonucleotide, optionally the single-stranded oligonucleotide comprises an antisense oligonucleotide (ASO), a short hairpin RNA (shRNA), or a microRNA (miRNA); or DS2 comprises a double-stranded oligonucleotide, optionally the double-stranded oligonucleotide comprises a double-stranded small interfering RNA (siRNA), or a Dicer substrate RNA.
[0489] Embodiment 110. The compound of any of the preceding embodiments, wherein the DS2 is a double-stranded oligonucleotide comprising a second sense strand and a second antisense strand, optionally the second sense strand and the second antisense strand form a second double-stranded portion that is 15-27 nucleotides in length, further optionally the DS2 further comprises a second 5' extension in the second antisense strand upstream of 5' of the second double-stranded portion.
[0490] Embodiment 111. The compound of any of the preceding embodiments, wherein the cleaved DS2 product is capable of silencing a second target RNA or inhibiting expression of a second target gene by RNA interference.
[0491] Embodiment 112. A compound according to any of the preceding embodiments, wherein the L is attached to the second sense strand or the second antisense strand, optionally to the 3’ end of the second sense strand, the 5’ end of the second sense strand, the 3’ end of the second antisense strand, or the 5’ end of the second antisense strand, optionally the L is attached to the 5’ end of the second antisense strand, and the second sense strand comprises the second 5’ extension.
[0492] Embodiment 113. A compound according to any of the preceding embodiments, wherein the second double-stranded portion is formed by base pairing of a fourth segment of the second antisense strand and a fifth segment of the second sense strand, optionally the fourth segment and the fifth segment are the same length.
[0493] Embodiment 114. A compound according to any of the preceding embodiments, wherein the second double-stranded portion is 15-25, 15-24, 15-23, 16-24, 16-23, 16-22, 16-21, 16-20, 17-23, 17-22, 17-21, 17-20, 18-23, 18-22, 18-21, 18-20, 19-23, 19-22, 19-21, or 19-20 nucleotide pairs in length.
[0494] a) 15-25, 15-24, 15-23, 16-24, 16-23, 16-22, 16-21, 16-20, 17-23, 17-22, 17-21, 17-20, 18-23, 18-22, 18-21, 18-20, 19-23, 19-22, 19-21, or 19-20 nucleotide pairs; or
[0495] b) 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide pairs.
[0496] Embodiment 115. A compound according to any of the preceding embodiments, wherein the fourth segment comprises a second targeting region that is sufficiently complementary to the second target RNA or a target mRNA encoding the second target gene.
[0497] Embodiment 116. A compound according to any of the preceding embodiments, wherein the second antisense strand further comprises a second 3’ extension downstream of the 3’ of the second double-stranded portion (or the fourth segment).
[0498] Embodiment 117. The compound of any preceding embodiment, wherein the second 3’ extension segment is at least 1, 2, or more nucleotides in length Embodiment 118. The compound of any preceding embodiment, wherein the second 5’ extension segment is at least 3 nucleotides in length and is cleavable at the most 3’-end nucleotide of the second 5’ extension segment.
[0499] Embodiment 119. The compound of any preceding embodiment, wherein the second 5’ extension segment is at least 3, 4, 5, 6, 7, or more nucleotides in length.
[0500] Embodiment 120. The compound of any preceding embodiment, wherein the second antisense strand comprises a second cleavage region comprising a nucleotide sequence according to Formula A-2:
[0501] Formula A-2: (3’-5’) X2’-Y’-Z’,
[0502] wherein Formula A-2 is the same as Formula A-1 as defined in any one of embodiments 89-103, X2’ is the same as X2 as defined in any one of embodiments 89-103, Y’ is the same as Y as defined in any one of embodiments 89-103, and Z’ is the same as Z as defined in any one of embodiments 89-103.
[0503] Embodiment 121. The compound of any preceding embodiment, wherein the second cleavage region further comprises a nucleotide (N1’), N1 being the third nucleotide from the most 3’-end of the second 5’ extension segment, the second cleavage region comprising a nucleotide sequence according to Formula B-2:
[0504] Formula B-2: (3’-5’) X2’-Y’-Z’-N1’,
[0505] wherein Formula B-2 is the same as Formula B-1 as defined in any one of embodiments 90-103, X2’ is the same as X2 as defined in any one of embodiments 90-103, Y’ is the same as Y as defined in any one of embodiments 90-103, Z’ is the same as Z as defined in any one of embodiments 90-103, and N1’ is the same as N1 as defined in any one of embodiments 90-103.
[0506] Embodiment 122. The compound of any preceding embodiment, wherein the second cleavage region further comprises a sixth segment (N’), the sixth segment comprising at least one nucleotide, wherein the most 3’-end nucleotide of the sixth segment is N1’, the second cleavage region comprising a nucleotide sequence according to Formula B’-2:
[0507] Formula B'-2: (3'-5') X2'-Y'-Z'-N',
[0508] wherein Formula B'-2 is the same as Formula B'-1 as defined in any one of embodiments 91 to 103, X2' is the same as X2 as defined in any one of embodiments 91 to 103, Y' is the same as Y as defined in any one of embodiments 91 to 103, Z' is the same as Z as defined in any one of embodiments 91 to 103, N' is the same as N as defined in any one of embodiments 91 to 103, and N1' is the same as N1 as defined in any one of embodiments 91 to 103.
[0509] Embodiment 123. The compound according to any one of the preceding embodiments, wherein the second cleavage region comprises at least one modified nucleotide, preferably all nucleotides of the second cleavage region are modified nucleotides.
[0510] Embodiment 124. The compound according to any one of the preceding embodiments, wherein the modified nucleotide comprises a modified base, a modified sugar, and / or a modified internucleoside linkage.
[0511] Embodiment 125. The compound according to any one of the preceding embodiments, wherein the second cleavage region is not sufficiently complementary to the second target RNA or a target mRNA encoding the second target gene.
[0512] Embodiment 126. The compound according to any one of the preceding embodiments, wherein:
[0513] (a) the second cleavage region comprises at least one internucleoside linkage that is not a phosphorothioate linkage;
[0514] (b) the internucleoside linkage between X2' and Y' is not a phosphorothioate linkage;
[0515] (c) the internucleoside linkage between Y' and Z' is not a phosphorothioate linkage;
[0516] (d) all internucleoside linkages of the second cleavage region are not phosphorothioate linkages;
[0517] (e) the second cleavage region comprises at least one internucleoside linkage that is a phosphodiester linkage;
[0518] (f) the internucleoside linkage between X2' and Y' is a phosphodiester linkage;
[0519] (g) the internucleoside linkage between Y' and Z' is a phosphodiester linkage;
[0520] (h) all internucleoside linkages of the second cleavage region are phosphodiester linkages; and / or
[0521] (i) the internucleotide linkage between the second cleavage region and the fourth segment is a phosphodiester linkage.
[0522] Embodiment 127. The compound according to any of the preceding embodiments, wherein:
[0523] (a) the second cleavage region comprises at least one nucleotide selected from a 2'-OMe modified nucleotide or a 2'-F modified nucleotide;
[0524] (b) each nucleotide of the second cleavage region is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide;
[0525] (c) the second cleavage region comprises at least one 2'-F modified nucleotide;
[0526] (d) the second cleavage region comprises no more than two 2'-F modified nucleotides;
[0527] (e) Z' in Formula A-2, Formula B-2, or Formula B'-2 is a 2'-F modified nucleotide, and optionally X2' in Formula A-2, Formula B-2, or Formula B'-2 is a 2'-F modified nucleotide;
[0528] (f) N1' in Formula B-2, or Formula B'-2 is a 2'-F modified nucleotide;
[0529] (g) X2' and Y' in Formula A-2, Formula B-2, or Formula B'-2 are both 2'-OMe modified nucleotides, and Z' is a 2'-F modified nucleotide, and further N1' in Formula B-2, or Formula B'-2 is a 2'-F modified nucleotide; and / or
[0530] (h) X2', Y', and Z' in Formula A-2, Formula B-2, or Formula B'-2 are 2'-OMe modified nucleotides, and N1' in Formula B-2, or Formula B'-2 is a 2'-F modified nucleotide.
[0531] Embodiment 128. The compound according to any of the preceding embodiments, wherein the DS2, or the second double-stranded portion in the DS2, further comprises at least one internucleoside linkage selected from a phosphorothioate linkage or a methylphosphonate linkage.
[0532] Embodiment 129. The compound according to any of the preceding embodiments, wherein:
[0533] (a) the first and / or second internucleotide linkage from the 5' end of the fourth segment is a phosphorothioate linkage or a methylphosphonate linkage; and / or
[0534] (b) the 1st and / or 2nd internucleoside linkage from the 3' end of the fourth segment is a phosphorothioate or methylphosphonate linkage. Embodiment 130. The compound of any of the preceding embodiments, wherein the DS2 comprises a double-stranded oligonucleotide of Formula C-2:
[0535] Formula C-2, wherein the fourth segment and the fifth segment form the second double- stranded portion by base pairing, and the fourth segment and the fifth segment are the same length;
[0536] wherein the second 5' extension segment comprises at least 3 nucleotides;
[0537] wherein the second antisense strand comprises the second cleavage region comprising the nucleotide (X2') 5' most of the second segment and the two nucleotides (Y'-Z') 3' most of the second 5' extension segment, the second cleavage region comprising a nucleotide sequence of Formula A-2:
[0538] Formula A-2: (3'-5') X2'-Y'-Z',
[0539] wherein the cleavage occurs between X2' and Y', Formula A-2 being as defined in any of embodiments 120-129;
[0540] wherein the second sense strand is 15-35, 15-23, 15-22, or 15-21 nucleotides in length;
[0541] wherein the second antisense strand is 25-35, 26-35, 26-30, 25-27, or 26-27 nucleotides in length; and wherein the 5' end of the first 5' extension segment and the 5' end of the second 5' extension segment are connected to the two ends of L, respectively.
[0542] Embodiment 131. The compound of any of the preceding embodiments, wherein the DS2 comprises a double-stranded oligonucleotide of Formula D-2:
[0543] Formula D-2, wherein the fourth segment and the fifth segment form the second double- stranded portion by base pairing, and the fourth segment and the fifth segment are the same length;
[0544] wherein the second 5' extension segment comprises at least 3 nucleotides;
[0545] wherein the second antisense strand comprises the second cleavage region comprising the nucleotide (X2') 5' most of the second segment and the two nucleotides (Y'-Z') 3' most of the second 5' extension segment, the second cleavage region comprising a nucleotide sequence of Formula A-2:
[0546] Formula A-2: (3'-5') X2'-Y'-Z',
[0547] wherein the cleavage occurs between X2' and Y', Formula A-2 is defined in any one of embodiments 120 to 129;
[0548] wherein the second sense strand is 15-35, 15-23, 15-22, 15-21, 16-25, 17-23, 18-23, 19-23, 19-21, 20-23, 20-21, or 21-23, e.g., 17, 18, 19, 20, 21, 22, or 23 nucleotides in length;
[0549] wherein the second antisense strand is 25-35, 25-30, 26-35, 26-30, 25-27, or 26-27, e.g., 25, 26, 27, 28, 29, or 30 nucleotides in length;
[0550] wherein the 5' end of the first 5' extension and the 5' end of the second 5' extension are connected to the two ends of L, respectively.
[0551] Embodiment 132. The compound according to any one of the preceding embodiments, wherein L is selected from a bond, a degradable linker, or a non-degradable linker.
[0552] Embodiment 133. The compound according to any one of the preceding embodiments, wherein L is selected from DNA, RNA, a functionalized monosaccharide, or an oligosaccharide.
[0553] Embodiment 134. The compound according to any one of the preceding embodiments, wherein L is a non-degradable linker.
[0554] Embodiment 135. The compound according to any one of the preceding embodiments, wherein L is sufficiently stable in an in vivo or in vitro environment.
[0555] Embodiment 136. The compound according to any one of the preceding embodiments, wherein L remains intact in the corresponding environment for a period of time before the compound contacts the target mRNA, e.g., remains intact in plasma for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 24, 48, or 72 hours without more than 5%, 10%, 20%, 30%, 40%, or 50% cleavage.
[0556] Embodiment 137. The compound according to any one of the preceding embodiments, wherein the molar ratio of the cleaved DS1 product that acts on the first target RNA or the target mRNA encoding the first target gene and the cleaved DS2 product that acts on the second target RNA or the target mRNA encoding the second target gene is about 1.
[0557] Embodiment 138. The compound according to any of the preceding embodiments, wherein L is as depicted in Formula (I-1') or (I-1),
[0558] wherein:
[0559] X is O or S;
[0560] Y is a single bond, -O-, or -S-;
[0561] L1is selected from the group consisting of a single bond, -O-, -S-, -S-S-, -(C=0)-, -NH-, -NH-(C=0)-, -CH2-, -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2CH2-, -0-CH2-, -S-CH2-, -0-CH2CH2-, -S-CH2CH2-, -CH2-0-CH2CH2-, -CH2CH2-0-CH2CH2-, -CH2CH2-0-CH2CH2-0-, -CH2-0-CH2-0-, -CH2CH2CH2-0-, -CH2CH2CH2-S-, -CH2-(C=0)-, -CH2-NH-(C=0)-, -0-(C=0)-NH-, -CH2-NH-, -C(=0)0-, -NHC(=0)0-, -NHC(=0)NH-, -OC(=0)0-, -OC(=0)NH-, -S(0)2NH-, -NHS(0)2-, and L2, L3, L4, L6, L7, L8, and L9are each independently selected from the group consisting of a single bond, -0-, -S-, -S-S-, -(C=0)-, -NH-, -NH-(C=0)-, -CH2-, -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2CH2-, -0-CH2-, -S-CH2-, -0-CH2CH2-, -S-CH2CH2-, -CH2-0-CH2CH2-, -CH2CH2-0-CH2CH2-, -CH2CH2-0-CH2CH2-0-, -CH2-0-CH2-0-, -CH2CH2CH2-0-, -CH2CH2CH2-S-, -CH2-(C=0)-, -CH2-NH-(C=0)-, -0-(C=0)-NH-, -C(=0)0-, -NHC(=0)0-, -NHC(=0)NH-, -OC(=0)0-, -OC(=0)NH-, -S(0)2NH-, -NHS(0)2-, and -CH2-NH-;
[0562] L5is selected from the group consisting of a single bond, -0-, -S-, -S-S-, -(C=0)-, -NH-, -NH-(C=0)-, -CH2-, -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2CH2-, -0-CH2-, -S-CH2-, -0-CH2CH2-, -S-CH2CH2-, -CH2-0-CH2CH2-, -CH2CH2-0-CH2CH2-, -CH2CH2-0-CH2CH2-0-, -CH2-0-CH2-0-, -CH2CH2CH2-0-, -CH2CH2CH2-S-, -CH2-(C=0)-, -CH2-NH-(C=0)-, -0-(C=0)-NH-, -CH2-NH-, -C(=0)0-, -NHC(=0)0-, -NHC(=0)NH-, -OC(=0)0-, -OC(=0)NH-, -S(0)2NH-, -NHS(0)2-, carbocycle, and heterocycle; the L5is optionally substituted with one or more R5; to the 5' end of the first antisense strand of the DS1.
[0563] Embodiment 139. The compound according to any of the preceding embodiments, wherein the L is according to Formula (I-2') or (I-2),
[0564] wherein:
[0565] Ring A is absent and L6is directly attached to the triazole;
[0566] Alternatively, Ring A is selected from a 5-16 membered heterocycle.
[0567] Embodiment 140. The compound according to any of the preceding embodiments, wherein L comprises 1, 2, or 3 dT, optionally, L further comprises the structure of (I-1) or (I-2) as described above.
[0568] Embodiment 141. The compound according to any of the preceding embodiments, wherein L is as depicted in (I-3), (I-4), or (I-5):
[0569] Embodiment 142. The compound according to any of the preceding embodiments, wherein L is as depicted in (I-6), (I-7), or (I-8):
[0570] Embodiment 143. The compound according to any of the preceding embodiments, wherein one end of L is attached to the nucleotide at position 6 from the 5’ end of the first sense strand, the other end of L is attached to the 5’ end of the second sense strand, and the second sense strand comprises the second 5’ extension.
[0571] Embodiment 144. The compound according to any of the preceding embodiments, wherein: structural unit is selected from optionally substituted
[0572] Embodiment 144A. The compound according to any of the preceding embodiments, wherein L is as depicted in (I-9), (I-10), (I-11), (I-12), (I-13), (I-14), (I-15), (I-16), (I-17), or (I-18),
[0573] Embodiment 145. The compound according to any of the preceding embodiments, wherein L is selected from
[0574] Embodiment 146. The compound according to any of the preceding embodiments, wherein L is absent and the 5’ most nucleotide of the first antisense strand is linked by a bond
[0575] (i) the 3' most nucleotide of the second sense strand; or
[0576] (ii) the 5' most nucleotide of the second sense strand; or
[0577] (ii) the 3' most nucleotide of the second antisense strand; or
[0578] (iv) the 5' most nucleotide of the second antisense strand.
[0579] Embodiment 147. The compound according to any of the preceding embodiments, wherein the L is absent and the 5' most nucleotide of the first 5' extension is linked to
[0580] (i) the 3' most nucleotide of the second sense strand; or
[0581] (ii) the 5' most nucleotide of the second sense strand; or
[0582] (ii) the 3' most nucleotide of the second antisense strand; or
[0583] (iv) the 5' most nucleotide of the second antisense strand.
[0584] Optionally, the first 5' extension is 3 nucleotides.
[0585] Embodiment 148. The compound according to any of the preceding embodiments, wherein at least one nucleotide is a modified nucleotide, preferably all nucleotides are modified nucleotides, the modification comprising one, two or more of the following in combination: 2'-OMe modification, 2'-F modification, 2'-deoxy modification, VP modification, 5'-MP modification, C16 modification, D02 modification, PS modification, PS2 modification, MP modification, MOP modification, invAB modification, invAb modification, modification that enhances the affinity of double stranded ribonucleic acid to ARGO protein.
[0586] Embodiment 149. The compound according to any of the preceding embodiments, further comprising one or more delivery systems, optionally each of the delivery systems is independently linked to DS1, DS2 or L.
[0587] Embodiment 150. The compound according to any of the preceding embodiments, wherein each of the delivery systems is independently a ligand, preferably the ligand alters the distribution, targeting or lifetime of the compound, more preferably the ligand provides enhanced affinity to a target, such as a molecule, a cell or cell type, a compartment, a receptor, such as a cellular or organ compartment, a tissue, an organ or a body region, more preferably the ligand enables delivery of the compound to a target tissue and produces an RNA interference effect.
[0588] Embodiment 151. The compound according to any of the preceding embodiments, wherein the ligands are each independently selected from GalNAc ligands, lipophilic ligands, or other ligands that target receptors to facilitate endocytosis of the compound, such as TfR-targeting ligands, LDL-R-targeting ligands, or integrin-targeting ligands.
[0589] Embodiment 152. The compound according to any of the preceding embodiments, wherein the first target RNA or first target gene is the same as the second target RNA or second target gene; or the first target RNA or first target gene is a different segment of the same RNA or the same gene as the second target RNA or second target gene; or the first target RNA or first target gene is a different RNA or a different gene than the second target RNA or second target gene.
[0590] Embodiment 153. A pharmaceutical composition comprising a compound according to any of the preceding embodiments, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
[0591] Embodiment 154. A method of inhibiting expression of a target gene in a subject in need thereof, comprising administering to the subject a pharmaceutically effective amount of a compound according to any one of embodiments 81-152, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to embodiment 153.
[0592] Embodiment 155. A method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a pharmaceutically effective amount of a compound according to any one of embodiments 81-152, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to embodiment 153, optionally the disease or disorder is related to a first target gene and / or a second target gene.
[0593] Also provided herein are the following non-limiting embodiments E1-E34.
[0594] Embodiment E1. A compound represented by Formula (I),
[0595] is capable of silencing a first target RNA or inhibiting expression of a first target gene and silencing a second target RNA or inhibiting expression of a second target gene by RNA interference;
[0596] wherein:
[0597] L is a bond;
[0598] DS1 is a double-stranded oligonucleotide comprising a first sense strand and a first antisense strand, which form a first double-stranded portion of 15 to 27 nucleotide pairs in length, and a first 5' extension in the first antisense strand upstream of the first double-stranded portion, the first 5' extension being 3 nucleotides in length,
[0599] the first double-stranded portion is formed by base pairing of a first segment of the first antisense strand and a second segment of the first sense strand, the first antisense strand comprising a nucleotide sequence represented by Formula B-1:
[0600] Formula B-1: (3'-5') X2-Y-Z-N1,
[0601] X2 is the 5'-most nucleotide of the first segment, Y, Z and N are the 3'-most three nucleotides of the first 5' extension.
[0602] DS2 is a double-stranded oligonucleotide comprising a second sense strand and a second antisense strand, which form a second double-stranded portion of 15 to 27 nucleotide pairs in length,
[0603] one end of L is connected to the 5'-end of the first antisense strand, and the other end is connected to the 3'-end or 5'-end of the second sense strand;
[0604] the first target RNA or first target gene is the same as or different from the second target RNA or second target gene.
[0605] Embodiment E2-1. The compound according to any of the preceding embodiments, wherein the first target RNA or first target gene and the second target RNA or second target gene are selected from PCSK9 and LPA, respectively.
[0606] Embodiment E2-2. The compound according to any of the preceding embodiments, wherein the first target RNA or first target gene is PCSK9, and the second target RNA or second target gene is LPA.
[0607] Embodiment E2-3. The compound according to any of the preceding embodiments, wherein the first antisense strand comprises the following sequence (5'-3'): CAA AAG CAA AAC AGG UCU AG.
[0608] Embodiment E2-4. The compound according to any of the preceding embodiments, wherein the second antisense strand comprises the following sequence (5'-3'): AU AAC UCUGUCCAUUACCAUU.
[0609] Embodiment E2. The compound according to any of the preceding embodiments, wherein Z is selected from G or A, or a natural or unnatural analogue thereof.
[0610] Embodiment E3. The compound according to any of the preceding embodiments, wherein Z is selected from G, or a natural or non-natural analogue thereof.
[0611] Embodiment E4. The compound according to any of the preceding embodiments, wherein X2is selected from A or U, or a natural or non-natural analogue thereof.
[0612] Embodiment E5. The compound according to any of the preceding embodiments, wherein Y is selected from A or U, or a natural or non-natural analogue thereof.
[0613] Embodiment E6. The compound according to any of the preceding embodiments, wherein N1is selected from A, C or U, or a natural or non-natural analogue thereof.
[0614] Embodiment E7. The compound according to any of the preceding embodiments, wherein N1is selected from C, or a natural or non-natural analogue thereof.
[0615] Embodiment E8. The compound according to any of the preceding embodiments, wherein the Formula B-1 has a sequence (3’-5’) selected from UUG-N1, UAG-N1, AUG-N1, AAG-N1, UUA-N1, UAA-N1, AUA-N1, AAA-N1, UCG-N1, UGG-N1, ACG-N1, AGG-N1, UCA-N1, UGA-N1, ACA-N1, AGA-N1, or a natural or non-natural analogue thereof.
[0616] Embodiment E9. The compound according to any of the preceding embodiments, wherein the Formula B-1 has a sequence (3’-5’) selected from UUGC, UAGC, AUGC, AAGC, UUAC, UAAC, AUAC, AAAC, UCGC, UGGC, ACGC, AGGC, UCAC, UGAC, ACAC, AGAC, or a natural or non-natural analogue thereof.
[0617] Embodiment E10. The compound according to any of the preceding embodiments, wherein the Formula B-1 has a sequence (3’-5’) selected from UUGC, UAGC, AUGC, AAGC, UUAC, UAAC, AUAC, and AAAC.
[0618] Embodiment E11. The compound according to any of the preceding embodiments, wherein the sequence represented by Formula B-1 comprises at least one modified nucleotide; preferably, all nucleotides in the sequence represented by Formula B-1 are modified nucleotides.
[0619] Embodiment E12. The compound according to any of the preceding embodiments, wherein the nucleotides comprise at least one modification; preferably, all nucleotides are modified nucleotides.
[0620] Embodiment E13. The compound according to any of the preceding embodiments, wherein the modification comprises: a 2'-OMe modification, a 2'-F modification, a 2'-deoxy modification, a VP modification, a 5'-MP modification, a C16 modification, a D02 modification, a PS modification, a PS2 modification, a MP modification, a MOP modification, an invAB modification, an invAb modification, a modification that enhances the affinity of the double-stranded ribonucleic acid for an ARGO protein.
[0621] Embodiment E14. The compound according to any of the preceding embodiments, wherein Formula B-1 has a sequence (3'-5') selected from: uaGfCf or aaGfCf.
[0622] Embodiment E15. The compound according to any of the preceding embodiments, wherein
[0623] (a) the internucleoside linkage between X2 and Y is not a phosphorothioate linkage;
[0624] (b) the internucleoside linkage between Y and Z is not a phosphorothioate linkage;
[0625] (c) the internucleoside linkage between Z and N1 is not a phosphorothioate linkage;
[0626] (d) the internucleoside linkage between X2 and the nucleotide immediately 3' downstream of X2 is a phosphorothioate linkage;
[0627] (e) the internucleoside linkage between the nucleotide immediately 3' downstream of X2 and the nucleotide second immediately 3' downstream of X2 is a phosphorothioate linkage;
[0628] (f) the internucleoside linkage between N1 and the nucleotide immediately 5' upstream of N1 is a phosphorothioate linkage; and / or
[0629] (g) the internucleoside linkage between the nucleotide immediately 5' upstream of N1 and the nucleotide second immediately 5' upstream of N1 is a phosphorothioate linkage.
[0630] Embodiment E16. The compound according to any of the preceding embodiments, wherein the first antisense strand further comprises a first 3' extension located 3' downstream of the first double-stranded portion; optionally, the first 3' extension has a length of 2 nucleotides.
[0631] Embodiment E17. The compound according to any of the preceding embodiments, wherein the second antisense strand further comprises a second 3' extension downstream of the 3' of the second double-stranded portion; optionally, the second 3' extension is 2 nucleotides in length.
[0632] Embodiment E18. The compound according to any of the preceding embodiments, wherein the first double-stranded portion and / or the second double-stranded portion is 15-25, 15-24, 15-23, 16-24, 16-23, 16-22, 16-21, 16-20, 17-23, 17-22, 17-21, 17-20, 18-23, 18-22, 18-21, 18-20, 19-23, 19-22, 19-21, or 19-20 nucleotide pairs in length.
[0633] a) 15-25, 15-24, 15-23, 16-24, 16-23, 16-22, 16-21, 16-20, 17-23, 17-22, 17-21, 17-20, 18-23, 18-22, 18-21, 18-20, 19-23, 19-22, 19-21, or 19-20 nucleotide pairs; or
[0634] b) 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide pairs.
[0635] Embodiment E19. The compound according to any of the preceding embodiments, wherein the first sense strand, the first antisense strand, the second sense strand, and / or the second antisense strand is 15-35, 16-35, 16-30, 16-27, 16-26, 16-25, 16-21, 17-35, 17-30, 17-25, 17-21, 18-35, 18-30, 18-25, 18-23, 18-21, 19-35, 19-30, 19-25, 19-21, 20-35, 20-30, 20-25, 20-23, 21-35, 21-30, 21-25, 21-23, e.g., 25, 24, 24, 23, 22, or 21 nucleotides in length.
[0636] Embodiment E20. The compound according to any of the preceding embodiments, wherein the first double-stranded portion is formed by base pairing of a first segment of the first antisense strand and a second segment of the first sense strand, optionally, the first segment and the second segment are the same in length; further, the first segment and the second segment have at least 80%, 85%, 90%, or 95% complementarity; still further, the first segment and the second segment have 100% complementarity.
[0637] Embodiment E21. The compound according to any of the preceding embodiments, wherein the first segment comprises a first targeting region that is sufficiently complementary to the first target RNA or a target mRNA encoding the first target gene; further, the first targeting region has at least 80%, 85%, 90%, or 95% complementarity to a portion of the target mRNA encoding the first target gene; further still, the first targeting region has 100% complementarity to a portion of the target mRNA encoding the first target gene.
[0638] Embodiment E22. The compound according to any of the preceding embodiments, wherein the second double-stranded portion is formed by base pairing of a fourth segment of the second antisense strand and a fifth segment of the second sense strand, optionally, the fourth and fifth segments are the same length; further, the fourth and fifth segments have at least 80%, 85%, 90%, or 95% complementarity; further still, the fourth and fifth segments have 100% complementarity.
[0639] Embodiment E23. The compound according to any of the preceding embodiments, wherein the fourth segment comprises a second targeting region that is sufficiently complementary to the second target RNA or a target mRNA encoding the second target gene; further, the second targeting region has at least 80%, 85%, 90%, or 95% complementarity to a portion of the target mRNA encoding the second target gene; further still, the second targeting region has 100% complementarity to a portion of the target mRNA encoding the second target gene.
[0640] Embodiment E24. The compound according to any of the preceding embodiments, wherein L is sufficiently stable in an in vivo or in vitro environment.
[0641] Embodiment E25. The compound according to any of the preceding embodiments, wherein L remains unbroken for a period of time in the corresponding environment before the compound contacts the target mRNA, for example, remains unbroken in plasma for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 24, 48, or 72 hours without breaking more than 5%, 10%, 20%, 30%, 40%, or 50%.
[0642] Embodiment E26. The compound according to any of the preceding embodiments, wherein the second sense strand and the second antisense strand are each independently 15-25, 15-23, 15-22, 15-21, 16-25, 17-23, 18-23, 19-23, 19-21, 20-23, 20-21, or 21-23, for example, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
[0643] Embodiment E27. The compound according to any of the preceding embodiments, wherein the molar ratio of the DS1 product that acts on the first target RNA or target mRNA encoding the first target gene and the DS2 product that acts on the second target RNA or target mRNA encoding the second target gene is about 0.8, 0.9, 1, 1.1, or 1.2.
[0644] Embodiment E27-1. The compound according to any of the preceding embodiments, wherein the first antisense strand comprises the following sequence (5’-3’): CGAACAAAAGCAAAACAGGUCUAGAA.
[0645] Embodiment E27-2. The compound according to any of the preceding embodiments, wherein the first antisense strand comprises the following sequence (5’-3’): CfGfaa*CfaAfAfAfgCfaAfaAfcAfgGfuCfuag*a*a (a: 2’-OMe adenine nucleoside; u: 2’-OMe uracil nucleoside; c: 2’-OMe cytosine nucleoside; g: 2’-OMe guanine nucleoside; Af: 2’-F adenine nucleoside; Uf: 2’-F uracil nucleoside; Cf: 2’-F cytosine nucleoside; Gf: 2’-F guanine nucleoside; (dC): cytosine deoxy nucleoside; *: phosphorothioate linkage).
[0646] Embodiment E27-3. The compound according to any of the preceding embodiments, wherein the second antisense strand comprises the following sequence (5’-3’): a*Uf*aa(dC)u(dC)uguc(dC)aUfuacca*u*u (a: 2’-OMe adenine nucleoside; u: 2’-OMe uracil nucleoside; c: 2’-OMe cytosine nucleoside; g: 2’-OMe guanine nucleoside; Af: 2’-F adenine nucleoside; Uf: 2’-F uracil nucleoside; Cf: 2’-F cytosine nucleoside; Gf: 2’-F guanine nucleoside; (dC): cytosine deoxy nucleoside; *: phosphorothioate linkage).
[0647] Embodiment E28. The compound according to any of the preceding embodiments, wherein further comprising 1, 2, or more delivery systems, optionally each of said delivery systems is independently linked to DS1 or DS2.
[0648] Embodiment E29. The compound according to any of the preceding embodiments, wherein each of said delivery systems is independently linked to the 5’ end of the first sense strand, to the 3’ end of the first sense strand, to the 5’ end of the second sense strand, or to the 3’ end of the second sense strand.
[0649] Embodiment E30. The compound according to any of the preceding embodiments, wherein the delivery system is each independently a ligand, preferably the ligand alters the distribution, targeting or lifetime, more preferably the ligand provides enhanced affinity to a target, such as a molecule, cell or cell type, compartment, receptor, such as a cellular or organ compartment, tissue, organ or body region, more preferably the ligand enables the compound to be delivered to a target tissue and produce an RNA interference effect.
[0650] Embodiment E31. The compound according to any of the preceding embodiments, wherein the ligand is each independently selected from a GalNAc ligand, a lipophilic ligand, or other ligand targeting a receptor to facilitate endocytosis of the compound, such as a TfR-targeting ligand, a LDL-R-targeting ligand or an integrin-targeting ligand; optionally the ligand is each independently NAG37 or L96.
[0651] Embodiment E32. A pharmaceutical composition comprising a compound according to any of the preceding embodiments, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
[0652] Embodiment E33. A method of inhibiting expression of a target gene in a subject in need thereof, comprising administering to the subject a pharmaceutically effective amount of a compound according to any one of embodiments E1-E31, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to embodiment E32.
[0653] Embodiment E34. A method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a pharmaceutically effective amount of a compound according to any one of embodiments E1-E31, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to embodiment E32, optionally the disease or disorder is related to a first target RNA or first target gene and / or a second target RNA or second target gene.
[0654] The following examples are intended to illustrate the present application and to better enable its use and practice. Modifications or variations to the application can be made by those skilled in the art, without departing from the spirit and scope of the application. Unless otherwise specifically indicated, reagents, kits and biological materials used in the present application are available from commercial sources. Unless otherwise specifically indicated, kits are used according to the manufacturer’s instructions.
[0655] Example 1 Preparation of Phosphoramidite Monomer M04
[0656] Step A: To a solution of M04-2 (2.23 g, 7.318 mmol) in DMF (30 mL) was added 2-(lH-benzotriazol-l-yl)-l,l,3,3-tetramethyluronium hexafluorophosphate (4.16 g, 10.977 mmol) and diisopropylethylamine (1.89 g, 14.636 mmol). After stirring for 10 min, M04-1 (3.07 g, 7.318 mmol) was added and stirred at room temperature under nitrogen overnight (15 h). Concentrated in vacuo and separated using reverse phase column (mobile phase: acetonitrile / water: 5%~95%) to give M04-3.
[0657] Step B: M04-3 (4.17 g, 5.908 mmol) was dissolved in dichloromethane (30 mL), 4,5-dicyanoimidazole (0.35 g, 2.954 mmol) and M04-4 (1.78 g, 5.908 mmol) were added and stirred at room temperature under nitrogen for 3 h. Saturated sodium bicarbonate (100 mL) was added and extracted with dichloromethane (50 mL x 3). The organic phase was washed with water (100 mL x 3) and saturated brine (100 mL) successively, dried over anhydrous sodium sulfate, filtered and concentrated to give the phosphoramidite monomer of M04.
[0658] 1 H NMR (400 MHz, CDC13) δ 7.38 - 7.35 (m, 2H), 7.29 - 7.15 (m, 7H), 6.83 - 6.79 (m, 4H), 4.73 - 4.53 (m, 1H), 4.37 - 4.33 (m, 1H), 4.20 (d, J = 2.4 Hz, 2H), 3.83 - 3.55 (m, 30H), 3.44 - 3.34 (m, 1H), 3.18 - 3.04 (m, 1H), 2.65 - 2.53 (m, 4H), 2.43 (t, J = 2.4 Hz, 1H), 2.39 - 2.02 (m, 2H), 1.20 - 1.13 (m, 12H). 31 P NMR (160 MHz, CDC13) δ 148.16, 147.89, 147.70, 147.52.
[0659] Preparation of phosphoramidite monomer M01
[0660] Step A: M01-1 (4 g, 14.217 mmol), M01-2 (2.02 g, 14.217 mmol) and triethylamine (3.952 mL, 28.434 mmol) were dissolved in methanol (20 mL) and stirred overnight (15 hours). After concentration in vacuo, it was dissolved in ethyl acetate (100 mL), washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered to give M01-3, which was used directly for the next step.
[0661] Step B: M01-3 (5.36 g, 14.204 mmol) was dissolved in dichloromethane (100 mL), 4,5-dicyanoimidazole (0.84 g, 7.102 mmol) and M04-4 (4.28 g, 14.204 mmol) were added, and stirred at room temperature for 2 hours under nitrogen protection. Saturated sodium bicarbonate (200 mL) was added, and extracted with dichloromethane (100 mL x 3). The organic phase was washed with water (100 mL x 3) and saturated brine (100 mL) successively, dried over anhydrous sodium sulfate, filtered, and concentrated to give the phosphoramidite monomer of M01.
[0662] 1 H NMR (400 MHz, CDCl3) δ 7.38 (s, 1H), 3.88-3.77 (m, 3H), 3.72-3.68 (m, 1H), 3.65-3.61 (m, 20H), 3.60-3.51 (m, 4H), 2.64 (6.4 Hz, 2H), 1.16 (dd, J = 6.8, 4.8 Hz, 12H). 31 P NMR (160 MHz, CDCl3) δ 148.51.
[0663] Preparation of phosphoramidite monomer M06
[0664] Step A: To a solution of M06-1 (10.88 g, 83.05 mmol) in dichloromethane (100 mL) was added 4,5-dicyanoimidazole (4.9 g, 41.53 mmol). It was cooled to 0 °C, and a solution of M04-4 (25 g, 83.05 mmol) in dichloromethane (30 mL) was added. The reaction was stirred at 25 °C for 16 hours under nitrogen protection. It was filtered, concentrated to remove dichloromethane, dissolved in n-hexane and separated using a silica gel column (mobile phase: pure n-hexane) to give M06. 1H NMR: (400 MHz, CDC13) δ 3.87-3.75 (m, 3H), 3.71-3.65 (m, 5H), 3.62-3.53 (m, 2H), 2.65-2.57 (m, 4H), 2.54-2.45 (m, 4H), 1.17 (dd, J = 8.0, 4.0 Hz, 12H). 31 P NMR: (160 MHz, CDC13) δ 148.02.
[0665] Example 4: Preparation of ribonucleic acid compound S1
[0666] 4.1 Synthesis of S1_1SS sequence and S1_2SS sequence
[0667] S1_1SS sequence (5'→ 3'): g * u * caucCfaCfAfAfugagagUfaca;
[0668] S1_2SS sequence (5'→ 3'): c * u * agacCfuGfu(dT)uugcuuuugu;
[0669] Synthesizer: MerMade 12;
[0670] Solid support: Universal CPG (40 pmol / g);
[0671] Synthesis scale: 5 pmol;
[0672] De-protection condition: 3% trichloroacetic acid in dichloromethane, 1.5 mL, 45 seconds, repeated 2 times;
[0673] Coupling condition: 0.05 M phosphoramidite (1 mL, 10 equivalents), 0.25 M 5- (ethylthio)-1H-tetrazole in acetonitrile (2 mL), 4.5 minutes;
[0674] Sulphurisation condition: 0.2 M ADTT in pyridine, 2 mL, 4 minutes;
[0675] Oxidation condition: 0.02 M iodine in pyridine / water / acetonitrile, 2 mL, 1.5 minutes;
[0676] Capping condition: Capping A / Capping B (1 : 1), 2 mL, 45 seconds;
[0677] De-protection condition: 20% diethylamine in acetonitrile, 5 mL, 10 minutes, repeated 3 times; 28% ammonia in ethanol (3: 1, v / v, 3 mL), 45 °C, 20 hours;
[0678] Purification: Ion pair reverse HPLC.
[0679] 4.2 S1_1AS-2AS sequence synthesis
[0680] 4.2.1 Synthesis of S1_1AS and S1_2AS sequences
[0681] S1_1AS sequence (5'→ 3'): [azide] [amine-C6] cgauGfuac(Tgn)cucauugUfgGfaugac*g*a
[0682] S1_2AS sequence (5'→ 3'): [BCN] [amine-C6] cgaaCfaAfAfAfgCfaAfaAfcAfgGfuCfuag*a*a
[0683] Synthesizer: MerMade 12
[0684] Solid support: Universal CPG (100 μmol / g)
[0685] Synthesis scale: 30 μmol;
[0686] Synthesis method: de-DMT protecting group conditions: 3% trichloroacetic acid in dichloromethane, 3 mL, 45 seconds, repeated 3 times;
[0687] Coupling conditions: 0.05 M phosphoramidite (1.2 mL, 2 equiv), 0.25 M 5-(ethylthio)-1 H-tetrazole in acetonitrile (2.4 mL), 2.5 minutes, repeated 3 times;
[0688] Sulphurisation conditions: 0.2 M ADTT in pyridine, 3 mL, 4.5 minutes;
[0689] Oxidation conditions: 0.02 M iodine in pyridine / water / acetonitrile, 3 mL, 2 minutes;
[0690] Capping conditions: Capping A / Capping B (1 : 1), 3 mL, 45 seconds;
[0691] Deprotection conditions: 20% diethylamine in acetonitrile, 5 mL, 10 minutes, 3 times; 28% aqueous ammonia / ethanol (3: 1, v / v, 15 mL), 45 °C, 20 hours;
[0692] Purification: Conversion to sodium salt: After removal of the aqueous ammonia, the amine salt sample was dissolved in sodium acetate (1 mol / L, 2 mL) and diluted with ethanol equivalent to 9 times the volume of the sodium acetate solution, then frozen precipitated in dry ice. The solid precipitate was collected by centrifugation and washed 3 times with ethanol (10 mL), then the solid was dissolved in Milli Q purified water. Water was removed by freeze-drying and finally about 13 μmol of crude product was obtained, which was directly used in the next step.
[0693] 4.2.2 Amino and carboxylate ligation reactions
[0694] Ten μmol of the amino-bearing compound (5'→3'): [amine-C6]cgauGfuac(Tgn)cucauugUfgGfaugac*g*a or [amine-C6]cgaaCfaAfAfAfgCfaAfaAfcAfgGfuCfuag*a*a, and 15 equivalents of azido carboxylate or BCN carboxylate and 100 equivalents of N,N-diisopropylethylamine were dissolved in a 1 : 1 water and acetonitrile solution (1 mL / 1 mL), and the solution was shaken for 16 hours. After 16 hours, the sodium salt was reconstituted: 3 M aqueous sodium acetate (1 mL) was added, diluted with 40 mL of ethanol solution, and frozen in dry ice for 30 minutes. The precipitated solid was collected by centrifugation, washed with 10 mL of ethanol three times, and then dissolved in Milli Q purified water. After removing water by lyophilization, approximately 10-11 μmol of S1_1AS and S1_2AS crude product was obtained, respectively, and used directly in the next step.
[0695] 4.2.3 Preparation of S1_1AS-2AS
[0696] To S1_1AS (3 μmol) and S1_2AS (3 μmol), 2 mL of water was added, and the solution was shaken for 16 hours. The resulting product was separated by ion pair reverse phase HPLC to obtain S1_1AS-2AS.
[0697] 4.3 Annealing
[0698] Two hundred thirty nmol of S1_1SS, S1_2SS, and S1_1AS-2AS were dissolved in enzyme-free water and mixed together, heated to 95°C for 2 minutes, and then cooled to room temperature. Lyophilization resulted in the ribonucleic acid compound S1.
[0699] Example 5: Preparation of ribonucleic acid compound Z1
[0700] 5.1 Synthesis of Z1_1SS sequence and Z1_2AS sequence
[0701] Z1_1SS sequence (5'→3'): g*u*caucCfaCfAfAfugagaguac*a;
[0702] Z1_2AS sequence (5'→3'): a*Cf*aAfAfAfgCfaAfaAfcAfgGfuCfuag*a*a;
[0703] Synthesizer: MerMade 12;
[0704] Solid support: Universal CPG (40 μmol / g);
[0705] Synthesis scale: 5 μmol;
[0706] Synthesis method:
[0707] De-DMT protecting group conditions: 3% trichloroacetic acid in dichloromethane, 1.5 mL, 45 seconds, repeated 2 times;
[0708] Coupling conditions: 0.05 M phosphoramidite (1 mL, 10 eq), 0.25 M 5-(ethylthio)-1 H-tetrazole in acetonitrile (2 mL), 4.5 minutes;
[0709] Sulfurization conditions: 0.2 M ADTT in pyridine, 2 mL, 4 minutes;
[0710] Oxidation conditions: 0.02 M iodine in pyridine / water / acetonitrile, 2 mL, 1.5 minutes;
[0711] Capping conditions: Capping A / Capping B (1 : 1), 2 mL, 45 seconds. Capping A is acetic anhydride / 2,6-dimethylpyridine / acetonitrile, 20:30:50, v / v / v, Capping B is 20% N-methylimidazole in acetonitrile, v / v;
[0712] Deprotection conditions: 20% diethylamine in acetonitrile, 5 mL, 10 minutes, repeated 3 times; 28% aqueous ammonia / ethanol (3 / 1, v / v, 3 mL), 45 °C, 20 hours;
[0713] Purification: First purification by anion exchange (AEX) HPLC, followed by RP-HPLC purification, then desalting using a reverse phase column, and lyophilization.
[0714] Product Z1_1SS, 11 mg (measured by optical density at 260 nm); Product Z1_2AS, 13 mg (measured by optical density at 260 nm).
[0715] 5.2 Z1_1AS sequence and Z1_2SS sequence synthesis
[0716] Z1_1AS sequence (5'→ 3'): [BCN] (M01) *CfGfau*Gfuac(Tgn)cucauugUfgGfaugac*g*a
[0717] Z1_2SS sequence (5'→ 3'): [azide] (M01) *c*uagacCfuGfu(dT)uugcuuuugu[L96]
[0718] Synthesizer: MerMade 12;
[0719] Solid support: Universal CPG (100 pmol / g);
[0720] Synthesis scale: 25 pmol * 2;
[0721] Synthesis method:
[0722] De-DMT protecting group condition: 3% trichloroacetic acid in dichloromethane, 3 mL, 4.5 min, repeated 3 times;
[0723] Coupling condition: 0.05 M phosphoramidite (1.2 mL, 2 equiv), 0.25 M 5-(ethylthio)-1 H-tetrazole in acetonitrile (2.4 mL), 2.5 min, repeated 3 times;
[0724] Sulfurization condition: 0.2 M ADTT in pyridine, 3 mL, 4.5 min;
[0725] Oxidation condition: 0.02 M iodine in pyridine / water / acetonitrile, 3 mL, 4.5 min;
[0726] Capping condition: Capping A / Capping B (1 : 1), 3 mL, 45 s. Capping A is acetic anhydride / 2,6-dimethylpyridine / acetonitrile, 20:30:50, v / v / v, Capping B is 20% N-methylimidazole in acetonitrile, v / v;
[0727] Deprotection condition: 20% diethylamine in acetonitrile, 5 mL, 10 min, repeated 3 times; 28% aqueous ammonia / ethanol (3 / 1, v / v, 15 mL), 45 °C, 20 h;
[0728] Purification: After removing the ammonia water, the ammonium salt sample was dissolved in 2 mL of 1 M sodium acetate solution, diluted with ethanol equivalent to 9 times the sodium acetate, and then frozen and precipitated in dry ice for 30 min. The solid precipitate was collected by centrifugation, washed with ethanol (10 mL) for 3 times, and then the solid was dissolved in enzyme-free water, freeze-dried to remove water, to obtain the products Z1_1ASM ((5’→3’): (M01)*CfGfau*Gfuac(Tgn)cucauugUfgGfaugac*g*a) and Z1_2SSM ((M01)*c*uagacCfuGfu(dT)uugcuuuugu[L96]), which were directly used for the next step.
[0729] 5.3 Amino and carboxylate linkage reaction
[0730] Amino-bearing compounds Z1_1ASM and Z1_2SSM (both 10 μmol) were dissolved in water / acetonitrile (1:1, 2 mL) with 10 equivalents of azido carboxylate or BCN carboxylate and 50 equivalents of N,N-diisopropylethylamine, respectively. The solution was shaken for 16 hours. The reaction solution was added with sodium acetate (3 mol / L, 2 mL), respectively, diluted with ethanol (40 mL) and placed in dry ice for 30 minutes. The precipitate was collected by centrifugal filtration, washed with ethanol (10 mL) for 3 times, added with enzyme-free water and freeze-dried to obtain the coupling crude product, which was purified by RP-IP-HPLC to obtain Z1_1AS and Z1_2SS, respectively.
[0731] 5.4 Preparation of Z1-1AS-2SS
[0732] Z1_1AS (6 μmol) and Z1_2SS (6 μmol) were dissolved in 0.1 M aqueous sodium tetraborate solution (4 mL) and stirred at room temperature for 16 hours. The obtained crude product was purified by RP-HPLC (TEAA system) and AEX-HPLC, and then desalted by RP-HPLC to obtain Z1_1AS-2SS after freeze-drying.
[0733] 5.5 Annealing
[0734] 1.1 μmol of Z1_1SS, Z1_1AS-2SS and Z1_2AS were mixed together in enzyme-free water (15 mL), respectively, heated to 95°C for 2 minutes and then cooled to room temperature, and then freeze-dried to obtain ribonucleic acid compound Z1. MS: m / z, 7026 (+Na + ), 7727 (+Na + ), 18291 (+Na + , +K + ).
[0735] Example 6: Preparation of ribonucleic acid compound Z24
[0736] 6.1 Sequence synthesis of Z24_1SS
[0737] Sequence of Z24_1SS (5’→3’): [L96]*c*uagacCfuGfu(dT)uugcuuuu*g*u
[0738] Synthesizer: MerMade 12
[0739] Solid phase support: Universal CPG (84.3 μmol / g)
[0740] Synthesis scale: 48 μmol;
[0741] Synthesis method: DMT protecting group removal condition: 3% trichloroacetic acid in dichloromethane, 3 mL, 75 seconds, repeated 4 times
[0742] Coupling condition: 1st nucleotide: 0.05 M phosphoramidite (1 mL), 0.25 M 5-(ethylthio)-lH-tetrazole in acetonitrile (2 mL), 100 seconds, repeated 3 times; 2nd nucleotide to nucleotide except special monomer [L96]: 0.05 M phosphoramidite (1 mL), 0.25 M 5-(ethylthio)-lH-tetrazole in acetonitrile (2 mL), 100 seconds, repeated 2 times; L96 monomer (special monomer): 0.05 M phosphoramidite (1 mL), 0.25 M 5-(ethylthio)-lH-tetrazole in acetonitrile (2 mL), 30 minutes, repeated 6 times. Sulfurization condition: 0.5 M DDTT in pyridine, 0.25 M amine, 0.05 M iodine in tetrahydrofuran, 3 mL, 6 minutes, repeated 2 times;
[0743] Oxidation condition: 0.02 M iodine in pyridine / water / acetonitrile, 2.4 mL, 1.5 minutes;
[0744] Capping condition: Capping A / Capping B (1 : 1), 3 mL, 45 seconds;
[0745] Deprotection condition: 20% diethylamine in acetonitrile, 5 mL, 4 times; 28% aqueous ammonia solution (6 mL), 55 °C, 4 hours;
[0746] Purification: ion exchange column purification, desalination, and lyophilization to obtain Z24_1SS.
[0747] 6.2 Sequence synthesis of Z24_2AS
[0748] Z24_2AS sequence (5'→ 3'): u*Af*cu(dG)a(dT)caaa(dT)aUfguuga*g*c
[0749] Synthesizer: OP100
[0750] Solid support: Unylinker 350PS (340.8 μmol / g)
[0751] Synthesis scale: 140 μmol;
[0752] Synthesis method: DMT protecting group removal condition: 3% trichloroacetic acid in dichloromethane, 300 cm / h, 8 CV;
[0753] Coupling condition: 1st nucleotide: 0.2 M phosphoramidite (2 equivalents), 0.6 M 5-(ethylthio)-lH-tetrazole in acetonitrile (9 equivalents), repeated 10 times;
[0754] Sulfurization conditions: 0.2 M ADTT in pyridine, 6 eq, 5 min;
[0755] Oxidation conditions: 0.02 M iodine in pyridine / water / acetonitrile, 2.4 mL, 1.5 min;
[0756] Capping conditions: Capping A / Capping B (1 : 1), 0.5 CV, 30 s;
[0757] Deprotection conditions: Ethanol / 28% ammonia solution (1 / 3), 45 °C, 20 h;
[0758] Purification: Ion pair reverse phase column purification, ion exchange column purification, desalting, lyophilization to give Z24_2AS.
[0759] 6.3 Sequence synthesis of Z24_2SS-1AS
[0760] Z24_2SS-1AS sequence (5'→ 3'):
[0761] [L96]*g*cucaacaUfaUfuUfgaucagu*a*CfGfaa*Cf*aAfAfAfgCfaAfaAfcAfgGfuCfuag*a*a
[0762] Synthesizer: MerMade 12
[0763] Solid support: Universal CPG (44.3 pmol / g)
[0764] Synthesis scale: 60 pmol;
[0765] Synthesis method: Deprotecting group conditions: 3% trichloroacetic acid in dichloromethane, 3 mL, 75 s, repeated 4 times;
[0766] Coupling conditions: 1st nucleotide: 0.05 M phosphoramidite (1 mL), 0.25 M 5-(ethylthio)-lH-tetrazole in acetonitrile (2 mL), 100 s, repeated 3 times; 2nd to 24th nucleotides: 0.05 M phosphoramidite (1 mL), 0.25 M 5-(ethylthio)-lH-tetrazole in acetonitrile (2 mL), 100 s, repeated 2 times; 25th to 34th nucleotides: 0.05 M phosphoramidite (1 mL), 0.25 M 5-(ethylthio)-lH-tetrazole in acetonitrile (2 mL), 6 min, repeated 2 times, 100 s, repeated 1 time; 35th to nucleotides except special monomer [L96]: 0.05 M phosphoramidite (1 mL), 0.25 M 5-(ethylthio)-lH-tetrazole in acetonitrile (2 mL), 6 min, repeated 2 times, 100 s, repeated 2 times; L96 monomer (special monomer): 0.05 M phosphoramidite (1 mL), 0.25 M 5-(ethylthio)-lH-tetrazole in acetonitrile (2 mL), 30 min, repeated 7 times.
[0767] Sulfurization conditions: 0.5 M DDTT in pyridine, 0.25 M amine, 0.05 M iodine in tetrahydrofuran, 3 mL, 6 min, repeated 2 times; oxidation conditions: 0.02 M iodine in pyridine / water / acetonitrile, 2.4 mL, 1.5 min;
[0768] Capping conditions: Capping A / Capping B (1:1), 3 mL, 45 s;
[0769] Deprotection conditions: 20% diethylamine in acetonitrile, 5 mL, 4 times; 28% aqueous ammonia solution (6 mL), 55 °C, 4 h;
[0770] Purification: ion pair reverse phase column purification, ion exchange column purification, desalination, and lyophilization to obtain Z24_2SS-1AS.
[0771] 6.4 Annealing
[0772] Equal molar amounts of Z24_1SS, Z24_2SS-1AS and Z24_2AS were dissolved in enzyme-free water, mixed together, heated to 95 °C, cooled to room temperature after 3 min, and then freeze-dried to obtain the ribonucleic acid compound Z24. MS: m / z, 6951, 8869, 17503.
[0773] Example 7: Preparation of a ribonucleic acid compound
[0774] Example 8 Synthesis of a precursor (diisopropylaminophosphorodithioic acid 2-cyanoethylhexadecyl ester) of D02
[0775] The synthesis method was similar to that of Example 3.
[0776] 1 H NMR (400 MHz, CDC13) δ 3.90-3.72 (m, 2H), 3.68-3.52 (m, 4H), 2.63 (t, J = 6.8 Hz, 2H), 1.59 (p, J = 6.8 Hz, 2H), 1.28-1.24 (m, 26H), 1.17 (d, J = 6.8, 4.2 Hz, 12H), 0.87 (t, J = 6.8 Hz, 3H).
[0777] 31 P NMR: (400 MHz, CDC13) δ 147.24.
[0778] Test Example 1: Cell activity of ribonucleic acid compounds
[0779] Materials
[0780] 1.1 Test compound
[0781] The test compound was prepared into a 20 μM stock solution with PBS.
[0782] 1.2 Cell strain
[0783] Huh7 cells were cultured in DMEM medium containing 10% fetal bovine serum, 1% glutamine, 1% NEAA, 1% penicillin-streptomycin.
[0784] 1.3 Main instruments
[0785] The main instruments used in this experiment include a fluorescence qPCR instrument, a centrifuge, and a cell counter.
[0786] 1.4 Main reagents and consumables
[0787] The main reagents used in this experiment include Lipofectamine TM iRNAiMAX transfection reagent, FastStart Universal Probe Mast (Roche), RNA extraction kit, FastKing cDNA first-strand synthesis kit, 96-well plate.
[0788] Experimental method
[0789] 2.1 Compound transfection plating
[0790] Huh7 cells (2x104cells / well) were seeded into 96-well cell plates, and siRNA was transfected into the cells using RNAiMAX at two concentration points (10 nM, 0.5 nM) at the time of plating. The cells were incubated overnight at 37°C in a 5% CO2incubator, and two replicate wells were measured in parallel. A no- compound control group containing RNAiMAX was also set up at the same time.
[0791] 2.2 RNA extraction and reverse transcription
[0792] After 24 hours of transfection, the culture medium was removed and the cells were collected for RNA extraction.
[0793] 2.3 qPCR detection of target gene mRNA expression levels
[0794] The target cDNA was detected by qPCR, and GAPDH cDNA was detected as an internal control in parallel. 8 μL of prepared PCR reaction solution and 2 μL of sample cDNA were added to a 384-well plate. The qPCR reaction program was as follows: heating at 95°C for 10 min, then entering the cycle mode, heating at 95°C for 15 s, then at 60°C for 1 min, and repeating multiple cycles.
[0795] Assays Primer supplier ID
[0796] AGT Thermo Hs01586213_m1 Thermo fisher
[0797] Experimental results: see Table E1.
[0798] Table E1 Cell activity test results
[0799] Experimental conclusion: The double-targeting compound produced by the present technology can significantly inhibit the target gene, which has a significant advantage over the prior art. The structural characteristics of the compound of the present technology play an important role in the activity of the target.
[0800] This experimental result confirms that in the present technology, the adjacent region, especially the first 5' extension, plays an important role in activity.
[0801] Test Example 2 Rat liver homogenate treatment reaction
[0802] Dissolve 1.00 mg of test article ds99 in 0.961 mL of water to give a working solution with a corrected concentration of 1,000,000 ng / mL. Mix the working solution with 20% rat liver homogenate and incubate at 37°C for 48 h to give a final sample with a concentration of 10000 ng / mL. Add 50.0 μL of IS working extraction solution (phenol / chloroform / isoamyl alcohol = 25 / 24 / 1, v / v / v) to the incubated sample to perform liquid-liquid extraction. After centrifugation, take 300 μL of supernatant to perform solid phase extraction. Then, transfer the sample to an equilibrated solid phase extraction plate, wash and elute the solid phase extraction plate. Evaporate the collected eluate. LC-HRMA: liquid chromatography-high resolution mass spectrometer; LC: Shimadzu, LC-30AD; HRMA: Q Exactive Plus or Q Exactive Focus (Thermo San Jose, CA)
[0803] Test article ds99:
[0804] SS (5'→ 3'): g*u*caucCfaCfAfAfugagagUfacu [L96]
[0805] AS (5'→ 3'): (M06)*CfGfaa*Gfuac(Tgn)cucauugUfgGfaugac*g*a
[0806] The results are shown in Figure 1. After 48 h of incubation, the observed products include un-catabolized test article (31%), test article with 1 nucleotide cleaved at the 3' end (15%), test article with 2 nucleotides cleaved at the 3' end and M06 cleaved (18%), test article with 3 nucleotides cleaved at the 5' end (15% + 5% + 10%), and other minor metabolites (5%).
[0807] From this, it can be seen that (1) the only 5' cleavage product is test article with 3 nucleotides cleaved at the 5' end; (2) the 3' end cleavage products include test article with one or two nucleotides cleaved at the 3' end; and (3) among all cleavage products, the product with 3 nucleotides cleaved at the 5' end is the major product.
[0808] Test Example 3: Mouse tail vein high pressure injection model
[0809] The blank control mice (BALB / C, 6-7 weeks, female) were subcutaneously injected with solvent PBS on day 0, and the administration group was subcutaneously injected with test siRNA (10 or 4 mg / kg) and single-target molecule (5 or 2 mg / kg) once. On day 6, all mice were injected with 8% of mouse weight of plasmid DNA solution (injection volume (mL) = mouse weight (g) x 8%) through high-pressure tail vein within 5 seconds. The mass of plasmid injected into each mouse was 10 μg. After all animals were sacrificed on day 7, the liver tissues of all groups were collected to extract RNA, and the RNA was reversely transcribed into cDNA according to the manual using RT SuperMix (+gDNA wiper) (Vazyme-R323) for qPCR. III RT SuperMix (+gDNA wiper) (Vazyme-R323) for qPCR. The target mRNA analysis was performed by the qPCR method, and the plasmid NEO (sequence information is shown in the following table) mRNA was detected as an internal control.
[0810] AGT single-target compound:
[0811] Test compound and dosage:
[0812] Test 1:
[0813] Test 2:
[0814] Experimental results: see FIGS. 2-5.
[0815] Experimental conclusion: the double-target compound produced by the present application can exhibit the effect of simultaneous inhibition of two target points in vivo, and is superior to the effect of single-target molecule.
[0816] The antisense strand of DS2 in the present embodiment can be compatible with a variety of different chemical modifications and molecular templates. Under a specific structure combination (type of delivery system and connection mode, type of linker), DS2 can exhibit significant in vivo efficacy, while DS1 maintains significant in vivo efficacy.
[0817] Test example 4: NHP long-term plasma target gene knockout model
[0818] The in vivo target gene knockdown effect of the dual-targeting compound Z1 of the present application was evaluated in cynomolgus monkeys. On the day of dosing, the dosing animals were weighed, and the prepared formulation was drawn up according to the body weight information and the dosing volume. The dosing site (waist back) of the selected animals was disinfected, and the animals (N = 2 per group) received either the vehicle PBS or a single 4 mg / kg subcutaneous dose of the Z1 reagent. Hemostasis was performed using dry cotton balls after the completion of dosing. Blood sampling was performed before dosing and on days 7, 14, 28, 35, 56, 70, and 98 after dosing. Blood sampling was performed after the blood sampling site of the animals was disinfected using alcohol cotton balls, and hemostasis was performed using dry cotton balls after blood sampling. The collected whole blood was sent to the clinical laboratory department for centrifugation to obtain serum.
[0819] The circulating AGT and PCSK9 protein contents of cynomolgus monkeys were quantified using ELISA kits specific for human AGT and PCSK9 (AGT: Sino Biological KIT10994; PCSK9: Sino Biological-KIT10594) according to the experimental procedures provided by the manufacturers. The data were expressed as percentages of the baseline values and presented as the mean value plus / minus the standard error of the mean value.
[0820] Experimental results: see FIGS. 6 and 7.
[0821] Experimental conclusion: the dual-targeting compound produced using the present technology can simultaneously and significantly inhibit the target in vivo in NHPs.
[0822] This experiment further suggests that the dual-targeting compound of the present application also has a significant in vivo efficacy in large animals. Since the in vivo efficacy of NHPs has a high conversion to human efficacy, it suggests the application prospect of the present technology.
[0823] Test Example 5: PBMC cytokine activation test
[0824] Experimental materials:
[0825] Experimental procedures:
[0826] PBMC cell treatment:
[0827] 1) Freshly extracted whole blood (10 mL) of healthy volunteers was collected in an EDTA anticoagulant tube vacuum blood collection tube. The whole blood sample was mixed evenly by repeatedly inverting up and down immediately after collection to ensure sufficient contact with the anticoagulant.
[0828] 2) Blood sample was diluted 2-fold with the same volume of PBS, 10 mL Lymphoprep (lymphocyte separation medium) was added to a 50 mL centrifuge tube, and 20 mL of the diluted blood sample was slowly added on top of the Lymphoprep, taking care not to break the interface.
[0829] 3) The centrifuge tube after sample addition was centrifuged at 1000 x g for 25 min at room temperature without brake.
[0830] 4) The middle white film layer where the PBMCs were located was collected into a new 50 mL centrifuge tube, and washed twice with 40 mL PBS at room temperature and centrifuged at 350 x g for 10 min. The cells were resuspended in complete medium at a cell density of 1.6 x 10^6 cells / mL.
[0831] 5) The PBMCs were plated into a 96-well plate at a cell number of 2E5 (125 μL) per well.
[0832] 6) The diluted test drug (125 μL) was added to the 96-well plate according to the plate map, with 2 duplicate wells; the blank group was added with the same content of RNase-free water medium and DMSO medium.
[0833] 7) After gently mixing the well plate, it was incubated in an incubator for 18-20 h.
[0834] 8) The supernatant was collected by centrifugation, and the secretion amounts of IL-6, TNF-a, IL-1β, and IFN-γ were detected by ELISA.
[0835] 9) The data were analyzed by GraphPad Prism 8 software.
[0836] Experimental results: see FIGS. 8, 9, 10, and 11.
[0837] Experimental conclusion: the double-targeting compound produced by the present technology has a lower immunogenicity risk.
[0838] Test Example 6: Huh7 cell activity test
[0839] Research purposes
[0840] The purpose of this experiment is to evaluate the in vitro inhibitory activity of the test substance on the target gene PCSK9 mRNA in Huh-7 cells.
[0841] Materials and methods
[0842] 2.1 Materials
[0843] 2.1.1 Test compound
[0844] Test compound: siRNA was prepared into 100 uM siRNA stock solution with RNase free H2O.
[0845] 2.1.2 Cell lines
[0846] Huh-7 cells were cultured in DMEM medium (Gibco Cat# 11965-092) containing 10% fetal bovine serum (FBS, Gibco Cat# 2279804CP) and 1% NEAA (ThermoFisher Cat# 11140050).
[0847] 2.1.3 Main instruments
[0848] The main instruments used in this experiment include fluorescent qPCR instrument (Roche 480), centrifuge (ThermoFisher SORVALL ST4 Plus), cell counter (Countstar Rigel2), PCR instrument (Dongshenglong ETC811), carbon dioxide incubator (ThermoFisher HERACELL240i).
[0849] 2.1.4 Main reagents and consumables
[0850] The main reagents used in this experiment include Lipofectamine TM RNAiMAX transfection reagent (INVITROGEN, Cat# 13778150), SuperReal PreMix Plus SYBR Green (Tiangen Cat# FP205), RNA extraction kit (Qiagen Cat# 74182), FastKing RT Kit With gDNase (TianGen Cat# KR116), 96-well plate (Costar 3799), qPCR specific primers for GAPDH, qPCR specific primers for PCSK9 & ANGPTL3.
[0851] Experimental methods
[0852] 3.1 Compound transfection plating
[0853] Huh-7 cells (2x104cells / well) were inoculated into 96-well cell plates, and siRNA was transfected into cells with RNAiMAX at the same time. The cells were cultured in a 37°C, 5% CO2 incubator for 24 hours, and 2 duplicate wells were measured in parallel. At the same time, a no-compound control group containing RNAiMAX was set up.
[0854] 3.2 RNA extraction and reverse transcription
[0855] After 24 hours of transfection, the culture medium was removed and the cells were collected for RNA extraction. Total RNA was extracted using RNeasy® Plus Universal 96Kit (QIAGEN - 74182). cDNA was synthesized using FastKing RT Kit (With gDNase) (Tiangen - KR116) according to the instructions.
[0856] 3.3 qPCR detection of target gene mRNA expression level
[0857] Target cDNA will be detected by SYBR Green qPCR, with GAPDH cDNA as an internal control for parallel detection. First dilute the cDNA 2.5 times with RNase free H2O, add 7.5 μL of prepared PCR reaction solution and 2.5 μL of sample cDNA in a 384-well plate. The qPCR reaction program is as follows: 50°C heating for 2 min, 95°C heating for 10 min, then enter the cycle mode, 95°C heating for 15 sec, followed by 60°C for 1 min, a total of 40 cycles.
[0858] Data analysis
[0859] The expression level of target gene mRNA of each sample was calculated by ΔΔCt relative quantification method. The relative expression of the target gene was expressed as 2-ΔΔCT.
[0860] The calculation formula is as follows: ΔCT = average Ct value of target gene - average Ct value of internal reference gene ΔΔCT = ΔCT (drug group) - ΔCT (RNAiMAX control group)
[0861] Relative expression of target gene PCSK9 = 2-ΔΔCT Inhibition rate of PCSK9 = (1 - value of sample / Ave. value of RNAiMAX Control) * 100
[0862] GraphPad Prism software was used for graphical analysis.
[0863] Assays primers:
[0864] PCSK9 Thermo Hs00545399_m1 Thermo fisher
[0865] Test Example 7: LPA psiCHECK-2 plasmid transfection cell activity test
[0866] Purpose of the study
[0867] The purpose of this study is to evaluate the in vitro inhibitory activity of the compound on LPA.
[0868] Materials and Methods
[0869] Test Compound was prepared in RNase-free water to a 100 mM stock solution. Huh7 was resuscitated and cultured in DMEM medium (Gibco Cat# 11965-092) containing 10% fetal bovine serum (FBS, Gibco Cat# 10091148), 1% penicillin-streptomycin (PS, HyClone Cat# SV30010). The main instruments used in the experiment include fluorescent multi-mode microplate reader (Synergy H4 Hybrid Multi-Mode Microplate Reader), centrifuge (Beckman Allegra-X15R Centrifuge), cell counter (Countstar Rigel S2). The main reagents used in the experiment include Lipofectamine RNAiMAX (Invitrogen Cat# 13778-150), FUGEN HD Transfection (Promega Cat# E2311), Dual-Glo luciferase Assay System (Promega Cat# E2940), psiCHECK-2 construct was synthesized by GenScript.
[0870] Test Method
[0871] 1 Day 0, psiCHECK-2 plasmid transfection
[0872] Add 300 μL Opti-MEM and 3 μg psiCHECK-2 plasmid to an RNase-free EP tube (mix #1). Take one bottle of T15 cell bottle to add trypsin-digested Huh7 cells, count the cells using a cell counter, and adjust the cell density to 1*10^5 / ml. Add 12 μL Fugene-HD to the mix #1 tube, mix the resulting solution and incubate for 15 minutes (mix #2). Add the solution to 12 mL of cell suspension, mix well, and aliquot the suspension into a 96-well plate (100 μL / well).
[0873] 2 Day 1, siRNA transfection
[0874] Dilute the siRNA with Opti-MEM medium at a ratio of 4.7:0.3 Incubate RNAiMAX reagent at room temperature for 15 minutes. Dilute siRNA with water without RNA to make 20x stock solution (for example, if the final test concentration is 25nM, make this stock solution to 500nM). Mix equal volume of diluted RNAiMax and siRNA (v:v=1:1). Incubate the mixture at room temperature for 15 minutes to form complex. Take 25μl complex per well, mix with 225μl fresh DMEM medium, discard the supernatant in the assay plate, and take 120μl complex mixture to add to the 96-well plate.
[0875] 3Detect dual fluorescence (firefly and Renilla)
[0876] After 48 hours, remove the culture medium. Dilute with DMEM medium containing 10% FBS at 1:1 Reagent, add 120μL, shake for 15 minutes to lyse the cells, and transfer 60μL to a white 96-well plate. Detect firefly fluorescence with Envision. Stop and Reagent, prepared at 1:100, add 30μL to a white 96-well plate, and detect Renilla fluorescence with Envision.
[0877] Data analysis: Test ratio = (Renilla luminescence value of sample - Renilla luminescence value of background) / (Firefly luminescence value of sample - Firefly luminescence value of background) Inhibition % = (1 - sample ratio / RNAiMAX control ratio) x 100%
[0878] Experimental results:
[0879] Table E2 Cell activity test results
[0880] Table E3 Cell activity test results
[0881] Experimental conclusion: In the present technology, when the first 5' extension segment of DS1 is DNA, it has a greater impact on activity. When the first 5' extension segment is various modified RNA, it shows wide compatibility, and when the length is 1 to 6 modified RNA, it shows good activity. The relatively optimal technical solution is NGfa (N is any RNA).
[0882] Table E4 Cell activity test results
[0883] Experimental conclusion: The number and position of internucleoside linkage modifications in the abutting region (especially nuclease resistant internucleoside linkages, such as phosphorothioate modifications) have a strong influence on activity. The number of internucleoside linkage modifications in the abutting region or near the abutting region also has a significant influence on activity. A decrease in activity was observed when the number of internucleoside linkage modifications in the abutting region and near the abutting region exceeded 6.
[0884] Experimental results:
[0885] Table E6 Cell activity test results
[0886] Table E7 Cell activity test results
[0887] Experimental conclusion: Compared to the molecule (Z14) in which the first trigger sense strand and the second trigger sense strand are connected using a fragile linker (dTdTdT), the present technology exhibits equivalent EC50, but a better inhibition rate at high concentrations.
[0888] Test results:
[0889] Table E8 Cell activity test results
[0890] Table E9 Cell activity test results
[0891] Experimental conclusion: The compounds produced using the present technology exhibit good inhibitory activity against the target under in vitro transfection conditions when combined with different delivery systems. Under in vitro transfection conditions, the molecule exhibits good, approximately equivalent activity whether one or two GalNAc delivery systems are connected.
[0892] Test results:
[0893] Table E10 Cell activity test results
[0894] Experimental conclusion: The compounds provided by the present technology, in which the non-nucleotide linker connects DS1 and DS2, also exhibit good results.
[0895] Test Example 8: Transfection cell activity test of human primary hepatocytes
[0896] Materials and methods
[0897] Test compound: Prepared into a 100 μM stock solution using RNase-free water.
[0898] PHHs were provided by Shanghai Medicilon Pharmaceutical Development Co., Ltd., batch JMJ.
[0899] Main instruments
[0900] The main instruments used in this experiment include fluorescent qPCR instrument (Quanstudio 7 flex / Quanstudio 6 flex), centrifuge (Beckman Allegra-X15R Centrifuge), cell counter (Countstar Rigel S2), PCR instrument (Dongshenglong ETC811), carbon dioxide incubator (ThermoFisher HERACELL240i).
[0901] Main reagents and consumables
[0902] The main reagents used in this experiment include AceQ Universal U+Probe Master Mix V2 (Vazyme, item number Q513-03), Lipofectamine TM RNAiMAX transfection reagent (INVITROGEN, item number 13778-150), EZB-Press 96 RNA Purification (EZB item number EZ4001-L), HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, item number R323-01), 96-well plate (Costar item number 3599), Hs02786624_g1 GAPDH gene Gene Expression Assays (60x) and Hs0054399_m1 PCSK9 gene Gene Expression Assays (60x) are provided by Pharmalink New Drug Development Co., Ltd.
[0903] Experimental method
[0904] Cell plating and drug addition
[0905] Dilute the test compound to a final concentration of 20 times with Nuclease-Free Water (e.g. final concentration of 100 nM, corresponding to dilution to 2000 nM).
[0906] Take 1 PHH (1 ml each) and transfer it to 10 ml of preheated InvitroGRO CP Medium containing 10% FBS and 1% Penicilin-Streptomyci, inoculate into a 96-well plate at a density of 54000 cells per well (90 μL / well), plate at the same time with RNAiMAX into cells with different concentrations of siRNA (10 μL / well), and set up a blank control containing Compound-free control group of RNAiMAX, cells were placed in a 5% CO2, 37°C incubator for 48 hours.
[0907] RNA extraction and reverse transcription
[0908] After 48 hours, remove the culture medium and collect the cells for RNA extraction. Total RNA was extracted using EZB-Press 96 RNA Purification (EZB Catalog No. EZ4001-L) according to the kit instructions. Synthesize cDNA using HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Catalog No. R323-01) according to the instructions.
[0909] qPCR detects the expression level of target gene mRNA
[0910] Target cDNA will be detected by qPCR, while detecting the reference gene GAPDH cDNA, qPCR reaction system preparation is shown in Table 1. Add 8 μL of prepared PCR reaction solution and 2 μL of sample cDNA in 384 wells. The qPCR reaction program is: 95°C for 10 min, then 95°C for 15 sec, 60°C for 1 min for 40 cycles, then 95°C for 15 sec, 60°C for 1 min, 95°C for 15 sec.
[0911] RT-PCR reaction system
[0912] Component volume (μL) / per well
[0913] AceQ Universal U+Probe Master Mix V2
[0914] Hs02786624_g1 GAPDH gene Gene Expression Assays (60x) / Hs0054399_m1 PCSK9 gene Gene Expression Assays (60x) 0.17
[0915] cDNA 2
[0916] Nuclease-free water Up to total 10 μl
[0917] Data analysis
[0918] The expression level of each sample target gene mRNA was calculated by the ΔΔCt relative quantification method. The relative expression of the target gene was expressed by 2-ΔΔCT.
[0919] The calculation formula is as follows: ΔCT = average Ct value of target gene - average Ct value of internal reference gene ΔΔCT = ΔCT (drug group) - ΔCT (RNAiMAX control group) Relative expression of target gene PCSK9 = 2-ΔΔCT Inhibition rate of PCSK9 = (1-value of sample / Ave.value of RNAiMAX control)*100
[0920] The data was processed using GraphPad Prism software to calculate the 50% inhibition concentration (EC50) value of the compound on PCSK9.
[0921] Test results:
[0922] Table E2 cell activity test results
[0923] Experimental conclusion: The double-targeting compound produced by the present application shows good inhibitory activity on the target in human primary hepatocytes in vitro.
[0924] Test Example 9: Human primary hepatocyte free uptake cell activity test Test compound: Nuclease-Free Water was used to prepare the corresponding concentration stock solution.
[0925] Cell strain:
[0926] PHH cells were provided by Shanghai or Chengdu Drug R&D Co., Ltd. The PHH cells were cultured in InvitroGRO CP medium containing 10% fetal bovine serum.
[0927] Main instruments:
[0928] The main instruments used in this experiment include a fluorescence qPCR instrument (Quanstudio 7flex), a centrifuge (Beckman Allegra-X15R Centrifuge), and a cell counter (Countstar Rigel S2).
[0929] Main reagents and consumables:
[0930] The main reagents and consumables used in this experiment include: RNA extraction kit (Qiagen-74182), FastKing cDNA first strand synthesis kit (TIANGEN-KR116-02), FasStart Universal Probe Master (Roche-04914058001), AceQ Universal U Probe Master Mix V2 (Vazyme-Q513-02), FasStart Universal SYBR Green Master (Roche-4913914001) and 96-well plates (Costar 3599).
[0931] Target genes PCSK9, ANGPTL3 and reference gene primers and probes were purchased from ThermoFisher. Other reagents and consumables were provided by WuXi.
[0932] Experimental methods:
[0933] Compound free uptake plating
[0934] Dilute the test compound to a final concentration of 10 times (e.g. final concentration of 25 nM, corresponding to dilution to 250 nM) with Nuclease-Free Water.
[0935] Inoculate PHH cells (5.4 x 104cells / well) into collagen-coated 96-well cell plates, and at the same time, add different concentrations of siRNA into the corresponding cell wells. At the same time, set up a no-compound control group containing Nuclease-Free Water.
[0936] RNA extraction and reverse transcription
[0937] After 48 hours of free uptake, remove the culture medium and collect the cells for RNA extraction. Extract total RNA using the RNA extraction kit (Qiagen-74182) according to the kit instructions. Synthesize cDNA using the FastKing cDNA first-strand synthesis kit (TIANGEN-KR116-02) according to the instructions.
[0938] qPCR detection of target gene mRNA expression levels
[0939] The target cDNA will be detected by qPCR, while the corresponding reference gene (such as GAPDH cDNA or β-actin cDNA) will be detected in parallel. qPCR reaction program (TapMan Probe): heat at 95°C for 10 minutes, then enter the cycle mode, heat at 95°C for 15 seconds, then at 60°C for 1 minute, for a total of 40 cycles. qPCR reaction program (SYBR Green): heat at 95°C for 10 minutes, then enter the cycle mode, heat at 95°C for 15 seconds, then at 60°C for 1 minute, for a total of 40 cycles.
[0940] Data analysis
[0941] The expression level of each sample target gene mRNA was calculated by the ΔΔCT quantitative method. The relative expression of the target gene was represented by 2-ΔΔCT.
[0942] The calculation formula is as follows: ΔCT = average Ct value of target gene- average Ct value of internal reference gene ΔΔCT = ΔCT (drug group)- ΔCT (nuclease-free water control group) Relative expression of target gene = 2-ΔΔCT Inhibition rate of target gene = (1-value of sample / nuclease-free water control)*100
[0943] GraphPad Prism software was used for graphing analysis, and the inhibition rate results were expressed as mean ± SD.
[0944] The primers used in the experiment are as follows:
[0945] Assay supplier ID
[0946] ANGPTL3 Thermo Hs00205581_m1 Thermo fisher
[0947] PCSK9 Thermo Hs00545399_m1 Thermo fisher
[0948] ANGPTL3 single-target compound Z82:
[0949] Experimental results:
[0950] Table E13 cell activity test results
[0951] Table E14 cell activity test results
[0952] Table E15 cell activity test results
[0953] Table E16 cell activity test results
[0954] Conclusion: The double-target compound produced by the application has good free uptake activity of hepatocytes, especially the compound containing two delivery systems has good free uptake activity.
[0955] Test example 10: cell activity test targeting different genes
[0956] Purpose
[0957] The in vitro activity of siRNA molecules was evaluated by the degree of silencing of target genes by each candidate molecule using HepG2, Hep3B and Huh7 cell lines
[0958] • Cell lines
[0959] HepG2, Hep3B and Huh7 cells were provided by Nanjing Kebai Biotechnology Co., Ltd.
[0960] HepG2 and Hep3B cells were cultured in MEM medium (Gibco catalog number 11095080) containing 10% fetal bovine serum (FBS, Gibco catalog number 10099-141C), 1% sodium pyruvate (100 mM) (Gibco catalog number 11360070), 1% NEAA (Gibco catalog number 11140050).
[0961] Huh-7 cells were cultured in DMEM medium (Gibco catalog number 11965-092) containing 10% fetal bovine serum (FBS, Gibco catalog number 2279804CP) and 1% NEAA (ThermoFisher catalog number 11140050).
[0962] • Main instruments
[0963] The main instruments used in this experiment include fluorescent qPCR instrument (Roche 480 II), centrifuge (ThermoFisher catalog number 75016073), cell counter (Countstar Rigel2).
[0964] • Main reagents and consumables
[0965] The main reagents used in this experiment include Lipofectamine TM iRNAiMAX transfection reagent (INVITROGEN, catalog number 56532), RNA extraction kit (Tiangen, catalog number DP671-T1), FastKing cDNA first strand synthesis kit (TianGen, catalog number KR116-02), 96-well plate (Costar 3599). SuperReal PreMix Plus (SYBR Green) (TIANGEN, catalog number: FP215-02), QPCR primers were synthesized by Goldenway.
[0966] • Experimental methods
[0967] 1. Compound transfection plating
[0968] According to the following table, the corresponding cells (1.5 x 10 4Cells were plated into 96-well cell plates at 5000 cells / well, and siRNA was transfected into cells using RNAiMAX at the same time. The siRNA testing set 7 concentration points (Dosing range refer to the table below), incubated overnight at 37°C, 5% CO2 incubator for 24h. At the same time, set up no compound control group containing RNAiMAX.
[0969] 2. RNA extraction and reverse transcription
[0970] After 24 hours of transfection, the culture medium was removed and the cells were collected for RNA extraction. Total RNA was extracted using the FastKing RT Kit (With gDNase) (Tiangen-KR116-02) according to the instructions.
[0971] 3. qPCR detection of target gene mRNA expression level
[0972] Target cDNA will be detected by qPCR, and GAPDH cDNA will be detected as an internal control at the same time. Add 9 μL of prepared PCR reaction solution and 1 μL of sample cDNA to 384 wells. The qPCR reaction program is as follows: heat at 95°C for 15 min, then enter the cycle mode, heat at 95°C for 10 sec, 60°C for 20 s, then 72°C for 32 s, a total of 40 cycles. The primer information is as follows:
[0973] • Data analysis
[0974] The expression level of target gene mRNA of each sample was calculated by ΔΔCt relative quantification method. The relative expression of target gene was represented by 2-ΔΔCT.
[0975] The calculation formula is as follows: ΔCT = average Ct value of target gene - average Ct value of internal reference gene ΔΔCT = ΔCT (drug group) - ΔCT (RNAiMAX control group) Relative expression of target gene = 2-ΔΔCT
[0976] According to the relative expression of target gene after treatment, the inhibition rate of each candidate molecule on target gene was obtained using formula (1-test group / control group) %.
[0977] • Experimental results
[0978] The inhibition IC50 of each candidate molecule on target gene is as follows.
[0979] Table E17 cell activity test results
[0980] Table E18 Cell activity test results
[0981] Table E14
[0982] Table E19 Cell activity test results
[0983] Table E20 Cell activity test results
[0984] Table E21 Cell activity test results
[0985] Experimental conclusion: The present technology has broad spectrum of sequence and target adaptability, and the dual-targeting compounds generated by the present technology for various sequences and targets all show good activity.
[0986] Test Example 11: ARPE-19 and G401 cell activity test
[0987] Purpose
[0988] Using ARPE-19 and G401 cell lines, the in vitro activity of siRNA molecules was evaluated by the silencing degree of target genes of each candidate molecule
[0989] Cell lines
[0990] G401 cells were provided by Nanjing Kebai Biotechnology Co., Ltd.
[0991] ARPE-19 cells were provided by Shanghai Fuheng Biotechnology Co., Ltd.
[0992] G401 cells were cultured in McCoy's 5A medium (Gibco catalog number 16600-082) containing 10% fetal bovine serum (FBS, Gibco catalog number 10099-141C).
[0993] ARPE-19 cells were cultured in DMEM medium (Gibco catalog number 11965-092) containing 10% fetal bovine serum (FBS, Gibco catalog number 2279804CP).
[0994] Main instruments
[0995] The main instruments used in this experiment include fluorescent qPCR instrument (Roche 480 II), centrifuge (ThermoFisher catalog number 75016073), cell counter (Countstar Rigel2).
[0996] Main reagents and consumables
[0997] The main reagents used in this experiment include Lipofectamine TM iRNAiMAX transfection reagent (INVITROGEN, item number 56532), RNA extraction kit (Tiangen, item number DP671-T1), FastKing cDNA first strand synthesis kit (Tiangen, item number KR116-02), 96-well plate (Costar 3599). SuperReal PreMix Plus (SYBR Green) (Tiangen, item number: FP215-02), QPCR primers synthesized by Goldengene.
[0998] Primer information:
[0999] • Experimental method
[1000] 4. Compound transfection plating
[1001] According to the following table, inoculate the corresponding cells (1.5 x 10 4 cells / well) into a 96-well cell plate. At the same time, transfect siRNA into cells with RNAiMAX. The siRNA test sets 7 concentration points (Dosing range, see table below). Incubate overnight at 37°C in a 5% CO2 incubator for 24 hours. At the same time, set up a no- compound control group containing RNAiMAX.
[1002] 5. RNA extraction and reverse transcription
[1003] After transfection for 24 hours, remove the culture medium and collect the cells for RNA extraction. Extract total RNA according to the kit instructions using 96 Kit (Tiangen-DP671-T1). Synthesize cDNA according to the instructions using FastKing RT Kit (With gDNase) (Tiangen-KR116-02).
[1004] 6. qPCR detection of target gene mRNA expression level
[1005] Target cDNA will be detected by qPCR, and GAPDH cDNA will be detected as an internal control. Add 9 μL of prepared PCR reaction solution and 1 μL of sample cDNA to a 384-well plate. The qPCR reaction program is as follows: heat at 95°C for 15 min, then enter the cycle mode, heat at 95°C for 10 sec, 60°C for 20 s, then 72°C for 32 s, for a total of 40 cycles.
[1006] • Data analysis
[1007] The expression level of each sample target gene mRNA was calculated by the ΔΔCt relative quantification method. The relative expression of the target gene was calculated using 2 -ΔΔCT indicates.
[1008] The calculation formula is as follows: ΔCT = average Ct value of target gene - average Ct value of internal reference gene ΔΔCT = ΔCT (drug group) - ΔCT (RNAiMAX control group) Relative expression of target gene = 2 -ΔΔCT
[1009] According to the relative expression of the target gene after treatment, the inhibition rate of each candidate molecule on the target gene was obtained using formula (1-test group / control group) %.
[1010] Results of the experiment
[1011] IC of each candidate molecule on the target gene 50 See the table below.
[1012] Table E22 results of cell activity test
[1013] Conclusion of the experiment: The present application has broad spectrum of sequence and target adaptability, and the compounds generated by the present application for a single target and the same sequence have good activity.
[1014] Table E23 results of cell activity test
[1015] Conclusion of the experiment: The present application has broad spectrum of sequence and target adaptability, and the compounds generated by the present application for a single target and the same sequence have good activity.
[1016] Test example 12: cell activity test
[1017] Purpose
[1018] The in vitro activity of siRNA molecules was evaluated by the silencing degree of each candidate molecule on the target gene using mPH cell lines
[1019] The mPH cell line was provided by Miaoshun (Shanghai) Biotechnology Co., Ltd.
[1020] The mPH cells were cultured in hepatocyte plating medium (provided in the hepatocyte culture medium kit, Miaoshun, item number HCTPM-R-002).
[1021] Main instruments
[1022] The main instruments used in this experiment include fluorescence qPCR instrument (Roche 480 II), centrifuge (ThermoFisher item number 75016073), cell counter (Countstar Rigel2).
[1023] • Main reagents and consumables
[1024] The main reagents used in this experiment include Lipofectamine TM iRNAiMAX transfection reagent (INVITROGEN, item number 56532), RNA extraction kit (Tiangen, item number DP671-T1), FastKing cDNA first strand synthesis kit (Tiangen, item number KR116-02), 96-well plate (Costar 3599). SuperReal PreMix Plus (SYBR Green) (Tiangen, item number FP215-02), QPCR primers synthesized by Goldenway.
[1025] • Experimental methods
[1026] 7. Compound transfection plating
[1027] Add all the mouse tail type 1 collagen (provided in the hepatocyte culture medium kit, Miasun, item number HCTPM-R-002) into the hepatocyte coating medium (provided in the hepatocyte culture medium kit, Miasun, item number HCTPM-R-002), 100 μL per well into the 96-well cell plate, incubate at 37°C for 40 minutes, and then aspirate the liquid in the well.
[1028] Take the mPH out of the liquid nitrogen and heat it in a 37°C water bath until there are no obvious ice blocks. Then add all the cells into the hepatocyte recovery medium (provided in the hepatocyte culture medium kit, Miasun, item number HCTPM-R-002), centrifuge at 50 x g for 2 minutes, resuspend with hepatocyte plating medium (provided in the hepatocyte culture medium kit, Miasun, item number HCTPM-R-002), and then count.
[1029] Inoculate mPH cells (1.0 x 10 4 Cell / well) into the 96-well cell plate according to the table below, and transfect siRNA into the cells with RNAiMAX at the same time. The siRNA testing set has 7 concentration points (dosing range, refer to the table below), and incubate overnight in a 37°C, 5% CO2 incubator for 24 hours. At the same time, set up a no-compound control group containing RNAiMAX.
[1030] 8. RNA extraction and reverse transcription
[1031] After 24 hours of transfection, the culture medium was removed and the cells were collected for RNA extraction. Total RNA was extracted using the 96 Kit (Tiangen-DP671-T1) according to the kit instructions. cDNA was synthesized using the FastKing RT Kit (With gDNase) (Tiangen-KR116-02) according to the instructions.
[1032] 9. qPCR detection of target gene mRNA expression levels
[1033] Target cDNA will be detected by qPCR, with GAPDH cDNA as an internal control for parallel detection. Add 9 μL of prepared PCR reaction solution and 1 μL of sample cDNA to a 384-well plate. The qPCR reaction program is as follows: heat at 95°C for 15 min, then enter the cycle mode, heat at 95°C for 10 sec, 60°C for 20 s, then 72°C for 32 s, for a total of 40 cycles.
[1034] Primer information:
[1035] • Data analysis
[1036] The expression level of the target gene mRNA of each sample is calculated by the ΔΔCt relative quantification method. The relative expression of the target gene is represented by 2-ΔΔCT.
[1037] The calculation formula is as follows: ΔCT = average Ct value of target gene - average Ct value of internal reference gene ΔΔCT = ΔCT (drug-treated group) - ΔCT (RNAiMAX control group) Relative expression of target gene = 2-ΔΔCT
[1038] According to the relative expression of the target gene after treatment, the inhibition rate of each candidate molecule on the target gene is obtained using the formula (1-test group / control group) %.
[1039] • Experimental results
[1040] The percentage inhibition of each candidate molecule on the target gene (compared with the control group) is shown in the table below.
[1041] Table E24 cell activity test results
[1042] Table E25 cell activity test results
[1043] Experimental conclusion: The present technology has broad sequence and target adaptability, and the double-targeting compounds generated by the present technology for various sequences and targets all show good activity.
[1044] Test Example 13: NHP long-term plasma target gene knockdown model
[1045] The in vivo target gene knockdown effect of the modified siRNA was evaluated in cynomolgus monkeys. On the day of administration, the administration animals were weighed, and the prepared preparation was drawn according to the weight information and the administration volume. The administration site (dorsal waist) of the selected animals was disinfected, and for the mixed administration group animals (N = 2), inclisiran and R1 were mixed and prepared, and a single subcutaneous injection was performed at the same position of the animals, and the drug dose in the mixture was 3 mg / kg, and the total dose was 6 mg / kg; for another group of animals (N = 5), a single subcutaneous injection of 6 mg / kg dose of Z18 reagent was performed. After completing the administration, dry cotton balls were used for hemostasis. Blood sampling was performed before administration and on day 7, day 14, day 21, day 28, day 56 and day 85 after administration. After the animal blood sampling site was disinfected with alcohol cotton ball, blood sampling was performed, and dry cotton ball was used for hemostasis after blood sampling. The collected whole blood was sent to the laboratory department for centrifugation to obtain serum.
[1046] The serum centrifuged after blood sampling was subjected to blood biochemical detection using a HITACHI 008AS biochemical analyzer. After turning on the biochemical analyzer, the reagent was replaced, followed by quality control and / or calibration. After determining that the instrument meets the operation requirements, the sample to be tested is placed on the sample tray, then the animal tattoo number on the sample label is checked, and the detection of LPa, LDL-c and ApoB is started. The data is expressed as a percentage of the baseline value, and is presented as the mean value plus / minus the standard error of the mean value.
[1047] According to the experimental steps provided by the manufacturer, the circulating PCSK9 protein content of cynomolgus monkeys was quantified using an ELISA kit specific for human PCSK9 (and cross-reactive with cynomolgus monkeys) (Sino Biological-KIT10594). The data is expressed as a percentage of the baseline value, and is presented as the mean value plus / minus the standard error of the mean value.
[1048] R1:
[1049] Experimental results: see Figures 12, 13, 14 and 15.
[1050] Experimental conclusion: the dual-targeting compound produced by the present technology can inhibit the target in NHP, and is significantly superior to single-target mixture administration in terms of persistence.
[1051] Test Example 14: C57 mouse liver target gene knockdown model (mINHBE + mINHBA)
[1052] Test method
[1053] C57BL / 6J mice were used, with a weekly age of 6W-8W and a gender of male.
[1054] All mice were acclimated for 3 days or more after entering the animal facility, and the mice were divided into 7 groups according to body weight, and the grouping day was defined as Day-1.
[1055] Experimental grouping: Group 1: PBS; Group 2: single-target siRNA mixture (Z76+Z79, 9mg / kg+9mg / kg); Group 3: double-target siRNA (Z36, 18mg / kg).
[1056] D0 start dosing, dosing method: s.c.; dosing frequency: once a week; dosing volume: 5μL / g x mouse weight (g); dosing frequency: once a week, prepared fresh; dosing cycle: 2 weeks. D14 end point dissection, take the left lobe of the liver, divide into 3 parts, and place in RNAlater for RNA extraction and QPCR detection.
[1057] Mixtures:
[1058] Quantitative PCR detects the expression content of the target gene in mouse liver
[1059] The TGuide Smart Universal Total RNA Extraction Kit (TIANGEN, Catalog No: DP671) was used, and the method is briefly described as follows: about 10 mg of liver sample was cut and added with 600 μL Trizol (Invitrogen 15596018CN), and Tissue-Lysis was used for homogenization at 70Hz for 40s, and RNA was extracted according to the kit instructions. The RNA sample concentration was determined by Nanodrop ONE, and the reverse transcription experimental steps were referred to the FastKing cDNA First-Strand Synthesis Kit (TIANGEN, Catalog No: KR116) instructions.
[1060] The target cDNA will be detected by qPCR, and GAPDH cDNA will be detected as an internal control. Add 9 μL of prepared PCR reaction solution and 1 μL of sample cDNA to a 384-well plate. The qPCR reaction program is as follows: 95℃ heating for 15min, then entering the cycle mode, 95℃ heating for 10sec, 60℃ for 20s, followed by 72℃ for 32s, a total of 40 cycles.
[1061] The primer sequences are as follows (5'-3'):
[1062] mINHBE-F ACCAGCCGTCCCAGAATAAC
[1063] mINHBE-R TAGGTTGAAGTGGATTTGTCTATGA
[1064] mINHBA-F ATCATCACCTTTGCCGAGTC
[1065] mINHBA-R CCCTTTAAGCCCATTTCCTC
[1066] mGAPDH-F ACTTTGGCATTGTGGAAGGG
[1067] mGAPDH-R CCATCCACAGTCTTCTGGGT
[1068] Data analysis
[1069] The expression level of each sample target gene mRNA was calculated by the ΔΔCt relative quantification method. The relative expression of the target gene was represented by 2-ΔΔCT.
[1070] The calculation formula is as follows: ΔCT = average Ct value of target gene - average Ct value of internal reference gene ΔΔCT = ΔCT (drug group) - ΔCT (RNAiMAX control group) Relative expression of target gene = 2-ΔΔCT
[1071] According to the relative expression of the target gene after treatment, the inhibition rate of each candidate molecule on the target gene was obtained by using formula (1-test group / control group) %.
[1072] Experimental results: see Figure 16.
[1073] Experimental conclusion: the double-target compound produced by the application can simultaneously and significantly inhibit two targets in vivo. Combined with other experimental examples, it is proved that the application can exhibit strong effectiveness and broad applicability for different targets in vivo.
[1074] Test example 15: C57 mouse liver target gene knockout model (mINHBE+mMRAC1)
[1075] Test method
[1076] C57BL / 6J mice were used, with a week age of 6W-8W and a gender of male.
[1077] After all the mice entered the animal facility, they were adaptively fed for more than 3 days, and the mice were divided into 7 groups according to their weight. The day of grouping was defined as Day-1.
[1078] Experimental grouping and dose design: the first group: PBS; the second group: single-target siRNA mixture (Z78+Z79, 9mg / kg+9mg / kg); the third group: double-target siRNA (Z39, 18mg / kg).
[1079] D0 Start of dosing, mode of dosing: s.c.; frequency of dosing: 1 time per week; volume of dosing: 5 μL / g x mouse weight (g); frequency of dispensing: 1 time per week, extemporaneous preparation; dosing period: 2 weeks. D14 End point dissection, left lobe of liver taken, divided into 3 parts, placed in RNAlater for RNA extraction and QPCR detection.
[1080] Mixtures:
[1081] Quantitative PCR detection of the expression content of the target gene in mouse liver
[1082] The TGuide Smart Universal Total RNA Extraction Kit (TIANGEN, Catalog No: DP671) was used, and the method is briefly described as follows: about 10 mg of liver sample was cut and added with 600 μL Trizol (Invitrogen 15596018CN), and homogenized at 70 Hz for 40 s using Tissue-Lysis, and the RNA was extracted according to the kit instructions. The RNA sample concentration was determined using Nanodrop ONE, and the reverse transcription experimental steps were referred to the FastKing cDNA First-Strand Synthesis Kit (TIANGEN, Catalog No: KR116) instructions.
[1083] The target cDNA will be detected by qPCR, and GAPDH cDNA will be detected as an internal control. Add 9 μL of prepared PCR reaction solution and 1 μL of sample cDNA to a 384-well plate. The qPCR reaction program is as follows: heating at 95℃ for 15 min, then entering the cycle mode, heating at 95℃ for 10 sec, 60℃ for 20 s, and then 72℃ for 32 s, for a total of 40 cycles.
[1084] The primer sequences are as follows (5'-3'):
[1085] mINHBE-F ACCAGCCGTCCCAGAATAAC
[1086] mINHBE-R TAGGTTGAAGTGGATTTGTCTATGA
[1087] mMTARC1-F GTGGAACTGAAACGGGTGAT
[1088] mMTARC1-R ACGAACAGTTCCCATCACTG
[1089] mGAPDH-F ACTTTGGCATTGTGGAAGGG
[1090] mGAPDH-R CCATCCACAGTCTTCTGGGT
[1091] Data analysis
[1092] The expression level of each sample target gene mRNA was calculated by the ΔΔCt relative quantification method. The relative expression of the target gene was represented by 2-ΔΔCT.
[1093] The calculation formula is as follows: ΔCT = average Ct value of target gene - average Ct value of internal reference gene ΔΔCT = ΔCT (drug group) - ΔCT (RNAiMAX control group) Relative expression of target gene = 2-ΔΔCT
[1094] According to the relative expression of the target gene after treatment, the inhibition rate of each candidate molecule on the target gene is obtained by using formula (1-test group / control group) %.
[1095] Experimental results: see Figure 17.
[1096] Experimental conclusion: the double-target compound produced by the application can significantly inhibit two targets in vivo at the same time. Combined with other experimental examples, it is proved that the application can exhibit strong effectiveness and broad applicability for different targets in vivo.
[1097] Test example 16: mouse IVT administration eye knockout model (mSOD-1+mTTR)
[1098] 4.1 Male C57 / 6J mice, 6-8 weeks old; single intravitreal injection (IVT) injection, and eye cup on D7.
[1099] Experimental grouping and dose design: the first group: PBS; the second group: single target siRNA mixture (Z80+Z81, 10mg+10mg); the third group: double target siRNA (Z75, 20mg).
[1100] Both eyes were taken: retinal, RPE layer sample, choroid / sclera complex. The RPE layer sample or choroid / sclera complex of 4 eyeballs was combined together as a sample for RNA extraction and qpcr experiment; the left eye retina was used as an independent sample for QPCR experiment; the right eye retina was treated with RNAlater and frozen. QPCR experiment; QPCR detected target genes (mouse SOD1+mouse TTR+internal reference). Before and after administration, eye surface and fundus examination was performed to observe whether there was any abnormality, and OCT was taken (inflammation observation) if there was any abnormality.
[1101] 4.2 Total RNA extraction (both the gun head and the centrifuge tube are enzyme-free and sterile packaged, and are taken in the super-clean bench):
[1102] a.Quickly transfer the frozen retinal / RPE cells / choroid + sclera sample tissue into a centrifuge tube containing 1 mL Trizol lysis solution and homogenate beads, and homogenize on a homogenizer. After homogenizing the tissue, there will still be insoluble substances remaining. Centrifuge at 12,000 x g for 10 min at 4°C, and transfer the supernatant to a new centrifuge tube.
[1103] b. Allow the lysis product to stand at room temperature for 5 min to completely separate the nucleic acid-protein complex. Add 0.2 mL chloroform to each 1 mL Trizol, tightly cap the tube, and vigorously shake for 15 s, and stand at room temperature for 2-3 min.
[1104] c. Centrifuge at 12,000 x g for 15 min at 4°C, and the sample will separate into three layers: an orange lower organic phase, a middle layer, and a colorless upper aqueous phase. Transfer the upper aqueous phase containing total RNA to a new centrifuge tube, taking care not to absorb the middle protein layer.
[1105] d. Add 0.5 mL isopropanol to each 1 mL Trizol used initially, mix well by inverting several times, and stand at room temperature for 10 min. Centrifuge at 12,000 x g for 10 min at 4°C, and discard the supernatant. A gelatinous RNA precipitate can be seen.
[1106] e. Add 1 mL 75% ethanol to each 1 mL Trizol used initially, mix well by inverting several times, and wash the precipitate. Centrifuge at 12,000 x g for 5 min at 4°C, discard the supernatant, and dry at room temperature by inverting for 5-10 min or vacuum dry. Add an appropriate amount (e.g., 25 μL) of Nuclease-free Water (DEPC-treated) or TE buffer, and dissolve the RNA by blowing several times with a pipette.
[1107] f. Use a Nanodrop 2000 to detect the concentration and purity of the RNA. The obtained RNA can be used immediately or stored at -80°C after aliquoting, to avoid repeated freeze-thawing.
[1108] 4.3 Reverse transcription:
[1109] a. Prepare the following reaction system in an RNase-free centrifuge tube:
[1110] Gently mix well with a pipette, and centrifuge briefly.
[1111] b. The reaction conditions are as follows:
[1112] After the reaction, the obtained cDNA can be stored at -80°C for later use.
[1113] 4.4 Fluorescent quantitative PCR:
[1114] a. Take 0.2 ml PCR tube, prepare the following reaction system, each reverse transcription product prepares 3 tubes.
[1115] b. The reaction conditions are as follows:
[1116] 4.3.4 Result analysis and processing: ΔΔCT method: A = CT (target gene, test sample) - CT (internal standard gene, test sample) B = CT (target gene, control sample) - CT (internal standard gene, control sample) K = A - B Expression fold = 2-K
[1117] 4.4 Test results: No abnormal reaction was found during the experiment. The target mRNA KD results of each tissue (retina, RPE layer) are shown in Figures 18 and 19.
[1118] Experimental conclusion: The double-targeting compound produced by the present application can significantly inhibit two extrapheic targets simultaneously in vivo. Combined with other experimental examples, it is proved that the present application can exhibit strong effectiveness and broad applicability against different targets in vivo.
[1119] Test Example 17: Identification of rat liver metabolic products after continuous administration
[1120] Three male SD rats were subcutaneously injected with 30 mg / kg of Z18 at 0 hours and 168 hours, and euthanized 24 hours after the second administration. Liver samples were taken from each animal and homogenized, and the homogenate was combined in equal volumes to form one sample. The same volume of blank liver sample was taken as a blank control. Then, LC-UV-HRMS was used to find and identify the metabolic products and relative abundance of Z18, and to determine the main metabolic pathway of Z18.
[1121] Experimental results: In addition to the common NAG37 metabolic mode, the main product is the product of cleavage within the intermediate sequence CfGfaa. See Figure 20. Note: Common NAG37 metabolism: [-3GalNAc], [-3GalNAc+H2O-C4H11NO2], [-3GalNAc+H2O-C22H43N5O10], [-3GalNAc+2H2O-C17H38N4O8]
[1122] Experimental conclusion: The double-targeting compound produced by the present application can produce high-activity RNA interference trigger molecules in vivo.
[1123] Test Example 18: Plasma stability study
[1124] Experimental method
[1125] Preparation of stock solution
[1126] Compound Z8 was dissolved in nuclease-free water to prepare a stock solution with appropriate concentration.
[1127] Preparation of plasma
[1128] The plasma was taken out from the refrigerator and centrifuged at 3,220 x g for 5 min to remove the suspended and precipitated substances.
[1129] Incubation process
[1130] The Z8 working solution and the plasma were mixed in a 96-well plate (or other suitable container) respectively, and then incubated in a 37°C water bath. The time points of the reaction were 0, 1, 2, 4, 6 and 24 hours, respectively, and each compound had three repeated samples at each time point. The final concentration of CDP and the control compound Patisiran in the test system was 0.2 μM.
[1131] After the incubation, the samples were properly pretreated and then analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS). The detailed sample processing method will be described in the experimental records and research reports.
[1132] Sample analysis
[1133] The sample analysis of the plasma incubation of the compound was carried out by liquid chromatography-tandem mass spectrometry (LC / MS / MS), and the ratio of the peak area of the analyte to the peak area of the internal standard was used for semi-quantitative determination. The retention time, chromatogram acquisition and chromatogram integration of the analyte and the internal standard were processed by the software Analyst (Sciex, Framingham, Massachusetts, USA).
[1134] Experimental results:
[1135] Experimental conclusion: The compound of the present application has good plasma stability.
Claims
1. The compound represented by formula (I), It can silence the first target RNA or inhibit the expression of the first target gene through RNA interference, as well as silence the second target RNA or inhibit the expression of the second target gene; in: DS1 is a double-stranded oligonucleotide comprising a first sense strand and a first antisense strand, which together form a first double-stranded portion of 15–27 nucleotide pairs in length. DS2 is a double-stranded oligonucleotide containing a second sense strand and a second antisense strand, which together form a second double-stranded portion of 15 to 27 nucleotide pairs in length. L is a structural unit that serves as a connector; one end of L is connected to the 5' end of the first antisense chain, and the other end is connected to the second justice chain; The compound described herein is capable of cleavage within cells but exhibits sufficient stability outside cells; The first target RNA or the first target gene is the same as or different from the second target RNA or the second target gene.
2. The compound according to claim 1, wherein the other end of L is connected to the 5' end or 3' end of the second positive chain.
3. The compound according to claim 1 or 2, wherein the L and one or more nucleotides (e.g., at least one, at least two, at least three, at least four, at least five, or at least six nucleotides) at the 5' end of the first antisense strand constitute an adjacent region.
4. The compound according to claim 3, wherein the adjacent region can be specifically cleaved.
5. The compound according to claim 3 or 4, wherein the adjacent region does not contain deoxyribonucleosides, disulfide bonds, pH-sensitive cleavage groups, polypeptide hydrolase substrates, or sugars; optionally, the adjacent region does not contain deoxyribonucleosides.
6. The compound according to any one of claims 3-5, wherein the adjacent region comprises at least one modified nucleotide.
7. The compound according to any one of claims 3-6, wherein the adjacent region comprises at least one nucleoside inter-bond that is not a thiophosphate bond, optionally, the adjacent region comprises at least one nucleoside inter-bond that is not nuclease resistant, and further optionally, the adjacent region comprises at least one phosphodiester bond.
8. The compound according to any one of claims 3-7, wherein the adjacent region further comprises at least one modified nucleoside inter-bond, said modified nucleoside inter-bond being a nuclease-resistant nucleoside inter-bond, optionally a thiophosphate bond.
9. The compound according to any one of claims 3-8, wherein the adjacent region comprises at least two consecutive nucleotides having the following structure: (5'-3')-p1-NT1-p2-NT2-p3-, wherein NT1 is a 5' nucleoside, NT2 is a 3' nucleoside, and p1, p2, and p3 are internucleotide bonds, wherein p1 is a phosphodiester bond and p2 is a nuclease-resistant internucleotide bond (e.g., a thiophosphate bond).
10. The compound according to claim 9, wherein p2 and p3 are both phosphothiophosphate diester bonds.
11. The compound according to claim 9 or 10, wherein the specific cleavage occurs upstream of the 5' of p2.
12. The compound according to any of the preceding claims, wherein the first antisense chain further has a first 5' extension located upstream of the 5' of the first double-stranded portion.
13. The compound according to claim 12, wherein NT1 and NT2 are the two nucleotides of the first double-stranded portion of the first antisense chain.
14. The compound according to any one of claims 3-13, wherein the adjacent region further comprises one or more nucleotides (e.g., one nucleotide) of the second positive strand at the 3' or 5' end.
15. The compound according to any one of claims 3-14, wherein the adjacent regions have no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, and no more than 5 nucleotides.
16. The compound according to any one of claims 3-15, wherein the adjacent region has one or more internucleotide bonds, and no more than 75% (e.g., no more than 65%, no more than 55%, no more than 45%, no more than 30%) of the internucleotide bonds in the adjacent region are nuclease-resistant internucleotide bonds (e.g., phosphate thioester bonds).
17. The compound according to any one of claims 3-16, wherein no more than 75% (e.g., no more than 65%, no more than 55%, no more than 45%, no more than 30%) of the internucleotide bonds in the adjacent region are phosphodiester bonds.
18. The compound according to any of the preceding claims, wherein L is a bond or a chemical linker.
19. The compound according to any one of claims 12-18, wherein the length of the first 5' extension is at least one, two, or three nucleotides.
20. The compound of claim 19, wherein the length of the first 5' extension is 2 or 3 nucleotides.
21. The compound according to any of the preceding claims, wherein the first double-stranded portion is formed by base pairing of a first segment of a first antisense strand and a second segment of a first sense strand, the 5' end of the first segment being directly connected to the 3' end of the first 5' extension; optionally, the first segment and the second segment are of the same length; further optionally, the first segment and the second segment have at least 80%, 85%, 90%, or 95% complementarity; even more optionally, the first segment and the second segment have 100% complementarity.
22. The compound according to claim 19 or 20, wherein the first antisense strand comprises the nucleotide sequence shown in formula A-1: Equation A-1: (3'-5')X2-YZ in, X2 is the nucleotide at the 5' end of the first segment, Y and Z are the two nucleotides at the 3' end of the first 5' extension, the nucleotide immediately downstream of X2 is M1, and the nucleotide immediately downstream of M1 is M2, wherein: The internucleotide bond between Y and X2 is not a thiophosphate bond; alternatively, the internucleotide bond between Y and X2 is a phosphodiester bond. The internucleotide bond between X2 and M1 is a modified internucleotide bond. Optionally, the internucleotide bond between X2 and M1 is a modified internucleotide bond resistant to nuclease degradation. Optionally, the modified internucleotide bond resistant to nuclease degradation is a phosphate thioester bond; and / or The internucleotide bond between M1 and M2 is a modified internucleotide bond. Optionally, the internucleotide bond between M1 and M2 is a modified internucleotide bond that resists nuclease degradation. Optionally, the modified internucleotide bond that resists nuclease degradation is a phosphate thioester bond.
23. The compound according to any of the preceding claims, wherein the second double-stranded portion is formed by base pairing of a fourth segment of the second antisense strand and a fifth segment of the second sense strand, one end of L being connected to the 5' or 3' end of the fifth segment; optionally, the fourth and fifth segments are of the same length; further optionally, the fourth and fifth segments have at least 80%, 85%, 90%, or 95% complementarity; even more optionally, the fourth and fifth segments have 100% complementarity.
24. The compound according to claim 23, wherein the 3' nucleotide of the fifth fragment is K1, and the nucleotide immediately preceding K1 at its 5' end is K2, wherein: The internucleotide bond between K1 and K2 is a modified internucleotide bond. Optionally, the internucleotide bond between K1 and K2 is a modified internucleotide bond resistant to nuclease degradation. Optionally, the modified internucleotide bond resistant to nuclease degradation is a phosphate thioester bond; and / or Optionally, the internucleotide bond between L and K1 is a modified internucleotide bond; alternatively, the internucleotide bond between L and K1 is a modified internucleotide bond resistant to nuclease degradation; alternatively, the modified internucleotide bond resistant to nuclease degradation is a phosphate thioester bond.
25. The compound according to any of the preceding claims, wherein the five nucleotides at the 5' end of the first fragment, the five nucleotides at the 3' or 5' end of the fifth fragment, the first 5' extension, and L together comprise no more than seven, six, five, or four phosphate thioester bonds.
26. The compound of claim 25, wherein the five nucleotides at the 5' end of the first fragment, the five nucleotides at the 3' or 5' end of the fifth fragment, the first 5' extension, and L together comprise two, three, four, five, or six phosphate thioester bonds.
27. The compound according to any of the preceding claims, wherein the first antisense strand further comprises a first 3' extension located downstream of the first double-stranded portion; further, the first 3' extension is 2 nucleotides in length; further optionally, the first 3' extension is 100% complementary to the target mRNA encoding the first target gene; optionally, the first 3' extension has GG.
28. The compound according to any of the preceding claims, wherein the length of the first double-chain portion is: a) 15–25 nucleotide pairs, 15–24 nucleotide pairs, 15–23 nucleotide pairs, 16–24 nucleotide pairs, 16–23 nucleotide pairs, 16–22 nucleotide pairs, 16–21 nucleotide pairs, 16–20 nucleotide pairs, 17–23 nucleotide pairs, 17–22 nucleotide pairs, 17–21 nucleotide pairs, 17–20 nucleotide pairs, 18–23 nucleotide pairs, 18–22 nucleotide pairs, 18–21 nucleotide pairs, 18–20 nucleotide pairs, 19–23 nucleotide pairs, 19–22 nucleotide pairs, 19–21 nucleotide pairs, or 19–20 nucleotide pairs; or b) 15 nucleotide pairs, 16 nucleotide pairs, 17 nucleotide pairs, 18 nucleotide pairs, 19 nucleotide pairs, 20 nucleotide pairs, 21 nucleotide pairs, 22 nucleotide pairs, or 23 nucleotide pairs.
29. The compound according to any of the preceding claims, wherein the length of the first positive chain is: 15–35, 16–35, 16–30, 16–27, 16–26, 16–25, 16–21, 17–35, 17–30, 17–25, 17–21, 18–35, 18–30, 18–25, 18–23, 18–21, 19–35, 19–30, 19–25, 19–21, 20–35, 20–30, 20–25, 20–23, 21–35, 21–30, 21–25, 21–23, for example 25, 24, 24, 23, 22 or 21 nucleotides.
30. The compound according to any of the preceding claims, wherein the length of the first 5' extension is at least 2, 3, 4, 5, 6, 7 or more nucleotides, and / or the length of the first 3' extension is at least 1, 2 or more nucleotides.
31. The compound according to any of the preceding claims, wherein the length of the first 5' extension is 2, 3, 4, 5, 6, 7 or 8 nucleotides.
32. The compound according to any of the preceding claims, wherein the first fragment comprises a first targeting region, the first targeting region being sufficiently complementary to the first target RNA or a target mRNA encoding the first target gene; further, the first targeting region having at least 70%, 80%, 85%, 90%, or 95% complementarity to a portion of the target mRNA encoding the first target gene; and even further, the first targeting region having 100% complementarity to a portion of the target mRNA encoding the first target gene.
33. The compound according to any of the preceding claims, wherein the first antisense strand further comprises a nucleotide (N1), N1 being the third nucleotide from the 3' end of the first 5' extension, the first antisense strand comprising the nucleotide sequence shown in Formula B-1: Formula B-1:(3'-5')X2-YZ-N1.
34. The compound according to any of the preceding claims, wherein the first antisense strand further comprises a third segment (N), the third segment comprising at least one nucleotide, wherein the nucleotide at the 3' end of the third segment is N1, and the first antisense strand comprises the nucleotide sequence shown in Formula B'-1: Equation B'-1:(3'-5')X2-YZN.
35. The compound according to any one of claims 22-34, wherein Z is selected from G or A, or their natural or non-natural analogues.
36. The compound according to any one of claims 22-35, wherein Z is selected from G, or its natural or non-natural analogues.
37. The compound according to any one of claims 22-36, wherein X2 is selected from A or U, or their natural or non-natural analogues.
38. The compound according to any one of claims 33-36, wherein X2 is selected from A, C, G, U or I, or their natural or non-natural analogs; optionally, X2 is selected from A, U or I, or their natural or non-natural analogs.
39. The compound according to any one of claims 33-38, wherein N1 is selected from C, or its natural or non-natural analogues.
40. The compound according to any one of claims 22-39, wherein formula A-1 has a sequence (3'-5') selected from the following: UUG, UAG, AUG, AAG, UUA, UAA, AUA, AAA, UCG, UGG, ACG, AGG, UCA, UGA, ACA and AGA, or natural or non-natural analogues thereof.
41. The compound according to any one of claims 22-40, wherein Y is selected from A or U, or their natural or non-natural analogues.
42. The compound according to any one of claims 22-41, wherein formula A-1 has a sequence (3'-5') selected from the following: UUG, UAG, AUG, AAG, UUA, UAA, AUA and AAA.
43. The compound according to any one of claims 33-42, wherein, Formula B-1 has a sequence (3'-5') selected from the following: UUG-N1, UAG-N1, AUG-N1, AAG-N1, UUA-N1, UAA-N1, AUA-N1, AAA-N1, UCG-N1, UGG-N1, ACG-N1, AGG-N1, UCA-N1, UGA-N1, ACA-N1, AGA-N1, or natural or non-natural analogs thereof.
44. The compound according to any one of claims 33-43, wherein, The formula B-1 or B'-1 has a sequence (3'-5') selected from the following: UUGC, UAGC, AUGC, AAGC, AAGU, UUAC, UAAC, AUAC, AAAC, UCGC, UGGC, ACGC, AGGC, UCAC, UGAC, ACAC, AGAC, AAGG, AAGCC, AAUC, AUUU, AAGAG, AAGAGC, AAGACCA, or their natural or non-natural analogues.
45. The compound according to any one of claims 33-44, wherein, Formula B-1 has a sequence (3'-5') selected from the following: UUGC, UAGC, AUGC, AAGC, AAGG, UUAC, UAAC, AUAC and AAAC.
46. The compound according to any one of claims 33-45, wherein the sequence shown in formula A-1, formula B-1 or formula B'-1 contains at least one modified nucleotide, preferably, all nucleotides shown in the sequence shown in formula A-1, formula B-1 or formula B'-1 are modified nucleotides.
47. The compound according to any one of claims 33-46, wherein the modified nucleotide comprises a modified base, a modified glycoside and / or a modified nucleoside internucleotide bond; further, the formula B'-1 has a sequence (5'-3') selected from the following: CfGfau or CfGfaa.
48. The compound according to any one of claims 33-47, wherein the sequence shown in formula A-1, formula B-1 or formula B'-1 is not sufficiently complementary to the first target RNA or the target mRNA encoding the first target gene.
49. The compound according to any one of claims 33-48, wherein: (a) The sequence shown in Formula A-1, Formula B-1 or Formula B'-1 contains at least one nucleoside internucleotide bond that is not a thiophosphate bond. (b) The internucleotide bond between X2 and Y is not a thiophosphate bond; (c) The internucleotide bond between Y and Z is not a thiophosphate bond; (d) All nucleoside bonds in the sequences shown in Formula A-1, Formula B-1 or Formula B'-1 are not phosphate thioester bonds. (e) The sequence shown in Formula A-1, Formula B-1 or Formula B'-1 contains at least one phosphate diester bond between nucleosides; (f) The internucleotide bond between X2 and Y is a phosphodiester bond; (g)The internucleotide bond between Y and Z is a phosphodiester bond; (h) All internucleotide bonds in the sequence regions shown in Formula A-1, Formula B-1, or Formula B'-1 are phosphodiester bonds; and / or (i) The nucleoside bond between the sequence shown in Formula A-1, Formula B-1 or Formula B'-1 and the first fragment is a phosphodiester bond.
50. The compound according to any one of claims 33-49, wherein: (a) The sequence shown in Formula A-1, Formula B-1 or Formula B'-1 contains at least one nucleotide selected from nucleotides containing 2'-OMe modification or nucleotides containing 2'-F modification; (b) Each nucleotide of the sequence shown in Formula A-1, Formula B-1 or Formula B'-1 is a nucleotide containing 2'-OMe modification or a nucleotide containing 2'-F modification; (c) The sequence shown in Formula A-1, Formula B-1 or Formula B'-1 contains at least one nucleotide modified with 2'-F; (d) The sequence shown in Formula A-1, Formula B-1 or Formula B'-1 contains no more than two nucleotides modified with 2'-F; (e) Z in the sequence shown in Formula A-1, Formula B-1 or Formula B'-1 is a nucleotide containing 2'-F modification, and optionally X2 in the sequence shown in Formula A-1, Formula B-1 or Formula B'-1 is a nucleotide containing 2'-F modification; (f) N1 in Formula B-1 or the sequence shown in Formula B-1 is a nucleotide containing 2'-F modification; (g) In the sequences shown in Formula A-1, Formula B-1, or Formula B'-1, X2 and Y are both nucleotides containing 2'-OMe modification, and Z is a nucleotide containing 2'-F modification, and further, N1 in the sequences shown in Formula B-1 or Formula B'-1 is a nucleotide containing 2'-F modification; and / or (h) X2, Y and Z in the sequences shown in Formula A-1, Formula B-1 or Formula B'-1 are nucleotides containing 2'-OMe modification, and further N1 in Formula B-1 or Formula B'-1 is a nucleotide containing 2'-F modification.
51. The compound according to any of the preceding claims, wherein the DS1 or the first double-chain portion of the DS1 further comprises at least one nucleoside internucleotide bond selected from thiophosphate bonds or methylphosphonate bonds.
52. The compound according to any of the preceding claims, wherein: (a) The first and / or second internucleotide bond from the 5' end of the first fragment is a thiophosphate bond or a methylphosphonate bond; (b) The first and / or second internucleotide bond from the 3' end of the first fragment is a thiophosphate bond or a methylphosphonate bond; (c) The first and / or second nucleotide internucleotide bond from the 3' end of the second fragment is a thiophosphate bond or a methylphosphonate bond; and / or (d) The first and / or second internucleotide bond from the 3' end of the second segment is a thiophosphate bond or a methylphosphonate bond.
53. The compound according to any of the preceding claims, wherein the DS1 comprises a double-stranded oligonucleotide of formula C-1: Formula C-1, The first fragment and the second fragment form the first double-stranded portion through base pairing, and the first fragment and the second fragment have the same length; The first 5' extension contains at least 3 nucleotides; The first antisense strand contains the nucleotide sequence shown in formula A-1: Equation A-1: (3'-5')X2-YZ in, X2 is the nucleotide at the 5' end of the first fragment, and Y and Z are the two nucleotides at the 3' end of the first 5' extension, as defined in any one of claims 22 to 52; The length of the first positive strand is 15–35, 15–23, 15–22, or 15–21 nucleotides; The length of the first antisense strand is 25–35, 26–35, 26–30, 25–27, or 26–27 nucleotides; The 5' end of the first 5' extension is connected to one end of L.
54. The compound according to any of the preceding claims, wherein the length of the first sense strand is 17–23, 17–22, 21–23 or 17–21 nucleotides; and the length of the first antisense strand is 25–30, 35–27 or 26–27 nucleotides.
55. The compound according to any of the preceding claims, wherein the lengths of the first sense strand and the first antisense strand are (a) 17 and 20 nucleotides; (b) 18 and 21 nucleotides; (c) 19 and 22 nucleotides; (d) 20 and 23 nucleotides; or (e) 21 and 24 nucleotides.
56. The compound according to any of the preceding claims, wherein the DS1 comprises a double-stranded oligonucleotide of formula D-1: Formula D-1, The first fragment and the second fragment form the first double-stranded portion through base pairing, and the first fragment and the second fragment have the same length; The first 5' extension contains at least 3 nucleotides; The first antisense strand contains the nucleotide sequence shown in formula A-1: Equation A-1: (3'-5')X2-YZ in, X2 is the nucleotide at the 5' end of the first fragment, and Y and Z are the two nucleotides at the 3' end of the first 5' extension, as defined in any one of claims 8 to 34; The length of the first positive chain is 15–35, 15–23, 15–22, 15–21, 16–25, 17–23, 18–23, 19–23, 19–21, 20–23, 20–21 or 21–23, for example 17, 18, 19, 20, 21, 22 or 23 nucleotides; The length of the first antisense strand is 25–35, 25–30, 26–35, 26–30, 25–27, or 26–27, for example, 25, 26, 27, 28, 29, or 30 nucleotides; The 5' end of the first 5' extension is connected to one end of L.
57. The compound according to any of the preceding claims, wherein the length of the first sense strand is 17–23, 17–22, or 17–21 nucleotides; and the length of the first antisense strand is 22–28, 22–27, or 22–26 nucleotides.
58. The compound according to any of the preceding claims, wherein the lengths of the first sense strand and the first antisense strand are (a) 19 and 25 nucleotides; (b) 20 and 25 nucleotides; (c) 21 and 25 nucleotides; (d) 19 and 26 nucleotides; (e) 20 and 26 nucleotides; (f) 21 and 26 nucleotides; or (g) 21 and 27 nucleotides.
59. The compound according to any of the preceding claims, wherein the DS2 further comprises a second 5' extension in the second antisense chain located upstream of the 5' of the second double-stranded portion.
60. The compound according to any of the preceding claims, wherein its DS1 product in target tissue cells can silence a first target RNA or inhibit the expression of a first target gene by RNA interference, and its DS2 product in target tissue cells can silence a second target RNA or inhibit the expression of a second target gene by RNA interference.
61. The compound according to any of the preceding claims, wherein the length of the second double-chain portion is: a) 15–25 nucleotide pairs, 15–24 nucleotide pairs, 15–23 nucleotide pairs, 16–24 nucleotide pairs, 16–23 nucleotide pairs, 16–22 nucleotide pairs, 16–21 nucleotide pairs, 16–20 nucleotide pairs, 17–23 nucleotide pairs, 17–22 nucleotide pairs, 17–21 nucleotide pairs, 17–20 nucleotide pairs, 18–23 nucleotide pairs, 18–22 nucleotide pairs, 18–21 nucleotide pairs, 18–20 nucleotide pairs, 19–23 nucleotide pairs, 19–22 nucleotide pairs, 19–21 nucleotide pairs, or 19–20 nucleotide pairs; or b) 15 nucleotide pairs, 16 nucleotide pairs, 17 nucleotide pairs, 18 nucleotide pairs, 19 nucleotide pairs, 20 nucleotide pairs, 21 nucleotide pairs, 22 nucleotide pairs, or 23 nucleotide pairs.
62. The compound according to any of the preceding claims, wherein the second antisense strand further comprises a second 3' extension located downstream of the second double-stranded portion (or the fourth fragment); further, the second 3' extension is 100% complementary to the target mRNA encoding the second target gene; even further, the second 3' extension is 2 nucleotides in length; optionally, the second 3' extension has GG.
63. The compound of claim 62, wherein the length of the second 3' extension is at least 1, 2 or more nucleotides.
64. The compound according to claim 62 or 63, wherein the second 5' extension is at least 3 nucleotides in length.
65. The compound according to any of claims 62 or 63, wherein the length of the second 5' extension is at least 3, 4, 5, 6, 7 or more nucleotides.
66. The compound according to any of the preceding claims, wherein the second antisense strand comprises the nucleotide sequence shown in formula A-2: Equation A-2: (3'-5')X2'-Y'-Z', in, Formula A-2 is the same as Formula A-1 as defined in any one of claims 22 to 52, X2' is the same as X2 as defined in any one of claims 22 to 52, Y' is the same as Y as defined in any one of claims 22 to 52, and Z' is the same as Z as defined in any one of claims 22 to 52.
67. The compound according to any of the preceding claims, wherein the second antisense strand further comprises a nucleotide (N1'), N1 being the third nucleotide from the 3' end of the second 5' extension, the second antisense strand comprising the nucleotide sequence shown in Formula B-2: Formula B-2: (3'-5')X2'-Y'-Z'-N1', in, Formula B-2 is the same as Formula B-1 as defined in any one of claims 33 to 52, X2' is the same as X2 as defined in any one of claims 33 to 52, Y' is the same as Y as defined in any one of claims 33 to 52, Z' is the same as Z as defined in any one of claims 33 to 52, and N1' is the same as N1 as defined in any one of claims 33 to 52.
68. The compound according to any of the preceding claims, wherein the second antisense strand further comprises a sixth segment (N'), the sixth segment comprising at least one nucleotide, wherein the nucleotide at the 3' end of the sixth segment is N1', and the second antisense strand comprises the nucleotide sequence shown in Formula B'-2: Formula B'-2:(3'-5')X2'-Y'-Z'-N', in, Formula B'-2 is the same as Formula B'-1 as defined in any one of claims 34 to 52, X2' is the same as X2 as defined in any one of claims 34 to 52, Y' is the same as Y as defined in any one of claims 34 to 52, Z' is the same as Z as defined in any one of claims 34 to 52, N' is the same as N as defined in any one of claims 34 to 52, and N1' is the same as N1 as defined in any one of claims 34 to 52.
69. The compound according to any one of claims 66-68, wherein the sequence shown in formula A-2, formula B-2 or formula B'-2 contains at least one modified nucleotide, preferably, all nucleotides shown in the sequence shown in formula A-2, formula B-2 or formula B'-2 are modified nucleotides.
70. The compound according to any one of claims 66-69, wherein the modified nucleotide comprises a modified base, a modified glycoside, and / or a modified nucleoside bond.
71. The compound according to any one of claims 66-70, wherein the sequence shown in formula A-2, formula B-2 or formula B'-2 is not sufficiently complementary to the second target RNA or the target mRNA encoding the second target gene.
72. The compound according to any one of claims 66-71, wherein: (a) The sequence shown in Formula A-2, Formula B-2 or Formula B'-2 contains at least one nucleoside internucleotide bond that is not a thiophosphate bond; (b) The internucleotide bond between X2' and Y' is not a thiophosphate bond; (c) The internucleotide bond between Y' and Z' is not a thiophosphate bond; (d) All nucleoside bonds in the sequences shown in Formula A-2, Formula B-2 or Formula B'-2 are not phosphate thioester bonds; (e) The sequence shown in Formula A-2, Formula B-2 or Formula B'-2 contains at least one phosphate diester bond between nucleosides; (f) The internucleotide bond between X2' and Y' is a phosphodiester bond; (g)The internucleotide bond between Y' and Z' is a phosphodiester bond; (h) All internucleotide bonds in the sequences shown in Formula A-2, Formula B-2, or Formula B'-2 are phosphodiester bonds; and / or (i) The nucleoside bond between the sequence shown in Formula A-2, Formula B-2 or Formula B'-2 and the fourth fragment is a phosphodiester bond.
73. The compound according to any one of claims 66-72, wherein: (a) The sequence shown in Formula A-2, Formula B-2 or Formula B'-2 contains at least one nucleotide selected from nucleotides containing 2'-OMe modification or nucleotides containing 2'-F modification; (b) Each nucleotide of the sequence shown in Formula A-2, Formula B-2 or Formula B'-2 is a nucleotide containing 2'-OMe modification or a nucleotide containing 2'-F modification; (c) The sequence shown in Formula A-2, Formula B-2 or Formula B'-2 contains at least one nucleotide with a 2'-F modification; (d) The sequence shown in Formula A-2, Formula B-2 or Formula B'-2 contains no more than two nucleotides containing 2'-F modification; (e) Z' in the sequence shown in Formula A-2, Formula B-2 or Formula B'-2 is a nucleotide containing 2'-F modification, and optionally X2' in Formula A-2, Formula B-2 or Formula B'-2 is a nucleotide containing 2'-F modification; (f) N1' in the sequence shown in Formula B-2 or Formula B-2 is a nucleotide containing 2'-F modification; (g) In the sequences shown in Formula A-2, Formula B-2, or Formula B'-2, X2' and Y' are both nucleotides containing 2'-OMe modification, and Z' is a nucleotide containing 2'-F modification, and further, N1' in the sequences shown in Formula B-2 or Formula B'-2 is a nucleotide containing 2'-F modification; and / or (h) shows that X2', Y' and Z' in the sequence of formula A-2, formula B-2 or formula B'-2 are nucleotides containing 2'-OMe modification, and N1' in the sequence of formula B-2 or formula B'-2 is a nucleotide containing 2'-F modification.
74. The compound according to any of the preceding claims, wherein the DS2 or the second double-chain portion of the DS2 further comprises at least one nucleoside internucleotide bond selected from thiophosphate bonds or methylphosphonate bonds.
75. The compound according to any of the preceding claims, wherein: (a) The first and / or second internucleotide bond from the 5' end of the fourth segment is a thiophosphate bond or a methylphosphonate bond; (b) The first and / or second internucleotide bond from the 3' end of the fourth segment is a thiophosphate bond or a methylphosphonate bond; (c) The first and / or second nucleotide internucleotide bond from the 3' end of the fifth segment is a thiophosphate bond or a methylphosphonate bond; and / or (d) The first and / or second internucleotide bond from the 3' end of the fifth segment is a thiophosphate bond or a methylphosphonate bond.
76. The compound according to any of the preceding claims, wherein the DS2 comprises a double-stranded oligonucleotide of formula C-2: Formula C-2, The fourth and fifth segments form the second double-stranded portion through base pairing, and the fourth and fifth segments are of the same length. The second 5' extension contains at least 3 nucleotides; The second antisense strand contains the nucleotide sequence shown in formula A-2: Equation A-2: (3'-5')X2'-Y'-Z', in, X2' is the nucleotide at the 5' end of the fourth fragment, and Y' and Z' are the two nucleotides at the 3' end of the second 5' extension, as defined in Formula A-2 as in any one of claims 66 to 75; The length of the second positive strand is 15–35, 15–23, 15–22, or 15–21 nucleotides. The second antisense strand has a length of 25–35, 26–35, 26–30, 25–27, or 26–27 nucleotides; and Wherein the 5' end of the first 5' extension segment and (i) The 5' end of the second 5' extension. (ii) the 3' or 5' end of the second justice chain, or (iii) The 3' end of the second antisense chain is connected to both ends of L.
77. The compound according to any of the preceding claims, wherein the DS2 comprises a double-stranded oligonucleotide of formula D-2: Formula D-2, The fourth and fifth segments form the second double-stranded portion through base pairing, and the fourth and fifth segments are of the same length. The second 5' extension contains at least 3 nucleotides; The second antisense strand contains the nucleotide sequence shown in formula A-2: Equation A-2: (3'-5')X2'-Y'-Z', in, X2' is the nucleotide at the 5' end of the fourth fragment, and Y' and Z' are the two nucleotides at the 3' end of the second 5' extension, as defined in Formula A-2 as in any one of claims 66 to 75; The second sense strand has a length of 15–35, 15–23, 15–22, 15–21, 16–25, 17–23, 18–23, 19–23, 19–21, 20–23, 20–21, or 21–23, for example, 17, 18, 19, 20, 21, 22, or 23 nucleotides; wherein the second antisense strand has a length of 25–35, 25–30, 26–35, 26–30, 25–27, or 26–27, for example, 25, 26, 27, 28, 29, or 30 nucleotides; and Wherein the 5' end of the first 5' extension segment and (i) The 5' end of the second 5' extension. (ii) the 3' or 5' end of the second justice chain, or (iii) The 3' end of the second antisense chain is connected to both ends of L.
78. The compound according to any of the preceding claims, wherein the lengths of the second sense strand and the second antisense strand are independently 15–25, 15–23, 15–22, 15–21, 16–25, 17–23, 18–23, 19–23, 19–21, 20–23, 20–21 or 21–23, for example 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.
79. The compound according to any of the preceding claims, wherein the molar ratio of the DS1 product interacting with the first target RNA or the target mRNA encoding the first target gene and the DS2 product interacting with the second target RNA or the target mRNA encoding the second target gene is about 0.8, 0.9, 1, 1.1 or 1.
2.
80. The compound according to any of the preceding claims, wherein L is as shown in formula (I-1') or formula (I-1), in: X is either O or S; Y represents a single bond, -O-, or -S-; L1 is selected from a single bond, -O-, -S-, -S-S-, -(C=O)-, -NH-, -NH-(C=O)-, -CH2-, -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2CH2-, -O-CH2-, -S-CH2-, -O-CH2CH2-, -O-CH2CH2CH2-, -O-CH2CH2CH2CH2-, -O-CH2CH2CH2CH2CH2-, -O-CH2CH2CH2CH2CH2CH2-, -S-CH2CH2-, -CH2-O-CH2CH2-, -CH2CH2-O-CH2CH2-, -CH2CH2-O-CH2CH2-O-, -CH2-O-CH2-O-, -CH2CH2-O-, -CH2CH2CH2-O-, CH2CH2CH2CH2-O-, CH2CH2CH2CH2CH2-O-, CH2CH2CH2CH2CH2CH2-O-, -CH2CH2CH2-S-, -CH2-(C=O)-, -CH2-NH-(C=O)-, -O-(C=O)-NH-, -CH2-NH-, -C(=O)O-, -NHC(=O)O-, -NHC(=O)NH-, -OC(=O)O-, -OC(=O)NH-, -S(O)2NH-, -NHS(O)2- and L2, L3, L4, L6, L7, L8 sum L9 separate independent local selection self key, -O-, -S-, -SS-, -(C=O)-, -NH-, -NH-(C=O)-, - CH2-, -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, -CH2CH2CH 2CH2CH2CH2-, -O-CH2-, -S-CH2-, -O-CH2CH2-, -O-CH2CH2CH2-, -O-CH2CH2CH2CH2-, -O-CH2CH2CH2CH2CH2-, -O-CH2CH2CH2CH2CH2CH2-, -S-CH2CH2-, -CH2-O-CH2CH2 -, -CH2CH2-O-CH2CH2-, -CH2CH2-O-CH2CH2-O-, -CH2-O-CH2-O-, -CH2CH2-O-, -CH2CH2CH2-O-, CH2CH2CH2CH2-O-, CH2CH2CH2CH2CH2-O-, CH2CH2CH2CH2CH2CH2-O-, -CH2CH2CH2-S-, -CH2-(C=O)-, -CH2-NH-(C=O)-, -O-(C=O)-NH-, -C(=O)O-, -NHC( =O)O-, -NHC(=O)NH-, -OC(=O)O-, -OC(=O)NH-, -S(O)2NH-, -NHS(O)2-, sum-CH2-NH-; L5 is selected from single bond, -O-, -S-, -SS-, -(C=O)-, -NH-, -NH-(C=O)-, -CH2-, -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2CH2-, -O-CH2- , -S-CH2-, -O-CH2CH2-, -O-CH2CH2CH2-, -O-CH2CH2CH2CH2-, -O-CH2CH2CH2CH2CH2-, -O-CH2CH2CH2CH2CH2CH2-, -S-CH2CH2-, -CH2-O-CH2CH2-, -CH2CH2-O-CH 2CH2-, -CH2CH2-O-CH2CH2-O-, -CH2-O-CH2-O-, -CH2CH2-O-, -CH2CH2CH2-O-, CH2CH2CH2CH2-O-, CH2CH2CH2CH2CH2-O-, CH2CH2CH2CH2CH2CH2-O-, -CH2CH2CH2 -S-, -CH2-(C=O)-, -CH2-NH-(C=O)-, -O-(C=O)-NH-, -CH2-NH-, -C(=O)O-, -NHC (=O)O-, -NHC(=O)NH-, -OC(=O)O-, -OC(=O)NH-, -S(O)2NH-, -NHS(O)2-, carbocyclic and heterocyclic rings; The L It is connected to the 5' end of the first antisense chain of the DS1.
81. The compound according to claim 80, wherein the L is as shown in formula (I-2') or (I-2), in: Ring A is absent and L6 is directly connected to triazole; Alternatively, ring A can be selected from 5-16 membered heterocycles.
82. The compound according to claim 81, wherein: Structural unit Selected from the arbitrarily replaced locations 83. The compound according to claim 80, wherein the L is as shown in formula (I-9), (I-10), (I-11), (I-12), (I-13), (I-14), (I-15), (I-16), (I-17) or (I-18), 84. The compound according to claim 80, wherein, The L is selected from 85. The compound according to any one of claims 1-79, wherein L is absent, and the 5' end nucleotide of the first antisense strand is bonded together. (i) The 3' terminal nucleotide of the second sense strand; or (ii) The 5' terminal nucleotide of the second sense strand; or (ii) The 3' terminal nucleotide of the second antisense strand; or (iv) The 5' end nucleotide of the second antisense strand.
86. The compound according to any one of claims 1-79, wherein the L is absent, and the 5' end nucleotide of the first 5' extension is bonded together. (i) The 3' terminal nucleotide of the second sense strand; or (ii) The 5' terminal nucleotide of the second sense strand; or (ii) The 3' terminal nucleotide of the second antisense strand; or (iv) The 5' terminal nucleotide of the second antisense strand; Optionally, the first 5' extension is 3 nucleotides.
87. The compound according to any one of claims 1-79, wherein, The L does not exist, and (i) The 5' end nucleotide of the first 5' extension is bonded to the 3' end nucleotide of the second positive strand, or (ii) The 5' end nucleotide of the first 5' extension is bonded to the 3' end nucleotide of the second antisense strand.
88. The compound according to any of the preceding claims, wherein, (i) The second antisense chain does not contain a second 5' extension; (ii) Alternatively, the first antisense strand is 19-21 nucleotides long and the second antisense strand is 21-23 nucleotides long.
89. The compound according to any of the preceding claims, wherein at least one nucleotide is a modified nucleotide, preferably all nucleotides are modified nucleotides, said modification comprising one, two or more of the following: 2'-OMe modification, 2'-F modification, 2'-deoxy modification, C16 modification, DO2 modification, VP modification, 5'-MP modification, PS modification, PS2 modification, MP modification, MOP modification, invAB modification, invAb modification, and modification enhancing the affinity of double-stranded ribonucleic acid for ARGO protein; optionally, said modification comprising one, two or more of the following: 2'-OMe modification, 2'-F modification, VP modification, 5'-MP modification, PS modification, PS2 modification, MP modification, MOP modification, invAB modification, and modification enhancing the affinity of double-stranded ribonucleic acid for ARGO protein; further optionally, said modification comprising one, two or more of the following: 2'-OMe modification, 2'-F modification, VP modification, PS modification, and invAB modification.
90. The compound according to any of the preceding claims, further comprising one, two or more delivery systems, optionally each of the delivery systems being independently connected to DS1, DS2 or L, and further optionally each of the delivery systems being independently connected to DS1 or DS2.
91. The compound according to any of the preceding claims, wherein the delivery system is independently connected to the 5' end of the first positive chain, the 3' end of the first positive chain, the 5' end of the second positive chain, or the 3' end of the second positive chain.
92. The compound according to any of the preceding claims, wherein the delivery system is each independently a ligand, preferably the ligand alters the distribution, targeting, or lifetime, more preferably the ligand provides enhanced affinity to a target, such as a molecule, cell or cell type, compartment, receptor, such as a cell or organ compartment, tissue, organ, or body region, and more preferably the ligand causes the compound to be delivered to the target tissue and produce an RNA interference effect.
93. The compound according to any of the preceding claims, wherein each of the ligands is independently selected from GalNAc ligands, lipophilic ligands, or other ligands that target receptors to promote endocytosis of the compound, such as TfR-targeting ligands, LDL-R-targeting ligands, or integrin-targeting ligands; optionally, each of the ligands is independently NAG37 or L96.
94. The compound according to any of the preceding claims, wherein the first target RNA or the first target gene is the same as the second target RNA or the second target gene; or the first target RNA or the first target gene and the second target RNA or the second target gene are different segments of the same RNA or the same gene; or the first target RNA or the first target gene and the second target RNA or the second target gene are different RNAs or different genes.
95. The compound according to any of the preceding claims, wherein the compound is selected from the compounds shown in Tables 1-90.
96. A pharmaceutical composition comprising a compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
97. A method for inhibiting the expression of a target gene in a subject in need, comprising administering to the subject a pharmaceutically effective amount of a compound according to any one of claims 1-95 or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 96.
98. A method of treating a disease or condition in a subject in need, comprising administering to the subject a pharmaceutically effective amount of a compound or a pharmaceutically acceptable salt thereof according to any one of claims 1-95, or a pharmaceutical composition according to claim 96, wherein the disease or condition is optionally related to a first target gene and / or a second target gene.
Citation Information
Patent Citations
Modified RNAi agents
CN108977446A
Bivalent siRNA Chimeras and Methods of Use Thereof
US20180105815A1
Nucleic acid compounds
WO2024023256A1