MIR-23a / b as a therapeutic agent for social behavioral deficits in psychiatric disorders
Extracellular vesicles containing miR-103-3p and miR-23a-3p enhance neuronal activity in the pre-frontal cortex, addressing sociability deficits in psychiatric disorders by improving synaptic GABAergic signaling and social behaviors.
Patent Information
- Application Number
- PCT/US2025/039241
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-26
- Filing Date
- 2025-07-25
- Publication Date
- 2026-01-29
AI Technical Summary
There is a need to address sociability deficits in psychiatric disorders, such as autism spectrum disorder and schizophrenia, as existing treatments are inadequate in improving social behaviors and brain function.
The use of extracellular vesicles (EVs) derived from blood, containing specific microRNAs like miR-103-3p and miR-23a-3p, administered to increase neuronal activity in the pre-frontal cortex, particularly targeting CaMKIIa+ excitatory neurons, to enhance sociability in individuals with psychiatric disorders.
The administration of EVs with miR-103-3p and miR-23a-3p increases neuronal activity, thereby improving sociability and restoring impaired synaptic GABAergic signaling in the pre-frontal cortex, leading to enhanced social behaviors in subjects with psychiatric disorders.
Smart Images

Figure US2025039241_29012026_PF_FP_ABST
Abstract
Description
[0001] MIR-23A / B AS A THERAPEUTIC AGENT FOR SOCIAL BEHAVIORAL DEFICITS IN PSYCHIATRIC DISORDERS
[0002] CROSS REFERENCE TO RELATED APPLICATIONS]
[0003] This application claims priority to, and the benefit of, U.S. Provisional Patent Application Serial No. 63 / 675,772 filed on July 26, 2024, the entire contents of which are incorporated herein by reference as if set forth in its entirety.
[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0005] This invention was made with Government support under contract NIH R01 MH1 13645 awarded by the National Institutes of Health. The Government has certain rights in the invention.
[0006] SEQUENCE LISTING
[0007] The instant application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on July 25, 2025, is named “222120-21 10 sequence listing.xml” and is 16,384 bytes in size.
[0008] BACKGROUND
[0009] Factors circulating in the blood can influence brain function and behavior in rodents. A concept established in aging research is that the transfusion of young rodent blood into aged rodents restores memory function. However, it is unclear whether normal blood components ameliorate other behavioral deficits in a non-aging context. Accumulating evidence supports the requirement of lymphocytes, such as T cells, for brain function and behavior. For example, immunodeficient mice, lacking T and B cells, display deficits in various behaviors, such as learning and memory, anxiety-related behaviors, and social behaviors. Although T cell- derived cytokines ( / .e., interferon-gamma (IFN-y), interleukin-4 (IL-4), and interleukin-17 (IL- 17)), have been shown to influence these behaviors, additional factors may be involved in immune regulation of brain function and behavior. Notably, lymphocytes regulate a range of circulating molecules, including gut microbiota-derived metabolites, glucocorticoids, amino acids, and extracellular microRNAs (miRNAs). Accordingly, there is a need to address the aforementioned deficiencies and inadequacies. SUMMARY
[0010] Described herein are compositions, kits, and methods relating to increasing sociability in a subject, in particular, a subject having a psychiatric disorder with a symptom of or otherwise characterized by aberrant sociability.
[0011] In embodiments, described herein are compositions for increasing sociability in a subject. In embodiments, compositions can comprise, a miR-103-3p, a miR-23a-3p, one or more miR-103-3p mimics, one or more miR-23a-3p mimics, or any combination of any thereof. In embodiments, compositions as described herein can consist essentially of a miR-103-3p, a miR-23a-3p, one or more miR-103-3p mimics, one or more miR-23a-3p mimics, or any combination of any thereof. In embodiments, the miR-103-3p, the miR-23a-3p, the one or more miR-103-3p mimics, the one or more miR-23a-3p mimics, or the any combinations thereof is present within and / or associated with one or more extracellular vesicles. In embodiments, the extracellular vesicles are blood-derived.
[0012] In embodiments, the miR-103-3p, the miR-23a-3p, the one or more miR-103-3p mimics, the one or more miR-23a-3p mimics, or the any combinations thereof is present in a therapeutically effective amount. In embodiments, the therapeutically effective amount is an amount effective to increase sociability in a subject. In embodiments, the subject is one that has a disorder affecting sociability. In embodiments, the disorder is one or more of an autism spectrum disorder, schizophrenia, a disorder affecting sociability, a psychiatric disorder, Williams syndrome (WS), Aspergers syndrome, an anxiety disorder, generalized anxiety disorder, major depressive disorder, dementia, Alzheimer’s disease, frontotemporal dementia, vascular dementia, substance abuse, alcohol abuse, or abuse of illicit drugs such as amphetamine. In embodiments, the therapeutically effective amount is an amount effective to increase neuronal activity of a population of neurons in the pre-frontal cortex. In embodiments, the population of neurons comprise CaMKIIa+ excitatory neurons. In embodiments, the population of neurons consists essentially of CaMKIIa+ excitatory neurons.
[0013] In embodiments, the miR-103-3p, miR-23a-3p, one or more miR-103-3p mimics, or one or more miR-23a-3p mimics has at least 95% sequence identity with SEQ ID NO:1 , SEQ ID NO:2, or SEQ ID NO:15, individually or in any combination of any thereof.
[0014] Described herein are pharmaceutical compositions. In embodiments, described herein are pharmaceutical compositions for improving sociability in a subject, comprising a composition as described herein and a pharmaceutically acceptable carrier.
[0015] Described herein are kits. In embodiments, described herein are kits for increasing sociability in a subject, comprising a composition as described herein and instructions for use. In embodiments, the composition or any one or more components thereof are lyophilized. Also described herein are methods of increasing sociability in a subject, comprising administering a composition or pharmaceutical composition as described herein to a subject in need thereof (i.e., a subject as described herein). In embodiments, the subject is one that has a disorder affecting sociability. In embodiments, the disorder is one or more of an autism spectrum disorder, schizophrenia, a disorder affecting sociability, a psychiatric disorder, Williams syndrome (WS), Aspergers syndrome, an anxiety disorder, generalized anxiety disorder, major depressive disorder, dementia, Alzheimer’s disease, frontotemporal dementia, vascular dementia, substance abuse, alcohol abuse, or abuse of illicit drugs such as amphetamine. In embodiments, the therapeutically effective amount is an amount effective to increase neuronal activity of a population of neurons in the pre-frontal cortex. In embodiments, the population of neurons comprise CaMKIIa+ excitatory neurons. In embodiments, the population of neurons consists essentially of CaMKIIa+ excitatory neurons.
[0016] BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Many aspects of the disclosed devices and methods can be better understood with reference to the following drawings. The components in the drawings are not necessarily to scale, emphasis instead being placed upon clearly illustrating the relevant principles. Moreover, in the drawings, like reference numerals designate corresponding parts throughout the several views.
[0018] FIGs. 1A-1L: Restoration of sociability deficits by T cell transfer in Rag17' mice is associated with blood EV changes. FIG. 1A is a cartoon outline of the three-chamber sociability test. FIG. 1 B is a graph showing sociability in the three-chamber social interaction test by WT and Rag1 mice. WT mice, n = 15; Rag1 mice, n = 9. FIG. 1C depicts an experimental outline of adoptive transfer / serum injection and subsequent behavioral assay. FIG. 1 D is a graph showing adoptive transfer of WT mouse splenocytes or T cells into Rag1 '- mice ameliorated their sociability deficits. Rag17mice + medium, n = 13; Rag1 '~ mice + WT splenocytes, n = 15; and Ragt7mice + WT T cells, n = 6. FIG. 1 E is a graph illustrating intravenous injection of sera from WT mice, but not from Rag1 mice, into Rag1 mice ameliorated their sociability deficits. Rag7mice + medium, n = 8; Rag7mice + WT sera, n = 5; and Rag mice + Rag7sera, n = 6. FIG. 1 F shows representative transmission electron microscopy (TEM) images of bEVs from WT and RagR mice. EVs with comparable size and morphology are observed in both samples. FIG. 1G is a graph of nanoparticle tracking analysis of bEVs from WT mice or Rag1-' mice using NanoSight NS300. No difference was observed in their size distribution and concentration. WT mice, n = 9; Rag1 mice, n = 7. FIG. 1H shows immunoblots of expression levels of EV marker proteins, CD9 and Alix, in WT and Rag1 samples (n=3 per group). Left, representative Western blot images. Right, quantification graphs showing no difference in expression levels of EV marker proteins, CD9 and Alix, between WT and Rag1 samples. Equal amounts of proteins were loaded into each lane. FIG. 11 depicts the presence of CD3+EVs in WT and Ragk samples (n=3 per group). Left, representative Western blot images showing the recovery of CD3+bEVs upon the adoptive transfer of WT mouse splenocytes into Rag11mice. Right, quantification graphs. FIG. 1 J is a waterfall plot representing the bEV miRNAs whose expression significantly changed (adjusted p < 0.05) by the adoptive transfer of WT T cells into Rag1!- mice. These miRNAs are regarded as T cell-dependent EV-miRNAs. Rag1 mice, n = 6; Rag1 mice + WT T cells, n = 6. FIG. 1K is a graph showing T cell-dependent EV miRNAs were over-represented by the miRNAs whose expression changes were previously observed in the mice with sociability deficits. The list of miRNAs were curated from the previous publications (at least 2 publications for each mouse model) on several mouse models with sociability impairment56'80. Enrichment was calculated with Fisher’s exact test. FIG. 1L depicts potential target genes of T cell-dependent EV miRNAs were enriched in the regulation of synapses and neurons. Each bar represent mean ± SE. Each dot represents one mouse, ns, not significant. *p<0.05, **p<0.01 , ***p <0.005, ****p<0.001 . Significance was determined by Student’s t test and one-way ANOVA with post hoc Dunnett’s test. See Supplementary Table 12 of Exhibit A of U.S. 63 / 675,772 for the detail of statistical analysis.
[0019] FIGs. 2A-2H: WT bEVs rescue sociability in Rag1 mice by entering the brain and localizing with neurons. FIG. 2A is a cartoon of an experimental outline of bEV collection, intravenous injection, and subsequent behavioral assay. FIG. 2B is a graph showing intravenous injection of WT bEVs into Rag1-' mice ameliorated their sociability deficits. Rag1 mice + medium, n = 8; Rag1 '~ mice + WT EVs, n = 10. FIG. 2C are graphs showing intravenous injection of WT bEVs did not enhance sociability in WT mice. WT mice + medium, n = 3; and WT mice + WT bEVs, n = 3. FIG. 2D are graphs depicting Cntnap2'- and Shank3'- mice showed a reduced preference for interacting with the mouse versus the object (sociability deficits) in the three-chamber social interaction test. FIG. 2E is a graph illustrating intravenous injection of WT bEVs into Cntnap2-'- and Shank3'- mice ameliorated their sociability deficits. FIG. 2F is a cartoon outline of the three-chamber social novelty recognition test. FIG. 2G is a graph showing Rag1 ' mice also showed a reduced preference in interacting with a novel mouse versus a familiar mouse (social novel preference deficits) in the three-chamber social interaction test. WT mice, n = 15; and Rag1 mice, n = 9. FIG. 2H is a graph depicting intravenous injection of neither WT bEVs increased social novelty preference in Rag17mice. Rag17mice + medium, n = 8; Rag1 mice + WT EVs, n = 9. Each bar represent mean ± SE. Each dot represents one mouse, ns, not significant. **p<0.01 , ***p <0.005. Significance was determined by Student’s t test. See Supplementary Table 12 of Exhibit A of U.S. 63 / 675,772 for the detail of statistical analysis.
[0020] FIGs. 3A-3E: Intravenously injected WT bEVs co-localize neurons and microglia in the brain parenchyma. FIG. 3A shows representative confocal microscope images showing the distribution patterns of intravenously injected PKH26-labeled EVs (Red) in the mPFC, hippocampus (HC) and cerebellum (CB) of Rag1 ' mice. DAPI stain (blue). FIG. 3B is a graph of quantification of PKH26- labeled EVs in the brains of Rag1 ' mice (n = 3). FIG. 30 depicts representative confocal microscope images showing the distribution patterns of intravenously injected mTdTomato+EVs (Red) from mTmG mice in the mPFC of Ragt7mice. DAPI stain (blue). FIG. 3D contains representative confocal microscope images showing the localization of TdTomato+EVs with neurons (NSE+cells) and microglia (Iba1+cells) in the mPFC of Rag17- mice. FIG. 3E is a graph of quantification of TdTomato+EVs localized with neurons (NSE+cells), microglia (Iba1+cells), astrocytes (S100p+cells), and oligodendrocytes (CC1+cells) in the mPFC of Rag7 / _mice (n = 4). Scale bar, 10 pm. Each bar represent mean ± SE. Each dot represents one mouse.
[0021] FIGs. 4A-4F: WT bEVs attenuate hyperexcitability in the mPFC of Rag1~ mice. FIG. 4A contains representative confocal microscope images showing an enhanced c-Fos immunoreactivity in the mPFC of Rag1~7mice. FIG. 4B is a graph showing quantification of c- Fos-positive neurons as fold change of percentages for c-Fos+cells per NeuN+cells. WT mice, n = 13 Rag7mice, n = 11. FIG. 4C is a graph showing quantification of c-Fos-positive CaMKIIa+neurons as percentages for c-Fos cells per CaMKIIa+neurons. WT mice, n = 4 Rag7mice, n = 4. FIG. 4D is a graph depicting quantification of chemogenetic inhibition of CamKIIcO neuronal activities in the mPFC by hM4D(Gi) upon CNO injection ameliorated sociability deficits in Ragt'- mice. Vehicle n = 8 mice; CNO n = 9 mice. FIG. 4E shows Representative confocal microscope images showed a reduction of c-Fos immunoreactivity in the mPFC of Ragl - mice after WT bEV injection. FIG. 4F is a graph of quantification of c-Fos- positive neurons as fold-change of percentages for c-Fos+cells per NeuN+cells. Ragt7mice + medium, n = 7; Ragl - mice + WT EVs, n = 7. Scale bar, 50 pm. Each bar represent mean ± SE. Each dot represents one mouse, ns, not significant. **p <0.01 , ****p<0.001. Statistical significance was determined by Student’s t-test. See Supplementary Table 12 of Exhibit A of U.S. 63 / 675,772 for the detail of statistical analysis.
[0022] FIGs. 5A-5D: WT bEVs restore impaired postsynaptic GABAergic currents in the pyramidal neurons of the mPFC in Ragl and Cntnap2~7mice. FIG. 5A is a Venn diagram showing the numbers of differentially expressed genes in the mPFC of Ragt7mice compared to WT mice and those in the mPFC of Ragl - mice with WT bEV injection compared to Ragt7mice with medium injection. WT mice, n = 3; Ragl - mice, n = 3; Ragt7mice + WT EVs, n = 3. Significance was determined by adjusted p <0.05. FIG. 5B shows the results of a pathway enrichment analysis of 1280 genes whose expression were altered in opposite directions between WT vs Ragl '- and Ragl '- vs Ragl '- + EV comparisons. Significance was determined by adjusted p <0.05. FIG. 5C shows representative traces of spontaneous inhibitory postsynaptic currents (sIPSCs) of pyramidal neurons in the mPFC brain slices of WT, Rag1 '- mice with or without WT EV treatment. Voltage was clamped at -70 mV, and recordings were taken for 5 min. AP-V (50 pM) and DNQX (50 pM) were added to the bath to inhibit NMDA and AMPA receptors throughout the experiment. The temperature was set at 30 ± 1 °C. FIG. 5D shows graphs depicting quantification of sIPSC amplitude and frequency between groups. For sIPSC quantification, significance was determined by one-way ANOVA with Bonferroni correction. FIG. 5E shows representative traces of sIPSCs of pyramidal neurons in the mPFC brain slices of WT, Cntnap2 ' mice with or without WT EV treatment. FIG. 5F shows graphs depicting quantification of sIPSC amplitude and frequency between groups. For sIPSC quantification, significance was determined by one-way ANOVA with Bonferroni correction. At least 3 different 8-10-week-old mice were used for each group. Each bar represents mean ± SEM of recorded cells. See Supplementary Table 12 of Exhibit A of U.S. 63 / 675,772 for the detail of statistical analysis.
[0023] FIGs. 6A-6D: Ragl'1' mice show an increased expression of PKCE in the mPFC and a downregulation of its regulatory miRNAs, miR-23a-3p and miR-103-3p, in the blood EVs. FIG. 6A depicts a flow of data analysis to identify candidate genes responsible for GABAergic signaling changes in Ragl1- mPFC. FIG. 6B comprises representative confocal microscope images showing an enhanced neuronal PKCE immunoreactivity the mPFC of Ragl - mice. FIG. 6C shows graphs depicting quantification of PKCE+neurons in the mPFC of WT and Ragl - mice (n = 7 per group). FIG. 6D comprises graphs showing expression of miR- 23a-3p and miR-103-3p in the bEVs from WT and Ragl ' mice (n = 8 per group). Data are shown as fold-change relative to WT data. Scale bar, 50 pm. Each bar represent mean ± SE. Each dot represents one mouse, ns, not significant. **p <0.01 , ***p<0.005. Statistical significance was determined by Student’s f-test. See Supplementary Table 12 of Exhibit A of U.S. 63 / 675,772 for the detail of statistical analysis.
[0024] FIGs. 7A-7J: Supplementation of miR-23a-3p and miR-103-3p to Ragl'1' EVs rescues the mPFC molecular and functional alterations and enhances sociability in Ragl1' mice. FIG. 7A is a cartoon showing an experimental outline of bEV collection, miRNA mimics loading, intravenous injection, and subsequent behavioral assay. FIG. 7B is a graph depicting sociability data of Ragl1- mice administered with negative control miRNA mimics (control mimics) and miRNA mimics for miR-23a-3p and miR-103-3p (miR-23a-3p + miR-103- 3p mimics). Control, n = 15; miR-23a-3p + miR-103-3p, n = 11. FIG. 7C shows representative confocal microscope images of neuronal c-Fos expression in the mPFC of Ragl7- mice administered with control and miR-23a-3p + miR-103-3p mimics (n = 10 mice per group). FIG. 7D is a graph depicting quantification of c-Fos+neurons in the mPFC of WT and Rag 1- mice (n = 7 per group). FIG. 7E shows representative confocal microscope images of neuronal PKCE expression in the mPFC of Ragl - mice administered with control and miR-23a-3p + miR-103-3p mimics (n = 10 mice per group). FIG. 7F is a graph showing quantification of PKCE* neurons in the mPFC of WT and Ragl '- mice (n - 10 per group). FIG. 7G shows representative confocal microscope images of neuronal Gephyrin and GABA-A expression in CaMKIIcT cells in the mPFC of Rag1 ' mice administered with control and miR-23a-3p + miR- 103-3p mimics. FIG. 7H is a graph illustrating quantification of number of Gephyrin and GABA- A puncta in CaMKIIcf in the mPFC of WT and Rag1 ' mice (n = 10 per group). FIG. 71 shows representative traces of sIPSCs of the mPFC layer V neurons in brain slices from RagT' mice administered with control and miR-23a-3p + miR-103-3p mimics. FIG. 7J are graphs depicting quantification data of sIPSC amplitude and frequency changes by miR-23a-3p + miR-103-3p mimics in Ragl - mice (aggregated data from n = 3 mice per group). FIG. 7K are graphical summary of mechanism. Circulating EV miRNAs, including miiR-23a-3p and miR-103-3p in circulating EVs inhibits the expression of PKCE in mPFC neurons increasing synaptic GABAA receptor localization, and enhancing inhibitory postsynaptic signaling. Scale bars, 50 pm (FIG. 7C and FIG. 7E) and 10 pm (FIG. 7I). Each bar represent mean ± SE. ns, not significant. *p<0.05, **p <0.01 , and ***p<0.005. Statistical significance was determined by Student’s t- test. See Supplementary Table 12 of Exhibit A of U.S. 63 / 675,772 for the detail of statistical analysis.
[0025] FIGs. 8A-8D: Additional behavioral data of Ragl1- mice and Rag protein expression in the brain. FIG. 8A is a graph showing no difference in latency to find a buried food pellet in the buried food pellet test between WT and Ragl1- mice. WT mice, n = 11 Rag1~ / mice, n = 18. FIG. 8B is a graph showing no difference in total activities analyzed with the open field test between WT and Ragl1- mice. WT mice, n = 13 Ragl - mice, n = 9. FIG. 8C are representative Western blot images showing no detectable Ragl and Rag 2 proteins in the brains of WT mice. PFC, prefrontal cortex; HC, hippocampus; STR, striatum. FIG. 8D are representative Western blot images showing Ragl , TNFa, and p-actin proteins in the thymus and brains of WT mice (embryonic day 15 (E15), postnatal day 8 (P8), P21 , and P42. Ragl and TNFa images were taken with the same exposure time (5 seconds). Each bar represent mean ± SE. Each dot represents one mouse, ns, not significant. Statistical significance was determined by Student’s t-test. See Supplementary Table 12 of Exhibit A of U.S. 63 / 675,772 for the detail of statistical analysis.
[0026] FIGs. 9A-9C: Lymphocyte reconstitution after adoptive cell transfer. FIG. 9A shows plots of flow cytometry data showing the recovery of CD3+T cells and B220+B cells in Ragl1- mice adoptively transferred with WT splenocytes. FIG. 9B shows plots of flow cytometry data showing the recovery of CD3+T cells in Ragl1- mice adoptively transferred with WT T cells. FIG. 9C are graphs showing ELISA data showing the levels of IFN-y, IL-4, and IL-17 in WT mouse sera.
[0027] FIGs. 10A-10D: Characterization of EVs prepared with several methods. FIG. 10A shows representative TEM images of EVs prepared with precipitation (PPT). Scale bar = 200 nm. FIG. 10B is representative Western blot images of EV marker proteins, CD81 and Alix, in EVs prepared with PPT and differential ultracentrifugation (UC). Calnexin, a cytoplasmic protein marker. Sup, supernatants after EV precipitations. FIG. 10C are results of NanoSight® analysis of EVs prepared with PPT from WT and Rag1 ' mouse sera. WT, n = 13; Ragl ', n = 11. FIG. 10D are results of ZetaView® analysis of EVs prepared with size exclusion chromatography (SEC) from WT and Ragl - mouse sera. WT, n = 4; Ragl7-, n = 4. Each bar represent mean ± SE. Each dot represents one mouse, ns, not significant. Statistical significance was determined by Student’s f-test. See Supplementary Table 12 of Exhibit A of U.S. 63 / 675,772 for the detail of statistical analysis.
[0028] FIG. 11: No recovery of T and B cells in Rag1- / - mice intravenously injected with bEVs from WT mice. Cell sorting plots showing no recovery of T and B cells in Ragl - mice intravenously injected with bEVs from WT mice. No changes in T or B cell populations were detected in the spleen from Rag1 / - mice after intravenous injection with bEVs from WT mice.
[0029] FIGs. 12A-12D: No recovery in social novelty preference by Ragl1- mice after intravenous injection with WT bEVs or adoptive transfer of WT splenocytes or T cells. FIGs. 12A and 12B are graphs showing intravenous injection of WT bEVs (enriched by PPT) into Ragl - mice ameliorated their sociability deficits, but not social novelty preference deficits. Ragl7mice + medium, n = 10; Ragl7mice + WT bEVs 1 .5 g, n = 5; Rag7mice + WT bEVs 7.5 pg, n = 7; Rag1~7mice + WT bEVs 25 pg, n = 2; and Ragl - mice + WT bEVs 150 pg, n = 5. FIG. 12C is a graph depicting Intravenous injection of WT and Ragl1- sera into Ragl7mice did not show any rescue effect on their social novelty preference deficits. Ragl7mice + medium, n = 8; Rag1~7mice + WT sera, n = 5; Ragl - mice + Rag1~7sera, n = 6. FIG. 12D is a graph showing adoptive transfer of neither splenocytes nor T cell reconstitution on Rag7mice showed any rescued effect on their social novelty preference deficits. Ragt7mice + medium, n = 12; Ragl - mice + WT splenocytes, n = 15; Ragt7mice + WT T cells, n = 6. Each bar represent mean ± SE. Each dot represents one mouse, ns, not significant. *p<0.05, **p<0.01 , ****p <0.001. Significance was determined by one-way ANOVA with post hoc Dunnett’s test. See Supplementary Table 12 of Exhibit A of U.S. 63 / 675,772 for the detail of statistical analysis.
[0030] FIGs. 13A-13B: Co-localization of PKH26-labeled EVs with neurons and microglia. FIG. 13A shows representative confocal microscope images showing the localization of PKH26-labeled EVs with NeuN+neurons and Iba1+microglia in the mPFC of Ragt7mice. FIG. 13B is a graph depicting quantification of PKH26-labeled EVs localized with NeuN+neurons, Iba1+microglia, S100b+astrocytes, and Olig2+oligodendrocyte-lineage cells in the mPFC of Ragl - ice, n = 3. Scale bar, 10 m. Each bar represent mean ± SE.
[0031] FIG. 14: Increased cFos expression in CaMKIla* neurons in the mPFC of Rag1~~ mice. Representative images of c-Fos immunoreactivities in CaMKIIa+neurons in the mPFC of Rag1 '- mice compared with WT mice. Scale bar, 50 pm.
[0032] FIGs. 15A-15D: Validation of DREADD experiments for chemogenic inhibition of CaMKIla* neurons in the mPFC of Rag1~'~ mice. FIG. 15A is a representative image of AAV- CaMKIIa-hM4D(Gi)-mCherry expression in the mPFC of Ragl1' mice. Scale bar, 500 pm. FIG. 15B are images showing c-Fos immunoreactivities were suppressed in CNO injected group compared with Vehicle injected group. Vehicle n = 3; CNO n = 3. FIG. 15C is a graph showing no impact of CNO injections on sociability behaviors in Ragl1- mice lacking the expression of DREADD construct. FIG. 15D comprises graphs showing no significant changes in total travel distance during sociability assays in Ragl1- mice expressing DREADD construct upon CNO injections. Scale bar, 50 pm. Each bar represent mean ± SE. Each dot represents one mouse. **p<0.01. Statistical significance was determined by Student’s f-test. See Supplementary Table 12 of Exhibit A of U.S. 63 / 675,772 for the detail of statistical analysis.
[0033] FIGs. 16A-16B: No changes in spontaneous excitatory AMPAR signaling in the mPFC layer V pyramidal neurons of Ragl1- mice. FIG. 16A comprises representative traces of a gap free recording of L5PNs in the PrL. sEPSCs through AMPA receptors can be seen. Recordings were made in the presence of AP-V (50 pM). FIG. 16B is a graph showing no significant difference in the amplitudes or the frequencies of AMPA currents between WT and Ragl1- mice. Data are mean ± SEM. Sample size was 3 adult male animals per group, with recorded cells used as the statistical unit for analysis. Statistical significance was determined by Student’s f-test. ns, not significant.
[0034] FIGs. 17A-17B: Differential effects of bEV-derived RNAs. FIG. 17A is a cartoon showing an experimental outline of bEV collection, intravenous injection, and subsequent behavioral assay. FIG. 17B is a graph of sociability data of Ragl1- mice administered with WT mice EVs + WT RNA, Ragl1- mice EVs + Ragl1- mice RNA, and Ragl1- mice EVs + WT RNA. WT mice EVs + WT RNA, n = 6; Ragl '- mice EVs + Ragl '- mice RNA, n = 9; Ragl '- mice EVs + WT RNA, n = 9. Each bar represent mean ± SE. Each dot represents one mouse. *p<0.05, ***p<0.001 . ns, not significant. Statistical significance was determined by Student’s f-test. See Supplementary Table 13 for the detail of statistical analysis.
[0035] FIGs. 18A-18B: Predicted targeting sites for miR-23a-3p and miR-103-3p in the 3’ UTR of Prkce gene. FIG. 18A is a schematic showing predicted consequential pairings of target region (top) and miRNA (bottom) are shown for miR-23a-3p and miR-103-3p. The target regions are conserved between mouse and human. Prediction data were obtained using TargetScan (release 8.0: September 2021). FIG. 18B is a graph showing expression of miR- 23a-3p in the bEVs from WT, Shanks -, and Cntnap27- mice (n = 6 per group). Data are shown as fold-change relative to WT data. Each bar represent mean ± SE. **p <0.01. Each dot represents one mouse. Significance was determined by one-way ANOVA with post hoc Dunnett’s test.
[0036] FIGs. 19A-19B: Source of miR-23a-3p and miR-103-3p in bEVs. FIG. 19A is a cartoon showing experimental procedures for Triton-X100 and RNase treatments of bEVs. FIG. 19B is a graph of quantitative reverse-transcription PCR (qPCR) data of miR-23a-3p and miR-103-3p expression in WT bEV fractions treated as in FIG. 19A. Each bar represent mean ± SE. **p<0.01. Each dot represents one mouse. Statistical significance was determined by Student’s f-test. See Supplementary Table 12 of Exhibit A of U.S. 63 / 675,772 for the detail of statistical analysis.
[0037] FIGs. 20A-20I: T cell-derived miR-23a-3p contributes to circulating EVs and sociability. FIG. 20A is a cartoon showing experimental procedures for preparing EVs from highly purified T cells. FIG. 20B is a graph of qPCR data of miR-23a-3p expression in WT T cell-derived EVs. FIG. 20C is a representative set of images showing the co-localization of PKH-26-labeled EVs with each brain cell type, including neurons (NSE+cells), microglia (Iba1+cells), astrocytes (S100b+cells), and oligodendrocytes (CC1+cells). Scale bar, 10 pm. FIG. 20D is a graph of quantification of cells co-localized with PKH-26 EVs per each cell type (%). FIG. 20E is a cartoon outline of adoptive transfer experiments. FIG. 20F is a representative set of flow cytometry data showing CD3+ T cells in the spleen of Ragl1- mice receiving WT and Mir23a ' cells 4 weeks after the adoptive transfer. FIG. 20G is a graph of quantification of flow cytometry data showing CD3+T cells are similar in number between Ragl1- mice receiving WT and Mir23alT cells. FIG. 20H is a graph showing miR-23a-3p expression levels in serum EVs from Ragl - mice receiving WT and Mir23a!T cells. FIG. 201 is a graph showing Ragl7mice receiving Mir23a7T cells showed more sociability deficits than those receiving WT T cells in the three-chamber social interaction test. Ragl - mice with WT T cells, n = 13; and Rag1 - mice with Mir23a '- T cells, n = 13. Each bar represent mean ± SE. **p<0.01 . Each dot represents one mouse. Statistical significance was determined by Student’s f-test.
[0038] FIGs. 21A-21 F: T cell-derived EVs contain miR-23a-3p and co-localize with neurons following intravenous injection. FIG. 21A shows representative Western blot images of EV marker proteins, CD9 and Alix, and T cell marker protein, CD3c, in EVs from purified T cell culture supernatants and cell culture media. FIG. 21 B shows representative confocal microscopic images showing the distribution of PKH26-labeled EVs from cultured T cells in the mPFC following intravenous injection. FIG. 21C is a cartoon showing experimental procedures for adoptive T cell transfer from WT and mTmG mice into Ragl1- mice. FIG. 21 D shows representative confocal microscopic images showing the distribution of EVs generated in vivo from mTmG mouse-derived T cells in the mPFC of Ragl1- mice. FIG. 21 E shows representative confocal microscopic images showing the co-localization of EVs generated in vivo from mTmG mouse-derived T cells with each brain cell type, including neurons (NSE+cells), microglia (Iba1+cells), astrocytes (S100b+cells), and oligodendrocytes (CC1+cells). Scale bar, 10 pm. FIG. 21F is a graph of quantification of cells co-localized with mTdTomato (mT)+EVs per each cell type (%).
[0039] FIGs. 22A-22B: Mir23a deficiency impairs the rescue effects by bEVs on sIPSCs in mPFC pyramidal neurons. FIG. 22A shows representative traces of sIPSCs of pyramidal neurons in the mPFC brain slices of Cntnap2 ' mice with Cntnap2 ' , WT, and Mir23a'- bEV treatment. FIG. 22B shows graphs depicting quantification of sIPSC amplitude and frequency between groups. For sIPSC quantification, significance was determined by one-way ANOVA with Bonferroni correction. At least 3 different 8-10-week-old mice were used for each group. Each bar represents mean ± SEM of recorded cells.
[0040] DETAILED DESCRIPTION
[0041] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.
[0042] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit (unless the context clearly dictates otherwise), between the upper and lower limit of that range, and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.
[0043] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.
[0044] Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of genetics, biochemistry, molecular biology, cellular biology, tissue culture, therapeutic administrations and the like. Before the embodiments of the present disclosure are described in detail, it is to be understood that, unless otherwise indicated, the present disclosure is not limited to particular materials, reagents, reaction materials, manufacturing processes, or the like, as such can vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting. It is also possible in the present disclosure that steps can be executed in different sequence where this is logically possible.
[0045] Definitions
[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described herein.
[0047] As used in the specification and the appended claims, the singular forms “a,” “an,” and “the” may include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a support” includes a plurality of supports. In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings unless a contrary intention is apparent.
[0048] Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently disclosed subject-matter.
[0049] The term “about”, when used herein in reference to a value, refers to a value that is similar, in context to the referenced value. In general, those skilled in the art, familiar with the context, will appreciate the relevant degree of variance encompassed by “about” in that context, for example, ±5%, ±4%, ±3%, ±2%, etc. In embodiments, about is ±5%, ±4%, ±3%, ±2%, or ±1 %.
[0050] Two events or entities are “associated” with one another, as that term is used herein, if the presence, level and / or form of one is correlated with that of the other. For example, a particular entity (e.g., polypeptide, genetic signature, metabolite, microbe, etc.) is considered to be associated with a particular disease, disorder, or condition, if its presence, level and / or form correlates with incidence of and / or susceptibility to the disease, disorder, or condition (e.g., across a relevant population). In some embodiments, two or more entities are physically “associated” with one another if they interact, directly or indirectly, so that they are and / or remain in physical proximity with one another. In some embodiments, two or more entities that are physically associated with one another are covalently linked to one another; in some embodiments, two or more entities that are physically associated with one another are not covalently linked to one another but are non-covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof. An miRNA or mimic thereof as described herein can be “associated” with an EV as described herein if it is loaded into the EV core or otherwise chemically or electrostatically attracted to and / or conjugated to the inner membrane surface or outer membrane surface.
[0051] As used herein, the term “comparable” refers to two or more agents, entities, situations, sets of conditions, etc., that may not be identical to one another but that are sufficiently similar to permit comparison there between so that one skilled in the art will appreciate that conclusions can reasonably be drawn based on differences or similarities observed. In some embodiments, comparable sets of conditions, circumstances, individuals, or populations are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, etc. to be considered comparable. For example, those of ordinary skill in the art will appreciate that sets of circumstances, individuals, or populations are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under or with different sets of circumstances, individuals, or populations are caused by or indicative of the variation in those features that are varied.
[0052] The term "composition" as used herein refers to a product comprising the specified ingredients (i.e., one or more enzymes described herein) in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts. Such a term in relation to a composition is intended to encompass a product comprising the active ingredient(s), and the inert ingredient(s) that make up the carrier, as well as any product which results, directly or indirectly, from combination, complexation, or aggregation of any two or more of the ingredients, or from dissociation of one or more of the ingredients, or from other types of reactions or interactions of one or more of the ingredients. In general, unless otherwise specified, a composition can be of any suitable form - e.g. , gel, liquid, solid, etc.
[0053] A composition of the disclosure can be a liquid solution, suspension, emulsion or a powder. Compositions described herein may include sterile aqueous or non-aqueous solvents, such as water, isotonic saline, isotonic glucose solution, buffer solution, or other solvents conveniently used for parenteral administration of therapeutically active agents, stabilizers, buffers, or preservatives, e.g. antioxidants such as methylhydroxybenzoate or similar additives. A composition of the disclosure may be sterilized by, for example, addition of sterilizing agents to the composition, irradiation of the composition, or heating the composition. Alternatively, the compounds or compositions of the present disclosure may be provided as sterile solid preparations e.g. lyophilized powder, which are readily dissolved in sterile solvent immediately prior to use.
[0054] The term “freeze-dried (lyophilized) as used herein refers to a preparation of a component described herein, for example, nucleic acids or enzymes, that have been initially frozen and the water content removed by vacuum.
[0055] A composition or method described herein as "comprising" one or more named elements or steps is open-ended, meaning that the named elements or steps are essential to a particular aspect or embodiment, but other elements or steps can be added within the scope of the composition or method. To avoid prolixity, it is also understood that any composition or method described as "comprising" (or which "comprises") one or more named elements or steps also describes the corresponding, more limited composition or method "consisting essentially of' (or which "consists essentially of') the same named elements or steps, meaning that the composition or method includes the named essential elements or steps and can also include additional elements or steps that do not materially affect the basic and novel characteristic(s) of the composition or method. It is also understood that any composition or method described herein as "comprising" or "consisting essentially of' one or more named elements or steps also describes the corresponding, more limited, and closed-ended composition or method "consisting of (or "consists of) the named elements or steps to the exclusion of any other unnamed element or step. In any composition or method disclosed herein, known or disclosed equivalents of any named essential element or step can be substituted for that element or step.
[0056] In this disclosure, "consisting essentially of or "consists essentially" or the like, when applied to methods and compositions encompassed by the present disclosure refers to compositions like those disclosed herein, but which may contain additional structural groups, composition components or method steps (or analogs or derivatives thereof as discussed above). Such additional structural groups, composition components or method steps, etc., however, do not materially affect the basic and novel characteristic(s) of the compositions or methods, compared to those of the corresponding compositions or methods disclosed herein. "Consisting essentially of or "consists essentially" or the like, when applied to methods and compositions encompassed by the present disclosure have the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments. As used herein, “Improved,” “increased” or “reduced,” or grammatically comparable comparative terms, indicate values that are relative to a baseline value or reference measurement. For example, in some embodiments, an assessed value achieved with an agent of interest may be “improved” relative to that obtained or expected in the absence of treatment or with a comparable reference agent or control. Alternatively, or additionally, in some embodiments, an assessed value achieved with an agent of interest may be “improved” relative to that obtained in the same subject or system under different conditions (e.g. , prior to or after an event such as administration of an agent of interest), or in a different, comparable subject (e.g., in a comparable subject or system that differs from the subject or system of interest). In some embodiments, comparative terms refer to statistically relevant differences (e.g., that are of a prevalence and / or magnitude sufficient to achieve statistical relevance). Those skilled in the art will be aware, or will readily be able to determine, in a given context, a degree and / or prevalence of difference that is required or sufficient to achieve such statistical significance.
[0057] As used herein, “isolated” means separated from constituents, cellular and otherwise, in which the polynucleotide, peptide, polypeptide, protein, antibody, or fragments thereof, are normally associated with in nature. A non-naturally occurring polynucleotide, peptide, polypeptide, protein, antibody, or fragments thereof, do not require “isolation” to distinguish it from its naturally occurring counterpart.
[0058] As used herein, the term “encode” refers to principle that DNA can be transcribed into RNA, which can then be translated into amino acid sequences that can form proteins
[0059] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0060] As used herein, the term “specific binding” or “preferential binding” can refer to non- covalent physical association of a first and a second moiety wherein the association between the first and second moieties is at least 2 times as strong, at least 5 times as strong as, at least 10 times as strong as, at least 50 times as strong as, at least 100 times as strong as, or stronger than the association of either moiety with most or all other moieties present in the environment in which binding occurs. Binding of two or more entities may be considered specific if the equilibrium dissociation constant, Kd, is 103M or less, 104M or less, 105M or less, 10-6M or less, 10-7M or less, 10-8M or less, 10-9M or less, 10-10M or less, 10-11M or less, or 10-12M or less under the conditions employed, e.g., under physiological conditions such as those inside a cell or consistent with cell survival. In some embodiments, specific binding can be accomplished by a plurality of weaker interactions (e.g., a plurality of individual interactions, wherein each individual interaction is characterized by a Kd of greater than 10-3M). In some embodiments, specific binding, which can be referred to as “molecular recognition,” is a saturable binding interaction between two entities that is dependent on complementary orientation of functional groups on each entity. Examples of specific binding interactions include primer-polynucleotide interaction, aptamer-aptamer target interactions, antibody-antigen interactions, avidin-biotin interactions, ligand-receptor interactions, metalchelate interactions, hybridization between complementary nucleic acids, etc.
[0061] As used herein, the term “recombinant” or “engineered” can generally refer to a non- naturally occurring nucleic acid, nucleic acid construct, or polypeptide. Such non-naturally occurring nucleic acids may include natural nucleic acids that have been modified, for example that have deletions, substitutions, inversions, insertions, etc., and / or combinations of nucleic acid sequences of different origin that are joined using molecular biology technologies (e.g., a nucleic acid sequences encoding a fusion protein (e.g., a protein or polypeptide formed from the combination of two different proteins or protein fragments), the combination of a nucleic acid encoding a polypeptide to a promoter sequence, where the coding sequence and promoter sequence are from different sources or otherwise do not typically occur together naturally (e.g., a nucleic acid and a constitutive promoter), etc. Recombinant or engineered can also refer to the polypeptide encoded by the recombinant nucleic acid. Non-naturally occurring nucleic acids or polypeptides include nucleic acids and polypeptides modified by man.
[0062] As used herein, “variant” can refer to a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, but retains essential and / or characteristic properties (structural and / or functional) of the reference polynucleotide or polypeptide. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. The differences can be limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in nucleic or amino acid sequence by one or more modifications at the sequence level or post-transcriptional or post-translational modifications (e.g., substitutions, additions, deletions, methylation, glycosylations, etc.). A substituted nucleic acid may or may not be an unmodified nucleic acid of adenine, thiamine, guanine, cytosine, uracil, including any chemically, enzymatically or metabolically modified forms of these or other nucleotides. A substituted amino acid residue may or may not be one encoded by the genetic code. A variant of a polypeptide may be naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. “Variant” includes functional and structural variants.
[0063] As used herein, "organism", "host", and "subject" refers to any living entity comprised of at least one cell. A living organism can be as simple as, for example, a single isolated eukaryotic cell or cultured cell or cell line, or as complex as a mammal, including a human being, and animals (e.g., vertebrates, amphibians, fish, mammals, e.g., cats, dogs, horses, pigs, cows, sheep, rodents, rabbits, squirrels, bears, primates (e.g., chimpanzees, gorillas, and humans).
[0064] As used herein, “kit” means a collection of at least two components constituting the kit. Together, the components constitute a functional unit for a given purpose. Individual member components may be physically packaged together or separately. For example, a kit comprising an instruction for using the kit may or may not physically include the instruction with other individual member components. Instead, the instruction can be supplied as a separate member component, either in a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation.
[0065] As used herein, “instruction(s)” means documents describing relevant materials or methodologies pertaining to a kit. These materials may include any combination of the following: background information, list of components and their availability information (purchase information, etc.), brief or detailed protocols for using the kit, trouble-shooting, references, technical support, and any other related documents. Instructions can be supplied with the kit or as a separate member component, either as a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation. Instructions can comprise one or multiple documents and are meant to include future updates.
[0066] Reference throughout this specification to “one embodiment", “an embodiment”, “another embodiment”, “some embodiment,” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment,” “in an embodiment,” “in another embodiment”, or “in some embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but they may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some, but not other, features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments can be used in any combination.
[0067] A “control” sample or value refers to a sample that serves as a reference, usually a known reference, for comparison to a test sample or condition. For example, a test sample can include cells exposed to a test condition or a test agent, while the control is not exposed to the test condition or agent (e.g. , negative control). The control can also be a positive control, e.g., a known primary cell or a cell exposed to known conditions or agents, for the sake of comparison to the test condition. A control can also represent an average value gathered from a plurality of samples, e.g., to obtain an average value. For therapeutic applications, a sample obtained from a patient suspected of having a given disorder or deficiency can be compared to samples from a known normal (non-deficient) individual. A control can also represent an average value gathered from a population of similar individuals, e.g., patient having a given deficiency or healthy individuals with a similar medical background, same age, weight, etc. A control value can also be obtained from the same individual, e.g., from an earlier-obtained sample, prior to the disorder or deficiency, or prior to treatment. One of skill will recognize that controls can be designed for assessment of any number of parameters.
[0068] The term “biological sample” encompasses a variety of sample types obtained from an organism or a cell line. The term encompasses blood and other liquid samples of biological origin, solid tissue samples, such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The term includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components. The term includes a clinical sample, and also includes cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples.
[0069] The terms “individual,” “subject,” “host,” and “patient,” used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans.
[0070] The term “normal” as used in the context of “normal cell,” is meant to refer to a cell of an untransformed phenotype or exhibiting a morphology of a non-transformed cell of the tissue type being examined. A “cancer cell” refers to a cell of a cancer that can be identified by abnormalities in, for example, cell growth or proliferation (e.g., uncontrolled growth or proliferation), regulation of the cell cycle, cell mobility, cell-cell interaction, or metastasis, etc.
[0071] The term “clinical well-being” as used herein, refers to a state or degree of clinical or physiological wellness or health of a patient. A clinician can evaluate a patient’s clinical wellbeing by physical examination or performing one or more tests or assays.
[0072] “Inhibitors,” “activators,” and “modulators” of expression or of activity are used to refer to inhibitory, activating, or modulating molecules, respectively, identified using in vitro and in vivo assays for expression or activity of a described target protein (or encoding polynucleotide), e.g., ligands, agonists, antagonists, and their homologs and mimetics. The term “modulator” includes inhibitors and activators. Inhibitors are agents that, e.g., inhibit expression or bind to, partially or totally block stimulation or protease inhibitor activity, decrease, prevent, delay activation, inactivate, desensitize, or down regulate the activity of the described target protein, e.g., antagonists. Activators are agents that, e.g., induce or activate the expression of a described target protein or bind to, stimulate, increase, open, activate, facilitate, enhance activation or protease inhibitor activity, sensitize or up regulate the activity of described target protein (or encoding polynucleotide), e.g., agonists. Modulators include naturally occurring and synthetic ligands, antagonists and agonists (e.g., small chemical molecules, antibodies and the like that function as either agonists or antagonists). Such assays for inhibitors and activators include, e.g., applying putative modulator compounds to cells expressing the described target protein and then determining the functional effects on the described target protein activity, as described above. Samples or assays comprising described target protein that are treated with a potential activator, inhibitor, or modulator are compared to control samples without the inhibitor, activator, or modulator to examine the extent of effect. Control samples (untreated with modulators) are assigned a relative activity value of 100%. Inhibition of a described target protein is achieved when the activity value relative to the control is about 80%, optionally 50% or 25, 10%, 5% or 1%. Activation of the described target protein is achieved when the activity value relative to the control is 110%, optionally 150%, optionally 200, 300%, 400%, 500%, or 1000-3000% or more higher.
[0073] The terms “administering,” “delivering,” and “introducing,” can be used interchangeably to indicate the introduction of a therapeutic composition or agent (e.g., cells, exosomes, and / or natriuretic peptides) into the body of a subject. The therapeutic composition or agent can be administered through any appropriate means that results in the delivery of at least a portion of the composition or agent to a desired location in the subject such that the composition or agent retains its therapeutic capability. Useful methods of delivering the therapeutic include, but are not limited to, intravenous delivery, subcutaneous delivery, intradermal delivery, intracoronary delivery, intracardiac delivery, oral delivery, or any combination thereof.
[0074] The term “administered continuously” refers to the continuous delivery of a therapeutic agent, e.g., compound, molecule, peptide, biologic, chemical, etc. over a 24 hour period.
[0075] The term “therapeutically effective amount” refers to an amount of therapeutic agent effective to treat at least one symptom of a disease or disorder in a subject. In other words, such an amount is sufficient to bring about a beneficial or desired clinical effect. The “therapeutically effective amount” of the agent for administration may vary based upon the desired activity, the diseased state of the subject being treated, the dosage form, method of administration, subject factors such as the subject's sex, genotype, weight and age, the underlying causes of the condition or disease to be treated, the route of administration and bioavailability, the persistence of the administered agent in the body, evidence of natriuresis and / or diuresis, the type of formulation, and the potency of the agent.
[0076] As used herein, the terms “pharmaceutically acceptable” or “pharmacologically acceptable” refer to compositions that do not substantially produce adverse reactions, e.g., toxic, allergic, or immunological reactions, when administered to a subject. The terms “therapy,” “treatment,” and “amelioration” refer to any reduction in the severity of symptoms, e.g., of a neurodegenerative disorder or neuronal injury. As used herein, the terms “treat” and “prevent” are not intended to be absolute terms. Treatment can refer to any delay in onset, amelioration of symptoms, improvement in patient survival, improved cognitive function or coordination, increase in survival time or rate, etc. The effect of treatment can be compared to an individual or pool of individuals not receiving the treatment, or to the same patient prior to treatment or at a different time during treatment. In some aspects, the severity of disease is reduced by at least 10%, as compared, e.g., to the individual before administration or to a control individual not undergoing treatment. In some aspects the severity of disease is reduced by at least 25%, 50%, 75%, 80%, or 90%, or in some cases, no longer detectable using standard diagnostic techniques.
[0077] As used throughout, the terms “nucleic acid,” “nucleic acid sequence,” “oligonucleotide,” “nucleotides,” or other grammatical equivalents as used herein mean at least two nucleotides, either deoxyribonucleotides or ribonucleotides, or analogs thereof, covalently linked together. Polynucleotides are polymers of any length, including, e.g., 20, 50, 100, 200, 300, 500, 1000, 2000, 3000, 5000, 7000, 10,000, etc. A polynucleotide described herein generally contains phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have at least one different linkage, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphophoroamidite linkages, and peptide nucleic acid backbones and linkages. Mixtures of naturally occurring polynucleotides and analogs can be made; alternatively, mixtures of different polynucleotide analogs, and mixtures of naturally occurring polynucleotides and analogs may be made. The following are nonlimiting examples of polynucleotides: a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, cRNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. The term also includes both double- and single-stranded molecules. Unless otherwise specified or required, the term polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form. A polynucleotide is composed of a specific sequence of four nucleotide bases: adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U) for thymine when the polynucleotide is RNA. Thus, the term “polynucleotide sequence” is the alphabetical representation of a polynucleotide molecule. Unless otherwise indicated, a particular polynucleotide sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues.
[0078] Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof, alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated.
[0079] As used herein, “cDNA” refers to a DNA sequence that is complementary to an RNA transcript in a cell. It is a man-made molecule. Typically, cDNA is made in vitro by an enzyme called reverse-transcriptase using RNA transcripts as templates.
[0080] As used herein with reference to the relationship between DNA, cDNA, cRNA, RNA, protein / peptides, and the like “corresponding to” or “encoding” (used interchangeably herein) refers to the underlying biological relationship between these different molecules. As such, one of skill in the art would understand that operatively “corresponding to” can direct them to determine the possible underlying and / or resulting sequences of other molecules given the sequence of any other molecule which has a similar biological relationship with these molecules. For example, from a DNA sequence an RNA sequence can be determined and from an RNA sequence a cDNA sequence can be determined.
[0081] As used herein, “gene” can refer to a hereditary unit corresponding to a sequence of DNA that occupies a specific location on a chromosome and that contains the genetic instruction for a characteristic(s) or trait(s) in an organism. The term gene can refer to translated and / or untranslated regions of a genome. “Gene” can refer to the specific sequence of DNA that is transcribed into an RNA transcript that can be translated into a polypeptide or be a catalytic RNA molecule, including but not limited to, tRNA, siRNA, piRNA, miRNA, long- non-coding RNA and shRNA.
[0082] As used herein, the term “exogenous DNA” or “exogenous nucleic acid sequence” or “exogenous polynucleotide” refers to a nucleic acid sequence that was introduced into a cell, organism, or organelle via transfection. Exogenous nucleic acids originate from an external source, for instance, the exogenous nucleic acid may be from another cell or organism and / or it may be synthetic and / or recombinant. While an exogenous nucleic acid sometimes originates from a different organism or species, it may also originate from the same species (e.g., an extra copy or recombinant form of a nucleic acid that is introduced into a cell or organism in addition to or as a replacement for the naturally occurring nucleic acid). Typically, the introduced exogenous sequence is a recombinant sequence.
[0083] The terms "transfection", "transduction", "transfecting" or "transducing" can be used interchangeably and are defined as a process of introducing a nucleic acid molecule or a protein to a cell. Nucleic acids are introduced to a cell using non-viral or viral-based methods. The nucleic acid molecules may be gene sequences encoding complete proteins or functional portions thereof. Non-viral methods of transfection include any appropriate transfection method that does not use viral DNA or viral particles as a delivery system to introduce the nucleic acid molecule into the cell. Exemplary non-viral transfection methods include calcium phosphate transfection, liposomal transfection, nucleofection, sonoporation, transfection through heat shock, magnetifection and electroporation. In some embodiments, the nucleic acid molecules are introduced into a cell using electroporation following standard procedures well known in the art. For viral-based methods of transfection any useful viral vector may be used in the methods described herein. Examples for viral vectors include, but are not limited to retroviral, adenoviral, lentiviral and adeno-associated viral vectors. In some embodiments, the nucleic acid molecules are introduced into a cell using a retroviral vector following standard procedures well known in the art. The terms "transfection" or "transduction" also refer to introducing proteins into a cell from the external environment. Typically, transduction or transfection of a protein relies on attachment of a peptide or protein capable of crossing the cell membrane to the protein of interest. See, e.g., Ford et al. (2001) Gene Therapy 8:1 -4 and Prochiantz (2007) Nat. Methods 4:119-20.
[0084] The word "expression" or "expressed" as used herein in reference to a gene means the transcriptional and / or translational product of that gene. The level of expression of a DNA molecule in a cell may be determined on the basis of either the amount of corresponding mRNA that is present within the cell or the amount of protein encoded by that DNA produced by the cell (Sambrook et al., 1989 Molecular Cloning: A Laboratory Manual, 18.1-18.88).
[0085] Expression of a transfected gene can occur transiently or stably in a cell. During "transient expression" the transfected gene is not transferred to the daughter cell during cell division. Since its expression is restricted to the transfected cell, expression of the gene is lost over time. In contrast, stable expression of a transfected gene can occur when the gene is co-transfected with another gene that confers a selection advantage to the transfected cell. Such a selection advantage may be a resistance towards a certain toxin that is presented to the cell. Expression of a transfected gene can further be accomplished by transposon- mediated insertion into to the host genome. During transposon-mediated insertion, the gene is positioned in a predictable manner between two transposon linker sequences that allow insertion into the host genome as well as subsequent excision.
[0086] The term "plasmid" refers to a nucleic acid molecule that encodes for genes and / or regulatory elements necessary for the expression of genes. Expression of a gene from a plasmid can occur in cis or in trans. If a gene is expressed in cis, gene and regulatory elements are encoded by the same plasmid. Expression in trans refers to the instance where the gene and the regulatory elements are encoded by separate plasmids. The term "episomal" refers to the extra-chromosomal state of a plasmid in a cell. Episomal plasmids are nucleic acid molecules that are not part of the chromosomal DNA and replicate independently thereof.
[0087] The term “exogenous” refers to a molecule or substance (e.g. , nucleic acid or protein) that originates from outside a given cell or organism. Conversely, the term “endogenous” refers to a molecule or substance that is native to, or originates within, a given cell or organism.
[0088] The term "vector" refers to a carrier DNA molecule into which a DNA sequence can be inserted for introduction into a host cell. In some embodiments, vectors of use in the invention are those capable of autonomous replication and / or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". Thus, an "expression vector" is a specialized vector that contains the necessary regulatory regions needed for expression of a gene of interest in a host cell. In some embodiments the gene of interest is operably linked to another sequence in the vector, e.g., a promoter. Vectors include non-viral vectors such as plasmids and viral vectors.
[0089] A "viral vector" is a viral-derived nucleic acid that is capable of transporting another nucleic acid into a cell. A viral vector is capable of directing expression of a protein or proteins encoded by one or more genes carried by the vector when it is present in the appropriate environment. Examples for viral vectors include, but are not limited to retroviral, adenoviral, lentiviral and adeno-associated viral vectors.
[0090] The term “operably linked” refers to a functional linkage between a first nucleic acid sequence and a second nucleic acid sequence, such that the first and second nucleic acid sequences are transcribed into a single nucleic acid sequence. Operably linked nucleic acid sequences need not be physically adjacent to each other. The term “operably linked” also refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a transcribable nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the transcribable sequence.
[0091] The terms "regulatory sequence" and "promoter" are used interchangeably herein, and refer to nucleic acid sequences, such as initiation signals, enhancers, and promoters, which induce or control transcription of protein coding sequences with which they are operatively linked. In some examples, transcription of a recombinant gene is under the control of a promoter sequence (or other transcriptional regulatory sequence) which controls the expression of the recombinant gene in a cell- type in which expression is intended. It will also be understood that the recombinant gene can be under the control of transcriptional regulatory sequences which are the same or which are different from those sequences which control transcription of the naturally occurring form of a protein. In some instances, the promoter sequence is recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required for initiating transcription of a specific gene.
[0092] "Expression cassette" refers to a polynucleotide comprising a promoter or other regulatory sequence operably linked to a sequence encoding a protein.
[0093] The term “siRNA” refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA can reduce or inhibit expression of a gene or target gene when the siRNA expressed in the same cell as the gene or target gene. In the context of this invention, the term “siRNA” includes miRNA. “siRNA” thus refers to the double stranded RNA formed by the complementary strands. The complementary portions of the siRNA that hybridize to form the double stranded molecule typically have substantial or complete identity. In one embodiment, an siRNA refers to a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA. The sequence of the siRNA can correspond to the full-length target gene, or a subsequence thereof. Typically, the siRNA is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length, preferable about preferably about 20-30 base nucleotides, preferably about 20-25 nucleotides in length, e.g., 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
[0094] The term “shRNA” refers generally to an siRNA that is introduced into a cell as part of a larger DNA construct. Typically, such constructs allow stable expression of the siRNA in cells after introduction, e.g., by integration of the construct into the host genome.
[0095] An "antisense" oligonucleotide or polynucleotide is a nucleotide sequence that is substantially complementary to a target polynucleotide or a portion thereof and can specifically hybridize to the target polynucleotide.
[0096] The terms “polypeptide” and “peptide” are used interchangeably herein to refer to a polymer of amino acid residues in a single chain. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non- naturally occurring amino acid polymers. Amino acid polymers may comprise entirely L-amino acids, entirely D-amino acids, or a mixture of L- and D-amino acids. The term “protein” as used herein refers to either a polypeptide or a dimer (i.e., two) or multimer ( / .e., three or more) of single chain polypeptides. The single chain polypeptides of a protein may be joined by a covalent bond, e.g., a disulfide bond, or non-covalent interactions. The terms “portion” and “fragment” are used interchangeably herein to refer to parts of a polypeptide, nucleic acid, or other molecular construct.
[0097] The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, y- carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
[0098] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
[0099] The term “a recombination of amino acid sequences,” in the context of a peptide, refers to a change or variation in the amino acid sequence of a reference peptide, such that the biological properties of the reference peptide are maintained after the amino acid sequence change. For example, the recombination of amino acid sequence may be a conservative amino acid substitution or an amino acid sequence modification (addition, deletion or substitution) to produce a chimeric peptide.
[0100] The amino acids in the polypeptides described herein can be any of the 20 naturally occurring amino acids, D-stereoisomers of the naturally occurring amino acids, unnatural amino acids and chemically modified amino acids. Unnatural amino acids (that is, those that are not naturally found in proteins) are also known in the art, as set forth in, for example, Zhang et al. “Protein engineering with unnatural amino acids,” Curr. Opin. Struct. Biol. 23(4): 581-87 (2013); Xie et al. “Adding amino acids to the genetic repertoire, "Curr. Opin. Chem. Biol. 9(6): 548-54 (2005); and all references cited therein. Beta and gamma amino acids are known in the art and are also contemplated herein as unnatural amino acids.
[0101] In accordance with standard nomenclature, amino acid residue sequences are denominated by either a three letter or a single letter code as indicated as follows, for example: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic Acid (Asp, D), Cysteine (Cys, C), Glutamine (Gin, Q), Glutamic Acid (Glu, E), Glycine (Gly, G), Histidine (His, H), Isoleucine (He, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Vai, V). “Protein” and “Polypeptide” can refer to a molecule composed of one or more chains of amino acids in a specific order. The term protein is used interchangeable with “polypeptide.” The order is determined by the base sequence of nucleotides in the gene coding for the protein. Proteins can be involved in the structure, function, and regulation of various functions.
[0102] As used herein, a chemically modified amino acid refers to an amino acid whose side chain has been chemically modified. For example, a side chain can be modified to comprise a signaling moiety, such as a fluorophore or a radiolabel. A side chain can also be modified to comprise a new functional group, such as a thiol, carboxylic acid, or amino group. Post- translationally modified amino acids are also included in the definition of chemically modified amino acids.
[0103] The term “identity” or “substantial identity,” as used in the context of a polynucleotide or polypeptide sequence described herein, refers to a sequence that has at least 60% sequence identity to a reference sequence. Alternatively, percent identity can be any integer from 60% to 100%. Exemplary embodiments include at least: 60%, 65%, 70%, 75%, 80%, 85%, 88%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, as compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below. One of skill will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like.
[0104] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
[0105] A “comparison window,” as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith & Waterman Add. APL. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444 (1988), by computerized implementations of these algorithms (e.g., BLAST), or by manual alignment and visual inspection. Algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1990) J. Mol. Biol. 215: 403-10 and Altschul et al. (1977) Nucleic Acids Res. 25: 3389-402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI) web site. The algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1977)). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word size (W) of 28, an expectation (E) of 10, M=1 , N=-2, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word size (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).
[0106] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.01 , more preferably less than about 10‘5, and most preferably less than about 10'20.
[0107] As used herein, the term "biologically active fragments" or "bioactive fragment" of the polypeptides encompasses natural or synthetic portions of the full-length miRNA or mimic thereof that are capable of specific binding to their natural ligand or of performing the function of the protein. "Synthetic miRNA" or “synthetic miRNA mimic” means a non-naturally occurring miRNA polynucleotide. Synthetic nucleotides and polynucleotides can be synthesized, for example, using an automated nucleotide synthesizer. Various solid synthesis methods are known to those of skill in the art.
[0108] As used herein, the term "promoter / regulatory sequence" means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter / regulator sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter / regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
[0109] “Primer" refers to a polynucleotide that is capable of specifically hybridizing to a designated polynucleotide template and providing a point of initiation for synthesis of a complementary polynucleotide. Such synthesis occurs when the polynucleotide primer is placed under conditions in which synthesis is induced, i.e. , in the presence of nucleotides, a complementary polynucleotide template, and an agent for polymerization such as DNA polymerase. A primer is typically single-stranded, but may be double- stranded. Primers are typically deoxyribonucleic acids, but a wide variety of synthetic and naturally occurring primers are useful for many applications. A primer is complementary to the template to which it is designed to hybridize to serve as a site for the initiation of synthesis, but need not reflect the exact sequence of the template. In such a case, specific hybridization of the primer to the template depends on the stringency of the hybridization conditions. Primers can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.
[0110] As used herein, an "essentially pure" preparation of a particular nucleotide is a preparation wherein at least about 95%, and preferably at least about 99%, by weight, of the nucleotide in the preparation is the particular nucleotide.
[0111] A "subsequence", "fragment" or "segment" is a portion of a nucleotide sequence, comprising a portion of a nucleic acid sequence comprising at least two or more nucleotides of an miRNA or miRNA mimic as described herein. The terms "subsequence", "fragment" and "segment" are used interchangeably herein.
[0112] "Homologous" as used herein, refers to the subunit sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, e.g., two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions, e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the 25 positions, e.g., 9 of 10, are matched or homologous, the two sequences share 90% homology. By way of example, the DNA sequences 3' ATTGCC5' and 3'TATGGC share 50% homology.
[0113] As used herein, "homology" is used synonymously with "identity."
[0114] An "isolated nucleic acid" refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs. The term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell and / or which might be otherwise present in an artificial reaction by which the nucleic acids are produced or employed. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule ( e.g., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence. In embodiments, described herein are isolated miRNA and isolated miRNA mimics.
[0115] As used herein, an "isolated nucleic acid molecule" and "isolated nucleic acid fragment" may be used interchangeably and refer to a polymer of RNA or DNA that is si ng le- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid molecule in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
[0116] The term "nucleic acid construct", as used herein, encompasses DNA and RNA sequences encoding the particular gene or gene fragment desired, whether obtained by genomic or synthetic methods.
[0117] As used herein, the term "chemically synthesized", as pertaining to a DNA sequence, means that the component nucleotides were assembled in vitro. Manual chemical synthesis of DNA may be accomplished using well-established procedures, or automated chemical synthesis can be performed using one of a number of commercially available machines. Accordingly, the genes can be tailored for optimal gene expression based on optimization of nucleotide sequences to reflect the codon bias of the host cell. The skilled artisan appreciates the likelihood of successful gene expression if codon usage is biased towards those codons favored by the host. Determination of preferred codons can be based on a survey of genes derived from the host cell where sequence information is available. In some embodiments, suitable miRNAs or miRNA mimics may include enzymes comprising an amino acid sequence having at least 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the nucleotide sequences reported herein.
[0118] Discussion
[0119] Described herein are miRNA and miRNA mimics for improving sociability in subjects, compositions comprising miRNA and miRNA mimics, kits comprising miRNA and miRNA mimics, pharmaceutical compositions comprising miRNA and miRNA mimics, and methods of treatment utilizing miRNA and miRNA mimics. Such aspects of the present disclosure can improve sociability in subjects in need thereof, in particular, subjects having a psychiatric or psychological disorder that results in reduced sociability compared to a subject without the disorder.
[0120] I. MIRNAS AND MIRNA MIMICS microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post- transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA.
[0121] The present disclosure examined the influence of blood-derived miRNAs associated with extracellular vesicles (EVs) on sociability behaviors and related neuronal activities. It was found that intravenous injections of EV-rich fractions from socially normal wild-type (WT) mice attenuated sociability deficits in multiple mouse models, including immunodeficient Rag1 '- mice, Cntnap2'- mice, and Shanks - mice. Detailed analysis with Ragt7mice revealed that WT blood-derived EVs attenuated sociability deficits selectively, without affecting social novelty recognition deficits, by reaching neurons in the medial prefrontal cortex (mPFC) and modulating inhibitory postsynaptic currents of layer V neurons via miRNA-mediated control of PKCE expression. Further study identified found that loading two miRNAs identified from the analysis, miR-23a-3p and miR-103-3p, to Rag17EVs enabled them to enhance sociability in Rag1 '- mice, similar to WT EVs, accompanied by the reduced expression of PKCE, enhanced expression synaptic GABAA receptors, and restored neuronal activities in the PFC. A.. miR-23a-3p and miR-103-3p
[0122] Described herein are compositions comprising miR-23a-3p and miR-103-3p, and miRNA mimics thereof. In certain aspects, any one or more miRNA described herein can be part of a composition as described herein. In embodiments, miR-23a-3p and miR-103-3p and mimics thereof are mature miRNA. In certain aspects, any one or more miRNA described herein can be loaded in extracellular vesicles (EVs). The skilled artisan would readily understand that any miRNA described herein can be utilized with any other miRNA described herein in any combination of any thereof. miRNA and miRNA mimics as described herein can be isolated and / or purified. miRNA and miRNA mimics as described herein can be chemically synthesized. The miRNA and miRNA mimics described herein can be a component of a composition with a vehicle, for example, sterile water or phosphate buffered saline, which is not naturally occurring. miR-23a-3p (also known as MIRN23A; mir-23a; miRNA23A; NCBI Gene ID: 407010 and miRBase ID: Ml MAT 0000078 (Homo sapiens), NCBI Gene ID: 387216 and miRBase ID: MIMAT0000532 (Mus musculus), NCBI Gene ID: 100314228 and miRBase ID: MIMAT0000792 (Rattus norvegicus), for example, the contents of which are incorporated by reference herein) can be utilized in compositions according to the present disclosure. In embodiments, compositions according to the present disclosure can utilize mature miRNA that having 100% sequence identity to that of miRBase ID: MIMAT0000078 (Homo sapiens), miRBase ID: MIMAT0000532 (Mus musculus), miRBase ID: MIMAT0000792 (Rattus norvegicus) - AUCACAUUGCCAGGGAUUUCC (SEQ ID NO: 1). miR-103-3p (also known as MIR103-1 ; MIRN103-1 ; mir-103a-1 ; NCBI Gene ID: 406895 and miRBase ID: MIMAT0000101 (Homo sapiens), NCBI Gene ID: 723824 and miRBase ID: MIMAT0000546 (Mus musculus), NCBI Gene ID: 100314021 and MIMAT0000824 (Rattus norvegicus), for example, the contents of which are incorporated by reference herein) can also be utilized in compositions according to the present disclosure. In embodiments, compositions according to the present disclosure can utilize mature miRNA that having 100% sequence identity to that of miRBase ID: MIMAT0000101 (Homo sapiens), miRBase ID: MIMAT0000532 (Mus musculus), miRBase ID: MIMAT0000792 (Rattus norvegicus) - AGCAGCAUUGUACAGGGCUAUGA (SEQ ID NO: 2). microRNA mimics are double-stranded miRNA-like RNA that are designed to copy the functionality of mature endogenous miRNA. In embodiments, compositions can comprise a mimic of one or more of miR-23a-3p and miR-103-3p. In embodiments, a miRNA mimic of miR-23a-3p is miRNA mimic #339173 (YM 00470983- AD A) from Qiagen. In embodiments, a miRNA mimic of miR-103-3p is miRNA mimic #339173 (YM 00470828-ADA) from Qiagen. Similar mimics can be generated using other resources, such as IDT. Additional commercially available mimics also exist, such as hsa-miR-23a-3p mimic from MedChemExpress (Cat. No.: HY-R00480). The skilled artisan would readily understand that guidelines for generation of miRNA mimics exist at the time of filing of the present application, for example, those set forth in Wang Z. The guideline of the design and validation of MiRNA mimics. Methods Mol Biol. 201 1 ;676:21 1-23. doi: 10.1007 / 978-1-60761-863-8_15. PMID: 20931400, which is incorporated by reference as if fully set forth herein for its teachings regarding guidelines for generation of miRNA mimics.
[0123] In embodiments, described herein are compositions and EVs comprising a microRNA having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater sequence identity with human miR-23a-3p (hsa- miR-23a-3p, having miRbase Accession Number MIMAT0000078), mouse miR-23a-3p (mmu- miR-23a-3p, having miRbase Accession Number MIMAT0000532), or rat miR-23a-3p (rno- miR-23a-3p, having miRbase Accession Number MIMAT0000792).
[0124] In embodiments, described herein compositions and EVs comprising a microRNA having about 100% sequence identity with human miR-23a-3p (hsa-miR-23a-3p, having miRbase Accession Number MIMAT0000078), mouse miR-23a-3p (mmu-miR-23a-3p, having miRbase Accession Number MIMAT0000532), or rat miR-23a-3p (rno-miR-23a-3p, having miRbase Accession Number MIMAT0000792). In embodiments, described herein are compositions and EVs comprising a microRNA with 100% sequence identity to SEQ ID NO:1.
[0125] In embodiments, described herein are compositions and EVs comprising a microRNA having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater sequence identity with human miR-103-3p (hsa- miR-103a-3p, having miRbase Accession Number MIMAT0000101), mouse miR-103-3p (mmu-miR-103-3p, having miRbase Accession Number MIMAT0000546), or rat miR-103-3p (rno-miR-103-3p, having miRbase Accession Number MIMAT0000824).
[0126] In embodiments, described herein are compositions and EVs comprising a microRNA having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater sequence identity with SEQ ID NO:1. In embodiments, described herein are compositions and EVs comprising a microRNA having about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater sequence identity with SEQ ID NO:1 . In embodiments, described herein are compositions and EVs comprising a microRNA with 100% sequence identity to SEQ ID NO:1.
[0127] In embodiments, described herein are compositions and EVs comprising a microRNA having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater sequence identity with SEQ ID NO:2. In embodiments, described herein are compositions and EVs comprising a microRNA having about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater sequence identity with SEQ ID NO:2. In embodiments, described herein are compositions and EVs comprising a microRNA with 100% sequence identity to SEQ ID NO:2.
[0128] In embodiments, described herein are compositions and EVs comprising a microRNA having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater sequence identity with SEQ ID NO: 15. In embodiments, described herein are compositions and EVs comprising a microRNA having about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater sequence identity with SEQ ID NO:15. In embodiments, described herein are compositions and EVs comprising a microRNA with 100% sequence identity to SEQ ID NO: 15.
[0129] In embodiments, the stem-loop miRNA and / or miRNA mimics described herein (for example, SEQ ID NOs: 3-14) can be incorporated into an expression vector, where they can be expressed and processed to generate mature miRNA and / or miRNA mimics described herein. The mature miRNA and / or mimics thereof can then be isolated.
[0130] In embodiments, described herein are compositions and EVs comprising a microRNA having about 100% sequence identity with human miR-103-3p (hsa-miR-103a-3p, having miRbase Accession Number MIMAT0000101), mouse miR-103-3p (mmu-miR-103-3p, having miRbase Accession Number MIMAT0000546), or rat miR-103-3p (rno-miR-103-3p, having miRbase Accession Number MIMAT0000824).
[0131] In another aspect, the present invention provides for a recombinant vector comprising the nucleotide sequences for a miR-23a-3p, a miR-23a-3p mimic, a miR-103-3p, a miR-103- 3p mimic, or any combination of any thereof. Additional methods for expression of miRNAs can be found, for example, in Fan, J., Feng, Y., Zhang, R. et al. A simplified system for the effective expression and delivery of functional mature microRNAs in mammalian cells. Cancer Gene Ther 27, 424-437 (2020). https: / / doi.org / 10.1038 / s41417-019-01 13-y, the contents of which are incorporated by reference as if fully set forth herein for miRNA expression systems and vectors.
[0132] B. Extracellular Vesicles
[0133] Extracellular vesicles (EVs) are small cell-derived membrane-surrounded vesicles that carry bioactive molecules and deliver them to recipient cells. EVs include exosomes, microvesicles, apoptotic bodies, autophagic EVs, matrix vesicles, and stressed EVs. EVs according to the present disclosure can be utilized as a delivery vehicle to deliver miRNAs and miRNA mimics to a subject by loading the miRNAs and miRNA mimics into the EV or otherwise associating them with the EV membrane.
[0134] In embodiments, miRNAs and miRNA mimics as described herein can be “loaded” into extracellular vesicles prior to administration into a subject. In embodiments, loading of miRNA / miRNA mimics can be done by utilizing existing methods and delivery systems, for example, transfection and electroporation. In embodiments, mature miRNA is loaded into vesicles.
[0135] In embodiments, about 250-500 picomoles, about 260-490 picomoles, about 270-480 picomoles, about 280-470 picomoles, about 290-460 picomoles, about 300-450 picomoles, about 310-440 picomoles, about 320-430 picomoles, about 330-420 picomoles, about 340-
[0136] 410 picomoles, about 350-400 picomoles, about 360-390 picomoles, about 370-380 picomoles, about 260 picomoles, about 270 picomoles, about 280 picomoles, about 290 picomoles, about 300 picomoles, about 310 picomoles, about 320 picomoles, about 330 picomoles, about 340 picomoles, about 350 picomoles, about 360 picomoles, about 370 picomoles, about 380 picomoles, about 390 picomoles, about 400 picomoles, about 410 picomoles, about 420 picomoles, about 430 picomoles, about 440 picomoles, about 450 picomoles, about 460 picomoles, about 470 picomoles, about 480 picomoles, about 490 picomoles, or about 500 picomoles of miRNA / miRNA mimics can be loaded into EVs.
[0137] In embodiments, miRNA is loaded into about 1x109, about 2x109, about 3x109, about
[0138] 4x109, about 5x109, about 5x109, about 5x109, about 6x109, about 7x109, about 8x109, about
[0139] 9x109, about 10x109particles of peripheral blood-derived extracellular vesicles prior to administration. In embodiments, miRNA is loaded into about 1x109to about 2x109, about 1x109to about 3x109, about 1x109to about 4x109, about 1x109to about 5x109, about 1x109to about 6x109particles, about 1x109to about 7x109particles, about 1x109to about 8x109particles, about 1x109to about 9x109particles, about 1x109to about 10x109particles of peripheral blood-derived extracellular vesicles prior to administration.
[0140] In embodiments, miRNA is loaded into about 1x109to about 10x109, about 2x109to about 10x109, about 3x109to about 10x109, about 4x109to about 10x109, about 5x109to about 10x109particles, about 6x109to about 10x109particles, about 7x109to about 10x109particles, about 8x109to about 10x109particles, about 9x109to about 10x109particles of peripheral blood-derived extracellular vesicles prior to administration.
[0141] In embodiments and without intending to be limiting, miRNAs and miRNA mimics can be loaded, for example, into blood-derived EVs using an Exo-Fect Exosome transfection kit (#EXFT20A-1 , System Biosciences) according to the manufacturer’s instructions, and the EVfect Transfection Kit from Galen Molecular (JOT-EV-T1) according to the manufacturer’s instructions. II. KITS AND PACKAGING
[0142] The compositions ( / .e., those comprising, consisting essentially of, or consisting of miRNA and / or miRNA mimics described herein) can be utilized in the preparation of a kit. In some embodiments, kits are provided for carrying out any of the methods described herein. The kits of this disclosure may comprise a carrier container being compartmentalized to receive in close confinement one or more containers such as vials, tubes, and the like, each of the containers comprising one of the separate elements to be used in the method.
[0143] In some instances, one of the containers may comprise a composition as described in this disclosure that is, or can be, detectably labeled. The kit may also have containers containing buffer(s) and / or a container comprising a reporter-means, such as a biotin-binding protein, such as avidin or streptavidin, bound to a reporter molecule, such as an enzymatic or fluorescent label. In some embodiments, the kit comprises separate containers containing compositions described herein and a detectable label.
[0144] A composition as described in this disclosure for use in improving sociability in subjects may be delivered in a pharmaceutical package or kit to doctors and psychiatric patients. Such packaging is intended to improve patient convenience and compliance with the treatment plan. Typically, the packaging comprises paper (cardboard) or plastic. In some embodiments, the kit or pharmaceutical package further comprises instructions for use (e.g., for administering according to a method as described herein).
[0145] In some embodiments, a pharmaceutical package or kit comprises unit dose forms of a composition or components of compositions described herein. In some embodiments, the pharmaceutical package or kit further comprises unit dose forms of one or more of an additional therapeutic, for example, another medicament used for treatment of a disorder in a patient.
[0146] In one embodiment, the kit or pharmaceutical package comprises a composition as described herein in a defined, therapeutically effective dose in a single unit dosage form or as separate unit doses. The dose and form of the unit dose (e.g., tablet, capsule, immediate release, delayed release, etc.) can be any doses or forms as described herein.
[0147] In one embodiment, the kit or pharmaceutical package includes doses suitable for multiple days of administration, such as one week, one month, or three months.
[0148] In certain embodiments, kits are provided for producing a single-dose administration unit. In certain embodiments, kits containing single or multi-chambered pre-filled syringes are included. In certain embodiments, kits containing one or more containers of a formulation described in this disclosure are included. III. PHARMACEUTICAL COMPOSITIONS AND FORMULATIONS
[0149] Compositions comprising one or more miRNAs, miRNA mimics, or both of the present disclosure and a pharmaceutically acceptable carrier are also provided. The compositions may further comprise a diluent, solubilizer, emulsifier, preservative, and / or adjuvant to be used with the methods disclosed herein. Such compositions can be used in a subject with abnormal or atypical sociability that would benefit from any of the one or more miRNAs, miRNA mimics, or both thereof described herein.
[0150] In certain embodiments, acceptable formulation materials preferably are nontoxic to recipients at the dosages and concentrations employed. In certain embodiments, the formulation material(s) are for I.V. administration. In certain embodiments, the pharmaceutical composition can contain formulation materials for modifying, maintaining or preserving, for example, the pH, osmolality, viscosity, clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adsorption or penetration of the composition. In certain embodiments, suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine or lysine); antimicrobials; antioxidants (such as ascorbic acid, sodium sulfite or sodium hydrogen- sulfite); buffers (such as borate, bicarbonate, Tris-HCI, citrates, phosphates or other organic acids); bulking agents (such as mannitol or glycine); chelating agents (such as ethylenediamine tetraacetic acid (EDTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, beta-cyclodextrin or hydroxypropyl-beta- cyclodextrin); fillers; monosaccharides, disaccharides, and other carbohydrates (such as glucose, mannose or dextrins); proteins (such as serum albumin, gelatin or immunoglobulins); coloring, flavoring and diluting agents; emulsifying agents; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight polypeptides; salt-forming counterions (such as sodium); preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide); solvents (such as glycerin, propylene glycol or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents; surfactants or wetting agents (such as pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate 80, triton, tromethamine, lecithin, cholesterol, tyloxapal); stability enhancing agents (such as sucrose or sorbitol); tonicity enhancing agents (such as alkali metal halides, preferably sodium or potassium chloride, mannitol sorbitol); delivery vehicles; diluents; excipients and / or pharmaceutical adjuvants. (Allen (2012) Remington - The Science and Practice of Pharmacy, 22d Edition, Lloyd V, Allen, ed., The Pharmaceutical Press). In certain embodiments, the optimal pharmaceutical composition is determined by one skilled in the art depending upon, for example, the intended route of administration, delivery format and desired dosage. See, for example, Allen (2012) Remington - The Science and Practice of Pharmacy, 22d Edition, Lloyd V, Allen, ed., The Pharmaceutical Press. In certain embodiments, such compositions may influence the physical state, stability, rate of in vivo release and / or rate of in vivo clearance of the one or more miRNAs, miRNA mimics, or both.
[0151] In certain embodiments, the primary vehicle or carrier in a pharmaceutical composition can be either aqueous or non-aqueous in nature. For example, in certain embodiments, a suitable vehicle or carrier can be water for injection, physiological saline solution or artificial cerebrospinal fluid, possibly supplemented with other materials common in compositions for parenteral administration. In certain embodiments, the saline comprises isotonic phosphate-buffered saline. In certain embodiments, neutral buffered saline or saline mixed with serum albumin are further exemplary vehicles. In certain embodiments, pharmaceutical compositions comprise a pH controlling buffer such phosphate-buffered saline or acetate-buffered saline. In certain embodiments, a composition comprising a one or more miRNAs, miRNA mimics, or both disclosed herein can be prepared for storage by mixing the selected composition having the desired degree of purity with optional formulation agents (see Allen (2012) Remington - The Science and Practice of Pharmacy, 22d Edition, Lloyd V, Allen, ed., The Pharmaceutical Press) in the form of a lyophilized cake or an aqueous solution. Further, in certain embodiments, a composition comprising a one or more miRNAs, miRNA mimics, or both disclosed herein can be formulated as a lyophilizate using appropriate excipients. In some instances, appropriate excipients may include a cryo-preservative, a bulking agent, a surfactant, or a combination of any thereof. Exemplary excipients include one or more of a polyol, a disaccharide, or a polysaccharide, such as, for example, mannitol, sorbitol, sucrose, trehalose, and dextran 40. In some instances, the cryo-preservative may be sucrose or trehalose. In some instances, the bulking agent may be glycine or mannitol. In one example, the surfactant may be a polysorbate such as, for example, polysorbate-20 or polysorbate-80.
[0152] In certain embodiments, the pharmaceutical composition can be selected for parenteral delivery. In certain embodiments, the compositions can be selected for inhalation or for delivery through the digestive tract, such as orally. The preparation of such pharmaceutically acceptable compositions is within the ability of one skilled in the art.
[0153] In certain embodiments, the formulation components are present in concentrations that are acceptable to the site of administration. In certain embodiments, buffers are used to maintain the composition at physiological pH or at a slightly lower pH, typically within a pH range of from about 5 to about 8. For example, the pH may be 5.0, 5.1 , 5.2, 5.3, 5.4, 5.5, 5.6,
[0154] 5.7, 5.8, 5.9, 6.0, 6.1 , 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8. 6.9, 6.9, 7.0, 7.1 , 7.2, 7.3, 7.4, 7.5, 7.6,
[0155] 7.7, 7.8, 7.9, 8.0, 8.1 , 8.2, 8.3, 8.4, or 8.5. In some instances, the pH of the pharmaceutical composition may be in the range of 6.6-8.5 such as, for example, 7.0-8.5, 6.6-7.2, 6.8-7.2, 6.8-7.4, 7.2-7.8, 7.0-7.5, 7.5-8.0, 7.2-8.2, 7.6-8.5, or 7.8-8.3. In some instances, the pH of the pharmaceutical composition may be in the range of 5.5-7.5 such as, for example, 5.5-5.8, 5.5- 6.0, 5.7-6.2, 5.8-6.5, 6.0-6.5, 6.2-6.8, 6.5-7.0, 6.8-7.2, or 6.8-7.5. In some instances, the pH of the pharmaceutical composition may be in the range of 4.0-5.5 such as, for example, 4.0- 4.3, 4.0-4.5, 4.2-4.8, 4.5-4.8, 4.5-5.0, 4.8-5.2, or 5.0-5.5. In an embodiment, the pH is 7.2.
[0156] In certain embodiments when parenteral administration is contemplated, a therapeutic composition can be in the form of a pyrogen-free, parenterally acceptable aqueous solution comprising a one or more miRNAs, miRNA mimics, or both in a pharmaceutically acceptable vehicle. In certain embodiments, a vehicle for parenteral injection is sterile distilled water in which a one or more miRNAs, miRNA mimics, or both is formulated as a sterile, isotonic solution and properly preserved. In certain embodiments, the preparation can involve the formulation of the desired molecule with an agent, such as injectable microspheres, bio- erodible particles, polymeric compounds (such as polylactic acid or polyglycolic acid), beads or liposomes, that can provide for the controlled or sustained release of the product which can then be delivered via a depot injection. In certain embodiments, hyaluronic acid can also be used, and can have the effect of promoting sustained duration in the circulation. In certain embodiments, implantable drug delivery devices can be used to introduce the desired molecule.
[0157] In certain embodiments, it is contemplated that formulations can be administered orally. In certain embodiments, one or more miRNAs, miRNA mimics, or both that are administered in this fashion can be formulated with or without carriers customarily used in compounding solid dosage forms, such as tablets and capsules. In certain embodiments, a capsule can be designed to release the active portion of the formulation at the point in the gastrointestinal tract when bioavailability is maximized, and pre-systemic degradation is minimized. In certain embodiments, at least one additional agent can be included to facilitate absorption of a one or more miRNAs, miRNA mimics, or both (or EV comprising such). In certain embodiments, diluents, flavorings, low melting point waxes, vegetable oils, lubricants, suspending agents, tablet disintegrating agents, and binders can also be employed.
[0158] Additional pharmaceutical compositions can be selected by one skilled in the art, including formulations involving a one or more miRNAs, miRNA mimics, or both in sustained- or controlled-delivery formulations. In certain embodiments, techniques for formulating a variety of other sustained- or controlled-delivery means, such as liposome carriers, bio- erodible microparticles or porous beads and depot injections, are also known to those skilled in the art. See for example, International Application Publication No. WO / 1993 / 015722, which describes the controlled release of porous polymeric microparticles for the delivery of pharmaceutical compositions. In certain embodiments, sustained-release preparations can include semipermeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules. Sustained release matrices can include polyesters, hydrogels, polylactides (see, e.g., U.S. Patent No. 3,773,919; U.S. Patent No. 5, 594,091 ; U.S. Patent No. 8,383,153; U.S. Patent No. 4,767,628; International Application Publication No. WO1998043615, Calo, E. et al. (2015) Eur. Polymer J 65:252-267 and European Patent No. EP 058,481), including, for example, chemically synthesized polymers, starch based polymers, and polyhydroxyalkanoates (PHAs), copolymers of L-glutamic acid and gamma ethyl-L-glutamate (Sidman et al. (1993) Biopolymers 22:547-556), poly (2-hydroxyethyl-methacrylate) (Langer et al. (1981) J Biomed Mater Res. 15: 167-277; and Langer (1982) Chem Tech 12:98-105), ethylene vinyl acetate (Hsu and Langer (1985) J Biomed Materials Res 19(4) :445-460) orpoly- D(-)-3-hydroxybutyric acid (European Patent No. EP0133988). In certain embodiments, sustained release compositions can also include liposomes, which can be prepared by any of several methods known in the art. (See, e.g., Eppstein et al. (1985) Proc. Natl. Acad. Sci. USA 82:3688-3692; European Patent No. EP 036,676; and U.S. Patent Nos. 4,619,794 and 4,615,885).
[0159] The pharmaceutical composition to be used for in vivo administration typically is sterile. In certain embodiments, sterilization is accomplished by filtration through sterile filtration membranes. In certain embodiments, where the composition is lyophilized, sterilization using this method can be conducted either prior to or following lyophilization and reconstitution. In certain embodiments, the composition for parenteral administration can be stored in lyophilized form or in a solution. In certain embodiments, parenteral compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
[0160] In certain embodiments, once the pharmaceutical composition has been formulated, it can be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or as a dehydrated or lyophilized powder. In certain embodiments, such formulations can be stored either in a ready-to-use form or in a form (e.g., lyophilized) that is reconstituted prior to administration.
[0161] In certain embodiments, kits are provided for producing a single-dose administration unit. In certain embodiments, the kit can contain both a first container having a dried protein and a second container having an aqueous formulation. In certain embodiments, kits containing single and multi-chambered pre-filled syringes are included.
[0162] In certain embodiments, the effective amount of a pharmaceutical composition comprising a one or more miRNAs, miRNA mimics, or both to be employed therapeutically depends, for example, upon the therapeutic context and objectives. One skilled in the art will appreciate that the appropriate dosage levels for treatment, according to certain embodiments, vary depending, in part, upon the molecule delivered, the indication for which a one or more miRNAs, miRNA mimics, or both is being used, the route of administration, and the size (body weight, body surface or organ size) and / or condition (the age and general health) of the patient. The clinician can titer the dosage and modify the route of administration to obtain the optimal therapeutic effect.
[0163] The clinician also selects the frequency of dosing, taking into account the pharmacokinetic parameters of the one or more miRNAs, miRNA mimics, or both in the formulation used. In certain embodiments, a clinician administers the composition until a dosage is reached that achieves the desired effect. In certain embodiments, the composition can therefore be administered as a single dose or as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infusion via, for example, an implantation device or catheter. Further refinement of the appropriate dosage is routinely made by those of ordinary skill in the art and is within the ambit of tasks routinely performed by them. In certain embodiments, appropriate dosages can be ascertained through use of appropriate dose-response data.
[0164] In certain embodiments, the route of administration of the pharmaceutical composition is in accord with known methods, e.g., orally, through injection by intravenous, intraperitoneal, intracerebral (intra-parenchymal), intracerebral, intraventricular, intramuscular, subcutaneously, intra-ocular, intraarterial, intraportal, or intralesional routes; by sustained release systems or by implantation devices. In certain embodiments, the compositions can be administered by bolus injection or continuously by infusion, or by implantation device. In certain embodiments, individual elements of a combination therapy may be administered by different routes.
[0165] In certain embodiments, the composition can be administered locally, e.g., during surgery or topically. Optionally local administration is via implantation of a membrane, sponge, or another appropriate material onto which the desired molecule has been absorbed or encapsulated. In certain embodiments, where an implantation device is used, the device can be implanted into any suitable tissue or organ, and delivery of the desired molecule can be via diffusion, timed-release bolus, or continuous administration.
[0166] In certain embodiments, a one or more miRNAs, miRNA mimics, or both can be delivered by implanting certain cells that have been genetically engineered, using methods such as those described herein, to express and secrete the nucleic acids. In certain embodiments, such cells can be animal or human cells, and can be autologous, heterologous, or xenogeneic. In certain embodiments, the cells can be immortalized. In certain embodiments, in order to decrease the chance of an immunological response, the cells can be encapsulated to avoid infiltration of surrounding tissues. In certain embodiments, the encapsulation materials are typically biocompatible, semi-permeable polymeric enclosures or membranes that allow the release of the protein product(s) but prevent the destruction of the cells by a subject’s immune system or by other detrimental factors from the surrounding tissues. In yet another aspect, the present invention provides for a pharmaceutical composition comprising one or more miRNAs selected from the group consisting of a miRNA- 23a-3p, a miR-23a-3p mimic, a miR-103-3p, and a miR-103-3p mimic. The composition may further comprise a pharmaceutically acceptable excipient. Preferably, the amount of the miRNA-23a-3p, a miR-23a-3p mimic, a miR-103-3p, and a miR-103-3p mimic is from about 1 nanomole to about 1 micromole per kg of body weight, and more preferably, from about 10 nanomoles to about 100 nanomoles per kg of body weight, e.g., from about 10 nanomoles to about 50 nanomoles per kg of body weight; from about 10 nanomoles to about 40 nanomoles per kg of body weight; from about 10 nanomoles to about 30 nanomoles per kg of body weight; from about 20 nanomoles to about 50 nanomoles per kg of body weight; from about 20 nanomoles to about 60 nanomoles per kg of body weight; from about 20 nanomoles to about 80 nanomoles per kg of body weight; e.g., about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100 nanomoles per kg of body weight.
[0167] IV. METHODS OF USE AND TREATMENT
[0168] As described herein, the present disclosure provides a method of treating a subject with a disorder affecting sociability (i.e., a subject “in need thereof’), comprising administering to the subject a therapeutically effective amount of compositions ( / .e., those comprising, consisting essentially of, or consisting of miRNA and / or miRNA mimics described herein) according to the present disclosure. In some embodiments, the subject has or is determined to have a disorder affecting sociability.
[0169] The compositions described herein are useful in, inter alia, methods for treating a disorder affecting sociability in a subject. As used herein, the term subject means a mammalian subject. Exemplary subjects include, but are not limited to humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats and sheep. In some embodiments, the subject is a human. In some embodiments, the subject has or is suspected to have a disorder affecting sociability. In some embodiments, the subject is diagnosed with a disorder affecting sociability. In some embodiments, the subject is a human that is suspected of having a disorder affecting sociability.
[0170] In embodiments, a disorder affecting sociability is a psychiatric disorder. In embodiments, a disorder affecting sociability is one or more of an autism spectrum disorder (ASD) or schizophrenia. In embodiments, a disorder affecting sociability is Williams syndrome (WS) or Aspergers syndrome. In embodiments, a disorder affecting sociability is an anxiety disorder, for example, generalized anxiety disorder. In embodiments, a disorder affecting sociability is depression, for example, major depressive disorder. In embodiments, a disorder affecting sociability is dementia, for example, Alzheimer’s disease, frontotemporal dementia, and vascular dementia. In embodiments, a disorder affecting sociability is substance abuse, for example, alcohol abuse and abuse of illicit drugs such as amphetamine.
[0171] As used herein, administer or administration refers to the act of injecting or otherwise physically delivering a substance as it exists outside the body into a patient, such as by mucosal, intradermal, intravenous, intramuscular, subcutaneous delivery and / or any other method of physical delivery described herein or known in the art. When a disease, or a symptom thereof, is being treated, administration of the substance typically occurs after the onset of the disease or symptoms thereof. When a disease, or symptoms thereof, are being prevented, administration of the substance typically occurs before the onset of the disease or symptoms thereof.
[0172] The compositions can be administered to a subject, e.g., a human subject, using a variety of methods that depend, in part, on the route of administration. The route can be, e.g., intravenous injection or infusion (IV), intranasal spraying, intracranial injection, or intrathecal injection (IT). The injection can be in a bolus or a continuous infusion. Techniques for preparing injectate or infusate delivery systems containing antibodies are well known to those of skill in the art. Generally, such systems should utilize components which will not significantly impair the biological properties of the antibodies, such as the paratope binding capacity (see, for example, Remington's Pharmaceutical Sciences, &th edition, 1990, Mack Publishing). Those of skill in the art can readily determine the various parameters and conditions for producing antibody injectates or infusates without resort to undue experimentation. In some embodiments, compositions as described herein can be therapeutically delivered to a subject by way of intravenous administration.
[0173] Administration can be achieved by, e.g., topical administration, local infusion, injection, or by means of an implant. The implant can be of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. The implant can be configured for sustained or periodic release of the composition to the subject. See, e.g., U.S. Patent Application Publication No. 20080241223; U.S. Patent Nos. 5,501 ,856; 5,164,188; 4,863,457; and 3,710,795. The composition can be delivered to the subject by way of an implantable device based on, e.g., diffusive, erodible, or convective systems, e.g., osmotic pumps, biodegradable implants, electrodiffusion systems, electroosmosis systems, vapor pressure pumps, electrolytic pumps, effervescent pumps, piezoelectric pumps, erosion-based systems, or electromechanical systems.
[0174] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer’s dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, antioxidants, chelating agents, and the like.
[0175] Treating or treatment of any disease or disorder refers to ameliorating a disease or disorder that exists in a subject or a symptom thereof, in particular, ameliorating deficits in sociability resulting from the disorder. The term ameliorating refers to any therapeutically beneficial result in the treatment of a disease state, e.g., decreased or depressed sociability compared to the same level of sociability in a subject without the disorder or lessening in the severity or progression.
[0176] Thus, treating or treatment includes ameliorating at least one parameter or symptom, in particular a behavioral symptom such as sociability. Treating or treatment includes modulating the disease or disorder, either physically (e.g., stabilization of a discernible symptom) or physiologically (e.g., stabilization of a physical parameter) or both. Thus, in the disclosed methods, treatment can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of an established disease or condition or symptom of the disease or condition. For example, a method for improving sociability in a subject by administering a composition as described in this disclosure is considered to be a treatment or therapeutic, for example, if there is a 10% improvement in sociability according to the measured or observed parameter in a subject as compared to a control. Thus, the reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more (or any percent improvement in between 10% and 100%) as compared to native or control levels. It is understood that treatment does not necessarily refer to a cure or complete ablation of the disease, condition, or symptoms of the disease or condition.
[0177] Symptoms of aberrant or decreased sociability include, but are not limited to: Physical symptoms, psychological symptoms, and behavioral symptoms. Physical symptoms can include one or more of blushing, sweating, trembling, rapid heart rate, chest pain, nausea, dizziness, muscle tension, and tightened breathing. Psychological symptoms can include one or more of difficulty making eye contact, self-consciousness, fear of being judged negatively, fear of being embarrassed, humiliated, or rejected, and anxiety in anticipation of a feared activity or event. Behavioral symptoms can include avoidance of doing things or speaking to people out of fear of embarrassment, avoidance of situations where you might be the center of attention, and safety behaviors such as always using headphones when catching public transport or only attending social events if there is alcohol available.
[0178] As used herein, the term “therapeutically effective amount’’ or effective amount refers to an amount of a miRNA or miRNA mimic thereof that, when administered to a subject, is effective to treat a disease or disorder (or ameliorate a symptom thereof, for example, lack of sociability), e.g., a psychiatric disorder characterized as having symptomatic lack of sociability, such that the symptoms thereof are ameliorated. A therapeutically effective amount is not, however, a dosage so large as to cause adverse side effects. A suitable dose capable of ameliorating lack of sociability in a subject, can depend on a variety of factors including the particular construct used and whether it is used concomitantly with other therapeutic agents. Generally, a therapeutically effective amount may vary with the subject’s age, condition, and sex, as well as the extent of the disease in the subject and can be determined by one of skill in the art. Other factors can include, e.g., other medical disorders concurrently or previously affecting the subject, the general health of the subject, the genetic disposition of the subject, diet, time of administration, rate of excretion, drug combination, and any other additional therapeutics that are administered to the subject. It should also be understood that a specific dosage and treatment regimen for any particular subject also depends upon the judgment of the treating medical practitioner (e.g., doctor or nurse). A therapeutically effective amount is also one in which any toxic or detrimental effects of the composition are outweighed by the therapeutically beneficial effects. The dosage of the therapeutically effective amount may be adjusted by the individual physician or veterinarian in the event of any complication. In some instances, a therapeutically effective amount may vary from about 0.01 mg / kg to about 50 mg / kg, preferably from about 0.1 mg / kg to about 20 mg / kg, most preferably from about 0.2 mg / kg to about 2 mg / kg, in one or more dose administrations daily, for one or several days.
[0179] A pharmaceutical composition can include a therapeutically effective amount of one or more miRNAs or miRNA mimics described herein. Such effective amounts can be readily determined by one of ordinary skill in the art as described above. Considerations include the effect of the administered miRNAs or miRNA mimics, orthe combinatorial effect of the miRNAs or miRNA mimics with one or more additional active agents, if more than one agent is used in or with the pharmaceutical composition. In certain aspects, the doses can be about 1 , about 0.5, about 0.1 , about 0.05, or about 0.01 mg / kg, or any intervening dose between about 0.01 mg / kg and 1 mg / kg.
[0180] Suitable human doses of any of the miRNAs or miRNA mimics described herein can further be evaluated in, e.g., Phase I dose escalation studies. See, e.g., van Gurp et al. (2008) Am J Transplantation 8(8):171 1-1718; Hanouska et al. (2007) Clin Cancer Res 13(2, part 1):523-531 ; and Hetherington et al. (2006) Antimicrobial Agents and Chemotherapy 50(10): 3499-3500.
[0181] Toxicity and therapeutic efficacy of such miRNAs or miRNA mimics can be determined by known pharmaceutical procedures in cell cultures or experimental animals (e.g., animal models of any of the sociability disorders described herein). These procedures can be used, e.g., for determining the LD5o (the dose lethal to 50% of the population) and the ED5O (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, and it can be expressed as the ratio LD50 / ED50. A miRNA or miRNA mimic that exhibits a high therapeutic index is preferred. While constructs that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such constructs to the site of affected tissue and to minimize potential damage to normal cells and, thereby, reduce side effects.
[0182] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of a miRNA or miRNA mimic lies generally within a range of circulating concentrations of the miRNAs or miRNA mimics that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For miRNAs or miRNA mimics herein, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the EC50 ( / .e., the concentration of the construct - e.g., antibody - which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. In some embodiments, e.g., where local administration is desired, cell culture or animal models can be used to determine a dose required to achieve a therapeutically effective concentration within the local site.
[0183] In some embodiments, a composition or component of a composition described herein (i.e., one or more miRNAs or miRNA mimics, or any combination thereof) can be administered to a subject as a monotherapy. Alternatively, the composition or component of a composition described herein can be administered in conjunction with other therapies for the psychiatric disorder or symptoms thereof (combination therapy). For example, the composition can be administered to a subject at the same time, priorto, or after, a second therapy. In some embodiments, the composition or component of a composition described herein, and the one or more additional active agents are administered at the same time. Optionally, the composition or component of a composition described herein is administered first in time and the one or more additional active agents are administered second in time. In some embodiments, the one or more additional active agents are administered first in time and the miRNA / miRNA mimic composition or component of a composition described herein is administered second in time. Optionally, the composition or component of a composition described herein, and the one or more additional agents are administered simultaneously in the same or different routes.
[0184] A composition as described herein can replace or augment a previously or currently administered therapy, such as previously prescribed psychiatric therapeutic. Monitoring a subject (e.g., a human patient) for an improvement of sociability, as defined herein, means evaluating the subject for a change in a behavioral parameter exhibited by the subject by a clinician in a social setting or self-reporting by the patient. In some embodiments, the evaluation is performed at least one (1) hour, e.g., at least 2, 4, 6, 8, 12, 24, or 48 hours, or at least 1 day, 2 days, 4 days, 10 days, 13 days, 20 days or more, or at least 1 week, 2 weeks, 4 weeks, 10 weeks, 13 weeks, 20 weeks or more, after an administration. The subject can be evaluated in one or more of the following periods: prior to beginning of treatment; during the treatment; or after one or more elements of the treatment have been administered. Evaluation can include evaluating the need for further treatment, e.g., evaluating whether a dosage, frequency of administration, or duration of treatment should be altered. It can also include evaluating the need to add or drop a selected therapeutic modality.
[0185] In some instances, the one or more miRNA or one or more miRNA mimics can be administered via virus-like particles. Virus-like particles (VLPs) comprise viral protein(s) derived from the structural proteins of a virus. Methods for making and using virus like particles are described in, for example, Garcea and Gissmann, Current Opinion in Biotechnology 15:513-7 (2004).
[0186] In some instances, the one or more miRNA or one or more miRNA mimics can be administered by subviral dense bodies (DBs). DBs transport proteins into target cells by membrane fusion. Methods for making and using DBs are described in, for example, Pepperl- Klindworth et al., Gene Therapy 10:278-84 (2003).
[0187] In another aspect, provided is a method of improving sociability in a subject, the method comprising administering to the patient a vector comprising a nucleic acid sequence encoding a miRNA or miRNA mimic as described in this disclosure.
[0188] There are a number of compositions and methods which can be used to deliver the nucleic acid molecules to cells, either in vitro or in vivo via, for example, expression vectors. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non-viral based delivery systems. Such methods are well known in the art and readily adaptable for use with the compositions and methods described herein.
[0189] As used herein, plasmid or viral vectors are agents that transport the disclosed nucleic acids into the cell without undesired degradation and include a promoter yielding expression of the nucleic acid molecule and / or adapter polypeptide in the cells into which it is delivered. Viral vectors are, for example, Adenovirus, Adeno-associated virus, herpes virus, Vaccinia virus, Polio virus, Sindbis, and other RNA viruses, including these viruses with the HIV backbone. Also preferred are any viral families which share the properties of these viruses which make them suitable for use as vectors. Retroviral vectors, in general are described by Coffin et al., Retroviruses, Cold Spring Harbor Laboratory Press (1997), which is incorporated by reference herein for the vectors and methods of making them. The construction of replication-defective adenoviruses has been described (Berkner et al., J. Virology 61 :1213-20 (1987); Massie et al., Mol. Cell. Biol. 6:2872-83 (1986); Haj-Ahmad et al., J. Virology 57:267-74 (1986); Davidson et al., J. Virology 61 :1226-39 (1987); Zhang et al., BioTechniques 15:868-72 (1993)). The benefit and the use of these viruses as vectors is that they are limited in the extent to which they can spread to other cell types, since they can replicate within an initial infected cell, but are unable to form new infections viral particles. Recombinant adenoviruses have been shown to achieve high efficiency after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma, and a number of other tissue sites. Other useful systems include, for example, replicating and host- restricted non-replicating vaccinia virus vectors. In some instances, the nucleic acid molecules according to the present disclosure can be delivered via extracellular vesicles or virus-like particles.
[0190] Non-viral based delivery methods can include expression vectors comprising nucleic acid molecules and nucleic acid sequences encoding the miRNAs or miRNA mimics, wherein the nucleic acids are operably linked to an expression control sequence. Suitable vector backbones include, for example, those routinely used in the art such as plasmids, artificial chromosomes, BACs, YACs, or PACs. Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, Wl), Clonetech (Pal Alto, CA), Stratagene (La Jolla, CA), and Invitrogen / Life Technologies (Carlsbad, CA). Vectors typically contain one or more regulatory regions. Regulatory regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5’ and 3’ untranslated regions (UTRs), transcriptional start sites, termination sequences, polyadenylation sequences, and introns.
[0191] Preferred promoters controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis B virus, and most preferably cytomegalovirus (CMV), or from heterologous mammalian promoters (e.g., 0-actin promoter or EF1 a promoter), or from hybrid or chimeric promoters (e.g., CMV promoter fused to the - actin promoter). Of course, promoters from the host cell or related species are also useful herein.
[0192] Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5’ or 3’ to the transcription unit. Furthermore, enhancers can be within an intron as well as within the coding sequence itself. They are usually between 10 and 300 bp in length, and they function in cis. Enhancers usually function to increase transcription from nearby promoters. Enhancers can also contain response elements that mediate the regulation of transcription. While many enhancer sequences are known from mammalian genes (globin, elastase, albumin, fetoprotein, and insulin), typically one will use an enhancer from a eukaryotic cell virus for general expression. Preferred examples are the SV40 enhancer on the late side of the replication origin, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
[0193] The promoter and / or the enhancer can be inducible (e.g., chemically or physically regulated). A chemically regulated promoter and / or enhancer can, for example, be regulated by the presence of alcohol, tetracycline, a steroid, or a metal. A physically regulated promoter and / or enhancer can, for example, be regulated by environmental factors, such as temperature and light. Optionally, the promoter and / or enhancer region can act as a constitutive promoter and / or enhancer to maximize the expression of the region of the transcription unit to be transcribed. In certain vectors, the promoter and / or enhancer region can be active in a cell type specific manner. Optionally, in certain vectors, the promoter and / or enhancer region can be active in all eukaryotic cells, independent of cell type. Preferred promoters of this type are the CMV promoter, the SV40 promoter, the beta-actin promoter, the EF1 a promoter, and the retroviral long terminal repeat (LTR).
[0194] The vectors also can include, for example, origins of replication and / or markers. A marker gene can confer a selectable phenotype, e.g., antibiotic resistance, on a cell. The marker product is used to determine if the vector has been delivered to the cell and once delivered is being expressed. Examples of selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hygromycin, puromycin, and blasticidin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure. Examples of other markers include, for example, the E. coli lacZ gene, green fluorescent protein (GFP), and luciferase. In addition, an expression vector can include a tag sequence designed to facilitate manipulation or detection (e.g., purification or localization) of the expressed polypeptide. Tag sequences, such as GFP, glutathione S- transferase (GST), polyhistidine, c-myc, hemagglutinin, or FLAG™ tag (Kodak; New Haven, CT) sequences typically are expressed as a fusion with the encoded polypeptide. Such tags can be inserted anywhere within the polypeptide including at either the carboxyl or amino terminus.
[0195] In certain embodiments, the effective amount of a pharmaceutical composition comprising one or more miRNAs, miRNA mimics, or any combination thereof of the present disclosure to be employed therapeutically depends, for example, upon the therapeutic context and objectives. One skilled in the art will appreciate that the appropriate dosage levels for treatment, according to certain embodiments, vary depending, in part, upon the molecule delivered, the indication for which one or more miRNAs, miRNA mimics, or any combination thereof is being used, the route of administration, and the size (body weight, body surface or organ size) and / or condition (the age and general health) of the patient. The clinician can titer the dosage and modify the route of administration to obtain the optimal therapeutic effect.
[0196] The clinician also selects the frequency of dosing, taking into account the pharmacokinetic parameters of the active components in the formulation used. Such pharmacokinetic parameters are well known in the art, i.e., the rate of absorption, bioavailability, metabolism, clearance, and the like (see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol. 58:61 1-617; Groning (1996) Pharmazie 51 :337-341 ; Fotherby (1996) Contraception 54:59-69; Johnson (1995) J. Pharm. Sci. 84:1144-1146; Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin. Pharmacol. 24:103-108; the latest Remington's, supra). In certain embodiments, a clinician administers the composition until a dosage is reached that achieves the desired effect. In certain embodiments, the composition can therefore be administered as a single dose or as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infusion via, for example, an implantation device or catheter. Further refinement of the appropriate dosage is routinely made by those of ordinary skill in the art and is within the ambit of tasks routinely performed by them. In certain embodiments, appropriate dosages can be ascertained through use of appropriate dose-response data.
[0197] In some cases, the dosage (of the active components] or compositions as described herein) ranges from about 0.0001 to 100 mg / kg, and more usually 0.01 to 20 mg / kg, of the patient’s body weight. For example, dosages can be 0.3 mg / kg body weight, 1 mg / kg body weight, 3 mg / kg body weight, 5 mg / kg body weight, 10 mg / kg body weight or within the range of 0.1-20 mg / kg. In certain examples, the compositions thereof can be administered at a dose of 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, or 5 mg / kg once every other day at least four times. An exemplary treatment regime may include administration once per day, once per week, twice a week, once every two weeks, once every three weeks, once every four weeks, once a month, once every 3 months, or once every three to 6 months. In some cases, the treatment comprises administering a composition according to one of the aforementioned dosing regimens for a first period and another of the aforementioned dosing regimens for a second period. In some cases, the treatment discontinues for a period of time before the same or a different dosing regimen resumes. For example, a patient may be on a dosing regimen for two weeks, off for a week, on for another two weeks, and so on. Dosage regimens for compositions of this disclosure include 0. 1 mg / kg body weight, 0.3 mg / kg body weight, 2 mg / kg body weight, 3 mg / kg body weight, or 10 mg / kg via intravenous administration, with the compositions being given using one of the following dosing schedules: (i) every four weeks for six dosages, then every three months; (ii) every three weeks; (iii) 3 mg / kg body weight once followed by 1 mg / kg body weight every three weeks. In certain embodiments, the route of administration of the pharmaceutical composition is in accord with known methods, e.g., orally, through injection by intravenous, intraperitoneal, intracerebral (intra-parenchymal), intracerebral, intraventricular, intramuscular, subcutaneously, intra-ocular, intraarterial, intraportal, or intralesional routes; by sustained release systems or by implantation devices. In certain embodiments, the compositions can be administered by bolus injection or continuously by infusion, or by implantation device. In certain embodiments, individual elements of a combination therapy may be administered by different routes.
[0198] In certain aspects, compositions according to the present disclosure can be administered as a co-therapy with other therapeutic agents. Other examples of therapeutic agents include other psychiatric therapeutics, for example and without intending to be limiting, typical or atypical anti-psychotic medication.
[0199] While embodiments of the present disclosure are described in connection with the Examples and the corresponding text and figures, there is no intent to limit the disclosure to the embodiments in these descriptions. On the contrary, the intent is to cover all alternatives, modifications, and equivalents included within the spirit and scope of embodiments of the present disclosure.
[0200] Other features, objects, and advantages of the present invention are apparent in the description that follows. It should be understood, however, that the description, while exemplifying certain embodiments of the present invention, is given by way of illustration only, not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the detailed description.
[0201] V. EXAMPLES
[0202] Now having described the embodiments of the disclosure, in general, the examples describe some additional embodiments. While embodiments of the present disclosure are described in connection with the example and the corresponding text and figures, there is no intent to limit embodiments of the disclosure to these descriptions. On the contrary, the intent is to cover all alternatives, modifications, and equivalents included within the spirit and scope of embodiments of the present disclosure.
[0203] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to perform the methods and use the compositions and compounds disclosed and claimed herein. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C, and pressure is in atmosphere. Standard temperature and pressure are defined as 25 °C and 1 atmosphere. EXAMPLE 1 :
[0204] Blood transfusion ameliorates sociability deficits in immunodeficient Ragl1' mice.
[0205] Previous studies reported that immunodeficient scid and Rag1- mice, lacking T and B cells, showed sociability deficits in the three-chamber social interaction test5 11. Consistent with these findings, it was found Ragl '- mice, another immunodeficient mouse line, exhibited sociability deficits in the three-chamber social interaction test (FIGs. 1A, 1 B). These mice showed no abnormalities in the olfaction test or open field exploration (FIGs. 8A, 8B). The behavioral phenotypes were also due to the lack of T and B cells, as Rag1 proteins were not expressed in the brain, even during the prenatal and early postnatal periods (FIGs. 8C, 8D). Adoptive transfer of splenocytes or T cells from wild-type (WT) mice ameliorated the sociability deficits of Ragl1- mice (FIGs. 1C, 1D, and FIGs. 9A, 9B). Notably, the transfer of sera from WT mice also ameliorated the sociability deficits of Ragl1- mice (FIG. 1 E). We speculated that the components in WT mouse sera mediated the effects because the sera from Ragl1- mice did not exhibit a similar effect. Although IFN-y and IL-17 were shown to modulate sociability behaviors5 7, the levels of IFN-y and L-17 in WT mouse sera were very low (mostly below the detection limit in enzyme-linked immunosorbent assay) (FIG. 9C), suggesting that these cytokines may not necessarily play a major role in modulating social behaviors. Therefore, we explored additional components in WT mouse sera that can modulate social behaviors.
[0206] EXAMPLE 2:
[0207] T cell-dependent rescue of sociability deficits in Ragl1' mice was associated with changes in EV-associated miRNAs in the blood.
[0208] An increasing number of studies show that cells communicate with each other via extracellular vesicles (EVs). EVs are small membrane vesicles secreted by multiple cell types in the body under both physiological and pathological conditions12 13. EVs contain various cellular components, including RNAs, proteins, lipids, and carbohydrates, and transfer these components between cells in a paracrine and endocrine manner12 17. EVs are readily detected in various body fluids, including the blood. Indeed, previous studies reported that EVs in the circulating blood reached other tissues, such as the brain and liver1820. Thus, we collected blood fractions enriched with EV fractions (hereafter bEVs) from the sera of WT and Ragl1- mice. Although the morphology, size distribution, and concentration of bEVs were comparable between WT and Ragl1- mice, we noted that the expression of CD9, one of the exosome markers, was reduced in Ragl1' bEVs (FIGs. 1 F-1 H and FIGs. 10A-10D). We also observed that CD3+EVs, EVs plausibly derived from T cells, were diminished in Ragl1- mice (FIG. 1H). WT T cell transfer, which attenuated sociability deficits (FIG. 1 D), restored CD3+bEV levels in Ragl '- mice (FIG. 11) and also modified the expression of bEV-associated miRNAs in Rag1 '- mice (FIG. 1 J and Supplementary Table 1). Notably, these miRNAs significantly overlapped with those altered in various mouse models exhibiting sociability deficits (FIG. 1K). In addition, the potential target genes of these miRNAs were enriched with those involved in the regulation of neurons and synapses in particular (FIG. 1 L and Supplementary Table 3-4). These findings suggest that circulating EVs and EV-associated miRNAs in the blood may affect social behaviors.
[0209] EXAMPLE 3:
[0210] Blood EV transfer ameliorated sociability deficits without affecting social novelty recognition deficits.
[0211] To examine the direct impacts of circulating EVs on social behaviors, we intravenously injected WT bEVs into Ragl '- mice (FIG. 2A). Although the injection did not change the numbers of peripheral T or B cells (FIG. 11), WT bEVs ameliorated sociability deficits in Rag1-Amice (FIG. 2B, and FIG. 12A). Notably, injection of WT bEVs also enhanced sociability in Cntnap2f- and ShankS1- mice, two representative mouse models with sociability deficits (FIG. 2C, 2D). In contrast, injection of WT bEVs did not enhance sociability in WT mice (FIG. 2E), excluding the possibility that a mere increase in blood circulating EVs may enhance sociability. Ragl1- mice also showed deficits in social novelty preference in the three-chamber social interaction test (FIG. 2F, 2G). We thus examined the effects of WT bEVs injection on social novelty preference deficits of Ragl1- mice. Notably, WT EVs did not ameliorate social novelty preference deficits in Ragl1' mice (FIG. 2H and FIG. 12B), indicating a selective effect of WT EVs on neuronal functions relevant to sociability. Social novelty preference deficits in Rag1 '- mice were also not rescued by the transfer of either WT sera, splenocytes, or T cells (FIG. 12C, 12D). Thus, our findings demonstrated that WT bEVs enhanced sociability, but not social novelty preference behaviors, in Ragl '- mice.
[0212] EXAMPLE 4:
[0213] Circulating bEVs reached the brain parenchyma and co-localized with neurons and microglia in Ragl'1' mice.
[0214] To gain insight into the underlying mechanisms of sociability rescue, we examined the distribution of chemically and genetically labeled bEVs in the brain upon systemic injections. We first labeled WT bEVs with a lipophilic dye, PKH26, and intravenously injected them into Ragl1- mice to monitor their distribution. As early as 1 hour after injection, labeled bEVs were detected throughout the brain, including the medial prefrontal cortex (mPFC), the hippocampus, and the cerebellum (FIGs. 3A, 3B). As lipid dye labeling may be promiscuous and generate non-EV micelles17, we further examined the biodistribution using bEVs collected from the mice expressing a membrane-anchored tdTomato protein (mTmG mice)21. Similar to the distribution patterns of PKH26-labeled bEVs, tdTomato-positive bEVs were detected in the mPFC of Ragl1- mice (FIG. 30). Among brain cell subpopulations, WT-bEVs co-localized mostly with neurons and microglia (FIG. 3D, 3E and FIGs. 13A, 13B).
[0215] EXAMPLE 5:
[0216] WT bEVs attenuate hyperexcitability in the prefrontal cortex underlying sociability deficits of Ragl1' mice.
[0217] The mPFC plays a crucial role in the control of sociability behaviors22‘25; hence we determined the involvement of the mPFC in sociability deficits and the EV-mediated rescue in RagT'- mice. We first examined c-Fos immunoreactivity, an indicator of neuronal activity, to determine the influence of gene expression on neuronal activities in the mPFC. c-Fos expression in the mPFC was increased in Ragl '- mice, mostly in CaMKIIa+excitatory neurons, compared to WT mice (FIGs. 4A-4C, and FIG. 14). To address the causal role of these increased activities of mPFC excitatory neurons in sociability deficits in Ragl1- mice, we then conducted chemogenetic manipulations of CaMKIIa+neurons in the mPFC using an inhibitory DREADD (designer receptors exclusively activated by designer drugs) receptor, hM4D(Gi)26. Expression of hM4D(Gi) via adeno-associated virus (AAV) vectors [AAV-CaMKIIa-hM4D(Gi)- mCherry] in the mPFC of Ragl1- mice ameliorated sociability deficits in Ragl1- mice upon the intravenous injection of a DREADD agonist, clozapine A / -oxide (CNO) (FIG. 4D, and FIGs. 15A-15D). Notably, intravenous injection of WT-bEVs attenuated c-Fos immunoreactivity in the mPFC of Ragl1- mice (FIGs. 4E, 4F). These data suggest that WT-bEVs ameliorate sociability deficits in Ragl1- mice by targeting excitatory- inhibitory imbalance in the mPFC. EXAMPLE 6:
[0218] WT bEVs modulated synaptic gene expression and activities in the mPFC of Ragl1' mice.
[0219] To understand the molecular mechanisms of EV-mediated modulation of mPFC neuronal activities, we conducted RNA-seq analysis to examine the gene expression changes in the mPFC of Ragl1- mice following intravenous injection of WT bEVs. We also compared the mPFC gene expression patterns between WT and Ragl '- mice. The RNA-seq data revealed that WT bEV injection altered the expression of 2027 genes in the mPFC of Ragl1- mice (FIG. 5A and Supplementary Tables 5-8). By comparing to the list of 4772 genes that were differentially expressed in the mPFC of WT vs. Ragl '- mice, we identified 1280 genes whose expression was altered in the Ragl1- mPFC and restored upon WT bEV injection (FIG. 5A and Supplementary Tables 5-8). Consistent with our findings on altered neuronal activities in the Ragl1- mPFC, these genes were functionally related to the regulation of neurons and synapses (FIG. 5B and Supplementary Table 9). Interestingly, this potential link had already been revealed by the analysis of bEV-associated miRNAs that were modulated by the adoptive transfer of T cells in Ragl1- mice (FIG. 1L). These data suggest that WT bEVs may affect synaptic activities in the Ragl1- mPFC.
[0220] EXAMPLE 7:
[0221] We next used brain slice electrophysiology to record the synaptic activities in the mPFC. We found that the amplitudes of spontaneous inhibitory postsynaptic currents (sIPSCs) were significantly reduced in Ragl1- mice compared to WT mice (FIGs. 50, 5D). sIPSC frequencies showed a trending decrease but were not significantly reduced in Ragl1- mice. Surprisingly, no difference was found in spontaneous excitatory postsynaptic components between WT and Ragl1- mice (FIGs. 16A, 16B). Notably, incubation of Ragl1- brain slices with WT bEVs restored the levels of sIPSC amplitudes to those seen in WT brain slices (FIGs. 5C, 5D). These findings suggest that inhibitory postsynaptic signaling in the layer V pyramidal neurons of Ragl1- mPFC are impaired and restored by WT bEVs.
[0222] EXAMPLE 7:
[0223] Enhanced sociability in Ragl'1' mice by WT bEVs was associated with small RNAs. miRNAs associated with EVs have been shown to mediate intercellular communications even across distant organs14 19. Thus, we tested if WT bEVs modulate sociability and neuronal activities via miRNAs. We extracted small RNA factions from WT bEVs and loaded them onto Ragl1- bEVs as previously described27. These WT bEV-RNA containing Ragl '- bEVs (Ragl1- bEVs + WT RNA) were intravenously injected into Rag1 '- mice and their effects on sociability were compared with the Ragf '-bEV-RNA containing Ragl1bEVs (Ragl1bEVs + Ragl1RNA) and WT-bEV-RNA containing WT bEVs (WT bEVs + WT RNA, positive control). Compared to “Ragl '- bEVs + Ragl '- RNA” group, “Ragl '- bEVs + WT RNA” group showed increased sociability to the level of “WT bEVs + WT-RNA” group (FIGs. 17A, 17B). These findings show that small RNAs associated with WT bEVs enhance sociability in Ragl '- mice.
[0224] EXAMPLE 8:
[0225] Altered expression of bEV-associated miR-103-3p and miR-23a-3p and their predicted target, PKCE, in the mPFC of Ragl'1mice.
[0226] To identify the miRNA cargos by which blood EVs enhance sociability and modulate mPFC neuronal activities, we further analyzed our blood EV-associated miRNA-seq data (Fig. 1j and Supplementary Table 1) and PFC RNA-seq data (FIGs. 5A, 5B and Supplementary Tables 5-8) to determine the potential candidate pairs of bEV-associated miRNAs and their target mRNAs (FIG. 6A). We examined the list of 755 mRNAs whose expression in the PFC was higher in Ragl1- mice than WT mice and reduced by WT bEV injections (Supplementary Table 10). These mRNAs were the candidate targets of bEV-miRNAs whose expression decreased in Ragl '- mice. As WT bEVs enhanced inhibitory postsynaptic activities in the mPFC of Ragl1' mice, we searched the mRNAs whose expression may impact GABAergic synapse components and found seven mRNAs (FIG. 6A). We further compared these mRNAs with the extended list of putative mRNA targets of the 40 bEV-associated miRNAs whose expression is recovered by T cell transfer in Ragl1- mice (FIG. 1 J, Supplementary Table 11). We focused on the mRNAs whose overexpression can reduce sIPSC amplitudes. These filtering criteria identified Prkce, which encodes PKCe protein, as a plausible target. PKCE was previously shown to reduce GABA-mediated postsynaptic inhibitory currents via downregulation of postsynaptic GABA receptors in mice28. We indeed found the increased expression of PKCc at the protein level in the Ragl1- mPFC by immunohistochemistry (FIG. 6B). We also observed that two miRNAs predicted to target PKCs, miR-103-3p and miR-23a- 3p (FIG. 18A), were expressed in WT bEVs and significantly decreased in Ragl1- bEVs (Fig. 6c). Expression of miR-23a-3p in Shank?1- and Catnap1- bEVs was also significantly lower compared to WT bEVs (FIG. 18B). These findings suggest that WT bEV-associated miR-103- 3p and miR-23a-3p influence the mPFC neuronal activities by modulating PKCs expression and sIPSCs.
[0227] EXAMPLE 9: miR-103-3p and miR-23a-3p were associated with EVs. miRNAs associated with EVs are protected from degradation unless EVs are disrupted by detergent29 30. Thus, to determine whether miR-103-3p and miR-23a-3p were associated with EVs, we examined their sensitivities to degradation by RNase treatment29 30. Expression levels for miR-103-3p and miR-23a-3p dramatically decreased by RNase in the presence, but not in the absence, of detergent (1 % Triton-X100) (FIGs. 19A, 19B). These results suggest that most miR-103-3p and miR-23a-3p were located inside the EVs while some might be on the surface of EVs or associated with non-EV fractions.
[0228] EXAMPLE 10:
[0229] Intravenous injections of Ragl'1bEVs loaded with miR-103-3p and miR-23a-3p rescued the mPFC neuronal activities and sociability in Ragl-1' mice.
[0230] We finally tested if miR-103-3p and miR-23a-3p could correct the mPFC neuronal alterations and attenuate sociability deficits in Ragl1- mice. We loaded Ragl1- bEVs with miRNA mimics for miR-103-3p and miR-23a-3p (miR-23a-3p: AUCACAUUGCCAGGGAUUUCC (SEQ ID NO: 1) and miR-103-3p: AGCAGCAUUGUACAGGGCUAUGA (SEQ ID NO: 2)) and intravenously injected them into Ragl1- mice. Then, we assessed their effects on sociability in Ragl ' mice (FIG. 7A). We found that Ragl1- bEVs loaded with miR-103-3p and miR-23a-3p mimics significantly attenuated sociability deficits compared to Ragl1- bEVs loaded with non-targeting mimics (FIG. 7B). Attenuated sociability deficits were accompanied by reduced expression of neuronal c-Fos and PKCs in the mPFC (FIGs. 7C-7F). Injections of Ragl1- bEVs loaded with miR-103-3p and miR-23a-3p also increased the co-localization of GABAA receptor subunit (GABAARY2) to Gephyrin (FIGs. 7G, 7H), suggesting that miR-103-3p and miR-23a-3p disinhibit PKCE- dependent downregulation of synaptic GABAA receptors28. We also examined the effects of miR-103-3p and miR-23a-3p on synaptic activities of layer V pyramidal neurons in the mPFC of Ragl7mice using brain slice electrophysiology. Rag17bEVs loaded with miR-103-3p and miR-23a-3p significantly enhanced the levels of sIPSCs to those observed by WT bEV treatment, while Ragl1bEVs loaded with non-targeting miRNA mimic controls had no effects on sIPSCs (FIGs. 71, 7J). These findings support that miR-103-3p and miR-23a-3p associated with circulating EVs in the WT blood reach the mPFC and increase inhibitory postsynaptic signaling by reducing PKCe-dependent GABAA receptor internalization (FIG. 7K).
[0231] EXAMPLE 11 : miR-23a-3p in T cell-derived EVs contributes to sociability.
[0232] We examined the cellular origin of these miRNAs. Since T cell transfer into Ragl1- mice restored their levels in bEVs (FIG. 1 D), we tested whether T cells secrete EVs containing these miRNAs. T cells were purified from spleens, cultured, and EVs were collected from the conditioned medium (FIG. 20A). Notably, miR-23a-3p was enriched in T cell-derived EVs, while miR-103-3p level was below the detection limit (FIG. 20B and FIG. 21 A). Following intravenous injection into Ragl1- mice, these cultured T cell-derived EVs were detected in the mPFC and co-localized with neurons and microglia (FIGs. 20C, 20D, and FIG. 21 B), similar to the whole bEVs (FIG. 3) and in vivo generated T cell-derived EVs (FIGs. 21C-21F), supporting their physiological relevance.
[0233] To determine whether T cell-derived miR-23a-3p contributes to the effects of WT bEVs on sociability, we used Mir23a - mice84. Mir23a bEVs failed to restore sIPSC amplitudes in the PFC of Cntnap2 ' mice (FIGs. 22A, 22B), consistent with the role of miR-23a-3p in mPFC inhibitory neurotransmission (FIGs. 7I, 7J). We purified T cells from Mir23a / mice and compared their ability to rescue sociability deficits in Rag1Amice with that of WT T cells (FIG. 20E). Despite successful T cell reconstitution (FIGs. 20F, 20G), Rag1 mice receiving Mir23a~ T cells exhibited reduced levels of miR-23a-3p in bEVs (FIG. 20H), indicating that T cells are a major source of this miRNA in circulating EVs. Remarkably, adoptive transfer of Niir23a ' ^ cells failed to rescue sociability deficits in Rag1 mice (FIG. 20I). Together, these findings demonstrate that miR-23a-3p is secreted in EVs from T cells and contributes to sociability. EXAMPLE 12: Discussion
[0234] The above examples demonstrate that EV-associated miRNAs from the blood of socially normal mice can improve social preference in socially impaired mice. The focus on immunodeficient Ragl1- mice has led to the discovery that EVs can enter the brain parenchyma from the circulation and co-localize with neurons and microglia in the mPFC. At the molecular level, miR-103-3p and miR-23a-3p, two miRNAs enriched in socially normal WT bEVs and diminished in socially impaired Rag1 '- bEVs, have been shown to reduce the expression of their common target, PKCs, and restore postsynaptic inhibitory signaling on pyramidal neurons via increased synaptic localization of GABAARY2 in the mPFC of Rag1 '- mice. Experiments using Mir23a / mice have also shown that miR-23a-3p is required for postsynaptic inhibitory signaling in the mPFC and sociability. Thus, these data herein provide a mechanistic understanding of how miRNAs associated with the blood circulating EVs influence social behaviors and the therapeutic potentials of EVs and miRNAs in sociability deficits.
[0235] PKCs was previously shown to downregulate synaptic GABAA receptors via the N- ethylmaleimide-sensitive factor and reduce the amplitudes of postsynaptic inhibitory currents in the hippocampus28. Our study demonstrated that PKCe-dependent modulation of postsynaptic GABA signaling is also critical for the proper synaptic function in the mPFC, the dysregulation of which leads to hyperexcitability and sociability deficits. Our data further revealed that this modulation of postsynaptic activities on pyramidal neurons was regulated by EV-associated miRNAs, miR-23a-3p and miR-103-3p, from the circulation. Considering that EVs from the circulation were detected in the hippocampus and cerebellum, it was postulated that similar EV-miRNA-mediated modulation of postsynaptic GABA signaling exists across different brain regions. Previous studies reported that local protein translation controls the expression of GABAA receptors and some PKC isoforms31 33. In addition, miRNAs were shown to regulate GABAA receptor expression locally at dendrites31.
[0236] Our data also showed that blood EV transfer from socially normal mice did not improve social novelty recognition in Ragl1- mice while improving their sociability. Notably, the transfer of WT sera, splenocytes, and T cells also failed to improve social novelty recognition while they improved sociability in Rag1!- mice. Thus, the social novelty recognition deficits in Rag1- mice may not be secondary to sociability deficits and may be caused by another yet-unknown mechanism.
[0237] Previous studies reported the expression changes of miR-23a-3p and miR-103-3p in the body fluids of patients with autism spectrum disorders (ASD) and schizophrenia36 37, both of which disorders are accompanied by social behavioral deficits. The level of miR-23a-3p was decreased in patients with schizophrenia while increased in ASD patients. In addition, miR- 103-3p showed a decrease across multiple studies with ASD patients. One of these human studies also found that the predicted mRNA targets of miR-23a-3p were related to synaptic functions and ASD risk genes36, which is consistent with data herein.
[0238] Alterations of circulating EVs and their associated molecular cargos are detected in various brain disorders, such as psychiatric disorders and neurodegenerative diseases38 39. While blood EV alterations are useful as biomarkers, our research indicates that they may also play a crucial role in disease mechanisms involving periphery-brain communication. Importantly, our data demonstrate that the supplementation of EVs and miRNAs could restore sociability.
[0239] EXAMPLE 13: Materials and Methods for Examples 1-11
[0240] 1. Mice
[0241] Rag '- and mTmG mice (Stock# 002216 and 007676, backcrossed to C57BL / 6J background), and C57BL / 6J mice were purchased from the Jackson Laboratory and housed in specific pathogen-free facilities at the Johns Hopkins University and the University of Alabama at Birmingham. Male mice were used for the experiments at 8-12 weeks of age unless stated otherwise. All experimental procedures were performed under the animal protocols approved by the Institutional Animal Care and Use Committees.
[0242] 2. Behavioral assays
[0243] Behavioral assays were performed on male mice at 8-12 weeks of age. All the assays were conducted between 10 am and 3 pm during the light phase. Independent cohort of mice were tested in the three-chamber social interaction test, the open field test, and the buried food pellet test.
[0244] Three-chamber social interaction test: The three-chamber social interaction test was conducted as previously described40 41. All mice were tested in a nonautomated threechambered box. Dividing walls had retractable doorways allowing access into each chamber. Mice were acclimated to the three-chambered box for 4 days before the test (10 min / day). On the test day, mice were transported to the testing room and habituated for at least 1 h before the experiment. A white noise generator was used to mitigate any unforeseen noises. The subject mouse was habituated in the chamber with two empty cylinders for 10 min. Then, the “toy” object was placed in one of the cylinders and mouse (stranger 1) was placed in another cylinder for the “sociability” trial. Mice were allowed to explore the chambers for 10 min. In the next “social novelty preference” trial, stranger 1 was kept in the cylinder as the familiar mouse and the toy object was replaced with a novel mouse (stranger 2). The subject mouse was again allowed to explore the chambers. During these two trials, mouse activities were recorded on video and the time spent sniffing each cylinder was manually measured. Preference index was calculated as follows. For sociability test: (sniffing time to mouse) x 100 / (sniffing time to mouse + sniffing time to object) - 50. For social novelty preference test: (sniffing time to novel mouse) x 100 / (sniffing time to novel mouse + sniffing time to familiar mouse) - 50.
[0245] Buried food pellet test: Buried food pellet test was performed as previously described42. Mice were food deprived for 24 h with free access to water. At the test, single mouse was placed in the test cage and allowed to freely explore the food pellets buried ~0.5 cm below the surface of a 3 cm-deep layer of beddings. Latency to find the hidden food pellet were measured. (n=1 1-18 mice per group).
[0246] Open field test: Novelty-induced activity in the open field was assessed as described previously41 43. Locomotion, rearing, and center time were measured for 10 min using a Photobeam Activity System (PAS-Open Field, San Diego Instruments). The PAS system consisted of two vertically stacked frames, each containing infrared lasers arranged in a 16 x 16 grid, which detected mouse movement, including ambulation and rearing. The open field box and surrounding photobeam apparatus were housed in a ventilated cabinet. Single-beam breaks were automatically recorded as “counts” and the PAS system automatically started recording counts once the mouse started moving. The total counts were recorded and the percentages of center counts (defined as those in the central 27.5 x 27.5 cm area) to total counts were calculated.
[0247] 3. Serum and EV preparation
[0248] Blood (600-700 pl) was collected from mice via cardiac puncture under a deep anesthesia at time of sacrifice and placed at room temperature for 30 min. Sera were then separated by centrifugation at 300 x g for 5 min and stored at -80°C for biochemical / molecular experiments or freshly used for in vivo experiments. For EV preparation, the sera were further centrifuged with 2,000 x g 10 min to remove platelets. EVs were prepared with three different methods: precipitation, differential ultracentrifugation, and size exclusion chromatography. For EV precipitation, the sera were processed with Total Exosome Isolation kit (Thermo Fisher Scientific) following the manufacturer’s protocol and the EV-containing fraction was resuspended in 50 pL PBS. For EV enrichment with differential ultracentrifugation, the sera were centrifuged at 10,000 x g for 30 min at 4°C to remove large vesicles. Then, the sera were diluted with PBS at 1 :4 ratio and ultracentrifuged at 100,000 x g for 30 min at 4°C using Optima MAX-XP ultracentrifuge with a TLA 120.2 rotor (k factor = 1 1) (Beckman Coulter)44. The pellet was resuspended with 1 ml of PBS and ultracentrifuged at 100,000 x g for 30 min at 4°C to wash, and then resuspended with 10 pL of PBS. For EV enrichment with size exclusion chromatography, each serum sample was applied to a 70 nm qEVsingle size exclusion column (Izon) and eluted with DPBS. Fractions were collected using an Izon automated fraction collector: following elution of a 1-ml void fraction, 0.5 ml fractions were collected, of which fractions 6 to 8 were enriched in EVs. These fractions were pooled, concentrated using Amicon 15 Ultra RC 100 kD filters, and aliquoted and stored in LoBind tubes (Eppendorf) at - 80°C.
[0249] 4. Transmission Electron Microscopy
[0250] Freshly prepared EV samples were adsorbed onto carbon-coated / palladium grids for 1 min and negatively stained with 2% (w / v) uranyl acetate for 1 min. EVs were visualized under a FEI Tecnai Spirit T12 transmission electron microscope (Thermo Fisher Scientific / FEI). 5. Nano particle tracking assay (NTA)
[0251] Concentration and size distribution of particles in EV samples were analyzed with NanoSight NS300 (Malvern Panalytical) or ZetaView (Particle Metrix) following standard protocols45 46.
[0252] 6. Adoptive cell transfer, serum injection, and EV injection,
[0253] For adoptive cell transfer, splenocytes and T cells were collected from spleen. T cells were isolated using the Pan T cell isolation kit II, mouse (#130-095-130, Miltenyi Biotech). T cells were above 99%-positive for CD3E expression by flow cytometry. Splenocytes (1 x 108cells 100 pL per mouse) and T cells (1 x 107cells 100 pL per mouse) were transferred intravenously into Rag1 ‘ mice via retro-orbital injection following a standard protocol47. Sera (150 pL per mouse) and EVs (2 x 109particles in 100 pL per mouse unless stated otherwise) were also transferred intravenously into WT and Rag1 '- mice via retro-orbital injection. In methods as described herein, the number of EVs recovered from 500 pL total venous blood was about 4 x 109particles. Considering that the total blood volume of an adult mouse is 2 ml, the injection corresponds to about 12.5% volume of the total circulating EVs in the blood
[0254] 7. Western blot
[0255] EV and brain lysates were prepared with RIPA buffer, separated on NuPAGE Bis-Tris Mini Gel (Thermo Fisher Scientific / Life Technologies) with equal amounts of total proteins loaded into each lane, and transferred to PVDF membrane (Millipore). After blocking in 5% skim milk / PBS-0.1% Tween® 20 (PBS-T) for 1 h, the membrane was incubated with the primary antibody overnight at 4°C and then incubated with the HRP or fluorescent secondary antibodies for 1 h at room temperature. Chemiluminescence and fluorescence gel images were captured by ImageQuant LAS 4000 imager (GE Healthcare), Odyssey imaging system (Li-Cor Biosciences), and analyzed with ImageJ / Fiji software4. The following primary antibodies were used: rabbit anti-CD9 (1 :1 ,000, #ab92726, Abeam, RRID:_10561589), rabbit anti-Alix (1 :1 ,000, #ab186429, Abeam, RRID:_2754981), rabbit anti-Calnexin (1 :1 ,000, #ADI- SPA-860-D, Enzo Life Science, RRID:_1061834), mouse anti-CD3s (1 :1 ,000, #362701 , BioLegend, RRID: AB_2563713), armenian hamster anti-CD3c (1 :1 ,000, #100302, BioLegend, RRID: AB_312667), mouse anti-CD81 (1 :1 ,000, #sc-166029, Santa Cruz Biotechnology, RRID: AB_2275892), armenian hamster anti-mouse CD81 (1 :1 ,000, #sc- 18877, Santa Cruz Biotechnology, RRID: AB_627194), IRDye 680RD Donkey anti-mouse lgG(H + L) (1 :10,000, LI-COR Biosciences #926-68072, RRID: AB_10706161), IRDye 800CW Donkey anti-rabbit lgG(H+L) (1 :10,000, LI-COR Biosciences #926-32213, RRID: AB_621848), rabbit anti-Rag1 (1 :1 ,000, #sc-5599, Santa Cruz Biotechnology, RRID: AB_2300670), goat anti-Rag2 (1 :1 ,000, #sc-7623, Santa Cruz Biotechnology, RRID: AB_2175836), mouse anti-TNFa (1 :100, #ab1793, Abeam, RRID: AB_302615), and mouse anti-P-actin (1 :5,000, #sc-47778, Santa Cruz Biotechnology, RRID: AB_626632).. 8. Flow cytometry
[0256] Flow cytometry of splenocytes was performed using a standard protocol47. Single cell suspensions were obtained from spleens collected after PBS perfusion. After lysis of red blood cell with 1x RBC Lysis Buffer (Thermo Fisher Scientific / eBioscience), cells were washed with FACS buffer and Fc-blocked with anti-CD16 / CD32 (#14-0161-82, Thermo Fisher Scientific / eBioscience, RRID: AB_467133). Then, cells were stained with the following antibodies: rat anti-CD3 APC (1 :100, #100235 BioLegend, RRID: AB_2561455), rat antimouse CD19 PE (1 :100, #1 15508, BioLegend, RRID: AB_313643), rat anti- B220 Alexa Fluor 488 (1 :100, #103228, BioLegend, RRID: AB_492974). Flow cytometry was conducted using FACS Calibur, LSRII, or Accuri C6 cytometer (all from BD Biosciences) and analyzed with FlowJo software (FlowJo LLC).
[0257] 9. DREADD experiments
[0258] Mice were stereotactically injected with 400 nl of pAAV-CamKlla-hM4D(Gi)-mCherry (4.4x1012genomic copies / mL, #50477, Addgene) at the rate of 100 to 200 nl / min into the mPFC bilaterally using a NanoFil syringe with a 35G blunt needle (WPI). The following stereotactic coordinate was used for injection; anteroposterior (AP): +1.8mm; mediolateral (ML): ± 0.3mm; and dorsoventral (DV): -2.1 mm from the bregma. Three to four weeks later, behavioral assays were conducted. CNO (10 mg / kg in 0.5% DMSO / PBS, #BML-NS105-0025, Enzo Life Sciences) was intraperitoneally injected 45 min prior to the three-chamber social interaction test. For the three-chamber social interaction test, mice were intraperitoneally injected with PBS during acclimation for 4 consecutive days and then injected with CNO or vehicle (0.5% DMSO / PBS) on the test day as previously described48.
[0259] 10. Brain collection
[0260] Mice were anesthetized and transcardially perfused with ice-cold PBS. For RNA-seq experiments, brains were dissected and stored in -80 °C until use. For immunohistochemistry, mice were further perfused by 4% paraformaldehyde (PFA) and the dissected brains were fixed in ice-cold 4% PFA / PBS for 24 h.
[0261] 11. Immunohistochemistry
[0262] Immunohistochemistry experiments were conducted as previously described41 49. Free floating coronal sections (40 pm in thickness) were prepared with a Leica cryostat and, if necessary, antigen retrieval was performed with 10 mM sodium citrate buffer (pH8.5). The sections were then placed in blocking solution (PBS supplemented with 2% Normal Goat Serum, 1% BSA, 0.1 % TritonX, 0.05% Tween-20, and 0.05% sodium azide) for 1 h at room temperature and then incubated at 4°C overnight with the following primary antibodies: mouse anti-NeuN (1 :500, #MAB377, Merck-Millipore, RRID: AB_2298772), rabbit anti-lba1 (1 :400, #019-19741 , Wako Chemicals, RRID: AB_839504), goat anti-c-Fos (1 :500, #sc-52, Santa Cruz Biotechnology, RRID: AB_2106783), rabbit anti-c-Fos (1 :200, #9F6, Cell Signaling, RRID: AB_2247211 1), mouse anti-CaMKIla (1 :200, #688602, Clone 6G9, BioLegend, RRID: AB_2617027), rabbit anti-CaMKIla (1 :100, #20666, Proteintech, RRID:AB_2878722), rabbit anti-RFP (1 :1 ,000, #600-401-379, Rockland, RRID: AB_2209751), rabbit anti-PKCs (1 :100, #20877-1-AP, Proteintech, RRID:AB_10697812), mouse anti-CC1 (1 :100, #OP80, Calbiochem, RRID:AB_2057371), rabbit anti-S1 OO (1 :200, #ab868, Abeam,
[0263] RRID:AB_306716), mouse anti-NSE (1 :500, #66150, Proteintech, RRID:AB_2881546), mouse anti-Gephyrin (1 :100, #147021 , Synaptic Systems, RRID:AB_2232546), and rabbit anti-GABAARy2 (1 :100, #AGA-005, Alomone Labs). After washing with PBS, the sections were further incubated with fluorophore-conjugated secondary antibodies at 1 :400 dilution for 2 h at room temperature, followed by DAPI staining (1 :50,000, #10236276001 , Roche) for 10 min at room temperature, were used for signal detection. The sections were mounted on glass slides with Permafluor™ mounting medium or ProLong Diamond antifade mounting medium (Thermo Fisher Scientific). Images were acquired using Zeiss LSM510, 700 and 800 confocal microscopes with Zen software (Carl Zeiss) or an Olympus BX61 epifluorescence microscope (Olympus).
[0264] 12. EV labeling and brain distribution analysis
[0265] For chemical dye labeling of EVs, WT EVs were stained with PKH26 lipophilic dye (Sigma-Aldrich). Briefly, EVs were suspended with 194 pl of Diluent C, mixed with 6 pl of PKH26 dye, and incubated for 5 min at room temperature. The reaction was stopped by adding 100 pl of 20% BSA. Then, the EV suspensions were applied to the Exosome Spin Column (Thermo Fisher Scientific) and spun down to remove excess amount of the dye. Then stained EVs were diluted to 2 x 1010 / mL with DMEM medium (Thermo Fisher Scientific). For genetically labeling of EVs, EVs were collected from the sera of mT mG mice, in which plasma membrane of cells and cell-derived vesicles express membrane-anchored TdTomato. EVs (2 x 109particles / mouse) were intravenously injected into recipient mice. Brains were collected 1 h later and PKH26 and TdTomato puncta were analyzed by immunohistochemistry.
[0266] 13. Image analysis
[0267] Image analysis was performed as previously described.41c-Fos quantification was conducted using Image J / Fiji software50and the percentages of c-Fos-expressing cells among NeuN neurons were calculated. Images were taken at 20x and 40x magnification. The maximal projection images of z-stacked images (14 sections at 0.75 pm) were used for quantification with confocal. Three to five brain sections from each animal were chosen based on anatomic landmarks to ensure that equivalent regions were analyzed.
[0268] EV co-localization images with each cell type marker (NSE+, Iba1+, S100p+, and CC1+cells) were taken with 63x magnification. The maximal projection images of z-stacked images (14 sections at 0.34 pm) were used for quantification. The co-localization was defined when at least one EV puncta were overlapped with the cell marker staining. The percentages of EV- positive cells among all the cells for each cell type was quantified per visual field and averaged across 4-5 independent fields to calculate %EV-positive cells / total cells. For synaptic GABA receptor quantification, images were taken using a 63x magnification objective with 2x optical zoom. The maximal projection images of z-stacked images (14 sections at 0.34 pm) were used for quantification. Postsynaptic GABAARY2 was determined by the co-localized puncta of GABAARY2 and gephyrin on the soma of CaMKIla* neurons. The number of GABAARY2+gephyrin+puncta per CaMKIIcT neurons was counted and averaged across 5-6 CaMKIla* neurons per mouse.
[0269] 14. RNA-seq
[0270] Total RNAs were extracted from frontal cortices of mice transcardially perfused with ice-cold PBS using RNeasy micro kit (Qiagen). Libraries were prepared with NEB Next Ultra II Directional RNA Library Prep kit (New England BioLabs) and a 75-bp paired-end sequencing was performed on a NextSeq500 (Illumina) at the UAB Genomics Core. Raw RNA sequencing reads were aligned to the mouse reference genome (GRCm38 p6, Release M24) from Gencode with STAR (version 2.7.5c) (using parameters --outReadsUnmapped Fastx - outSAMtype BAM SortedByCoordinate --outSAMattributes All)51. Following alignment, HTSeq-count (version 0.12.3) was used to count the number of reads mapping to each gene (using parameters -r pos -t exon -i genejd -a 10 -s no -f bam)52. Normalization and differential expression were then applied to the count files using DESeq2 (version 1.28.1) following their vignette53. Lists of genes whose expression were significantly altered between Ragl1- mice and WT mice, and between Ragl1- mice with and without WT EVs obtained. P values were adjusted using the Benjamini-Hochberg false discovery rate (FDR) and significance was determined by adjusted p < 0.05. Then, genes whose expression changes were overlapped were extracted for the downstream analysis. Gene ontology (GO) enrichment analysis was performed using Metascape54, including biological process (BP), molecular function (MF) and cellular component (CC).
[0271] 15. miRNA-seq
[0272] Total RNAs containing small RNA fractions were extracted from EVs enriched with differential ultracentrifugation using miRNeasy mini kit (Qiagen). Libraries were prepared with Qiagen miRNA library prep kit (Qiagen) and a 75-bp single-end sequencing was performed on a NextSeq500 (Illumina) at the UAB Genomics Core. Raw miRNA-Seq FASTQ reads were uploaded to Qiagen’s GeneGlobe Data Analysis Center (https: / / geneglobe.qiagen.com / us / analyze / ) for analysis. Briefly, the reads were trimmed, UMI sequences identified, and then aligned to miRbase (ver21)55and the mouse mm10 genome. This created a tab-delimited file containing the count reads and UMIs assigned to each miRNA. The UMIs were then normalized, and differential expression was calculated using DESeq2. For miRNA overrepresentation analysis, we curated the previous publications (at least 2 publications for one mouse model) and established the altered miRNA lists of several mouse models with sociability impairment56 80. The lists of miRNAs were converted to ver21 with miRBaseConverter81. The enrichments of altered miRNAs were analyzed with Fisher’s exact test. P values from multiple testing were adjusted (q-value) using the Benjamini-Hochberg false discovery rate (FDR) with a significant level of 0.05. For pathway analysis of potential target genes of miRNAs, experimentally validated target genes of miRNAs were obtained with miRTarBase and TargetScan 8.082 83. GO enrichment analysis of miRNA target genes was performed using Metascape as described above.
[0273] 16. Brain slice electrophysiology
[0274] Adult mice were anesthetized through isoflurane inhalation and then decapitated. The brain was quickly removed and coronal mPFC slices of 300 pm were obtained using a Leica VT1200S vibratome. The dissection buffer used for the slicing was at pH 7.3 and 305 mOsm, containing the following (in mM): 206 sucrose, 25 NaHCO3, 2.5 KCI, 10 MgSO4, 1.45 NaH2PO4, 0.5 CaCI2, and 1 1 d-glucose). This buffer was kept oxygenated (5% CO2-95% O2) during the whole dissection. Slices were then transferred to a holding chamber containing artificial cerebrospinal fluid solution (aCSF), composed of the following (in mM): 126 NaCI, 26 NaHCO3, 2.5 KCI, 1.45 NaH2PO4, 1 MgCI2, 2 CaCI2, and 9 d-glucose. Slices were kept oxygenated at room temperature (22-25 °C) for at least 1 h. After this resting period, they were transferred to a submersion-type recording chamber upon a modified microscope stage and kept constantly perfused with oxygenated aCSF throughout the experiments. The temperature in the recording chamber was kept at 30 ± 1.5 °C using an inline heater (Warner Instruments). Recording electrodes pipettes were fabricated from borosilicate glass with input resistances of ~4-7 MQ. A visualized slice setup was used under a differential interference contrast-equipped microscope to perform our electrophysiology experiments. Whole-cell patch-clamp recordings were made in neurons visually located in layer 5 of the prelimbic region of the mPFC. Spontaneous postsynaptic currents were recorded in voltage-clamp mode by using the SutterPatch double IPA system and SutterPatch software. Holding at -70 mV was applied and compensated the electrode and cell capacitance. For all experiments, recordings were taken only 5 minutes after the whole-cell configuration was achieved, to allow cell adaptation. Currents were recorded for 5 minutes for all experiments. Only recordings from cells were included in which the access resistance did not change more than 20% during the recording and that displayed relatively stable baselines. Synaptic currents were detected and measured using SutterPatch software in-built system for analysis, and average amplitude e frequency of events for each cell was taken for statistical analysis. For sEPSC experiments, the GABAA antagonist bicuculline at 20 pM plus the NMDA antagonist D-APV at 50 M were added to the bath, to isolate AMPA currents. The intracellular solution used was K+based and contained the following (in mM): 1 17 K-gluconate, 10 HEPES, 2 Na2ATP, 0.4 Na2GTP, 1 MgCI2, 0.1 EGTA, 13 KCI, 0.07 CaCI2, at pH 7.3, and 290 mOsm. For sIPSC experiments, the AMPA antagonist DNQX at 20 pM plus the NMDA antagonist D-APV at 50 pM were added to the bath, to isolate GABAergic currents. The intracellular solution used was Cs based and contained the following (in mM): 140 CsCI, 10 HEPES, 2 Na2ATP, 0.4 Na2GTP, 1 MgCI2, 0.05 EGTA, 3.6 NaCI, at pH 7.3, and 290 mOsm. For the experiments where EVs were used, EVs were added directly to the bath at a concentration of 2 e107, and allowed the slices to incubate for at least one hour before starting the experiments. Recordings were taken while constantly perfused by this aCSF with the EVs added.
[0275] 17. RNase and detergent treatment of EVs
[0276] EVs were mixed with or without 1 pl RNaseA (ThermoFisfer, EN0531) and 10 pl Triton X-100 (Sigma, T2199) and messed up to 200 pl by PBS. All samples were then incubated at 37 °C for 30 min, followed by RNase heat inactivation at 95 °C for 10 min. After samples had cooled, RNAwas extracted using miRNEasy mini kit (Qiagen) according to the manufacturer’s protocol.
[0277] 18. Quantitative reverse-transcription PCR (qRT-PCR) of miRNAs
[0278] EV-derived RNA (30 ng) was used to synthesize cDNA using miRCURRY LNA RT kit (Qiagen). The cDNAs were then diluted at 1 :30 and qPCR was performed using 2x miRCURRY SYBR Green master mix (Qiagen) and miRCURY LNA miRNA PCR Assays (#339306, YP00204772 for miR-23a-3p and #339306, YP00204063 for miR-103-3p, Qiagen) with 95 °C for 2 min, 50 cycles of 95 °C for 10 s, and 56 °C for 60 s, on a C1000 Touch Thermal Cycler with CFX96 Real Time PCR Detection System (Bio-Rad). Cycle threshold (Ct) values were averaged across triplicates per experiment and per target. ACt was calculated to compare the data between groups.
[0279] 19. EV small RNA extraction and loading onto other EVs
[0280] Small RNAs were extracted from EVs using miRNEasy mini kit (#217004, Qiagen). The extracted RNAs (25 ng) were mixed with 2 x 109EV particles using Exo-Fect Exosome transfection kit. EVs loaded with small RNAs were then re-constituted with 100 pl of DMEM media and then transferred intravenously into recipient mice via retro-orbital injection.
[0281] 20. EV loading with miR-23a-3p and miR-103a-3p mimics miRNA mimic of 23a-3p (250 pmol, #339173 YM00470983-ADA, Qiagen) and 103a- 3p (250 pmol, ##339173 YM 00470828-ADA, Qiagen) or negative control (500 pmol, #339173 YM00479902-ADA, Qiagen) were mixed with 2 x 109EV particles using Exo-Fect Exosome transfection kit (#EXFT20A-1 , System Biosciences) according to the manufacturer’s instruction. EVs containing miRNAs or negative controls were re-constituted with 100 pl of Dulbecco’s Modified Eagle Medium (#11965-092, Gibco) and then injected intravenously into recipient mice.
[0282] 21. Primary T cell culture Mouse primary T cells were purified from spleens as Thy1.2+CD19_cells by FACS sorting with a BD FACSAria II and cultured following a standard protocol85. Briefly, purified T cells (1 x106cells / ml per well on 24-well plates) were stimulated with plate-bound anti-CD3e (1 pg / ml) and anti-CD28 (1 pg / ml) and cultured for 36 and 60 h in RPMI complete medium (RPMI, 10% FBS, 1 % non-essential amino acids, 1 % sodium pyruvate, 0.05 mM B- Mercaptoethanol, and 1 % Pen / Strep). Cell culture supernatants were collected, and EVs were collected by UC as described above.
[0283] 22. Statistical analysis
[0284] Data were analyzed with Student’s f test, and one-way ANOVA using GraphPad Prism 7 (GraphPad Software) and R. Post hoc analyses for one-way ANOVA were per- formed using
[0285] Sidak’s method, respectively. Significant differences were accepted at p < 0.05.
[0286] EXAMPLE 14: GO pathways related to GABAerqic neurons in 755 overlaps EXAMPLE 14: Example Clauses
[0287] Clause 1 : A composition for increasing sociability in a subject, comprising: one or more miR-103-3p’s, one or more miR-23a-3p’s, one or more miR-103-3p mimics, one or more miR-23a-3p mimics, or any combination of any thereof.
[0288] Clause 2: The composition of clause 1 , wherein the one or more miR-103-3p, one or more miR-23a-3p, one or more miR-103-3p mimics, or one or more miR-23a-3p mimics has at least 95% sequence identity with SEQ ID NO:1 , SEQ ID NO:2, or SEQ ID NO:15, individually or in any combination of any thereof.
[0289] Clause 3: The composition of clause 1 or 2, consisting essentially of: one or more miR-103-3p’s, one or more miR-23a-3p’s, one or more miR-103-3p mimics, one or more miR-23a-3p mimics, or any combination of any thereof.
[0290] Clause 4: The composition of any one of clauses 1 to 3, wherein the one or more miR-103- 3p, the one or more miR-23a-3p, the one or more miR-103-3p mimics, the one or more miR-23a-3p mimics, or the any combinations thereof is present within and / or associated with one or more extracellular vehicles (EVs).
[0291] Clause 5: The composition of clause 4, wherein the extracellular vesicles comprise blood- derived EVs.
[0292] Clause 6: The composition of any one of clauses 1 to 5, wherein the one or more miR-103- 3p, the one or more miR-23a-3p, the one or more miR-103-3p mimics, the one or more miR-23a-3p mimics, or the any combinations thereof is present in a therapeutically effective amount.
[0293] Clause 7: The composition of clause 5, wherein the therapeutically effective amount is an amount effective to increase sociability in a subject.
[0294] Clause 8: The composition of any one of clauses 1 to 7, wherein the subject is one having or suspected of having a disorder characterized by reduced or abnormal sociability compared to a subject without the disorder.
[0295] Clause 9:The composition of clause 8, wherein the disorder is one or more of an autism spectrum disorder, schizophrenia, a disorder affecting sociability, a psychiatric disorder, Williams syndrome (WS), Aspergers syndrome, an anxiety disorder, generalized anxiety disorder, major depressive disorder, dementia, Alzheimer’s disease, frontotemporal dementia, vascular dementia, substance abuse, alcohol abuse, or abuse of illicit drugs such as amphetamine.
[0296] Clause 10: The composition of any one of clauses 1 to 9, wherein the therapeutically effective amount is an amount effective to increase neuronal activity of a population of neurons in the pre-frontal cortex.
[0297] Clause 11 : The composition of clause 10, wherein the population of neurons comprise CaMKIIa+ excitatory neurons. Clause 12: The composition of clause 11 , wherein the population of neurons consists essentially of CaMKIIa+ excitatory neurons.
[0298] Clause 13: A pharmaceutical composition for improving sociability in a subject, comprising a composition according to any one of clauses 1 to 12; and a pharmaceutically acceptable carrier.
[0299] Clause 14: A kit for increasing sociability in a subject, comprising: a composition of any one of clauses 1 to 13 or a pharmaceutical composition of clause 12; and instructions for use.
[0300] Clause 15: The kit of clause 14, wherein the composition is lyophilized.
[0301] Clause 16: A method of increasing sociability in a subject, comprising: administering a composition of any one of clauses 1 to 15 or a pharmaceutical composition of clause 12 a subject in need thereof.
[0302] Clause 17: The method of clause 16, wherein the subject in need thereof has or is suspected of having a disorder affecting sociability.
[0303] Clause 18: The method of clause 16 or 17, wherein the disorder affecting sociability is one or more of an autism spectrum disorder, schizophrenia, a disorder affecting sociability, a psychiatric disorder, Williams syndrome (WS), Aspergers syndrome, an anxiety disorder, generalized anxiety disorder, major depressive disorder, dementia, Alzheimer’s disease, frontotemporal dementia, vascular dementia, substance abuse, alcohol abuse, or abuse of illicit drugs such as amphetamine.
[0304] Clause 19: A composition, comprising: a plurality of one or more extracellular vesicles (EVs), wherein each of the plurality comprises one or more miRNA or miRNA mimics of any one of clauses 1 to 13.
[0305] Clause 20: The composition of clause 19, wherein the extracellular vesicles comprise blood- derived EVs.
[0306] Clause 21 : The composition of any one of clauses 19 to 20, wherein the miR-103-3p, the miR- 23a-3p, the one or more miR-103-3p mimics, the one or more miR-23a-3p mimics, or the any combinations thereof is present in a therapeutically effective amount.
[0307] Clause 22: The composition of any one of clauses 19 to 21 , wherein the therapeutically effective amount is an amount effective to increase sociability in a subject. Clause 23: The composition of any one of clauses 19 to 22, wherein the subject is one having or suspected of having a disorder characterized by reduced or abnormal sociability compared to a subject without the disorder.
[0308] Clause 24: The composition of any one of clauses 19 to 23, wherein the disorder is one or more of an autism spectrum disorder, schizophrenia, a disorder affecting sociability, a psychiatric disorder, Williams syndrome (WS), Aspergers syndrome, an anxiety disorder, generalized anxiety disorder, major depressive disorder, dementia, Alzheimer’s disease, frontotemporal dementia, vascular dementia, substance abuse, alcohol abuse, or abuse of illicit drugs such as amphetamine.
[0309] References Related to the Present Disclosure:
[0310] 1. Villeda, S.A., et al. Young blood reverses age-related impairments in cognitive function and synaptic plasticity in mice. Nat Med 20, 659-663 (2014).
[0311] 2. Castellano, J.M., et al. Human umbilical cord plasma proteins revitalize hippocampal function in aged mice. Nature 544, 488-492 (2017).
[0312] 3. Cushman, J., Lo, J., Huang, Z., Wasserfall, C. & Petitto, J.M. Neurobehavioral changes resulting from recombinase activation gene 1 deletion. Clinical and diagnostic laboratory immunology O, 13-18 (2003).
[0313] 4. Derecki, N.C., et al. Regulation of learning and memory by meningeal immunity: a key role for IL-4. The Journal of experimental medicine 207, 1067-1080 (2010).
[0314] 5. Filiano, A.J., et al. Unexpected role of interferon-gamma in regulating neuronal connectivity and social behaviour. Nature 535, 425-429 (2016).
[0315] 6. Smith, C.J., et al. Probiotics normalize the gut-brain-microbiota axis in immunodeficient mice. Am J Physiol Gastrointest Liver Physiol 307, G793-802 (2014).
[0316] 7. Reed, M.D., et al. IL-17a promotes sociability in mouse models of neurodevelopmental disorders. Nature 577, 249-253 (2020).
[0317] 8. Kawamoto, S., et al. Foxp3(+) T cells regulate immunoglobulin a selection and facilitate diversification of bacterial species responsible for immune homeostasis. Immunity 41 , 152- 165 (2014).
[0318] 9. Miyajima, M., et al. Metabolic shift induced by systemic activation of T cells in PD-1- deficient mice perturbs brain monoamines and emotional behavior. Nat Immunol 18, 1342- 1352 (2017).
[0319] 10. de Candia, P., et al. The circulating microRNome demonstrates distinct lymphocyte subset-dependent signatures. Eur J Immunol 46, 725-731 (2016).
[0320] 11. Clark, S.M., Vaughn, C.N., Soroka, J.A., Li, X. & Tonelli, L.H. Neonatal adoptive transfer of lymphocytes rescues social behaviour during adolescence in immune-deficient mice. Eur J Neurosci 47, 968-978 (2018). 12. Yanez-Mo, M., et al. Biological properties of extracellular vesicles and their physiological functions. J Extracell Vesicles 4, 27066 (2015).
[0321] 13. van Niel, G., D'Angelo, G. & Raposo, G. Shedding light on the cell biology of extracellular vesicles. Nat Rev Mol Cell Biol 19, 213-228 (2018).
[0322] 14. Valadi, H., et al. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol 9, 654-659 (2007).
[0323] 15. Gross, J.C., Chaudhary, V., Bartscherer, K. & Boutros, M. Active Wnt proteins are secreted on exosomes. Nat Cell Biol 14, 1036-1045 (2012).
[0324] 16. O'Brien, K., Breyne, K., Ughetto, S., Laurent, L.C. & Breakefield, X.O. RNA delivery by extracellular vesicles in mammalian cells and its applications. Nat Rev Mol Cell Biol 21 , 585-606 (2020).
[0325] 17. Verweij, F.J., et al. The power of imaging to understand extracellular vesicle biology in vivo. Nat Methods 18, 1013-1026 (2021).
[0326] 18. Ridder, K., etal. Extracellular vesicle-mediated transfer of genetic information between the hematopoietic system and the brain in response to inflammation. PLoS Biol 12, e1001874 (2014).
[0327] 19. Thomou, T., et al. Adipose-derived circulating miRNAs regulate gene expression in other tissues. Nature 542, 450-455 (2017).
[0328] 20. Dickens, A.M., et al. Astrocyte-shed extracellular vesicles regulate the peripheral leukocyte response to inflammatory brain lesions. Sci Signal ed (2017).
[0329] 21 . Muzumdar, M.D., Tasic, B., Miyamichi, K., Li, L. & Luo, L. A global double-fluorescent Cre reporter mouse. Genesis 45, 593-605 (2007).
[0330] 22. Yizhar, O., et al. Neocortical excitation / inhibition balance in information processing and social dysfunction. Nature 477, 171-178 (2011). 3. Bicks, L.K., Koike, H., Akbarian, S. & Morishita, H. Prefrontal Cortex and Social Cognition in Mouse and Man. Front Psychol 6, 1805 (2015).
[0331] 24. Chen, P. & Hong, W. Neural Circuit Mechanisms of Social Behavior. Neuron 98, 16-30 (2018).
[0332] 25. Yizhar, O. & Levy, D.R. The social dilemma: prefrontal control of mammalian sociability. Curr Opin Neurobiol 68, 67-75 (2021).
[0333] 26. Roth, B.L. DREADDs for Neuroscientists. Neuron 89, 683-694 (2016).
[0334] 27. Castano, C., Mirasierra, M., Vallejo, M., Novials, A. & Parrizas, M. Delivery of muscle- derived exosomal miRNAs induced by HUT improves insulin sensitivity through downregulation of hepatic FoxOl in mice. Proceedings of the National Academy of Sciences of the United States of America 117, 30335-30343 (2020).
[0335] 28. Chou, W.H., et al. GABAA receptor trafficking is regulated by protein kinase C(epsilon) and the N-ethylmaleimide-sensitive factor. J Neurosci 30, 13955-13965 (2010). 29. Shurtleff, M.J., Temoche-Diaz, M.M., Karfilis, K.V., Ri, S. & Schekman, R. Y-box protein 1 is required to sort microRNAs into exosomes in cells and in a cell-free reaction. Elife 5 (2016).
[0336] 30. Barman, B., et al. VAP-A and its binding partner CERT drive biogenesis of RNA-containing extracellular vesicles at ER membrane contact sites. Dev Cell 57, 974-994 e978 (2022).
[0337] 31. Rajgor, D., et al. Local miRNA-Dependent Translational Control of GABA(A)R Synthesis during Inhibitory Long-Term Potentiation. Cell Rep 31, 107785 (2020).
[0338] 32. Osten, P., Valsamis, L., Harris, A. & Sacktor, T.C. Protein synthesis-dependent formation of protein kinase Mzeta in long-term potentiation. J Neurosci 16, 2444-2451 (1996).
[0339] 33. Glock, C., et al. The translatome of neuronal cell bodies, dendrites, and axons. Proc Natl Acad Sci U S A 118 (2021).
[0340] 34. Feuerer, M., etal. Lean, but not obese, fat is enriched for a unique population of regulatory T cells that affect metabolic parameters. Nat Med 15, 930-939 (2009).
[0341] 35. Burzyn, D., et al. A special population of regulatory T cells potentiates muscle repair. Cell 155, 1282-1295 (2013).
[0342] 36. Wu, Y.E., Parikshak, N.N., Belgard, T.G. & Geschwind, D.H. Genome-wide, integrative analysis implicates microRNA dysregulation in autism spectrum disorder. Nat Neurosci 19, 1463-1476 (2016).
[0343] 37. Jin, M., et al. Establishment of a schizophrenia classifier based on peripheral blood signatures and investigation of pathogenic miRNA-mRNA regulation. J Psychiatr Res 159, 172-184 (2023).
[0344] 38. Kano, S.I., Dohi, E. & Rose, I.V.L. Extracellular Vesicles for Research on Psychiatric Disorders. Schizophr Bull 45, 7-16 (2019).
[0345] 39. Vassileff, N., Cheng, L. & Hill, A.F. Extracellular vesicles - propagators of neuropathology and sources of potential biomarkers and therapeutics for neurodegenerative diseases. J Cell Sci 133 (2020).
[0346] 40. Moy, S.S., et al. Sociability and preference for social novelty in five inbred strains: an approach to assess autistic-like behavior in mice. Genes Brain Behav 3, 287-302 (2004).
[0347] 41. Dohi, E., et al. Behavioral Changes in Mice Lacking Interleukin-33. eNeuro 4 (2017).
[0348] 42. Yang, M. & Crawley, J.N. Simple behavioral assessment of mouse olfaction. Curr Protoc Neurosci Chapter 8, Unit 8 24 (2009).
[0349] 43. Niwa, M., et al. Knockdown of DISC1 by in utero gene transfer disturbs postnatal dopaminergic maturation in the frontal cortex and leads to adult behavioral deficits. Neuron 65, 480-489 (2010).
[0350] 44. Thery, C., et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J Extracell Vesicles 7, 1535750 (2018). 45. Sakamoto, S., et al. Alterations in circulating extracellular vesicles underlie social stress- induced behaviors in mice. FEBS Open Bio 11 , 2678-2692 (2021).
[0351] 46. Arab, T., et al. Characterization of extracellular vesicles and synthetic nanoparticles with four orthogonal single-particle analysis platforms. J Extracell Vesicles 10, e12079 (2021).
[0352] 47. Kano, S., et al. The contribution of transcription factor IRF1 to the interferon-gamma- interleukin 12 signaling axis and TH1 versus TH-17 differentiation of CD4+ T cells. Nat Immunol 9, 34-41 (2008).
[0353] 48. Bariselli, S., et al. Role of VTA dopamine neurons and neuroligin 3 in sociability traits related to nonfamiliar conspecific interaction. Nat Commun 9, 3173 (2018).
[0354] 49. Kano, S.I., et al. Glutathione S-transferases promote proinflammatory astrocyte-microglia communication during brain inflammation. Sci Signal 'll (2019).
[0355] 50. Schindelin, J., et al. Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676-682 (2012).
[0356] 51. Dobin, A., et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013).
[0357] 52. Anders, S., Pyl, P.T. & Huber, W. HTSeq-a Python framework to work with high- throughput sequencing data. Bioinformatics 31 , 166-169 (2015).
[0358] 53. Love, M.I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550 (2014).
[0359] 54. Zhou, Y., et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun 10, 1523 (2019).
[0360] 55. Kozomara, A. & Griffiths-Jones, S. miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res 42, D68-73 (2014).
[0361] 56. Urdinguio, R.G., et al. Disrupted microRNA expression caused by Mecp2 loss in a mouse model of Rett syndrome. Epigenetics 5, 656-663 (2010).
[0362] 57. Wu, H., et al. Genome-wide analysis reveals methyl-CpG-binding protein 2-dependent regulation of microRNAs in a mouse model of Rett syndrome. Proc Natl Acad Sci U S A 107, 18161-18166 (2010).
[0363] 58. Cheng, T.L., et al. MeCP2 suppresses nuclear microRNA processing and dendritic growth by regulating the DGCR8 / Drosha complex. Dev Cell 28, 547-560 (2014).
[0364] 59. Gao, Y., et al. Inhibition of miR-15a Promotes BDNF Expression and Rescues Dendritic Maturation Deficits in MeCP2-Deficient Neurons. Stem Cells 33, 1618-1629 (2015).
[0365] 60. Edbauer, D., et al. Regulation of synaptic structure and function by FMRP-associated microRNAs miR-125b and miR-132. Neuron 65, 373-384 (2010).
[0366] 61. Xu, X.L., et al. FXR1 P but not FMRP regulates the levels of mammalian brain-specific microRNA-9 and microRNA-124. J Neurosci 31 , 13705-13709 (2011). 62. Liu, T., et al. A MicroRNA Profile in Fmr1 Knockout Mice Reveals MicroRNA Expression Alterations with Possible Roles in Fragile X Syndrome. Mol Neurobiol 51 , 1053-1063 (2015).
[0367] 63. Zhang, M., et al. Identification of differentially expressed microRNAs and their target genes in the hippocampal tissues of Fmr1 knockout mice. Am J Transl Res 12, 813-824 (2020).
[0368] 64. Hara, Y., et al. Prenatal exposure to valproic acid increases miR-132 levels in the mouse embryonic brain. Mol Autism 8, 33 (2017).
[0369] 65. Ozkul, Y., et al. A heritable profile of six miRNAs in autistic patients and mouse models. Sei Rep 10, 9011 (2020).
[0370] 66. Kumari, A., Singh, P., Baghel, M.S. & Thakur, M.K. Social isolation mediated anxiety like behavior is associated with enhanced expression and regulation of BDNF in the female mouse brain. Physiol Behav 158, 34-42 (2016).
[0371] 67. Chang, C.H., Kuek, E.J.W., Su, C.L. & Gean, P.W. MicroRNA-206 Regulates Stress- Provoked Aggressive Behaviors in Post-weaning Social Isolation Mice. Mol Ther Nucleic Acids 20, 812-822 (2020).
[0372] 68. Popa, N., Boyer, F., Jaouen, F., Belzeaux, R. & Gascon, E. Social Isolation and Enrichment Induce Unique miRNA Signatures in the Prefrontal Cortex and Behavioral Changes in Mice. iScience 23, 101790 (2020).
[0373] 69. Haramati, S., et al. MicroRNA as repressors of stress-induced anxiety: the case of amygdalar miR-34. J Neurosci 31 , 14191-14203 (2011).
[0374] 70. Dias, C., et al. beta-catenin mediates stress resilience through Dicerl / microRNA regulation. Nature 516, 51-55 (2014).
[0375] 71 . Torres-Berrio, A., et al. DCC Confers Susceptibility to Depression-like Behaviors in Humans and Mice and Is Regulated by miR-218. Biol Psychiatry 81 , 306-315 (2017).
[0376] 72. Volk, N., et al. Amygdalar MicroRNA-15a Is Essential for Coping with Chronic Stress. Cell Rep 17, 1882-1891 (2016).
[0377] 73. Deng, Z.F., et al. miR-214-3p Targets beta-Catenin to Regulate Depressive-like Behaviors Induced by Chronic Social Defeat Stress in Mice. Cereb Cortex 29, 1509-1519 (2019).
[0378] 74. Du, K., Lu, W., Sun, Y., Feng, J. & Wang, J.H. mRNA and miRNA profiles in the nucleus accumbens are related to fear memory and anxiety induced by physical or psychological stress. J Psychiatr Res 118, 44-65 (2019).
[0379] 75. Khandelwal, N., Dey, S.K., Chakravarty, S. & Kumar, A. miR-30 Family miRNAs Mediate the Effect of Chronic Social Defeat Stress on Hippocampal Neurogenesis in Mouse Depression Model. Front Mol Neurosci 12, 188 (2019).
[0380] 76. Torres-Berrio, A., et al. miR-218 in Adolescence Predicts and Mediates Vulnerability to Stress. Biol Psychiatry 89, 911-919 (2021). 77. Miao. Z., etai. Presence of the pregnant partner regulates microRNA-30a and BDNF levels and protects male mice from social defeat-induced abnormal behaviors. Neuropharmacology 59, 107589 (2019).
[0381] 78. Pfau, M.L., etal. Role of Monocyte-Derived MicroRNA106b approximately 25 in Resilience to Social Stress. Biol Psychiatry 86, 474-482 (2019).
[0382] 79. Luo, P.X., et al. Sex-specific effects of social defeat stress on miRNA expression in the anterior BNST. Behav Brain Res 401 , 113084 (2021).
[0383] 80. Miao, Z., et al. Anxiety-Related Behaviours Associated with microRNA-206-3p and BDNF Expression in Pregnant Female Mice Following Psychological Social Stress. Mol Neurobiol 55, 1097-1111 (2018).
[0384] 81 . Xu, T., et al. miRBaseConverter: an R / Bioconductor package for converting and retrieving miRNA name, accession, sequence and family information in different versions of miRBase. BMC Bioinformatics 19, 514 (2018).
[0385] 82. Huang, H.Y., et al. miRTarBase 2020: updates to the experimentally validated microRNA- target interaction database. Nucleic Acids Res 48, D148-D154 (2020).
[0386] 83. Santovito, D., et al. Plasma microRNA signature associated with retinopathy in patients with type 2 diabetes. Sci Rep 11, 4136 (2021).
[0387] 84. Kurkewich, J.L., et al. The mirn23a microRNA cluster antagonizes B cell development. J Leukoc Biol 100, 665-677 (2016).
[0388] 85. Kano, S., et al. The contribution of transcription factor IRF1 to the interferon-gamma interleukin 12 signaling axis and TH1 versus TH-17 differentiation of CD4+ T cells. Nat Immunol 9, 34-41 (2008).
[0389] Informal Sequence Listing:
[0390] It should be emphasized that the above-described embodiments are merely examples of possible implementations. Many variations and modifications may be made to the abovedescribed embodiments without departing from the principles of the present disclosure. All such modifications and variations are intended to be included herein within the scope of this disclosure and protected by the following claims.
Claims
CLAIMSAt least the following is claimed:1) A method of increasing sociability in a subject, comprising: administering a composition to a subject in need thereof, wherein the composition comprises a miR-103-3p, a miR-23a-3p, one or more miR-103-3p mimics, one or more miR-23a-3p mimics, or any combination of any thereof.2) The method of claim 1 , wherein the composition consists essentially of: a miR-103-3p, a miR-23a-3p, one or more miR-103-3p mimics, one or more miR-23a- 3p mimics, or any combination of any thereof.3) The method of any one of claims 1 to 2, wherein the miR-103-3p, miR-23a-3p, one or more miR-103-3p mimics, or one or more miR-23a-3p mimics has at least 95% sequence identity with SEQ ID NO:1 , SEQ ID NO:2, or SEQ ID NO:15, individually or in any combination of any thereof.4) The method of any one of claims 1 to 3, wherein the miR-103-3p, the miR-23a-3p, the one or more miR-103-3p mimics, the one or more miR-23a-3p mimics, or the any combinations thereof is present within and / or associated with one or more extracellular vehicles (EVs).5) The method of any one of claims 1 to 4, wherein the extracellular vesicles comprise blood-derived EVs.6) The method of any one of claims 1 to 5, wherein the miR-103-3p, the miR-23a-3p, the one or more miR-103-3p mimics, the one or more miR-23a-3p mimics, or the any combinations thereof is present in a therapeutically effective amount.7) The method of claim 6, wherein the therapeutically effective amount is an amount effective to increase sociability in a subject.8) The method of any one of claims 1 to 7, wherein the subject is one having or suspected of having a disorder affecting socialability, wherein the disorder affecting socialability is characterized by reduced or abnormal sociability compared to a subject without the disorder.9) The method of any one of claims 1 to 8, wherein the disorder is one or more of an autism spectrum disorder, schizophrenia, a disorder affecting sociability, a psychiatric disorder, Williams syndrome (WS), Aspergers syndrome, an anxiety disorder, generalized anxiety disorder, major depressive disorder, dementia, Alzheimer’s disease, frontotemporal dementia, vascular dementia, substance abuse, alcohol abuse, or abuse of illicit drugs such as amphetamine.10) The method of any one of claims 1 to 9, wherein the therapeutically effective amount is an amount effective to increase neuronal activity of a population of neurons in the pre-frontal cortex.11) The method of claim 10, wherein the population of neurons comprises CaMKIIa+ excitatory neurons.12) The method of claim 10, wherein the population of neurons consists essentially of CaMKIIa+ excitatory neurons13) The method of any one of claims 1 to 12 wherein the composition further comprises a pharmaceutically-acceptable carrier.14) The method of any one of claims 1 to 13, wherein the disorder affecting sociability is one or more of an autism spectrum disorder, schizophrenia, a disorder affecting sociability, a psychiatric disorder, Williams syndrome (WS), Aspergers syndrome, an anxiety disorder, generalized anxiety disorder, major depressive disorder, dementia, Alzheimer’s disease, frontotemporal dementia, vascular dementia, substance abuse, alcohol abuse, or abuse of illicit drugs such as amphetamine.15) A composition, comprising: a plurality of one or more extracellular vesicles (EVs), wherein each of the plurality comprises one or more miRNA or miRNA mimics a miR-103-3p, a miR-23a-3p, one or more miR-103-3p mimics, one or more miR-23a-3p mimics, or any combination of any thereof.16) The composition of claim 15, wherein the EVs are loaded with an miRNA composition that consists essentially of a miR-103-3p, a miR-23a-3p, one or more miR-103-3p mimics, one or more miR-23a-3p mimics, or any combination of any thereof.17) The composition of claim 15 or 16, wherein the extracellular vesicles comprise blood- derived EVs.18) The composition of any one of claims 15 to 17, wherein the miR-103-3p, miR-23a-3p, one or more miR-103-3p mimics, or one or more miR-23a-3p mimics has at least 95% sequence identity with SEQ ID NO:1 , SEQ ID NO:2, or SEQ ID NO:15, individually or in any combination of any thereof.19) The composition of any one of claims 15 to 18, wherein the miR-103-3p, the miR-23a- 3p, the one or more miR-103-3p mimics, the one or more miR-23a-3p mimics, or the any combinations thereof is present in a therapeutically effective amount.20) The composition of any one of claims 15 to 19, wherein the therapeutically effective amount is an amount effective to increase sociability in a subject.21) The composition of any one of claims 15 to 20, wherein the subject is one having or suspected of having a disorder characterized by reduced or abnormal sociability compared to a subject without the disorder.22) The composition of any one of claims 15 to 21 , wherein the disorder is one or more of an autism spectrum disorder, schizophrenia, a disorder affecting sociability, a psychiatric disorder, Williams syndrome (WS), Aspergers syndrome, an anxiety disorder, generalized anxiety disorder, major depressive disorder, dementia, Alzheimer’s disease, frontotemporal dementia, vascular dementia, substance abuse, alcohol abuse, or abuse of illicit drugs such as amphetamine.23) The composition of any one of claims 15 to 22, wherein the therapeutically effective amount is an amount effective to increase neuronal activity of a population of neurons in the pre-frontal cortex.24) The composition of any one of claims 15 to 23, wherein the population of neurons comprise CaMKIIa+ excitatory neurons.25) The composition of any one of claims 15 to 24, wherein the population of neurons consists essentially of CaMKIIa+ excitatory neurons26) The composition of any one of claims 15 to 25, wherein the composition further comprises a pharmaceutically-acceptable carrier.27) A composition for increasing sociability in a subject, comprising: a miR-103-3p, a miR-23a-3p, one or more miR-103-3p mimics, one or more miR-23a- 3p mimics, or any combination of any thereof.28) The composition of claim 27, wherein the miR-103-3p, miR-23a-3p, one or more miR- 103-3p mimics, or one or more miR-23a-3p mimics has at least 95% sequence identity with SEQ ID NO:1 , SEQ ID NO:2, or SEQ ID NO:15, individually or in any combination of any thereof.29) The composition of claim 27 or 28, consisting essentially of: a miR-103-3p, a miR-23a-3p, one or more miR-103-3p mimics, one or more miR-23a- 3p mimics, or any combination of any thereof.30) The composition of any one of claims 27 to 29, wherein the miR-103-3p, the miR-23a- 3p, the one or more miR-103-3p mimics, the one or more miR-23a-3p mimics, or the any combinations thereof is present within and / or associated with one or more extracellular vehicles (EVs).31) The composition of claim 30, wherein the extracellular vesicles comprise blood-derived EVs.32) The composition of any one of claims 27 to 31 , wherein the miR-103-3p, the miR-23a- 3p, the one or more miR-103-3p mimics, the one or more miR-23a-3p mimics, or the any combinations thereof is present in a therapeutically effective amount.33) The composition of claim 32, wherein the therapeutically effective amount is an amount effective to increase sociability in a subject.34) The composition of any one of claims 27 to 33, wherein the subject is one having or suspected of having a disorder characterized by reduced or abnormal sociability compared to a subject without the disorder.35) The composition of claim 34, wherein the disorder is one or more of an autism spectrum disorder, schizophrenia, a disorder affecting sociability, a psychiatric disorder, Williams syndrome (WS), Aspergers syndrome, an anxiety disorder, generalized anxiety disorder, major depressive disorder, dementia, Alzheimer’s disease, frontotemporal dementia, vascular dementia, substance abuse, alcohol abuse, or abuse of illicit drugs such as amphetamine.36) The composition of any one of claims 27 to 35, wherein the therapeutically effective amount is an amount effective to increase neuronal activity of a population of neurons in the pre-frontal cortex.37) The composition of claim 36, wherein the population of neurons comprise CaMKIIa+ excitatory neurons.38) The composition of claim 36, wherein the population of neurons consists essentially of CaMKIIa+ excitatory neurons.39) A pharmaceutical composition for improving sociability in a subject, comprising a composition according to any one of claims 27 to 38; and a pharmaceutically acceptable carrier.40) A kit for increasing sociability in a subject, comprising: a composition of any one of claims 15 to 38 or a pharmaceutical composition of claim 39; and instructions for use.41) The kit of claim 40, wherein the composition is lyophilized.
Citation Information
Patent Citations
Anti-inflammaatory and Anti-viral composition based on placenta-derived extracellular vesicle
US20230107241A1
Extracellular Vesicles Engineered to Be Loaded with Distinct RNA Cargo for Improved Therapeutic Efficacy
US20230220423A1
Use of miR-23a-3p and / or miR-27a-3p mimics as therapeutic agents for inhibition of neuronal apoptosis following brain injury
US9434945B2