P53 targeting compounds and uses thereof

Abstract

Disclosed herein are compounds of Formula (I), a pharmaceutically acceptable salt thereof, pharmaceutical compositions thereof, and methods of treating cancer comprising administering a compound of Formula (I), a pharmaceutical salt thereof, or a pharmaceutical composition thereof.

Description

P53 TARGETING COMPOUNDS AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 676,014, filed July 26, 2024. The entire contents of the above-identified applications are hereby fully incorporated herein by reference.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under Grant Nos. CA197568, CA217848, and GM127045 awarded by the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0003] This application contains a sequence listing filed in electronic form as an xml file entitled BROD-6050WP_ST26.xml, created on July 25, 2025, and having a size of 6,206 bytes. The content of the sequence listing is incorporated herein in its entirety.TECHNICAL FIELD

[0004] The subject matter disclosed herein is generally directed to compounds of Formula (I), pharmaceutical compositions thereof, and methods of treating cancer, aging, or an aging-related disease comprising administering a compound of Formula (I) or a pharmaceutical composition thereof.BACKGROUND

[0005] Cancer is a leading cause of death in developed countries, with cases increasing as the population ages, encompassing over 200 diseases marked by uncontrolled cell growth. It is highly diverse, with tumor cells frequently showing genomic instability, elevated oncogene expression, and loss of tumor suppressor genes.

[0006] The p53 gene is a critical tumor suppressor, preventing cancer progression by responding to cellular stress and triggering cell cycle arrest, apoptosis, or senescence. However, the p53 pathway is impaired in nearly all cancers, with over 50% of cases involving p53 mutations. These mutations, mostly missense point mutations in the DNA-binding core domain (DBD) of p53, hinder its tumor-suppressing function, making mutant p53 (Mut-p53) an attractive target for new therapies.

[0007] Mutations in p53 often destabilize its structure, but some mutants can revert to a functional state at lower temperatures. Mutant p53 proteins accumulate in tumor cells due to their inability to regulate Mdm2, a protein that degrades p53, and due to constant stress signals in cancer cells.

[0008] Efforts to stabilize p53 include designing peptides like CDB3 and small molecules like CP-31398, PRIMA-1, and MIRA-1, which show potential in restoring its function. However, these methods have limitations, and more effective treatments are still needed.

[0009] Despite progress, agents are still needed to treat cancers with p53 mutations.

[0010] Citation or identification of any document in this application is not an admission that such a document is available as prior art to the disclosure.SUMMARY

[0011] In some aspects, the techniques described herein relate to a compound of Formula (I): M-L-T (I) or a pharmaceutically acceptable salt thereof, wherein: M is a ligand that binds p53; T is a ligand that binds a target protein; and L is a linker.

[0012] In an embodiment, M is a ligand that binds mutant p53. In an embodiment, the mutant p53 is p53 Y220C. In an embodiment, T binds a target protein whose function is essential for proliferation of a cell. In an embodiment, the cell is a cancer cell. In an embodiment, T binds a target protein selected from BRD4, BUB1, BUB1B, CDC7, CDK1, CDK2, CDK4, CDK6, CDK7, CDK9, PLK1, PLK4, WEE1, and XPO1. In an embodiment, T binds PLK1.

[0013] In an embodiment, M is a compound of Formula (II):wherein Ri is H, substituted or unsubstituted alkyl, or substituted or unsubstituted alkenyl, -C(0)R4, or -SO2R5; R2 is H, halo, substituted or unsubstituted alkyl, or substituted or unsubstituted haloalkyl; R3 is halo, -NO, -CN, -S(O)2Re, -C(O)NR?, or -CORs; R4 and R5 are each independently selected from substituted or unsubstituted alkyl, haloalkyl, and substituted or unsubstituted alkenyl; R<; and R7 are each independently substituted or unsubstituted alkyl; and Rs is H or substituted or unsubstituted alkyl;is the attachment point of M to L.

[0014] In an embodiment, M is a compound of Formula (IIA):

[0015] In an embodiment, M is a compound of Formula (IIB):

[0016] In an embodiment, Ri is substituted or unsubstituted lower alkyl. In an embodiment, Ri is substituted lower alkyl. In an embodiment, Ri is substituted with a haloalkyl group. In an embodiment, Ri is substituted with CF3. In an embodiment, Ri is CH2CF3. In an embodiment, Ri is substituted with epoxy. In an embodiment, Ri is substituted or unsubstituted lower alkenyl. In an embodiment, Ri is unsubstituted lower alkenyl. In an embodiment, Ri is -CHCH2. In an embodiment, Ri is -SO2R9, wherein R9 is substituted or unsubstituted lower haloalkyl. In an embodiment, R9 is unsubstituted lower haloalkyl. In an embodiment, R9 is halomethyl. In an embodiment, Ri is -SO2R10, wherein Rio is substituted or unsubstituted alkenyl. In an embodiment, Rio is substituted lower alkenyl. In an embodiment, Rio is -CHCH2.

[0017] In an embodiment, Ri is -C(O)R4, wherein R4 is substituted or unsubstituted lower alkenyl. In an embodiment, R4 is unsubstituted lower alkenyl. In an embodiment, R4 is -CHCH2. In an embodiment, Ri is -C(O)Rn, wherein Rn is substituted or unsubstituted lower alkyl. In an embodiment, Rn is unsubstituted lower alkyl. In an embodiment, Rn is methyl. In an embodiment, Ri is -C(O)Rn, wherein Rn is substituted or unsubstituted lower haloalkyl. In an embodiment, Rn is unsubstituted lower haloalkyl. In an embodiment, Rn is halomethyl.

[0018] In an embodiment, T is a compound of Formula (III):wherein is the attachment point of T to L.

[0019] In an embodiment, T is a compound of Formula (IV):wherein is the attachment point of T to L.

[0020] In an embodiment, L is a length of about 4.33A to about 22.22A.

[0021] In an embodiment, L is a compound of Formula (V):wherein X is C=O or CH2; Y is C=O or CH2; n is 0-15; and '' is the attachment point of X and Y to M and T.

[0022] In an embodiment, L is a compound of Formula (VI):wherein X is C=O or CH2; Y is C=O or CH2; m is 0-15; n is 0-15; o is 0-15;the attachment point of X and Y to M and T.

[0023] In an embodiment, L is a compound of Formula (VII):% wherein X is C O or CH2; Y is C=O or CH2; m is 0-15; n is 0-15; and » is the attachment point of X and Y to M and T.

[0024] In an embodiment, L is a compound of Formula (VIII):the attachment point

[0025] In some aspects, the techniques described herein relate to a compound that isor a pharmaceutically acceptable salt thereof.

[0026] In some aspects, the techniques described herein relate to a pharmaceutical composition including any compound described herein and a pharmaceutically acceptable carrier. In an embodiment, the pharmaceutical composition further includes one or more additional anticancer agents.

[0027] In some aspects, the techniques described herein relate to a method of treating cancer comprising administering an effective amount of the compound of any of those described herein or the pharmaceutical composition of any of those described herein to a subject. In an embodiment, the cancer is associated with p53 overexpression. In an embodiment, the cancer is selected from endometrial cancer, ovarian cancer, uterine cancer, lung cancer, colon cancer, rectal cancer, colorectal cancer, breast cancer, prostate cancer, liver cancer, pancreatic cancer, brain cancer, pancreatic cancer, kidney cancer, stomach cancer, skin cancer, gastric cancer, glioma, bone cancers, hepatocellular carcinoma, papillary renal carcinoma, head and neck cancer, squamous cell carcinoma, leukemias, lymphomas, myelomas, larynx cancer, sarcoma, esophageal cancer, and solid tumors. In an embodiment, the method includes administering the effective amount of the compound or the pharmaceutical composition to the subject using a pulse dose regimen. In an embodiment, the subject is human.

[0028] In some aspects, the techniques described herein relate to a pulse dose regimen including administering an effective amount of any of the compounds described herein or any of the pharmaceutical compositions described herein to a subject. In an embodiment, the subject is human.

[0029] In some aspects, the techniques described herein relate to a method of treating aging or an aging-related disease comprising administering an effective amount of any compound described herein or any pharmaceutical composition as described herein to a subject. In an embodiment, the aging or aging-related disease is associated with senescent cells having elevated p53 protein levels. In an embodiment, the compound selectively eliminates senescent cells.

[0030] In an embodiment, the aging-related disease is selected from age-related frailty, sarcopenia, osteoarthritis, atherosclerosis, pulmonary fibrosis, kidney fibrosis, liver fibrosis, age- related macular degeneration, diabetic complications, metabolic dysfunction, neurodegeneration, skin aging, wound healing impairment, and progeroid syndromes. In an embodiment, the progeroid syndrome is associated with MDM2 deficiency. In an embodiment, the method reduces the amount of senescent cells in the subject.

[0031] In an embodiment, the method includes administering the effective amount of the compound or the pharmaceutical composition to the subject using a pulse dose regimen. In an embodiment, the subject is human. In an embodiment, the senescent cells are present in tissue selected from adipose tissue, muscle tissue, liver tissue, kidney tissue, skin tissue, lung tissue, and vascular tissue.

[0032] These and other aspects, objects, features, and advantages of the example embodiments will become apparent to those with ordinary skill in the art upon considering the following detailed description of example embodiments.BRIEF DESCRIPTION OF THE DRAWINGS

[0033] An understanding of the features and advantages of the disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure may be utilized, and the accompanying drawings of which:

[0034] FIGS. 1A-1D shows that p53 protein abundance is the only genetic or proteomic distinction between TP53 mutant and WT cancer cells. FIG. 1A shows mean CRISPR dependency scores for genes across DepMap in TP53 wild-type (x-axis) vs. TP53 mutant cells (y-axis). There are no genes with (Mean DepScorejwut < -0.5 and A(Mean DepScore)Mut-WT < -0.2. FIG. IB shows a proteome-wide volcano plot of enriched or depleted proteins in TP53 mutant cells versus TP53 wild-type cells across DepMap (difference in mean Z-scored quantitative proteomics; t-test). FIG. 1C shows TP53 mRNA expression (log2(TPM+l)) vs. p53 protein abundance (log2(Signal) from RPPA) across DepMap. Cell lines are colored by TP53 mutation status (wild-type: gray bottom cluster, truncating: dark grey, missense: gray bottom cluster). FIG. ID shows representative immunohistochemistry of p53 in Human Protein Atlas from resected tumors.

[0035] FIGS. 2A-2I show bifunctional compounds ligand p53 fusion proteins and selectively inhibit proliferation of p53 mutant cells. FIG. 2A shows protein concentration in HEK293T cells profded in OpenCell vs. mean CRISPR dependency score across DepMap for all genes / protein products. FIG. 2B shows the structure of small molecule (Compound 13) and fusion protein construct (Halo-p53R273H(FL)-mCherry) used in experiments. FIG. 2C shows cell viability of 293T cells stably expressing Halo-p53R273H(FL)-mCherry versus parental 293T cells treated withCompound 13, measured by cell-titer-glo after 5 days. FIG. 2D shows crystal violet staining of293T cells stably expressing Halo-p53R273H(FL)-mCherry versus parental 293T cells treated with Compound 13, analyzed after 4 days. FIG. 2E shows a competition experiment in which a 1 : 1 mixture of Halo-p53R273II(FL)-mCherry: parental 293T cells were treated with Compound 13 (200 nM) for seven days and analyzed for mCherry expression. FIG. 2F shows Calu-1 cell lines stably expressing Halo-p53WT(FL)-mCherry-2A-mTagBFP2-V5 and Halo-p53R273H(FL)-mCherry-2A- mTagBFP2-V5 were established and analyzed by RT-qPCR for expression of the transgene. Transcript abundance is normalized to GAPDH expression using the 2AACtmethod and is plotted relative to Calu-1 cells stably expressing Halo-p53WT(FL)-mCherry-2A-mTagBFP2-V5. mTagBFP2 expression in these cell lines was also assessed by FACS, and mean fluorescence intensity is plotted. *73<0.05,***P<0.001 by t-test. FIG. 2G shows mCherry expression in Calu-1 cell lines established in FIG. 2F assessed by FACS; mean fluorescence intensity is plotted. ***p<0.001 by t-test. FIG. 2H shows Cell viability of Calu-1 cell lines established in FIG. 2F treated with Halo-PEG2-BI2536 (left) or BI-2536 (right) measured by cell-titer-glo after 4 days. FIG. 21, Modeling of final intracellular concentration at steady-state for a freely diffusing bifunctional compound binding to p53 (see Methods) based on p53 protein half-life and initial extracellular concentration (held constant); darkening gray indicates a longer half-life.

[0036] FIGS. 3A-3J show p53Y220C-PLKl bifunctional compounds selectively inhibit proliferation of p53Y220Cmutant cells. FIG. 3A shows the chemical structure of p53Y220C-PLKl bifunctional compound (Compound 1) used in experiments. FIG. 3B shows a nanoluciferase signal one day after dose titration of Compound 1 in 293T cells co-transfected with NLS-LgBiT- p53Y220C(DBD) and mEGFP-PLKl-SmBiT. FIG. 3C shows live cell imaging of 293T cells cotransfected with Halo-p53Y220CATAD-mCherry and mEGFP-PLKl-SmBiT and treated with Compound 1. The white arrow indicates the extranuclear region containing PLK1; the dark gray arrow indicates the nucleus. Dividing and non-dividing cells are shown. mCherry (p53) and EGFP (PLK1) channels are shown separately. FIG. 3D shows competition of 293T cells stably expressing Halo-p53'1220CATAD-mCherry vs. parental 293T cells in the presence of various compounds (PMV6, Compound 12, selinexor, BI2536, Compound 11, Compound 1). Competition of 293T cells stably expressing Halo-p53R273H(FL)-mCherry vs. parental 293T cells in the presence of Compound 1 is also shown on the right. mCherry+ percentage on day 8 of competition normalized to that of DMSO-treated cells. One representative replicate is shown. FIG. 3E showscrystal violet staining of 293T cells stably expressing Halo-p53Y220CATAD-mCherry versus parental 293T cells treated with Compound 1, analyzed after 5 days. FIG. 3F Caspase-3 / 7 gio of Halo-p53Y220CATAD-mCherry vs. parental 293T cells treated with p53-01 after one day. FIG. 3G, Proportion of early apoptotic cells (Annexin+, PI-) following one day treatment with p53-01, BI- 2536, or PMV6 at indicated concentrations in Halo-p53Y220CATAD-mCherry vs. parental 293T cells, n.s. not significant, *P<0.05, **** / ’<0.0001 by t-test. FIG. 311 shows competition of 293T cells stably expressing Halo-p53Y220CATAD-mCherry vs. parental 293T cells in the presence of Compound 1 (250 nM) alone or in combination with PMV6 (2.5 pM). ***73<0.001 by t-test. FIG. 31 shows DNA content (assessed by flow cytometry of DAPI stained cells) following treatment of palbociclib synchronized Halo-p53Y220CATAD-mCherry vs. parental 293T cells with p53-01, BI- 2536, or PMV6 at indicated concentrations for one day; one representative replicate is shown. FIG. 3J shows western blot for PLK1 targets including cyclin Bl and phospho-PLK binding motif of double thymidine block synchronized Halo-p53Y220CATAD-mCherry vs. parental 293T cells treated with p53-01, BI-2536, or PMV6 at indicated concentrations for 8.5 hours.

[0037] FIGS. 4A-4I show that p53Y220C-PLK1 bifunctional compounds are active in endogenous settings and do not reactivate p53. FIG. 4A shows Huh7 cells homozygous for the p53Y220Cmutation treated with PMV6 (4 pM) or Compound 1 (4 pM) for 24 hours and subject to RNA sequencing. Iog2(fold-changes) in transcript abundance and logio(adjusted p-values) computed by DESeq2 are plotted. Top differentially expressed genes are labeled. FIG. 4B shows pre-ranked GSEA analysis using DESeq2 t-statistic as rank metric for PMV6 vs. DMSO (left) and Compound 1 vs. DMSO (right) comparisons on MSigDB Fisher direct p53 targets gene set. Normalized enrichment scores are listed. FIG. 4C shows gene expression analysis of p53 targets from a high-confidence p53 target set. Samples are arranged in columns by hierarchical clustering (Euclidean distance), and rows are scaled to z-scores (gray-scale). FIG. 4D shows Luciferase activity following PMV6, BI-2536, or Compound 1 treatment (16 hours) ofHuh7 (left) or MFE319 (right) cell lines stably expressing a p53 luciferase transcriptional reporter. Luciferase signal is normalized to untreated cells. ***P<0.001; n.s. not significant by two-way ANOVA. FIG. 4E shows cell viability of MFE319 cells treated with PMV6 or Compound 1, measured by cell-titer- glo after 4 days. ***7?<0.001 by two-way ANOVA. FIG. 4F shows a donut plot of cancers in TCGA Pan-Cancer Atlas studies in cBioPortal with p53Y220Cmutations with / without additionalp53 mutations. FIG. 4G shows cell viability of MFE319 cells treated with Compound lalone or combined with PMV6 (2.5 pM), measured by cell-titer-glo after four days. ***P<0.001 by two- way ANOVA. FIG. 4H shows competition of MFE319 cells stably expressing sgTP53-Cas9- EGFP vs. parental MFE319 cells in the presence of Compound 1, PMV6, or BI-2536. EGFP+ percentage on day 9 of competition normalized to that of DMSO-treated cells. *P<0.05,** <0.01,***P<0.001 by t-test. FIG. 41 shows Halo-p53Y220CATAD-mCherry 293T cells were cultured in the presence of Compound 1 for three weeks. The percentage of mCherry- negative cells was analyzed by FACS.

[0038] FIGS. 5A-5D optimization yields more potent p53Y220C-PLKl bifunctional compounds. FIG. 5A shows a summary of linkers tested; linker length, EC50 from Halo- p53Y220CATAD-mCherry vs. parental 293T growth competition, and EC50 from NanoBiT experiment is listed. Growth competition assays were analyzed on day 10. NanoBiT experiments were set up in 293T cells co-transfected with NLS-LgBiT-p53Y220C(DBD) and mEGFP-PLKl- SmBiT, treated with compound for 24 hours. NA indicates the EC50 could not be computed due to lack of potency. FIG. 5B shows Left. mCherry percentage versus dose for individual compounds from the growth competition assay, Right, normalized nanoluciferase signal from NanoBiT assay versus dose for individual compounds. FIG. 5C shows EC50 from the growth competition experiment is plotted against Einax (calculated as the lowest percentage of mCherry+ cells in the competition assay observed at a tested dose). FIG. 5D, shows EC50 from the NanoBiT experiment is plotted against Emax (maximum normalized luciferase signal observed at a tested dose, normalized to DMSO-treated cells).

[0039] FIG. 6 demonstrates PLK1 is essential for cancer cell proliferation; PLK1 mean CRISPR gene knockout score is overlayed on the distribution of mean CRISPR gene knockout scores for non-essential genes (as determined in DepMap). P-value computed by Z-test.

[0040] FIGS. 7A-7E show no small molecules specifically kill p53 mutant cancer cells or cell surface receptors upregulated on TP53 mutant cells. FIG. 7A shows the mean log2(fold-change) for compounds in the PRISM repurposing library (23Q2) on the viability of TP53 mutant (y-axis) and TP53 wild-type cell lines (x-axis) across DepMap. MDM2 inhibitors are boxed. There are no molecules >2-fold more toxic on average to p53Mutvs. p53WTcells in the PRISM repurposing library. FIG. 7B shows the area under the curve (AUC) for compounds in the CTD2 library on the viability of TP53 mutant (y-axis) and TP53 wild-type cell lines (x-axis) across DepMap. There are no molecules with A(Mean AUC)MUI-WT < -0.5 in CTD2 screen. FIG. 7C shows the mean mRNA expression (log2(TPM+l)) for genes encoding cell surface proteins for TP53 mutant (y-axis) and TP53 wild-type cell lines across DepMap. FIG. 7D shows p53 protein abundance (log2(RPPA Signal)) versus TP53 hotspot mutation status (WT, monoallelic, biallelic) across DepMap. FIG. 7E, p53 protein abundance (log2(RPPA Signal)) versus TP53 hotspot mutation status for select hotspot mutations (R273H, Y220C) across DepMap.

[0041] FIGS. 8A-8G show Compound 13 selectively kills cells overexpressing p53. FIG.8A shows Brightfield and mCherry imaging of Halo-p53R273H(FL)-mCherry 293T cells treated with Compound 13 (top row: 0.3 nM, bottom two rows: 20 nM) for eight days. FIG. 8B shows In(ICso) for adavosertib in DepMap (PRISM OncRef). FIG. 8C shows In(ICso) for BI-2536 in DepMap (GDSC1). FIG. 8D shows structure of Compound 14. FIG. 8E, shows competition of Hal o- p53R273H(FL)-mCherry vs. parental Calu-1 cells with Compound 1, BI2536, Compound 11, or Compound 13 for 7 days; analyzed for mCherry expression by flow cytometry. FIG. 8F shows competition of Halo-p53Y220CATAD-mCherry vs. parental 293T cells with Compound 1 or Compound 14 for 8 days; analyzed for mCherry expression by flow cytometry. FIG. 8G, Calu-1 cell lines stably expressing Halo-p53WT(FL)-mCherry-2A-mTagBFP2-V5 or Halo-p53'1220C(FL)- mCherry-2A-mTagBFP2-V5 were established. mTagBFP2 and mCherry expression was assessed by FACS, and mean fluorescence intensity is plotted. FIG. 8H shows cell viability of Calu-1 cell lines established in FIG. 8G treated with Compound 13 (left) or BI-2536 (right) measured by cell- titer-glo after 4 days.

[0042] FIGS. 9A-9I show cell killing is specific to Compound 12. FIGS. 9A, Structure of Compound 12. FIGS. 9B shows normalized nanoluciferase signal one day after dose titration of PMV6 and BI-2536 in 293T cells co-transfected with NLS-LgBiT-p53Y220C(DBD) and mEGFP-PLKl-SmBiT. FIGS. 9C shows live cell imaging of 293T cells co-transfected with Halo- p53Y220CATAD-mCherry and mEGFP-PLKl-SmBiT and treated with PMV6 or BI-2536 for 16 hours. FIGS. 9D shows crystal violet staining of 293 T cells stably expressing Halo- p53Y220CATAD-mCherry versus parental 293T cells treated with PMV6 or BI-2536, analyzed after 5 days. FIGS. 9E shows structure of Compound 10. FIGS. 9F shows competition of Halo- p53Y220CATAD-mCherry vs. parental 293T cells with Compound 1 or Compound 10 for 10 days; analyzed for mCherry expression by flow cytometry. FIGS. 9G shows proportion of late apoptotic cells (Annexin+, PI+) following one day treatment with Compound 1, BI-2536, or PMV6 at indicated concentrations in Halo-p53Y220CATAD-mCherry vs. parental 293T cells, n.s. not significant, ** <0.01, ***7?<0.001 by t-test. FIGS. 9H shows caspase-3 / 7 gio of Halo- p53Y220CATAD-mCherry vs. parental 293T cells treated with BI-2536 or PMV6 after one day. FIGS. 91 shows normalized viability of 293T cells expressing a dox inducible Halo- p53Y220CATAD-mCherry treated with Compound 1, PMV6, or BI-2536 for 4 days, induced with dox at various concentrations the day before beginning compound treatment (0 ng / mL, 100 ng / mL, 1000 ng / mL).

[0043] FIGS. 10A-10D show Compound 1 is active in endogenous settings. FIG. 10A shows the Difference in mRNA expression (logzFC) between TP 53 WT and mutant cell lines in DepMap for all genes. -values computed by t-test. Fischer census p53 targets are colored in dark gray. FIG. 10B shows an analysis of RNA-seq reads aligned to the p53 transcript sequence in MFE319 and visualized in IGV. Paired reads boxed in black span residues 220-273 demonstrate the Y220C and R273C mutations are present in trans. FIG. 10C shows distribution of log(ICso) of Compound 1 across a panel of Y220C+ (MFE319, NUGC-3, MFE296, BxPC-3, Huh7) and Y220C- cell lines (MCF7, LNCaP, DU145, HepG2) after 4 day treatment. E-value computed by heteroscedastic t- test; n.s., not significant. FIG. 10D shows individual viability-dose curves for Compound 1 across a panel of Y220C+ (MFE319, NUGC-3, MFE296, BxPC-3, Huh7) and Y220C- cell lines (MCF7, LNCaP, DU145, HepG2) after 4 day treatment. Cell lines in gray are Y220C+, those in black are Y220C-.

[0044] The figures herein are for illustrative purposes only and are not necessarily drawn to scale.DETAILED DESCRIPTION OF THE EXAMPLE EMBODIMENTSOVERVIEW

[0045] TP53 is the most mutated gene in human cancer (ICGC / TCGA Pan-Cancer Analysis of Whole Genomes Consortium 2020). TP53 mutations have been shown to induce resistance to cytotoxic chemotherapy and are associated with a worse prognosis across cancers (Ozaki and Nakagawara 2011; Petitjean et al. 2007; Robles and Harris 2010). In total, TP53 mutant cancers are responsible for the majority of cancer deaths. In the past, attempts have been made to target these cancers in several ways therapeutically: delivery of wild-type TP53 genes to cells with gene therapy or mRNA, indiscriminate induction of apoptosis, or small molecule re-folders of p53 (Foster et al. 1999; Bykov et al. 2002). Attempts to enact these strategies have invariably failed, and mutant-agnostic refolders have consistently shown off-target activity (Fujihara et al. 2021; Rippin et al. 2002). Furthermore, small molecule refolding of p53 may not be possible for contact mutants of p53 that specifically mutate residues that interact with the negatively charged phosphate backbone of DNA.

[0046] In contrast to most tumor suppressor proteins, such as APC, RBI, or PTEN, TP 53 mutations are typically missense mutations. These mutations act as dominant negative mutations that disallow DNA binding at consensus sequences and poison the tetramer (de Vries et al. 2002). Because they act as dominant negatives, they are a shorter evolutionary path to inactivating most p53 functions within the cells that harbor these mutations. P53 is a central signal integrator for various cellular stress signals such as hypoxia, DNA damage, or excessive oncogenic signaling. When these mutations occur, the mechanisms that normally sense the above cellular stressors are typically intact and jointly work to activate p53 by increasing its abundance and promoting its nuclear translocation. Meanwhile, the p53 that accumulates is impotent for driving the transcription of its destroyer, MDM2. The negative feedback loop that usually serves to regulate p53 protein tightly is broken, and the half-life of p53 stretches from its typical 20 minutes to more than 20 hours. Thus, the p53 protein accumulates in TP53 missense mutant cells. This is one of the most robust findings in all of cancer research.

[0047] Several recent examples have revealed the powerful effects of gain-of-function induced proximity pharmacology such as TCIPs, velcrins, RIPTACs, or cancer mutation-specific effectors of TPD30 33. Application of gain-of-function approaches might provide a generalizable method totarget deadly cancers associated with mutant TP53. Here, Applicants develop gain-of-function compounds that target the abundance of p53 protein, a characteristic of cancers harboring TP53 missense mutants, to selectively kill cancer cells with high levels of mutant p53.

[0048] Disclosed herein are bifunctional compounds, pharmaceutical compositions, and methods of using said compounds and pharmaceutical compositions to kill TP53 mutant cells selectively. The compounds disclosed herein generally comprise a small molecule ligand that binds mutant p53 variants linked to a small molecule ligand toxic to cells connected to the ligand that binds mutant p53 through a linker moiety. Further, the compounds leverage the increased abundance of mutant p53 in TP53 mutant cancers to selectively concentrate cytotoxic molecules in cancer cells. Accordingly, unlike previous therapeutic approaches, the compounds disclosed herein do not seek to restore TP53 wild-type function. Instead, the compounds exploit the differential abundance of p53 protein and the selective binding of mutant-specific p53 variants to deliver a cytotoxic small molecule linked to the mutant p53 binder, thereby selectively killing cells expressing mutant p53.

[0049] Additionally, the compounds disclosed herein offer a promising new avenue for cancer therapy by providing a targeted treatment that minimizes damage to normal, healthy cells. This targeted approach may result in fewer side effects than conventional therapies that affect both cancerous and non-cancerous cells. Furthermore, the versatility of the compounds disclosed herein allows for potential customization to target various p53 mutations, enhancing their applicability across different TP53 mutant cancers.BIFUNCTIONAL COMPOUNDS

[0050] The compounds disclosed herein comprise a p53-binding ligand connected to a targetbinding moiety via a linker. The compounds disclosed herein can be used to improve the kinetics of native protein modifications by bringing substrate molecules in proximity to the p53 protein. In addition, the compounds disclosed herein may be used to re-target a protein to modify a non-native or neo- sub strate.

[0051] In an embodiment, bifunctional compounds for target p53 mutants are compounds of Formula (I):M-L-T(I) or a pharmaceutically acceptable salt thereof, wherein:M is a ligand that binds p53;T is a ligand that binds a target protein andL is a linker.

[0052] In an embodiment, M is a ligand that binds mutant p53, which is p53 Y220C.

[0053] In an embodiment, T binds a target protein essential for proliferation of a cell. In an embodiment, T binds a target protein essential for proliferation of a human cancer cell. In an embodiment, T binds the target protein selected from BRD4, BUB1, BUB1B, CDC7, CDK1, CDK2, CDK4, CDK6, CDK7, CDK9, PLK1, PLK4, WEE1, and XPO1.

[0054] In an embodiment, T binds PLK1. p53 Binding Ligands

[0055] The p53 binding ligand can be any compound or portion that binds or associates with p53. In an embodiment, the p53 binding ligand binds or associates with mutant p53.

[0056] In an embodiment, M is eprenetapopt (APR-246), rezatapopt, azacitidine, ganetespib, atorvastatin, vorinostat, lamivudine, or zoledronic acid.

[0057] In an embodiment, M is a compound of Formula (II):whereinRi is H, substituted or unsubstituted alkyl, or substituted or unsubstituted alkenyl, -C(O)R4, or -SO2R5;R2 is H, halo, substituted or unsubstituted alkyl, or substituted or unsubstituted haloalkyl;R3is halo, -NO, -CN, -S(O)2R6, -C(O)NR7, or -COR8R4 andRs are each independently selected from substituted or unsubstituted alkyl, haloalkyl, and substituted or unsubstituted alkenyl;Rs and R7 are each independently substituted or unsubstituted alkyl, andRs is H or substituted or unsubstituted alkyl;the attachment point of M to L.

[0058] Rs and R7 are each independently substituted or unsubstituted lower alkyl (e.g., C1-C4- alkyl). Re and R7 are each independently unsubstituted lower alkyl (e.g., Ci-C4-alkyl).

[0059] Rs is H or substituted or unsubstituted alkyl (e g., Ci-C4-alkyl). Rs is H or unsubstituted alkyl (e.g., Ci-C4-alkyl).

[0060] In an embodiment, M is a compound of Formula (IIA):

[0061] In an embodiment, M is a compound of Formula (IIB):

[0062] In an embodiment, Ri is substituted or unsubstituted lower alkyl (e.g., Ci-C4-alkyl). In an embodiment, Ri is substituted for lower alkyl (e.g., Ci-C4-alkyl). In an embodiment, Ri is substituted with a haloalkyl group. In an embodiment, Ri is substituted with CF3.

[0063] In an embodiment, Ri is CH2CF3.

[0064] In an embodiment, Ri is substituted with epoxy.

[0065] In an embodiment, Ri is substituted or unsubstituted lower alkenyl (e.g., C3-C6- alkenyl). In an embodiment, Ri is unsubstituted lower alkenyl (e.g., Cs-Ce-alkyl).

[0066] In an embodiment, Ri is -CHCH2.

[0067] In an embodiment, Ri is -SO2R4, wherein R4 is substituted or unsubstituted lower haloalkyl (e.g., Ci-C4-haloalkyl). In an embodiment, R4 is unsubstituted lower haloalkyl (e.g., C2- C4-haloalkyl). In an embodiment, R4 is halomethyl, haloethyl, halopropyl, or halobutyl. In an embodiment, R4 is halomethyl. In an embodiment, R4 is CH3F, CH3CI, or CHsBr.

[0068] In an embodiment, Ri is -SO2R4, wherein R4 is substituted or unsubstituted alkenyl. In an embodiment, R4 is -CHCH2.

[0069] In an embodiment, Ri is -C(O)R3, wherein R3 is substituted or unsubstituted lower alkenyl (e.g., Cs-Ce-alkenyl). In an embodiment, R3 is unsubstituted lower alkenyl (e.g., C3-C6- alkenyl). In an embodiment, R3is -CH2CHCH, -(CH2)2CHCH, or -(CH2)4CHCH, -(CH2)2CHCH. In an embodiment, R3 is -CH2CHCH.

[0070] In an embodiment, T is a compound of Formula (III):whereinis the attachment point of T to L.Target Binding Ligands

[0071] As used herein, the term “target binding ligand” refers to a compound that binds to a target molecule. The target molecule may be a polypeptide. The target binding moiety can bind the target molecule (target substrate), thereby bringing the p53 protein into proximity to the target of interest.

[0072] In an embodiment, the target molecule is an essential protein to cancer cell survival, proliferation, or both. In an embodiment, the target molecule is BRD4, BUB1, BUB IB, CDC7, CDK1, CDK2, CDK4, CDK6, CDK7, CDK9, PLK1, PLK4, WEE1, or XPO1. In an embodiment, the target of interest is PLK1.

[0073] In an embodiment, T is BAY1816032, simurosertib (TAK-931), avotaciclib (BEY1107), INX-315, PF-07220060, palbociclib, abemaciclib, riboci clib, BG-68501, samuraciclib, plogosertib, BI-2536, onvasertib, CFI-400945, RP-1664, adavosertib, IMP7068, Debio 0123, selinexor (KPT-330), or WJ01024.

[0074] In an embodiment, Tis a compound of Formula (IV):whereinis the attachment point of T to L.Linkers

[0075] As used herein, a “linker” is a bond, a bond, molecule, or group of molecules that binds two separate entities to one another. Linkers provide optimal spacing for the two entities. The term “linker” in an embodiment refers to an agent or molecule that bridges the p53 binding ligand to the target binding ligand. One of ordinary skill in the art would recognize that sites on the p53 binding ligand or the target binding ligand, which are not necessary for the function of the bifunctional compounds of the present disclosure, are ideal sites for attaching a linker, provided that the linker, once attached to the conjugate of the present disclosures, does not interfere with the function of the p53 binding ligand (i.e., binds p53 protein) or the target binding ligand (i.e., binding of the target protein, e g., BRD4, BUB1, BUB1B, CDC7, CDK1, CDK2, CDK4, CDK6, CDK7, CDK9, PLK1, PLK4, WEE1, or XPO1).

[0076] In an embodiment, L is a length of about 4.33A to about 22.22A. This may include any decimal value within said range and / or including the floor and ceiling values of 4.00 A and 23.00 A. In an embodiment, L is a length of 5A to 10A, 10A to 20A, 5 A to 15A, 4A to 6A, 6A to 8A, 8A to 12A, 12A to 16A, 16A to 20A, 4A to IOA, 6A to 14A, 8A to ISA, or IOA to 22A. In an embodiment, L is a length of 4A, 5 A, 6A, 7 A, 8A, 9 A, 10 A, 11 A, 12A, 13 A, 14 A, 15A, 16 A, 17A, 18 A, 19 A, or 20 A.

[0077] In an embodiment, L is an alkyl linker. In an embodiment, L is substituted or unsubstituted Ci-Ci2-alkyl. In an embodiment, L is unsubstituted lower alkyl (e.g., Ci-C4-alkyl).

[0078] In an embodiment, L is a polyethylene glycol (PEG) linker, -[-O-(CH2-CH2)-]n-O- wherein n is 2, 4, or 6.

[0079] In an embodiment, L is a P-alanine linker.

[0080] In an embodiment, L is a compound of Formula (V):whereinX is C=O or CH2;Y is C=O or CH2; n is 0-15, andthe attachment point of X and Y to M and T.

[0081] In an embodiment, L is a compound of Formula (VI):whereinX is C=O or CH2;Y is C=O or CH2; m is 0-15; n is 0-15; o is 0-15; andthe attachment point of X and Y to M and T.

[0082] In an embodiment, L is a compound of Formula (VII):whereinX is C=O or CH2;Y is C=O or CH2; m is 0-15; n is 0-15, and''' is the attachment point of X and Y to M and T.

[0083] In an embodiment, L is a compound of Formula (VIII):whereinX is C=O or CH2;Z is CH2z is 0-15; x'' is the attachment point of X and A to M and T, andthe attachment point of A to Z andx' .Example Bi-Functional Molecules

[0084] In an embodiment, the compound of Formula (I) is any one of Compounds 1-15:(Compound 4),(Compound 9),(Compound11),(Compound 13),p , or a pharmaceutically acceptable salt thereof.

[0085] In an embodiment, the compound of Formula (I) is5) or a pharmaceutically acceptable salt thereof.Salts / Esters

[0086] The compounds disclosed herein (e.g., compounds of Formula (I), e.g., any ofCompounds 1-15) can be present as salts, particularly pharmaceutically acceptable salts.

[0087] Pharmaceutically acceptable salts of the compounds disclosed herein (e.g., compounds of Formula (I), e.g., any of Compounds 1-15) include suitable acid addition or base salts thereof. A review of suitable pharmaceutical salts may be found in Berge et al., J Pharm Sci, 66, 1-19 (1977). Salts are formed, for example, with strong inorganic acids such as mineral acids, e.g., sulphuric acid, phosphoric acid, or hydrohalic acids; with strong organic carboxylic acids, such as alkanecarboxylic acids of 1 to 4 carbon atoms which are unsubstituted or substituted (e.g., by halogen), such as acetic acid; with saturated or unsaturated dicarboxylic acids, for example oxalic, malonic, succinic, maleic, fumaric, phthalic or tetraphthalic; with hydroxycarboxylic acids, for example ascorbic, glycolic, lactic, malic, tartaric or citric acid; with amino acids, for example aspartic or glutamic acid; with benzoic acid; or with organic sulfonic acids, such as (Ci-C4)-alkyl- or aryl-sulfonic acids which are unsubstituted or substituted (for example, by a halogen) such as methane- or p-toluene sulfonic acid. In an embodiment, the salt is an HC1 salt.Process

[0088] The compounds disclosed herein, including salts, can be prepared using known organic synthesis techniques and synthesized according to any possible synthetic routes.

[0089] The reactions for preparing the compounds disclosed herein can be carried out in suitable solvents, which can be readily selected by one skilled in organic synthesis. Suitable solvents can be substantially non-reactive with the starting materials (reactants), the intermediates, or products at the temperatures at which the reactions are carried out, e.g., temperatures ranging from the solvent's freezing to the solvent's boiling temperature. A given reaction can be carried out in one solvent or a mixture of more than one solvent. Depending on the particular reaction step, suitable solvents for a specific reaction step can be selected by the skilled artisan.

[0090] The preparation of compounds disclosed herein can involve the protection and deprotection of various chemical groups. The need for protection and deprotection and selecting appropriate protecting groups can be readily determined by one skilled in the art. The chemistry of protecting groups is described, e.g., in Kocienski, Protecting Groups (Thieme, 2007); Robertson, Protecting Group Chemistry (Oxford University Press, 2000); Smith et al., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 6thEd. (Wiley, 2007); Peturssion et al., “Protecting Groups in Carbohydrate Chemistry,” J. Chem. Educ., 1997, 74(11), 1297; and Wuts et al., Protective Groups in Organic Synthesis, 4th Ed., (Wiley, 2006).

[0091] Reactions can be monitored according to any suitable method known in the art. For example, product formation can be monitored by spectroscopic means, such as nuclear magnetic resonance spectroscopy (e.g.,or13C), infrared spectroscopy, spectrophotometry (e.g., UV- visible), mass spectrometry, or chromatographic methods such as high-performance liquid chromatography (HPLC) or thin-layer chromatography (TLC).

[0092] The Scheme below provides general guidance on preparing the compounds disclosed herein. One skilled in the art would understand that the preparations shown in this Scheme can be modified or optimized using general knowledge of organic chemistry to prepare various compounds disclosed herein.

[0093] Compounds of Formula (I) can be prepared, e.g., using a process as illustrated below and in Examples 1-9.Scheme 1Methods of Treatment

[0094] The compounds disclosed herein (e.g., compounds of Formula (I), e.g., any of Compounds 1-15) kill cancer cells bearing TP53 mutations. Accordingly, a compound of the disclosure can, for example, slow the proliferation of cancer cell lines or kill cancer cells (e.g., cancer cells with a p53 mutation).

[0095] In an embodiment, selective cytotoxic small molecules (e.g., compounds of Formula (I), e.g., any of Compounds 1-15) that can selectively target cancer cells with a p53 mutation are disclosed herein.

[0096] The cell described herein may be abnormal The cell may be in vitro or in vivo. In an embodiment, the cell is proliferative. In an embodiment, the cell is a blood cell. In an embodiment, the cell is a lymphocyte Io an embodiment, the cell is a B-cell, In an embodiment, the cell is a T- cell. In an embodiment, the cell is a cancer cell. In an embodiment, the ceh is a leukemia cell. In an embodiment, the cell is a CLL cell. In an embodiment, the cell is a melanoma cell. In an embodiment, the cell is a multiple myeloma, cell. In an embodiment, the cell is a benign neoplastic cell. In an embodiment, the cell is an endothelial cell.

[0097] In an embodiment, disclosed herein are methods of inhibiting cell growth in a biological sample or subject.

[0098] In an embodiment, compounds disclosed herein (e.g., compounds of Formula (I), e.g., any of Compounds 1-15) can be used to treat cancer in a subject. In an embodiment, the cancer has one or more mutations. In an embodiment, the cancer has a p53 mutation

[0099] Non-limiting examples of cancer that can be treated by a compound disclosed herein include: acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS- related cancers, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytomas, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancers, brain tumors, such as cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, visual pathway and hypothalamic glioma, breast cancer, bronchial adenomas, Burkitt lymphoma, carcinoma of unknown primary origin, central nervous system lymphoma, cerebellar astrocytoma, cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing’s sarcoma, germ cell tumors, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gliomas, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin’s lymphoma, Hypopharyngeal cancer, intraocular melanoma, islet cell carcinoma, Kaposi sarcoma, kidney cancer, laryngeal cancer, lip and oral cavity cancer, liposarcoma, liver cancer, lung cancers, such as non-small cell and small cell lung cancer, lymphomas, leukemias, macroglobulinemia, malignant fibrous histiocytoma of bone / osteosarcoma, medulloblastoma, melanomas, mesothelioma, metastatic squamous neck cancer with occult primary, mouth cancer, multipleendocrine neoplasia syndrome, myelodysplastic syndromes, myeloid leukemia, nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin’s lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, pancreatic cancer islet cell, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pituitary adenoma, pleuropulmonary blastoma, plasma cell neoplasia, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, renal pelvis and ureter transitional cell cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcomas, skin cancers, skin carcinoma merkel cell, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, stomach cancer, T-cell lymphoma, throat cancer, thymoma, thymic carcinoma, thyroid cancer, trophoblastic tumor (gestational), cancers of unknown primary site, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom macroglobulinemia, and Wilms tumor.

[0100] In an embodiment, the cancer is selected from cancer endometrial cancer, ovarian cancer, uterine cancer, lung cancer, colon cancer, breast cancer, prostate cancer, liver cancer, pancreatic cancer, brain cancer, pancreatic cancer, kidney cancer, stomach cancer, skin cancer, gastric cancer, glioma, bone cancers, hepatocellular carcinoma, papillary renal carcinoma, head and neck cancer, squamous cell carcinoma, leukemias, lymphomas, myelomas, and solid tumors.

[0101] In an embodiment, the cancer is associated with p53 overexpression. Exemplary cancers associated with p53 overexpression include but are not limited to, ovarian cancer, esophageal cancer, colorectal cancer, head and neck cancer, larynx cancer, lung cancer, primary leukemia, sarcoma, testicular cancer, malignant melanoma, and cervical cancer.

[0102] In an embodiment, the compounds disclosed herein show non-lethal toxicity.

[0103] in an embodiment, the methods comprise administering to the subject or contacting a biological sample with an effective amount of Formula (I) compound (e.g., any of Compounds 1- 15). In an embodiment, the compound is in contact with a biological sample. In an embodiment, the compound is administered to a subject (e.g., a human).

[0104] The compounds disclosed herein (e.g., compounds of Formula (I), e.g., any ofCompounds 1-15) can target cells with increased p53 abundance beyond cancer applications.Accordingly, a compound disclosed herein, for example, can selectively eliminate senescent cells or reduce cellular senescence burden in a subject.

[0105] In an embodiment, selective cytotoxic small molecules (e.g., compounds of Formula (I), e.g., any of Compounds 1-15) that can selectively target senescent cells with elevated p53 protein levels are disclosed herein for treating aging and aging-related disorders.

[0106] The senescent cell described herein may be present in various tissues. The senescent cell may be in vitro or in vivo. In an embodiment, the senescent cell exhibits increased p53 protein abundance. In an embodiment, the senescent cell is a fibroblast. In an embodiment, the senescent cell is an endothelial cell. In an embodiment, the senescent cell is a smooth muscle cell. In an embodiment, the senescent cell is an epithelial cell. In an embodiment, the senescent cell is present in adipose tissue. In an embodiment, the senescent cell is present in muscle tissue. In an embodiment, the senescent cell is present in liver tissue. In an embodiment, the senescent cell is present in kidney tissue.

[0107] In an embodiment, disclosed herein are methods of reducing senescent cell burden in a biological sample or subject.

[0108] In an embodiment, compounds disclosed herein (e.g., compounds of Formula (I), e.g., any of Compounds 1-15) can be used as senolytic agents to treat aging and aging-related diseases in a subject. In an embodiment, the aging-related disease is characterized by accumulation of senescent cells with elevated p53 levels.

[0109] In an embodiment, compounds disclosed herein can be used to treat progeroid syndromes. In an embodiment, the progeroid syndrome is associated with MDM2 deficiency. In an embodiment, the progeroid syndrome is characterized by elevated p53 levels.

[0110] Non-limiting examples of aging-related conditions that can be treated by a compound disclosed herein include: age-related frailty, sarcopenia, osteoarthritis, atherosclerosis, pulmonary fibrosis, kidney fibrosis, liver fibrosis, age-related macular degeneration, diabetic complications, metabolic dysfunction, neurodegeneration, skin aging, wound healing impairment, and progeroid syndromes.

[0111] In an embodiment, the compound selectively eliminates senescent cells while sparing healthy, e.g., non-senescent cells with normal p53 levels.Pharmaceutical Compositions

[0112] Further disclosed herein are pharmaceutical compositions comprising a compound of the disclosed herein (e.g., a compound of Formula (I), e.g., any of Compounds 1-15) admixed with one or more pharmaceutically acceptable diluents, excipients, or carriers. A compound disclosed herein (e.g., a compound of Formula (I), e.g., any one of Compounds 1-15) (including their pharmaceutically acceptable salts) can be administered alone, or it can also be administered in admixture with a pharmaceutical carrier, excipient or diluent, particularly for human therapy. The pharmaceutical compositions may be for human or animal usage in human and veterinary medicine.

[0113] Examples of suitable excipients for the various pharmaceutical compositions described herein may be Handbook of Pharmaceutical Excipients, 2ndEdition, (1994), Edited by A Wade and PJ Weller.

[0114] Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art and are described, for example, in Remington’s Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985).

[0115] Suitable carriers include lactose, starch, glucose, methyl cellulose, magnesium stearate, mannitol, sorbitol, etc. Examples of suitable diluents include ethanol, glycerol, and water.

[0116] The choice of pharmaceutical carrier, excipient, or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as, or in addition to, the carrier, excipient, or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilizing agent(s).

[0117] Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free-flow lactose, beta-lactose, com sweeteners, natural and synthetic gums, such as acacia, tragacanth or sodium alginate, carboxymethyl cellulose, and polyethylene glycol.

[0118] Suitable lubricants may include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, and sodium chloride.

[0119] The pharmaceutical composition may include preservatives, stabilizers, dyes, and even flavoring agents. Examples of preservatives include sodium benzoate, sorbic acid, and esters of p- hydroxybenzoic acid. Antioxidants and suspending agents may also be used.

[0120] Any of the compounds disclosed herein (e.g., a compound of Formula (I), e.g., any oneof Compounds 1-15) can be delivered via liposomal technology. Using liposomes as drug carriers can increase the therapeutic index of the compounds. Liposomes comprise natural phospholipids and can contain mixed lipid chains with surfactant properties (e.g., egg phosphatidylethanolamine). A liposome design can employ surface ligands to attach to unhealthy tissue. Non-limiting examples of liposomes include the multilamellar vesicle (MLV), the small unilamellar vesicle (SUV), and the large unilamellar vesicle (LUV). Liposomal physicochemical properties can be modulated to optimize penetration through biological barriers and retention at the administration site and to reduce the likelihood of developing premature degradation and toxicity to non-target tissues. Optimal liposomal properties depend on the administration route: large-sized liposomes show good retention upon local injection, and small-sized liposomes are better suited to achieve passive targeting. PEGylation reduces the uptake of the liposomes by the liver and spleen and increases the circulation time, resulting in increased localization at the inflamed site due to the enhanced permeability and retention (EPR) effect. Additionally, liposomal surfaces can be modified to achieve selective delivery of the encapsulated drug to specific target cells. Non-limiting examples of targeting ligands include monoclonal antibodies, vitamins, peptides, and polysaccharides specific for receptors concentrated on the surface of cells associated with the disease.

[0121] In an embodiment, a pharmaceutical composition can be, for example, an immediate- release form or a controlled-release formulation. An immediate-release formulation can be formulated to allow the compounds to act rapidly. Non-limiting examples of immediate-release formulations include readily dissolvable formulations. A controlled release formulation can be a pharmaceutical formulation that has been adapted such that release rates and release profiles of the active agent can be matched to physiological and chronotherapeutic requirements or has been formulated to effect the release of an active agent at a programmed rate. Non-limiting examples of controlled-release formulations include granules, delayed-release granules, hydrogels (e.g., of synthetic or natural origin), other gelling agents (e.g., gel-forming dietary fibers), matrix-based formulations (e.g., formulations comprising a polymeric material having at least one active ingredient dispersed through), granules within a matrix, polymeric mixtures, and granular masses.31

[0122] In some, a controlled release formulation is a delayed release form. A delayed release form can be formulated to delay a compound's action for an extended period. A delayed release form can be formulated to delay the release of an effective dose of one or more compounds, for example, for about 4, about 8, about 12, about 16, or about 24 hours.

[0123] A controlled release formulation can be a sustained release form. A sustained release form can be formulated to sustain, for example, the compound's action over an extended period. A sustained release form can be formulated to provide an effective dose of any compound described herein (e.g., provide a physiologically effective blood profile) over about 4, about 8, about 12, about 16, or about 24 hours.Administration

[0124] The pharmaceutical compositions disclosed herein may be adapted for oral, rectal, vaginal, parenteral, intramuscular, intraperitoneal, intraarterial, intrathecal, intrabronchial, subcutaneous, intradermal, intravenous, nasal, buccal or sublingual routes of administration.

[0125] Compressed tablets, pills, jellies, drops, and capsules are particularly useful for oral administration.

[0126] Other forms of administration comprise solutions or emulsions that may be injected intravenously, intraarterially, intrathecally, subcutaneously, intradermally, intraperitoneally, or intramuscularly and prepared from sterile or sterilizable solutions. The pharmaceutical compositions disclosed herein may also be suppositories, pessaries, suspensions, emulsions, lotions, ointments, creams, gels, sprays, solutions, or dusting powders.

[0127] An alternative means of transdermal administration is using a skin patch. For example, the active ingredient can be incorporated into a cream with an aqueous emulsion of polyethylene glycol or liquid paraffin. The active ingredient can also be incorporated, at a concentration of between 1 and 10% by weight, into an ointment consisting of a white wax or soft paraffin base with stabilizers and preservatives as may be required.

[0128] Injectable forms may contain between 10-1000 mg.

[0129] Compositions may be formulated in unit dosage form, i.e., in discrete portions containing a unit dose or a multiple or sub-unit of a unit dose.

[0130] Multiple therapeutic agents can be administered in any order or simultaneously. In an embodiment, a compound disclosed herein can be administered before or after treatment with another therapeutic agent. The multiple therapeutic agents can be provided simultaneously in a single, unified form or multiple forms, such as multiple separate pills. The agents can be packed together or separately, in a single package or several packages. One or all the therapeutic agents can be given in multiple doses. The timing between the multiple doses can vary to about a month, if not simultaneous.

[0131] Therapeutic agents described herein can be administered before, during, or after a disease or condition, and the timing of administering the composition containing a therapeutic agent can vary. For example, the compositions can be prophylactic and administered continuously to subjects with a propensity to conditions or diseases to lessen the likelihood of the disease or condition. The compositions can be administered to a subject during or as soon as possible after the onset of the symptoms. The administration of the therapeutic agents can be initiated within the first 48 hours of the onset of the symptoms, within the first 24 hours of the onset, within the first 6 hours, or 3 hours of the onset. The initial administration can be via any practical route, such as any route described herein using any formulation described herein.

[0132] Administration should be as soon as possible after the onset of a disease or condition is detected or suspected, and the length of time necessary for treating the disease should be from about one month to about three months. In an embodiment, the length of time the compound or compound is administered is about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 1 month, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 2 months, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 3 months, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 4 months, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 5 months, about 21 weeks, about 22 weeks, about 23 weeks, about 24 weeks, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 1 year, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months about 23 months, about 2 years, about 2.5 years, about 3 years, about 3.5 years, about 4years, about 4.5 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, or about 10 years. The length of treatment can vary for each subject.Dosage

[0133] A person of ordinary skill in the art can easily determine an appropriate dose of one of the instant compounds and compositions to administer to a subject without undue experimentation. Typically, a physician will determine the actual dosage that will be most suitable for an individual patient, and it will depend on a variety of factors, including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the individual undergoing therapy. The dosages disclosed herein are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited, which are within this disclosure’s scope.

[0134] Any of the compounds as disclosed herein can be administered either once or at various time intervals, depending on the required dosage regimen for a given period. For example, the dosage can be administered once, twice, three times, or four times daily. A compound can be applied until the desired therapeutic effect is achieved or maintained indefinitely. The appropriate dosage regimen for a chemical compound depends on its pharmacokinetic properties, such as absorption, distribution, and half-life, which can be determined by one of ordinary skill. Additionally, the dosage regimen suitable for a compound as disclosed herein includes the duration over which this regimen is applied.

[0135] In an embodiment, the dosage regimen is a pulse dose regimen. As used herein, “pulse dosing regimen” refers to a dosage regimen in which escalating therapeutic levels are delivered early in the dosing interval, followed by a prolonged dose-free period. Accordingly, in an embodiment, disclosed here is a pulsed dosing regimen comprising administering an effective amount of any one of the compounds (e.g., a compound of Formula (I), e.g., any one of Compounds 1-15).

[0136] Any of the compounds disclosed herein (e.g., a compound of Formula (I), e.g., any one of Compounds 1-15) can be present in a composition in a range of from about 1 mg to about 2000 mg; from about 100 mg to about 2000 mg; from about 10 mg to about 2000 mg; from about 5 mg to about 1000 mg, from about 10 mg to about 500 mg, from about 50 mg to about 250 mg, from about 100 mg to about 200 mg, from about 1 mg to about 50 mg, from about 50 mg to about 100 mg, from about 100 mg to about 150 mg, from about 150 mg to about 200 mg, from about 200 mg to about 250 mg, from about 250 mg to about 300 mg, from about 300 mg to about 350 mg, from about 350 mg to about 400 mg, from about 400 mg to about 450 mg, from about 450 mg to about 500 mg, from about 500 mg to about 550 mg, from about 550 mg to about 600 mg, from about 600 mg to about 650 mg, from about 650 mg to about 700 mg, from about 700 mg to about 750 mg, from about 750 mg to about 800 mg, from about 800 mg to about 850 mg, from about 850 mg to about 900 mg, from about 900 mg to about 950 mg, or from about 950 mg to about 1000 mg.

[0137] Any of the compounds disclosed herein (e.g., a compound of Formula (I), e.g., any one of Compounds 1—15) can be present in a composition in an amount of about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1050 mg, about 1100 mg, about 1150 mg, about 1200 mg, about 1250 mg, about 1300 mg, about 1350 mg, about 1400 mg, about 1450 mg, about 1500 mg, about 1550 mg, about 1600 mg, about 1650 mg, about 1700 mg, about 1750 mg, about 1800 mg, about 1850 mg, about 1900 mg, about 1950 mg, or about 2000 mg.

[0138] In an embodiment, a dose can be expressed in terms of an amount of the compound divided by the subject's mass, for example, milligrams per kilogram of the subject body mass. In an embodiment, a compound is administered in an amount ranging from about 5 mg / kg to about 50 mg / kg, 250 mg / kg to about 2000 mg / kg, about 10 mg / kg to about 800 mg / kg, about 50 mg / kg to about 400 mg / kg, about 100 mg / kg to about 300 mg / kg, or about 150 mg / kg to about 200 mg / kg.Combinations

[0139] Any of the compounds disclosed herein (e.g., a compound of Formula (I), e.g., any one of Compounds 1-15) may be administered in combination with one or more other active agents, for example, existing anticancer drugs available on the market. In such cases, the compounds disclosed herein may be administered consecutively, simultaneously, or sequentially with one or more active agents.

[0140] Anticancer drugs, in general, are more effective when used in combination. Combination therapy is desirable to avoid an overlap of major toxicides, mechanisms of action, and resistance mechanism(s). Furthermore, it is also desirable to administer most drugs at their maximum tolerated doses with minimum time intervals between such doses. The major advantages of combining chemotherapeutic drugs are that it may promote additive or possible synergistic effects through biochemical interactions and decrease the emergence of resistance in early tumor cells that would have been otherwise responsive to initial chemotherapy with a single agent. The administration of leucovorin demonstrates an example of the use of biochemical interactions in selecting drug combinations to increase the binding of an active intracellular metabolite of 5- fluorouracil to its target, thymidylate synthase, thus increasing its cytotoxic effects.

[0141] Numerous combinations are used in current treatments of cancer and leukemia. A more extensive review of medical practices may be found in “Oncologic Therapies,” edited by E. E. Vokes and H. M. Golomb, published by Springer.

[0142] Beneficial combinations may be suggested by studying the growth inhibitory activity of the test compounds with agents known or suspected of being valuable in the treatment of a particular cancer initially or cell lines derived from that cancer. This procedure can also be used to determine the order of administration of the agents, i.e., before, simultaneously, or after delivery. Such scheduling may be a feature of all the cycle-acting agents identified herein.Kits

[0143] The present disclosure also includes useful pharmaceutical kits, e.g., in treating cancer, which include one or more containers containing a pharmaceutical composition comprising a therapeutically effective amount of a compound of Formula (I) or any of the embodiments thereof. Such kits can include one or more conventional pharmaceutical kit components, such as, e.g., containers with one or more pharmaceutically acceptable carriers, additional containers, etc., as will be readily apparent to those skilled in the art. Instructions, either as inserts or labels, indicating quantities of the components to be administered, guidelines for administration, and / or guidelines for mixing the components, can also be included in the kit.

[0144] The disclosures will be described in greater detail through specific examples. The following examples are offered for illustrative purposes and are not intended to be limiting in any manner. Those with skill in the art will readily recognize a variety of non-critical parameters that can be changed or modified to yield essentially the same results. The compounds of the Examples have been found to kill cancer cells bearing TP53 mutations according to at least one assay described herein.General Definitions

[0145] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of common terms and techniques in molecular biology may be found in Molecular Cloning: A Laboratory Manual, 2ndedition (1989) (Sambrook, Fritsch, and Maniatis); Molecular Cloning: A Laboratory Manual, 4thedition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (F.M. Ausubel et al. eds.); the series Methods in Enzymology (Academic Press, Inc.): PCR2: A Practical Approach (1995) (M.J. MacPherson, B.D. Hames, and G.R. Taylor eds.): Antibodies, A Laboratory Manual (1988) (Harlow and Lane, eds.): Antibodies A Laboratory Manual, 2ndedition 2013 (E.A. Greenfield ed.); Animal Cell Culture (1987) (R.I. Freshney, ed.); Benjamin Lewin, Genes IX, published by Jones and Bartlet, 2008 (ISBN 0763752223); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 9780471185710); Singleton etal., Dictionary of Microbiology and Molecular Biology 2nded., J. Wiley & Sons (New York, N.Y. 1994), March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992); and Marten H. Hofker and Jan van Deursen, Transgenic Mouse Methods and Protocols, 2ndedition (2011).

[0146] As used herein, the singular forms “a,” “an,” and “the” include both singular and plural referents unless the context dictates otherwise.

[0147] The use of the term “or” in the claims is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or.”

[0148] The term “optional” or “optionally” means that the subsequently described event, circumstance, or substituent may or may not occur. The description includes instances where the event or circumstance occurs and instances where it does not.

[0149] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges and the recited endpoints.

[0150] The terms “about” or “approximately,” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of + / -10% or less, + / -5% or less, + / - 1% or less, and + / -0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosure. It is understood that the value to which the modifier “about” or “approximately” refers is also disclosed.

[0151] The term “alkyl,” employed alone or in combination with other terms, refers to a saturated hydrocarbon group that may be straight-chained or branched. “Cn-Cmalkyl” refers to an alkyl group with n to m carbon atoms. An alkyl group formally corresponds to an alkane with one C — H bond replaced by the point of attachment of the alkyl group to the remainder of the compound. In an embodiment, the alkyl group contains 1 to 6 carbon atoms, 1 to 4 carbon atoms, 1 to 3 carbon atoms, or 1 to 2 carbon atoms. Examples of alkyl moi eties include, but are not limited to, chemical groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, secbutyl; higher homologs such as 2 -methyl- 1 -butyl, n-pentyl, 3-pentyl, n-hexyl, 1,2,2- trimethylpropyl and the like.

[0152] The term “lower alkyl,” as used herein and unless otherwise specified, refers to a Ci to C4 saturated straight or branched alkyl group, including both substituted and unsubstituted forms as defined above.

[0153] The term “alkenyl,” employed alone or in combination with other terms, refers to a straight-chain or branched hydrocarbon group corresponding to an alkyl group having one or more double carbon-carbon bonds. An alkenyl group formally corresponds to an alkene with one C — H bond replaced by the point of attachment of the alkenyl group to the remainder of the compound. “Cn-m alkenyl” refers to an alkenyl group with n to m carbons. In an embodiment, the alkenyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms. Examples of alkenyl groups include but are not limited to ethenyl, n-propenyl, isopropenyl, n-butenyl, sec-butenyl, and the like.

[0154] The term “lower alkenyl,” as used herein and unless otherwise specified, refers to a Ci to Ce straight or branched alkenyl group, including both substituted and unsubstituted forms as defined above.

[0155] When combined with other terms, “halo” or “halogen” refers to fluoro, chloro, bromo, and iodo. In an embodiment, “halo” refers to a halogen atom selected from F, Cl, Br, or I. In an embodiment, halo groups are F.

[0156] The term “haloalkyl,” as used herein, refers to an alkyl group in which a halogen atom has replaced one or more hydrogen atoms. The term “Cn-Cmalkyl” refers to a Cn-Cmalkyl group having n to m carbon atoms and from at least one up to {2(n to m)+l [halogen atoms, which may either be the same or different. In an embodiment, the halogen atoms are fluoro atoms. In an embodiment, the haloalkyl group has 1 to 6 or 1 to 4 carbon atoms. Example haloalkyl groups include CF3, C2F5, CHF2, CH2F, CCI3, CHCh, C2CI5 and the like. In an embodiment, the haloalkyl group is a fluoroalkyl group.

[0157] Substituted and unsubstituted linear, branched, or cyclic alkenyl include, ethenyl (C2), 3-propenyl (C3), 1-propenyl (also 2-methylethenyl) (C3), isopropenyl (also 2-methylethen-2-yl) (C3), buten-4-yl (C4), and the like; substituted linear or branched alkenyl, non-limiting examples of which include, 2-chloroethenyl (also 2-chlorovinyl) (C2), 4-hydroxybuten- 1 -yl (C4), 7-hydroxy- 7-methyloct-4-en-2-yl (C9), 7-hydroxy-7-methyloct-3,5-dien-2-yl (C9), and the like.

[0158] The term “substituted” means that an atom or group of atoms formally replaces hydrogen as a “substituent” attached to another group. Unless otherwise indicated, the term “substituted” refers to any level of substitution, e.g., mono-, di-, tri-, tetra-, or penta-substitution, where such substitution is permitted. The substituents are independently selected, and substitution may be at any chemically accessible position. It is to be understood that substitution at a given atom is limited by valency. It is to be understood that substitution at a given atom results in a chemically stable molecule. The phrase “optionally substituted” means unsubstituted or substituted. The term “substituted” means a hydrogen atom is removed and replaced by a substituent. A single divalent substituent, e g., oxo, can replace two hydrogen atoms.

[0159] The term Cn Cm indicates a range that includes the endpoints, wherein n and m are integers and indicate the number of carbons. Examples include C1-C4, Ci-Ce, C3-C6, and the like.

[0160] The compounds described herein can be asymmetric (e.g., having one or more stereocenters). All stereoisomers, such as enantiomers and diastereomers, are intended unless otherwise indicated. Compounds of the present disclosure that contain asymmetrically substituted carbon atoms can be isolated in optically active or racemic forms. Methods of preparing optically active forms from optically inactive starting materials are known in the art, such as by resolution of racemic mixtures or stereoselective synthesis. Many geometric isomers of olefins, C=N double bonds, and the like can also be present in the compounds described herein, and all such stable isomers are contemplated in the disclosure. Cis and trans geometric isomers of the compounds of the present disclosure are described and may be isolated as a mixture of isomers or as separated isomeric forms. In an embodiment, the compound has the (R)-configuration. In an embodiment, the compound has the (S)-configuration.

[0161] The resolution of racemic mixtures of compounds can be carried out by any of the numerous methods known in the art. An example method includes fractional recrystallization using a chiral resolving acid, an optically active, salt-forming organic acid. Suitable resolving agents for fractional recrystallization methods are, for example, optically active acids, such as the D and L forms of tartaric acid, diacetyl tartaric acid, dibenzoyl tartaric acid, mandelic acid, malic acid, lactic acid or the various optically active camphor sulfonic acids such as (3 -camphor sulfonic acid. Other resolving agents suitable for fractional crystallization methods include stereoisomerically pure forms of a-methyl benzylamine (e g., S and R forms or diastereomerically pure forms), 2- phenylglycinol, norephedrine, ephedrine, N-methyl ephedrine, cyclohexyl ethylamine, 1,2- diamino cyclohexane, and the like.

[0162] Racemic mixtures can also be resolved by elution on a column packed with an optically active resolving agent (e.g., dinitrobenzoylphenylglycine). Suitable elution solvent composition can be determined by one skilled in the art.

[0163] As used herein, a “biological sample” may contain whole cells and / or live cells and / or cell debris. The biological sample may contain (or be derived from) a “bodily fluid.” The present disclosure encompasses embodiments wherein the bodily fluid is selected from amniotic fluid, aqueous humor, vitreous humor, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof. Biological samples include cell cultures, bodily fluids, and cell cultures from bodily fluids. Bodily fluids may be obtained from a mammal organism, for example, by puncture or other collecting or sampling procedures.

[0164] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, such as a mammal, such as a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells, and the progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.

[0165] “p53,” as used herein, refers to a wild-type p53 protein. In an embodiment, “tumor protein P53” (“TP53”) and “wild-type p53” are exemplified by full-length 393 amino acid human TP53 described in UniProtKB - P04637 (P53 HUMAN). In an embodiment, “mutant p53” refers to wild-type p53 protein with one or more changes to the protein sequence, including but not limited to single amino acid substitution, insertion of new amino acid(s) with or without frameshift, deletion of amino acid(s) with or without frameshift, and truncation.

[0166] “Overexpression,” “upregulation,” and grammatical equivalents, when used in reference to a protein (such as p53) produced by a cell of interest (such as a cancer cell), refers to the production of a higher level of the protein by the cell of interest compared to another cell (such as a control normal cell).

[0167] “Essential for proliferation” results in a statistically significant decline in proliferation upon perturbation (e.g., gene knockout or inhibition) relative to no perturbation or known non- essential controls using any art-accepted statistical analysis method.

[0168] The term “chimeric small molecule” refers to a chemical compound with low molecular weight (e.g., <2,000 Daltons) that binds to two proteins simultaneously.

[0169] The term “molecular glue” refers to a chimeric small molecule with positive cooperativity, such as binding one protein to the molecule, which increases the affinity for the second protein.

[0170] The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0171] Various embodiments are described hereinafter. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment(s). Reference throughout this specification to “one embodiment,” “an embodiment,” and “an example embodiment” means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the disclosure. Thus, the appearances of the phrases “in one embodiment,” “in an embodiment,” or “an example embodiment” in various places throughout this specification do not necessarily all refer to the same embodiment but many.

[0172] Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the disclosure. For example, in the appended claims, any of the claimed embodiments can be used in any combination.

[0173] Reference is made to US20230024905A1, US10138219B2, WO2021262483A1, WO2021061643A1, WO2022213975A1, WO2023016434A1, and US20230024905A1 herein.

[0174] All publications, published patent documents, and patent applications cited herein are hereby incorporated by reference to the same extent as though each publication, published patent document, or patent application was specifically and individually indicated as being incorporated by reference.EXAMPLES

[0175] General Procedures. Commercial reagents, without additional purification, were used for all syntheses. Round-bottom flasks were used for reactions with Teflon-coated magnetic stir bars. Reaction progress was monitored using ultra-performance liquid chromatography-mass spectrometry on a Waters ACQUITY UPLC I-Class 15 PLUS System with an ACQUITY SQ Detector 2. Nuclear magnetic resonance (NMR) spectra were generated using a Bruker AVANCE III HD 400 MHz spectrometer at room temperature f1FT NMR, 400 MHz;13C NMR 101 MHz). Chemical shifts for1H NMR and13C NMR are given in parts per million (ppm), referenced toresidual solvent signals. DMSO-de and CD3CN were acquired from Cambridge Isotope Laboratories, Inc. and Oakwood Products, Inc., respectively. ’HNMR data is reported as follows: chemical shift value in ppm, multiplicity (s = singlet, d = doublet, t = triplet, dd = doublet of doublets, and m = multiplet), coupling constant value in Hz, and integration value. Electrospray ionization-high-resolution mass spectrometry (ESI-HRMS) was performed.Example 1 - Synthesis of 2-(3-((2-methoxy-4-(methylsulfonyl)phenyl)amino)prop-l-yn-l-yl)-N-(l-methylpiperidin-4-yl)-l-(2,2,2-trifluoroethyl)-lH-indol-4-amine (PMV6, PMV6-NMe)

[0176] To a solution of 2-iodo-l-(2,2,2-trifluoroethyl)-lH-indol-4-amine (50 mg, 0.147 mmol, eNovation Chemicals) in ethanol (5 mL), l-methyl-4-piperidone (100 pL, 0.867 mmol) and acetic acid (50 pL, 0.874 mmol) were added, and the mixture was heated to 60 °C with strong stirring. After 30 minutes, sodium triacetoxyborohydride (300 mg, 1.415 mmol) was added and allowed to react overnight. After completion, the reaction was purified by reverse-phase HPLC (acetonitrile: water gradient up to 90%) to yield 2-iodo-N-(l-methylpiperidin-4-yl)-l-(2,2,2-trifluoroethyl)-lH- indol-4-amine as an off-white solid (26 mg, 0.0595 mmol, 40.5% yield). Subsequently, 2-iodo-N- (l-methylpiperidin-4-yl)-l-(2,2,2-trifluoroethyl)-lH-indol-4-amine (10 mg, 0.0229 mmol), 2- methoxy-4-(methylsulfonyl)-N-(prop-2-yn-l-yl)aniline (10 mg, 0.0418 mmol, 1 ClickChemistry), Pd(PPha)4 (4 mg, 0.00346 mmol), and Cui (2 mg, 0.0105 mmol) were combined and dissolved in DMSO. The mixture was heated to 50 °C with strong stirring as nitrogen bubbled through the mixture. DIPEA (20 pL, 0.115 mmol) was added to the mixture and reacted overnight under a nitrogen atmosphere. After completion, the reaction was purified by reverse-phase HPLC (acetonitrile: water gradient up to 90%) to yield the desired product as a light brown solid (3.1 mg, 0.00566 mmol, 24.7% yield). 'H NMR (400 MHz, DMSO-d6) 8 7.39 (dd, J = 8.4, 2.0 Hz, 1H), 7.26 (d, J= 2.1 Hz, 1H), 7.09 (s, 1H), 7.00 (t, J= 8.0 Hz, 1H), 6.89 (d, J= 8.4 Hz, 1H), 6.68 (d, J= 8.2 Hz, 1H), 6.49 (t, J = 6.2 Hz, 1H), 6.16 (d, J= 7.8 Hz, 1H), 5.49 (d, J= 7.9 Hz, 1H), 4.93 (q, J= 9.0 Hz, 2H), 4.36 (d, J= 6.2 Hz, 2H), 3.90 (s, 3H), 3.10 (s, 3H), 2.79 (d, J= 11.2 Hz, 2H), 2.19 (s, 3H), 2.08-1.98 (m, 2H), 1.92 (d, J= 12.6 Hz, 2H), 1.55-1.42 (m, 2H), 1.28-1.11 (m, 1H). M+H, C27H31F3N4O3S+H] m / z theoretical 549.2142, found 549.2138.Example 2 - Synthesis of tert-butyl-4-((2-(3-((2-methoxy-4-(methylsulfonyl)phenyl)amino)prop-l-yn-l-yl)-l-(2,2,2-trifluoroethyl)-lH-indol-4- yl)amino)piperidine-l-carboxylate (PMV6-NBoc)

[0177] To a solution of 2-iodo-l-(2,2,2-trifluoroethyl)-lH-indol-4-amine (45 mg, 0.133 mmol, eNovation Chemicals) in ethanol (5 mL), l-Boc-4-piperidone (95 pL, 0.537 mmol) and acetic acid (50 pL, 0.874 mmol) were added, and the mixture was heated to 50 °C with strong stirring. After 30 minutes, sodium triacetoxyborohydride (108 mg, 0.510 mmol) was added and allowed to react overnight. After completion, the reaction was purified by reverse-phase HPLC (acetonitrile:water gradient up to 90%) to yield tert-butyl-4-((2-iodo-l-(2,2,2-trifluoroethyl)-lH-indol-4- yl)amino)piperidine-l -carboxylate as an off-white solid (18 mg, 0.0344 mmol, 25.9% yield). All of this product, 2-methoxy-4-(methylsulfonyl)-N-(prop-2-yn-l-yl)aniline (16.5 mg, 0.0690 mmol, 1 ClickChemistry), Pd(PPhs)4 (4 mg, 0.00346 mmol), and Cui (2 mg, 0.0105 mmol) were combined and dissolved in DMSO. The mixture was heated to 50 °C with strong stirring as nitrogen bubbled through the mixture. DIPEA (36 pL, 0.207 mmol) was added to the mixture and reacted overnight under a nitrogen atmosphere. After completion, the reaction was purified by reverse-phase HPLC (acetonitrile :water gradient up to 90%) to yield the desired product as a brown solid (9.8 mg, 0.0155 mmol, 45.0% yield). 'H NMR (400 MHz, DMSO-d6) 57.39 (dd, J= 8.4, 2.0 Hz, 1H), 7.26 (d, J= 2.0 Hz, 1H), 7.06 (s, 1H), 7.01 (t, J= 8.0 Hz, 1H), 6.89 (d, J= 8.4 Hz, 1H), 6.70 (d, J= 8.3 Hz, 1H), 6.49 (t, J= 6.2 Hz, 1H), 6.22 (d, J= 7.8 Hz, 1H), 5.52 (d, J= 7.9 Hz, 1H), 4.93 (q, J = 9.1 Hz, 2H), 4.36 (d, J = 6.2 Hz, 2H), 3.90 (s, 3H), 3.10 (s, 3H), 2.96-2.80 (m, 2H), 1.93 (d, J = 11.6 Hz, 2H), 1.41 (s, 9H), 1.39-1.22 (m, 4H), 0.91-0.79 (m, 1H). M+H, C31H37F3N4O5S+H] m / z theoretical 635.2510, found 635.2499.Example 3 - Synthesis of (R)-4-((8-cyclopentyl-7-ethyl-5-methyl-6-oxo-5, 6,7,8- tetrahydropteridin-2-yl)amino)-3-methoxy-N-(15-(4-((2-(3-((2-methoxy-4- (methylsulfonyl)phenyl)amino)prop-l-yn-l-yl)-l-(2,2,2-trifluoroethyl)-lH-indol-4- yl)amino)piperidin-l-yl)-15-oxo-3,6,9,12-tetraoxapentadecyl)benzamide (Compound 1)

[0178] To a solution of (R)-4-(8-cyclopentyl-7-ethyl-5-methyl-6-oxo-5, 6,7,8- tetrahydropteridin-2-ylamino)-3-methoxybenzoic acid (10 mg, 0.0235 mmol, IClickChemistry) in DMSO (1 mL), NH2-PEG4-CH2CH2CO2tBu (20 pL, 0.0755 mmol), HATU (12 mg, 0.0315 mmol), and DIPEA (20 pL, 0.115 mmol) were added. After stirring for 15 minutes, trifluoroacetic acid (2 mL) was added and the reaction was stirred for 1 hour. After completion, the reaction was purified by reverse-phase HPLC (acetonitrile:water gradient up to 90%) to yield (R)-l-(4-((8- cyclopentyl-7-ethyl-5-methyl-6-oxo-5,6,7,8-tetrahydropteridin-2-yl)amino)-3-methoxyphenyl)- 1 -oxo-5, 8,1 l,14-tetraoxa-2-azaheptadecan- 17-oic acid (BI2536-PEG4-acid) as a white solid (10mg, 0.0149 mmol, 63.1% yield). tert-butyl-4-((2-(3-((2-methoxy-4- (methylsulfonyl)phenyl)amino)prop- 1 -yn- 1 -yl)- 1 -(2,2,2-trifluoroethyl)- lH-indol-4- yl)amino)piperidine-l -carboxylate (PMV6-NBoc, 8.2 mg, 0.0129 mmol) was dissolved in DCM (1 mL), and trifluoroacetic acid (2 mb) was added to the solution. After stirring for 1 hour, solvents were removed under reduced pressure. The residue was redissolved in DMSO (l mL), andBI2536- PEG4-acid (10 mg, 0.0149 mmol), HATU (6 mg, 0.0158 mmol), and DIPEA (20 pL, 0.115 mmol) were added to the solution. After completion (30 minutes), the reaction was purified by reversephase HPLC (acetonitrile:water gradient up to 90%) to yield PMV6-PEG4-BI2536 as a brown solid (5.6 mg, 0.00471 mmol, 36.5% yield). ‘H NMR (400 MHz, DMSO-d6) 5 8.47 - 8.37 (m, 2H), 7.85 (s, 1H), 7.61 (s, 1H), 7.50 (d, J= 7.3 Hz, 2H), 7.39 (dd, J= 8.3, 2.0 Hz, 1H), 7.26 (d, J = 2.0 Hz, 1H), 7.07 (s, 1H), 7.01 (t, J= 8.0 Hz, 1H), 6.89 (d, J= 8.4 Hz, 1H), 6.71 (d, J= 8.2 Hz, 1H), 6.49 (t, J= 6.3 Hz, 1H), 6.22 (d, J= 7.9 Hz, 1H), 5.53 (d, J= 8.0 Hz, 1H), 4.93 (q, J= 9.1 Hz, 2H), 4.39 - 4.27 (m, 4H), 4.24 (dd, J= 7.6, 3.6 Hz, 1H), 3.91 (d, J = 14.4 Hz, 6H), 3.87 (s, 1H), 3.61 (t, J= 6.7 Hz, 2H), 3.56 - 3.50 (m, 6H), 3.49 (d, J= 3. 1 Hz, 7H), 3.44 (dd, J= 12.6, 7.0 Hz, 2H), 3.25 (s, 3H), 3.18 (s, 3H), 3.14 (s, 1H), 3.10 (s, 3H), 2.76 (t, J= 12.0 Hz, 1H), 2.57 (t, J = 6.7 Hz, 2H), 2.07 - 1.84 (m, 5H), 1.83 - 1.71 (m, 3H), 1.70 - 1.55 (m, 3H), 1.42 - 1.22 (m, 2H), 0.76 (t, J = 1A Hz, 3H).13C NMR (101 MHz, DMSO-d6) 5 168.96, 166.29, 163.40, 154.79, 151.96, 147.15, 146.58, 141.83, 140.99, 138.80, 138.30, 132.68, 129.04 - 124.35 (m), 123.28 - 114.61 (m), 109.63, 109.10, 108.23, 107.61, 100.02, 99.10, 93.63, 73.76, 71.79 - 68.74 (m), 69.59, 67.35, 60.28, 58.85, 56.36 (d, J= 20.4 Hz), 49.23 (d, J= 32.7 Hz), 44.63 (d, J= 33.4 Hz), 33.29, 32.94, 32.68, 29.19, 28.87, 28.25, 26.95, 23.64, 23.39, 9.32. M+H, C59H75F3N10O11S+H] m / z theoretical 1189.5362, found 1189.5350.Example 3 - Synthesis of Compounds 2-9

[0179] Compounds 2-9 were synthesized based on the procedure provided for Compound 1.Table 1Example 4 - Synthesis of l-(4-(4-((2-allyl-l-(6-(2-hydroxypropan-2-yl)pyridin-2-yl)-3-oxo- 2,3-dihydro-lH-pyrazolo[3,4-d]pyrimidin-6-yl)amino)phenyl)piperazin-l-yl)-16-(4-((2-(3- ((2-methoxy-4-(methylsulfonyl)phenyl)amino)prop-l-yn-l-yl)-l-(2,2,2-trifluoroethyl)-lH- indol-4-yl)amino)piperidin-l-yl)-4, 7, 10,13-tetraoxahexadecane-l, 16-dione (Compound 10)

[0180] 2-allyl-l-(6-(2-hydroxypropan-2-yl)pyridin-2-yl)-6-(methylthio)-l,2-dihydro-3H- pyrazolo[3,4-d]pyrimidin-3-one (50 mg, 0.140 mmol, AaronChem) was dissolved in 4 mL of toluene and 3-chloroperbenzoic acid (32 mg, 0.185 mmol) was added and stirred for 1 hour. 1 - Boc-4-(4-aminophenyl)piperazine (46.6 mg, 0.168 mmol, Combi-Blocks) and triethylamine (100 pL, 0.718 mmol) were added to the solution and left to stir overnight. The reaction was purified by reverse-phase HPLC (acetonitrile:water gradient up to 90%) to yield adavosertib-NBoc as a green-brown solid (38 mg, 0.0648 mmol, 46.3% yield). Some of the resulting solid (30 mg, 0.0512 mmol) was dissolved in DCM (1 mL), and trifluoroacetic acid was added to the solution (1.5 mL). After stirring for 1 hour, the solvent and reactants were removed under reduced pressure. The resulting residue was dissolved in DMSO (2 mL); HATU (40 mg, 0.105 mmol), 3-oxo-2,6,9,12,15- pentaoxaoctadecan- 18-oic acid (acid-PEG4-mono-methyl ester, 50 pL, 0.162 mmol), and triethylamine (50 pL, 0.359 mmol) were added to the solution and the mixture was stirred for 30 minutes. LiOH (2M solution in H2O, 2 mL) was added to the solution and stirred for 1 hour. The reaction was purified by reverse-phase HPLC (acetonitrile:water gradient up to 90%) to yield adavosertib-PEG4-acid as a light yellow solid (25 mg, 0.0328 mmol, 64.0%). tert-butyl-4-((2-(3- ((2-methoxy-4-(methylsulfonyl)phenyl)amino)prop-l-yn-l-yl)-l-(2,2,2-trifluoroethyl)-lH-indol- 4-yl)amino)piperidine-l -carboxylate (PMV6-NB0C, 15.1 mg, 0.0238 mmol) was dissolved in DCM (1 mL), and trifluoroacetic acid (2 mL) was added to the solution. After stirring for 1 hour, solvents were removed under reduced pressure. The residue was redissolved in DMSO (1 mL), and adavosertib-PEG4-acid (25 mg, 0.0328 mmol), HATU (20 mg, 0.0526 mmol), andtriethylamine (40 pL, 0.287 mmol) were added to the solution. After completion (30 minutes), the reaction was purified by reverse-phase HPLC (acetonitrile:water gradient up to 90%) to yield Compound 10 as a yellow solid (15.3 mg, 0.0120 mmol, 50.4% yield). 'H NMR (400 MHz, DMSO-d6) 5 8.83 (s, 1H), 8.04 (t, J = 7.9 Hz, 1H), 7.76 (d, J = 8.1 Hz, 1H), 7.61 (t, J = 6.8 Hz, 3H), 7.40 (dd, J = 8.4, 1.9 Hz, 1H), 7.26 (d, J = 2.0 Hz, 1H), 7.10 - 6.86 (m, 4H), 6.71 (d, J = 8.3 Hz, 1H), 6.48 (t, J = 6.3 Hz, 1H), 6.23 (d, J = 7.8 Hz, 1H), 5.67 (ddt, J = 16.5, 10.2, 6.0 Hz, 1H), 5.51 (d, J = 7.9 Hz, 1H), 5.32 (s, 1H), 5.03 - 4.79 (m, 3H), 4.70 (d, J = 6.0 Hz, 1H), 4.35 (q, J = 5.8 Hz, 6H), 3.90 (s, 2H), 3.69 - 3.57 (m, 6H), 3.52 - 3.38 (m, 13H), 3.20 - 3.02 (m, 4H), 2.76 (t, J = 11.8 Hz, 1H), 2.60 (dt, J = 17.2, 6.9 Hz, 4H), 2.04 - 1.90 (m, 2H), 1.48 (s, 4H), 1.41 (d, J = 6.4 Hz, 4H), 1.36 - 1.14 (m, 1H), 1.30 (d, J = 11.5 Hz, 1H), 1.07 (t, J = 7.0 Hz, 7H).13C NMR (101 MHz, DMSO-d6) 5 169.30, 168.97, 168.06, 161.62, 161.46, 160.95, 156.45, 147.47 (d, J = 15.8 Hz), 146.58, 141.83, 140.98, 139.23, 138.29, 132.25 (d, J= 80.3 Hz), 129.05 - 124.63 (m), 122.57 (d, J= 164.8 Hz), 118.63 (d, J= 8.3 Hz), 118.46, 116.75, 116.58, 116.15, 109.09, 108.21, 107.60, 100.04, 99.08, 93.60, 73.75, 72.78, 71.51 - 68.75 (m), 67.32 (d, J = 8.0 Hz), 56.36 (d, J = 29.1 Hz), 51.20 - 48.17 (m), 47.05, 46.20 - 42.94 (m), 41.32, 39.16, 33.27 (d, J= 5.2 Hz), 32.93, 32.66, 31.88, 31.34, 30.87, 28.11 (d, J = 7.4 Hz), 18.97. M+H, C64H77F3N12O11S+2H] m / z theoretical 640.2827, found 640.2825.Example 5 - Synthesis of (R)-l-(3-(2-((8-(4-(((R)-8-cyclopentyl-7-ethyl-5-methyl-6-oxo- 5,6,7,8-tetrahydropteridin-2-yl)amino)-3-methoxybenzamido)octyl)amino)-2- oxoethoxy)phenyl)-3-(3,4-dimethoxyphenyl)propyl-(S)-l-((S)-2-(3,4,5- trimethoxyphenyl)butanoyl)piperidine-2-carboxylate (Compound 11)

[0181] To a solution of (R)-4-(8-cyclopentyl-7-ethyl-5-methyl-6-oxo-5, 6,7,8- tetrahydropteridin-2-ylamino)-3-methoxybenzoic acid (4 mg, 0.00941 mmol, IClickChemistry) in DMSO (1 mL), meta-AP1867 (6.5 mg, 0.00937 mmol, MedChemExpress), 1,8-diaminooctane (1.4 pL, 0.00952 mmol), HATU (8 mg, 0.0205 mmol), and DIPEA (20 pL, 0.115 mmol) were added to the solution. After completion (30 minutes), the reaction was purified by reverse-phase HPLC (acetonitrile:water gradient up to 90%) to yield the desired compound as an off-white solid (3.2 mg, 0.00261 mmol, 27.7% yield). M+H, CesHgoNsO +H] m / z theoretical 1227.6700, found 1227.669EExample 6 - Synthesis of (R)-9-acryloyl-N-((l-(l-(4-((8-cyclopentyl-7-ethyl-5-methyl-6-oxo-5,6,7,8-tetrahydropteridin-2-yl)amino)-3-methoxyphenyl)-l-oxo-5,8,ll,14-tetraoxa-2- azahexadecan-16-yl)-lH-l,2,3-triazoI-4-yl)methyl)-9H-carbazole-3-carboxamide (Compound 12)

[0182] To a solution of 9H-carbazole-3 -carboxylic acid (25 mg, 0.118 mmol, 1 ClickChemistry) in DMF (1 mL), propargylamine (20 pL, 0.313 mmol), HATU (50 mg, 0.128 mmol), and DIPEA (50 pL, 0.288 mmol) were added to the solution. After completion (30 minutes), the reaction was purified by reverse-phase HPLC (acetonitrile: water gradient up to 90%) to yield N-(prop-2-yn-l-yl)-9H-carbazole-3 -carboxamide as a white solid (20 mg, 0.0806 mmol, 68.3%). The resulting solid was dissolved in DMF (3 mL), and acrylic anhydride (60 pL, 0.521 mmol) and DIPEA (120 pL, 0.691 mmol) were added to the solution to react overnight. After completion, the reaction was purified by reverse-phase HPLC (acetonitrile :water gradient up to 90%) to yield 9-acryloyl-N-(prop-2-yn-l-yl)-9H-carbazole-3-carboxamide as an off-white solid (8.1 mg, 0.0268 mmol, 33.2% yield). To a solution of (R)-4-(8-cyclopentyl-7-ethyl-5-methyl-6- oxo-5,6,7,8-tetrahydropteridin-2-ylamino)-3-methoxybenzoic acid (7 mg, 0.0165 mmol, 1 ClickChemistry) in DMSO (1 mL), N3-PEG4-NH2(10 pL, 0.0382 mmol), HATU (8 mg, 0.0205 mmol), and DIPEA (20 pL, 0.115 mmol) was added to the solution. After completion (30 minutes), the reaction was purified by reverse-phase HPLC (acetonitrile:water gradient up to 90%) to yield (R)-N-(14-azido-3, 6,9, 12-tetraoxatetradecyl)-4-((8-cy cl opentyl-7-ethyl-5-methyl-6-oxo-5, 6,7,8- tetrahydropteridin-2-yl)amino)-3-methoxybenzamide as an off-white solid (5.5 mg, 0.00822 mmol, 49.8% yield). The resulting solid was dissolved in DMSO (1 mL) and combined with 9- acryloyl-N-(prop-2-yn-l-yl)-9H-carbazole-3-carboxamide (3.5 mg, 0.0116 mmol), CuBr (2 mg, 0.0140 mmol), THPTA (6 mg, 0.0138 mmol), and water (0.3 mL). After completion (10 minutes), the reaction was purified by reverse-phase HPLC (acetonitrile: water gradient up to 90%) to yield Compound 12 as an off-white solid (3.6 mg, 0.00370 mmol, 45.1% yield). A stock solution was created in DMSO, and a portion was set aside for 'H NMR characterization. Due to mixing with residual DCM in the NMR tube from cleaning, the portion of the stock that underwent NMR was discarded. ’HNMR (400 MHz, DMSO) spectrum is shown below. HRMS (top: observed, bottom: theoretical isotope pattern; M+H, C51H61N11O9+H] m / z theoretical 972.4726, found 972.4709.Example 7 - Synthesis of (R)-N-(22-chloro-9-oxo-3,6,13,16-tetraoxa-10-azadocosyl)-4-((8- cyclopentyl-7-ethyl-5-methyl-6-oxo-5,6,7,8-tetrahydropteridin-2-yl)amino)-3-methoxybenzamide (Compound 13)

[0183] To a solution of (R)-4-(8-cyclopentyl-7-ethyl-5-methyl-6-oxo-5,6,7,8- tetrahydropteridin-2-ylamino)-3-methoxybenzoic acid (10 mg, 0.0235 mmol, IClickChemistry) in DMSO (1 mL), NH2-PEG2-CH2CH2CO2tBu (20 pL, 0.0858 mmol), HATU (12 mg, 0.0315 mmol), and DIPEA (20 pL, 0.115 mmol) were added. After stirring for 30 minutes, trifluoroacetic acid (2 mL) was added and the reaction was stirred for 16 hours. After completion, the reaction was purified by reverse-phase HPLC (acetonitrile:water gradient up to 90%) to yield (R)-3-(2-(2- (4-((8-cyclopentyl-7-ethyl-5-methyl-6-oxo-5,6,7,8-tetrahydropteridin-2-yl)amino)-3- methoxybenzamido)ethoxy)ethoxy)propanoic acid (BI2536-PEG2-acid) as a yellow solid (7 mg, 0.0120 mmol, 51.1% yield). To a solution of the product in DMSO (1 mL), 2-(2-((6- chlorohexyl)oxy)ethoxy)ethan-l -amine hydrochloride (10 mg, 0.0385 mmol, MedChemExpress), HATU (8 mg, 0.0205 mmol), and DIPEA (20 pL, 0.115 mmol) was added to the solution. After completion (30 minutes), the reaction was purified by reverse-phase HPLC (acetonitrile:water gradient up to 90%) to yield HLDA-131 as a yellow solid (5.2 mg, 0.00658 mmol, 54.8% yield). ’H NMR spectra matched previously reported (Raina et al. 2023). HRMS (top: observed, bottom: theoretical isotope pattern; M+H, C39H60CIN7O8+H] m / z theoretical 790.4265, found 790.4254.Example 8 - Synthesis of 3-(2-(3-(4-(4-((2-allyl-l-(6-(2-hydroxypropan-2-yl)pyridin-2-yl)-3- oxo-2, 3-dihydro-lH-pyrazolo[3,4-d]pyrimidin-6-yl)amino)phenyl)piperazin-l-yl)-3- oxopropoxy)ethoxy)-N-(2-(2-((6-chlorohexyl)oxy)ethoxy)ethyl)propanamide (Compound 14)

[0184] Adavosertib-NBoc (synthesis described in the synthesis of Compound 10, 22.2 mg, 0.0379 mmol) was dissolved in DCM (1 mL), and TFA was added (3 mL); the mixture was left to stir for 1 hour, and solvents were evaporated under reduced pressure. The residue was dissolved in DMSO (2 mL). PEG2 diacid (7.8 mg, 0.0379 mmol) and 2-(2-((6- chlorohexyl)oxy)ethoxy)ethan-l -amine hydrochloride (9.8 mg, 0.0378 mmol) were added, followed by triethylamine (75 pL, 0.539 mmol) and HATU (31.6 mg, 0.0832 mmol). After completion (30 minutes), the reaction was purified by reverse-phase HPLC (acetonitrile:water gradient up to 90%) to yield adavosertib-PEG2-Halo as a yellow solid (12.2 mg, 0.0139 mmol, 36.7% yield). 'HNMR (400 MHz, DMSO-d6) 8 8.84 (s, 1H), 8.05 (t, J= 7.8 Hz, 1H), 7.88 (t, J = 5.6 Hz, 1H), 7.76 (d, J= 8.1 Hz, 1H), 7.65 - 7.58 (m, 1H), 7.60 (s, 1H), 6.96 (d, J= 8.7 Hz, 2H), 5.76 (s, 2H), 5.67 (ddt, J= 16.4, 10.2, 6.0 Hz, 1H), 5.32 (s, 1H), 5.04 - 4.96 (m, 1H), 4.83 (dq, J = 17.1, 1.5 Hz, 1H), 4.69 (d, J= 6.0 Hz, 2H), 3.69 - 3.55 (m, 9H), 3.48 (tp, J= 5.2, 2.7 Hz, 8H), 3.47 - 3.31 (m, 4H), 3.19 (q, J = 5.9 Hz, 2H), 3.12 (t, J = 5.1 Hz, 2H), 3.06 (t, J= 5.2 Hz, 2H), 2.63 (t, J= 6.6 Hz, 2H), 2.31 (t, J= 6.5 Hz, 2H), 1.75 - 1.63 (m, 2H), 1.50 (d, J= 6.8 Hz, 1H), 1.47 (s, 7H), 1.46 (s, 1H), 1.43 - 1.21 (m, 4H).13C NMR (101 MHz, DMSO-d6) 8 170.57, 169.26, 168.06, 161.60, 160.95, 156.49, 147.38, 139.27, 132.67, 131.85, 118.73, 116.75, 116.60, 72.79, 70.66, 70.08, 70.05, 69.98, 69.89, 69.58, 67.28, 55.38, 49.80, 49.32, 47.06, 45.81, 45.34, 41.32, 39.00, 36.51, 33.28, 32.48, 30.92, 29.53, 26.59, 25.39. M+H, C44H62CIN9O8+H] m / z theoretical 880.4483, found 880.4473.Example 9 Synthesis of (R)-N-(15-(4-((l-(2-chloroacetyl)-2-(3-((2-methoxy-4- (methylsulfonyl)phenyl)amino)prop-l-yn-l-yl)-3-methyl-lH-indol-4-yl)amino)piperidin-l- yl)-15-oxo-3, 6,9, 12-tetraoxapentadecyl)-4-((8-cyclopentyl-7-ethyl-5-methyl-6-oxo-5, 6,7,8- tetrahydropteridin-2-yl)amino)-3-methoxybenzamide (Compound 15)

[0185] 2-iodo-3-methyl-4-nitro-lH-indole (150 mg, 0.498 mmol) is dissolved in ethyl acetate (10 mL) and is heated to 70 °C with strong stirring. SnCL dihydrate (500 mg, 2.22 mmol) is added to the solution and was left to stir for two days. The solution is cooled to room temperature, and IM NaOH was added (30 mL). After mixing, the layers are separated, and the ethyl acetate layer is collected. The NaOH solution is then extracted with ethyl acetate (10 mL x 3). The combined ethyl acetate fractions are concentrated under reduced pressure and are purified by reverse-phase HPLC (acetonitrile :water gradient up to 90%). 2-iodo-3-methyl-lH-indol-4-amine is yielded as a beige powder (52 mg, 0.191 mmol, 38.4%). The product is dissolved in ethanol (5 mL), and 1- Boc-4-piperidone (240 pL, 1.357 mmol) and acetic acid (50 pL, 0.874 mmol) are added, and the mixture is heated to 60 °C with strong stirring. After 30 minutes, sodium triacetoxyborohydride (650 mg, 3.067 mmol) is added and the mixture is allowed to react for 6 hours. After completion, the reaction is purified by reverse-phase HPLC (acetonitrile: water gradient up to 90%). Tert-butyl- 4-((2-iodo-3-methyl-lH-indol-4-yl)amino)piperidine-l-carboxylate is yielded as an off white solid (23 mg, 0.0505 mol, 26.4%). To all this product, 2-methoxy-4-(methylsulfonyl)-N-(prop-2- yn-l-yl)aniline (25 mg, 0.105 mmol), Pd(PPhs)4 (4 mg, 0.00346 mmol), and Cui (2 mg, 0.0105 mmol) are combined and dissolved in DMSO. The mixture is heated to 50 °C with strong stirring as nitrogen bubbled through the mixture. Et N (30 pL, 0.216 mmol) is added to the mixture, and is allowed to react overnight under a nitrogen atmosphere. After completion, the reaction is purified by reverse-phase HPLC (acetonitrile: water gradient up to 90%).Tert-butyl-4-((2-(3-((2- m ethoxy -4-(m ethyl sulfonyl)pheny l)amino)prop- 1 -yn- 1 -y 1 ) -3 -methyl- 1 H-indol-4- yl)amino)piperidine-l -carboxylate is yielded as a brown solid (6.2 mg, 0.0110 mmol, 21.8%). The product is dissolved in THF (1.5 mL) at 0°C, and 1.5 equivalents of NaH are added, followed by 1.1 equivalents of chloroacetyl chloride. After 1 day, the reaction is purified by reverse-phase HPLC (acetonitrile: water gradient up to 90%). Tert-butyl-4-((l-(2-chloroacetyl)-2-(3-((2- m ethoxy -4-(m ethyl sulfonyl)phenyl)amino)prop- 1 -yn- 1 -y 1 ) -3 -methyl- 1 H-indol-4- yl)amino)piperidine-l -carboxylate is yielded. The resulting product is dissolved in DCM (1 mL),and trifluoroacetic acid (3 mL) is added to the solution. After stirring for 1 hour, solvents are removed under reduced pressure. The residue is redissolved in DMSO (1 mL) and (R)-l-(4-((8- cyclopentyl-7-ethyl-5-methyl-6-oxo-5,6,7,8-tetrahydropteridin-2-yl)amino)-3-methoxyphenyl)- 1 -oxo-5, 8,1 l,14-tetraoxa-2-azaheptadecan- 17-oic acid (5 mg, 0.0745 mmol), HATU (3 mg, 0.0789 mmol), and DIPEA (20 pL, 0.115 mmol) are added to the solution. After completion (30 minutes), the reaction is purified by reverse-phase HPLC (acetonitrile:water gradient up to 90%). The desired product is yielded.Example 10 - P53 protein abundance is a therapeutic window across / / T -mutant cancers and is targetable with proximity-inducing small molecules.

[0186] TP 53 mutant cancers are responsible for the majority of cancer deaths, and the most common mechanism of p53 inactivation is missense mutation. Such mutations in TP53 result in a robust upregulation of the p53 protein. This example demonstrates an induced proximity approach that selectively kills TP53 mutant cells. This approach utilizes the increased abundance of p53 protein in TP53 mutant cancer cells to concentrate toxic molecules in cells. The first generalizable strategy is identified using a small molecule to kill TP53 mutant cells selectively. This molecule binds to the Y220C mutant of p53 and concentrates a PLK1 inhibitor in cells harboring TP53'{27acmutations. Together, these data demonstrate that the abundance of p53 protein is a therapeutic window for TP53 missense mutant cancers and can be translated into a cell death signal with proximity-inducing small molecules.ResultsTP53 mutant cells are not associated with synthetic lethality for any genes nor enriched for compound sensitivity

[0187] Large scale functional genomic studies have recently been undertaken to systematically determine the genetic vulnerabilities of nearly a thousand cancer cell lines34’35. Applicants sought to test the hypothesis that there exist synthetic lethal interactions with TP53 mutant cancer cells. Applicants performed a genome-wide analysis of CRISPR dependencies in cells with TP53 mutations vs. wild-type (WT) cell lines. Unfortunately, there is no genetic dependency that is enriched in cancer cells with TP53 loss-of-function mutations (FIG. 1A; consistent with a prior report22), nor any profiled small molecules selectively killing TP53 mutant cells (FIG. 7A-B). Onemight instead hope that a subset of proteins are enriched in cells with TP53 mutations, particularly cell surface proteins that might be amenable to targeting with a number of effector modalities such as CAR-T or antibody-drug conjugates. Unfortunately, no such cell-surface proteins are enriched in TP53 mutant cancers (FIG. IB, FIG. 7C).TP53 mutant cells show significant upregulation of p53 protein

[0188] Quantitative proteomics of the Cancer Cell Line Encyclopedia (CCLE)36shows that the only protein whose abundance is substantially and significantly increased in TP53 mutant cancers is p53 itself (FIG. IB; A(Z-scored Abundance)Mut-wT > 2, <7<O.O5). p53 protein is expressed at a low level in TP53^ cancer cells but is elevated in TP53 missense mutant cells (FIG. 1C; >2-fold increase in mean RPPA signal), for both monoallelic and bi allelic mutations as well as structural (e.g. Y220C) and contact mutants (e.g. R273H) (FIG. 7D-E). Correspondingly, immunohistochemistry of p53 in tumor tissues shows abundant staining in cancer cells, but not adjacent normal tissue (FIG. ID). Taken together, these data demonstrate that the only genetic dependency or substantial proteomic difference between TP53 mutant cells and WT cells, detected to date, is the overabundance of p53 protein in TP53 mutant cells.

[0189] The increased abundance of the p53 protein in cancer cells with TP53 missense mutations provides a unique therapeutic opportunity: a p53 concentration-dependent toxin could selectively kill TP53 mutant cancer cells in a way that is generalizable to multiple p53 missense mutations.Bifunctional compounds kill cells based on p53 protein abundance

[0190] Applicants therefore hypothesized that if the abundance of p53 protein could be translated into a proportionate cell death signal, TP53 missense mutant cells could be selectively killed. Applicants hypothesized that bifunctional compounds consisting of a p53 binder and a small molecule toxin may be able to concentrate the toxin in cells overexpressing mutant TP5333. Unfortunately, no high affinity ligands for WT p53 exist. In the absence of such ligands, Applicants used the Halo-tag as a surrogate for a small molecule binder of p53. Mutant p53R273Hwas stably expressed in 293T cells fused to a Halo-tag and mCherry for visualization. The fusion protein showed nuclear expression similar to native p53 (FIG. 8A).

[0191] To leverage the abundance of p53 protein for therapeutic purposes, a bifunctional compound would ideally be designed such that its binding partner is less abundant than overexpressed mutant p53 protein and highly essential for cell proliferation. To determine which cytotoxin to append to a potential bifunctional compound, Applicants compared CRISPR gene essentiality scores across Dependency Map37and absolute protein abundance profded in OpenCell38(FIG. 2A). Applicants identified five targets with high essentiality and low abundance: DNA2, WEE1, LRR1, PRELID 1, and PLK1 (FIG. 2 , see Methods). Of these, WEE1 and PLK1 have ligands previously used to synthesize bifunctional compounds for targeted protein degradation39 41. Applicants functionalized WEE1 inhibitor adavosertib42(IC50 = 5.2 nM for cell- free WEE1 inhibition) and an analog of PLK1 inhibitor BL253643(IC50 = 0.83 nM for cell-free PLK1 inhibition), both of which display potent antiproliferative effects across DepMap (adavosertib median IC50: 348 nM, BL2536 median IC50: 11.8 nM; FIG. 8B-C), with a Halo-tag ligand and PEG2 linker, yielding the bifunctional compounds Compound 14 and Compound 13 (FIG. 2B, FIG. 8D)

[0192] Compound 13 inhibited proliferation of 293T cells stably expressing Halo- p53R273H(FL)-mCherry at doses between 20 nM - 500 nM, with little impact on the proliferation of parental 293T cells (FIG. 2C-D, p53R273H293T IC50: 23 nM, parental 293T IC50: 1143 nM). When competing Halo-p53R273H(FL)-mCherry 293T cells with parental 293T cells in the presence of Compound 13 (200 nM), Applicants observed a 1200-fold decline in the population of mCherry+ cells after one week (0.04% vs. 47.94% for DMSO control; FIG. 2E). These results were reproducible in a competition assay between the parental p53 null (TP53 homozygous deletion) Calu-1 cell line and Calu-1 cells stably expressing Halo-p53R273H(FL)-mCherry (FIG. 8E, EC 50 = 13 nM). Furthermore, treatment of Halo-p53R273H(FL)-mCherry 293T cells with low doses of Compound 13 resulted in selection for low expressors of the fusion protein (FIG. 8A). Compound 14 also selectively inhibited proliferation of Halo-p53R273H(FL)-mCherry 293T cells in the competition assay at doses between 100 nM - 1 pM (FIG. 8F, EC50 = 41 nM).

[0193] To assess the therapeutic window obtained by this strategy, Applicants established Calu-1 cell lines stably expressing Halo-p53(FL)-mCherry and mTagBFP2 from the same transcript using 2A peptides. Applicants established versions of this cell line for p53W Tand p53R273H. Applicants confirmed that these cell lines displayed approximately equal expression ofthe transgene by RT-qPCR for the transcript and FACS for mTagBFP2 (FIG. 2F, Mean [7 / <53w lmRNA] / [ZP53R273HmRNA] = 1.14; Mean mTagBFP2 MFI p53WT / p53R273H= 0.77). Applicants then compared expression of Halo-p53(FL)-mCherry between the cell lines using FACS for mCherry and found 30.2-fold greater expression of Halo-p53R273H(FL)-mCherry compared to Halo-p53WT(FL)-mCherry (FIG. 2G). Applicants next assessed whether the 30x increase in p53 protein abundance was targetable. Indeed, Compound 13 had no effect on the proliferation of Calu- 1 p53WTcells at doses of < 2 pM. However, in Calu-1 p53R273Hcells, Applicants observed significant viability declines starting at 125 nM, with an IC50 = 402 nM after 4 days of treatment. BI-2536 alone lacked a differential proliferation effect (FIG. 2H). Applicants repeated this experiment for the p53Y220Cmutation. Calu-1 p53Y220Ccells displayed 18.6-fold greater mCherry expression than p53WTcounterparts with similar mTagBFP2 expression levels, corresponding to a ~4-fold therapeutic window for Compound 13 (FIG. 8G-H). This change in protein abundance is consistent with the reported p53Y220Cin cellulo half-life (i.e. in the presence of cellular chaperones) between 10-13 hours from cycloheximide chase experiments44(compared to the wild-type p53 half-life of minutes in quiescent cells), implying that Y220C destabilizes an active conformation of p53 rather than reducing p53 protein abundance.

[0194] Prior reports have suggested that the enhanced efficacy of similar bifunctional compounds can occur due to accumulation of small molecules in cells expressing high concentrations of the protein target33. Applicants therefore modeled reaction-diffusion kinetics of Compound 13 using ordinary differential equations (see Methods) to gain more insights into the enhanced toxicity observed in the presence of a ligandable p53 fusion protein. Previously reported increases in p53 protein half-life upon mutation greatly influence the expected accumulation of the bifunctional compounds28,29. In particular, an increase in half-life from the WT p53 half-life of 16 minutes to a mutant p53 half-life of 17 hours is expected to increase final intracellular concentration of the small molecule at steady-state by 2-3 orders of magnitude depending on the initial concentration (FIG. 21). Together, these data suggest that if a bifunctional compound combining a cytotoxic molecule with a small molecule ligand of p53 were developed, the high protein abundance of mutated p53 would allow for differential cell killing.Bifunctional compounds selectively kill pS3y22UCmutant cells

[0195] To assess the impact of bifunctional compounds containing p53-binding and cytotoxic moieties in an endogenous cellular context, Applicants synthesized bifunctional compounds that bind to p53Y220C. This mutant indirectly inhibits DNA binding activity through the loss of DNA- binding domain thermal stability43. The removal of a bulky tyrosine residue, creating a pocket, and its replacement with a ligandable cysteine makes it an attractive target for small molecule refolders meant to restore transcriptional activity46 3as well as to bifunctional cytotoxic strategies. Applicants initially used acrylamide KG5 as the p53't 220Cbinder in a PLKl-directed bifunctional; KG5 is a carbazole-based covalent fragment liganding >95% of p53Y220Cat 10 pM49. Applicants synthesized Compound 12 and did not observe any difference in cell survival between 293T cells stably expressing Halo-p53Y220CATAD-mCherry (transactivation domain deleted to remove confounding protein stabilization effects) and parental 293T cells in an 8-day competition assay (FIG. 3D, FIG. 9 A).

[0196] Applicants surveyed the patent literature and identified a p53Y220Cbinding pharmacophore consisting of an o-anisidine moiety linked to an indole and piperidine (US20230024905A1, US10138219B2, WO2021262483A1, WO2021061643A1,WO2022213975A1, WO2023016434A1, incorporated herein by reference in their entirety). These binders are exemplified by PMV6, a compound identified in a structure-activity relationship series by PMV Pharma, with close similarity to the recently disclosed structure of the investigational compound, rezatapopt, which has a Kd ~ 2.5 nM for p53Y220C(PMV6, p. 96: US20230024905A1)52. PMV6 induces an 8°C thermal shift of pSS^2200(p 21: US20230024905A1). The co-crystal structure with p53Y220Cshowed that the compound binds to a shallow groove created by the Y220C mutation, with the piperidine facing the solvent. To construct a bifunctional compound containing PMV6 and BI-2536, Applicants functionalized PMV6 at the solvent-exposed piperidine, which was functionalized in other analogs that continued to bind p53'220Cvia thermal shift assay (Compound 7 & Compound 10, p. 21&96: US20230024905A1).

[0197] Applicants synthesized Compound 1 (Compound 1, FIG. 3A) and confirmed that Compound 1 , but not binders PMV6 or BI-2536 alone, induce ternary complex formation between p53Y220Cand PLK1 using a NanoBiT assay in 293T cells co-transfected with mEGFP-PLKl-SmBiT and NLS-LgBiT-p53Y220C(DBD) (FIG. 3B, FIG. 9B, EC50 = 1.4 pM). As an alternative method to demonstrate ternary complex formation, Applicants assessed protein colocalization upon compound treatment33-56. Live cell imaging of 293T cells co-transfected with mEGFP- PLKl-SmBiT and Halo-p53Y220CATAD-mCherry revealed diffuse PLK1 localization throughout the cell, with strong enrichment in an extranuclear region, possibly the centrosome as previously reported57, while p53Y220Cwas constitutively nuclear. In non-mitotic cells, Compound 1 treatment resulted in PLK1 nuclear enrichment and colocalization with p53Y220C, while p53Y220Calso entered the extranuclear region colocalizing with PLK1. In untreated mitotic cells, p53Y220Cappeared localized to chromatin while PLK1 was localized elsewhere in the cell. Upon Compound 1 treatment, PLK1 became colocalized with p53Y220Con chromatin; binders alone had no impact on localization (FIG. 3C, FIG. 9C). Applicants speculate this mislocalization could disrupt the function of PLK1 as a mitotic kinase beyond simple steric blockade of its active site.

[0198] Applicants performed an 8-day growth competition experiment between Halo- p53Y220CATAD-mCherry and parental 293T cells and observed strong selection against p53Y220C+ cells (mCherry+) when Compound 1 was dosed between 250 nM - 2 pM (Emax: 21.5-fold decline in the mCherry+ fraction, EC50 = 443 nM). Applicants did not observe any activity from nonfunctionalized binders or control compounds, including PMV6, BI2536, Compound 11, or selinexor. Applicants also did not observe any activity of Compound 1 in either 293T or Calu-1 cells expressing Halo-p53R273H(FL)-mCherry (FIG. 3D, FIG. 8E). The differential antiproliferative activity of Compound 1 in Halo-p53't 220CTAD-mCherry 293T cells was validated with crystal violet staining (FIG. 3E, FIG. 9D). An analogous bifunctional compound constructed with a WEE1 inhibitor (Compound 10) was unable to selectively inhibit proliferation of p53Y220C+ cells (FIG. 9E-F).

[0199] Applicants next monitored for induction of apoptosis using caspase-3 / 7 gio and annexin / PI staining. Compound 1, but not either binder alone, differentially induced apoptosis in Halo-p53Y220CATAD-mCherry versus parental 293T cells (FIG. 3F-G, FIG. 9G-H). To confirm the effects of the system were protein dosage dependent, Applicants utilized a dox-inducible Halo- p53I 220CATAD-mCherry construct in 293T cells and were able to increase the potency of Compound 1 approximately 2-fold without impacting potency of either PMV6 or BI2536 (FIG. 91). To confirm that the effects were mediated by compound binding to p53Y220C, Applicantsrepeated the Halo-p531t 220CATAD-mCherry / parental 293T competition experiment using a 10-fold excess of PMV6, observing partial rescue (Compound 1 alone [250 nM]: 8.9-fold decline in mCherry+%, Compound 1 + PMV6 [2.5 pM]: 2.1-fold decline in mCherry+%, / J<0.001 ) (FIG. 3H)

[0200] PLK1 activity is critical for mitotic progression, and its inhibitor, BI-2536, has been previously shown to induce G2 / M arrest and genome doubling38. Applicants monitored DNA content following treatment of synchronized Halo-p53'1220CATAD-mCherry and parental 293T cells with Compound 1 or binders for 1 day. Low dose Compound 1 (0.75 pM) resulted in accumulation of Halo-p53Y220CATAD-mCherry 293T cells with 4N DNA content leaving parental cells unaffected, while a higher dose (1.5 pM) induced genome doubling (accumulation of cells with 8N DNA content) in -60% of Halo-p53Y220CATAD-mCherry 293T but <10% of parental cells, phenocopying high dose BI-2536 (10 nM) treatment (FIG. 31). To confirm the effect was due to differential PLK1 inhibition, Applicants performed Western blots for PLK1 substrates including cyclin B l (which accumulates upon PLK 1 inhibition) and using an antibody against phospho-PLKl binding motif (PLK1 binding partners and substrates). Compound 1 once again phenocopied BI2536 specifically in Halo-p53Y220CATAD-mCherry 293T but not in parental cells, with PMV6 having no effect. Together, these data indicate that a bifunctional compound that both binds to p53Y220Cand binds to and inhibits PLK1, can selectively inhibit proliferation of cells expressing 7P53Y220Cdue to enhanced PLK1 inhibition, leading to mitotic arrest. p53Y220C-PLKl bifunctional compounds do not function through p53 reactivation and are active in endogenous settings

[0201] Applicants next analyzed whether the mechanism of action for Compound 1 is distinct from that for PMV6, a reactivator of p53Y220C. Applicants performed RNA sequencing of Huh7 hepatocellular carcinoma cells (homozygous pSS^220C Y220C) treated with Compound 1 (4 pM) and PMV6 (4 pM) for one day. Applicants observed strong induction of a p53 signature by PMV6, including >10-fold upregulation of p53 targets such as MDM2, CDKN1A, GDP 15, and PUMA (BBC3), and downregulation of genes essential for proliferating cells such as TOP2A. Manual inspection of a set of high confidence p53 transcriptional targets, and gene set enrichment analysis (GSEA) of a larger group of consensus p53 targets confirmed strong upregulation of these genesby PMV6 (NES = 2.68) but not Compound 1 (NES = 1.33) (FIG. 4A-C, FIG. 10A). Thus, Compound 1 does not appear to act by a transcriptional mechanism of p53 reactivation.

[0202] Applicants subsequently established p53Y220C+ cell lines stably expressing a p53 luciferase reporter39. In Huh7 cells (p53'22oc 22oc^ PMV6 was able to induce activity of the reporter at doses of 1.25 - 10 pM (ECso = 2.4 pM), while Compound 1 and BI-2536 had no such effect. Applicants repeated the p53 reporter experiments in the p53Y220C+ endometrial cancer cell line MFE319, where no induction of luciferase activity for any compound (Compound 1, PMV6, BI-2536) was observed (FIG. 4D). Note that MFE319 has both p53'1220Cand p53R273Cmutations reported in the CCLE dataset33. Analysis of paired RNA sequencing reads in this cell line revealed that the mutations were in trans (FIG. 10B) It is possible that the additional dominant negative p53 mutation in this cell line prevents p53 reactivation by p53Y220Cre-folders (e.g. PMV6), plausibly due to poisoning of the tetramer even in the presence of correctly functioning pSS^2200proteins. The strategy presented in this paper, using p53Y220Cto concentrate a toxin in cells, is unlikely to be impacted by the additional p53R273Cmutation. This would result in a -20% greater scope of treatable cancers for PLKl-p53Y220Cbifunctional compounds compared to p53'1220Creactivators (FIG. 4E-F, as determined by analysis of p53Y220Cmutant cancers in TCGA60with additional TP 53 mutations).

[0203] Lastly, Applicants wanted to assess whether the effects of Compound 1 in MFE319 were dependent on its interaction with p53Y220C. Indeed, Applicants were able to partially compete the decline in cell viability induced by Compound 1 in MFE319 using PMV6 (FIG. 4G, P<0.001). Additionally, Applicants established MFE319 p53 knockout cells by stably expressing sgTP53- Cas9-EGFP. In competition with parental MFE319 cells, Compound 1 was able to significantly enrich an EGFP+ population at doses between 800 nM - 1.25 pM. BI-2536 and PMV6 had no such activity (FIG. 4H) As further evidence of on-target activity, Applicants cultured Halo- p53Y220CATAD-mCherry 293T cells for 3 weeks in the presence of low doses of Compound 1 (< 250 nM) and observed the expansion of an mCherry negative population (FIG. 41, 6.9-fold expansion of mCherry negative fraction at 250 nM). Furthermore, Compound 1 trended towards superior activity across a panel of p53Y220C+ cancer cell lines compared to p53Y220Cnegative counterparts (FIG. 10C-D). Altogether, these data indicate that Compound 1 has activity in celllines expressing TP53'220C, distinct from PMV6 (not through p53 reactivation), and its activity is dependent on its interaction with p53Y220C.Linker optimization improves the efficacy of p53Y220C-PLKl bifunctional compounds

[0204] Applicants created a library of nine PMV6-BI2536 bifunctional compounds (Compounds 1-9) with varying linker lengths (4.33 - 22.22 A) and assessed their efficacy in competition assays between parental and Halo-p53'1220CTAD-mCherry 293T cells (FIG. 5A). Applicants observed no consistent effect of linker length on compound efficacy in general, although shorter alkyl linkers outperformed longer alkyl linkers. PEG(2,4,6) linkers all performed similarly. The most potent compound: Compound 8 (P-alanine linker), was over 1.5 orders of magnitude more potent than Compound 1 in the competition assay (Compound 8 EC50: 25 nM, Compound 1 EC 50: 850 nM) (FIG. 5B-C). Activity of compounds strongly correlated with their ability to form ternary complexes in the mEGFP-PLKl-SmBiT / NLS-LgBiT-p53Y220C(DBD) NanoBiT system (FIG. 5B, FIG. 5D). These data indicate that substantial improvements to the efficacy of p53Y220C-PLKl bifunctional compounds are possible going forward.Discussion

[0205] TP53 mutations remain the dominant mutation associated with death from human cancers3. While there have been prior reports of mutation-agnostic small molecule re-folders of p53, these molecules have later been found to lack the desired activity17 18. To Applicants knowledge, the compounds reported in this manuscript represent the first generalizable strategy using small molecules to specifically kill cancer cells bearing TP53 mutations. This strategy reveals one critical insight: that p53-targeted drugs need not restore native p53 function, but can instead use differential p53 protein abundance or mutant specific ligands to bring about a TP53 mutant selective therapy. Here, Applicants use the high intracellular concentration of the missense mutant p53 protein to induce cancer-selective cell death. The prior observation that members of the manumycin polyketide family of natural products are molecular glues between p53 and UBR761indicate that molecular glues involving p53 are indeed possible.

[0206] More work will be needed to extend this strategy to other missense mutants. Because most sources of cell stress can induce the accumulation of p53, the optimal pan-p53 selective compounds are likely to be covalent and dosed in pulses such that the therapeutic window betweencancer and normal tissue is maximized. PLK1 inhibition in cells with high levels of wild-type p53 may be tolerated since these cells could be growth arrested. Other future compounds may bind selectively to mutant p53 proteins whose surface allows for selective small molecule binding. Furthermore, targeting certain essential genes may promote accumulation of mutant p53 protein, as was shown for WEE1 degraders recently63, possibly enabling larger therapeutic windows.

[0207] Clinical-grade compounds that can specifically kill cells with increased p53 abundance can be generated and they may enjoy roles outside of cancer therapy. In one example, p53 is highly expressed in senescent cells and deficiency of MDM2 causes a progeroid syndrome in humans64,65. p53-targeting compounds of this class could function as senolytics.

[0208] New targeted therapies are inevitably followed by the emergence of on-target and off- target resistance mechanisms. As Applicants have demonstrated, cancer cells evolved resistance by decreasing mutant p53 protein expression upon chronic exposure to intermediate doses of these compounds. These results reflect the observation that antigen loss follows exposure to cytotoxic agents whose activity depends on antigen presence. Nonetheless, Applicants hope that in the fullness of time, gain-of-function p53-selective compounds will allow for sufficient specific killing of cancer cells such that in combination with other therapies, a greater fraction of patients will achieve meaningful remissions.Methods

[0209] General Methods. Measurements / experiments were performed in triplicate unless otherwise specified. All statistical tests were two-tailed; heteroscedastic t-tests were used for pairwise comparisons unless otherwise specified. Points with error bars are plotted as mean ± standard deviation unless otherwise specified; boxplots lines represent QI - 1.5IQR, QI, median, Q3, Q3 + 1.5IQR.

[0210] Cancer Genomics Analyses. CRISPR dependency scores, RPPA Z-scored protein expression, RNA-seq, TP53 mutation calls, and compound sensitivity data were downloaded from the DepMap portal (depmap.org / portal / )37. Human cell surface proteins (N=1492) were previously reported67. Protein abundance in 293 T cells was downloaded from OpenCell38. Immunohistochemistry images were downloaded from the Human Protein Atlas66. To identify genes that were both essential and had low protein abundance, Applicants filtered to those with mean Chronos scores < -2 and with protein abundance < 920 nM (p53 protein abundance in 293Tcells). Applicants ranked the remaining genes based on (logio(protein concentration) + mean Chronos score) and identified those with the lowest score using this metric.

[0211] MFE319 TP53 Mutation Analysis. MFE319 paired RNA-seq reads were downloaded from CCLE (SRR8615235)35. The reads were aligned directly to the p53 major isoform mRNA transcript fasta (NM_000546.6) using STAR68. The resulting .bam file was visualized in IGV69. Read pairs spanning both mutated residues (Y 220C, R273C) were used to infer the mutations were in trans.

[0212] Modeling of Compound Accumulation. Applicants assume the cell membrane is permeable to the bifunctional small molecule, allowing it to freely diffuse. Applicants also assume p53 is in greater abundance than the other target bound by the bifunctional small molecule, such that the binding of the other target does not contribute meaningfully to intracellular trapping of the molecule. Applicants define the following variables: [MAO] is the initial concentration of the bifunctional small molecule outside of the cell (which is a parameter Applicants vary). [MBO]=O is the initial concentration of the bifunctional small molecule inside the cell. [Po]=le-6 M is the initial intracellular concentration of the p53 (defined based on abundance from OpenCell38). [MPo]=O is the initial intracellular concentration of the molecule-p53 complex. Applicants also define constants for diffusion (kdirr = le3 s’1), binding of a pharmaceutically optimized bifunctional molecule to p53 (kbind = 8.7e5 M’1s’1), dissociation of a pharmaceutically optimized bifunctional molecule from p53 (kunbind = le-6 s1), and p53 protein half-life (ti / 2, which is a parameter Applicants vary).

[0213] Applicants define the following rates: d[MA] / dt = 0 d[Ms] / dt = -kdiff[MB] + kdiff[MA] - kbind[ B][P] + kunbind[MP] d[MP] / dt = kbind[MB][P] - kunbind[MP] - [MP]*(ln 2) / (tl,2) d[P] / dt = -kbind[MB][P] + kUnbind[MP] - [P]*(ln 2) / (ti / 2) "I- rp53 production

[0214] Note: The constant rate of p53 protein production, rP53 production, was estimated using the concentration of p53 missense mutant protein at steady state in a cell. d[p53] / dt = protein production rate - protein degradation rate = 0 d[p53 missense] / dt = protein production rate - [p53miSSense]*ln(2) / tl / 2-P53missense = oProtein production rate =[p53miSsense]*ln(2) / ti / 2 -p53missense, with tl / 2-p53missense 24 hours

[0215] Applicants ran an ODE solver in R (package: deSolve) using these parameters, and calculated final intracellular ([MB] + [MP]) and extracellular ([MA]) bifunctional small molecule concentrations at t=600 hours.

[0216] Cell Culture. 293T, Calu-1, BxPC-3, HepG2, DU145, LNCaP, and MCF7 cells were obtained from ATCC; MFE319 and MFE296 from DSMZ; Huh7 and NUGC-3 from the JCRB. All cell lines were cultured in DMEM supplemented with 10% FBS, and 100 HJ / mL of penicillin, 100 pg / mL of streptomycin at 37°C in 5% CO2.

[0217] Plasmids. Plasmids were ordered as codon-optimized entry vectors from TWIST (pTwist-ENTR). This includes the following constructs: Halo-p53R273H(FL)-mCherry, Halo- p53Y220C(ATAD)-mCherry, Halo-p53Y220C(FL)-mCherry, Halo-p53WT(FL)-mCherry-2A- mTagBFP2- V 5 , Halo-p53R273H(FL)-mCherry-2 A-mTagBFP2- V5, Halo-p53Y220C(FL)-mCherry- 2A-mTagBFP2-V5, NLS-LgBiT-p53Y220C(DBD), mEGFP-PLKl-SmBiT.p53Y220Cwas ordered with stabilizing mutations (M133L / V203A / N239Y / N268D)45in all cases except for the Halo- p53Y220C(FL)-mCherry-2A-mTagBFP2-V5 construct. Plasmids were Gateway cloned into lentiviral EFla expression vector pLEX307 or pLIX403 using LR cl onase II (Invitrogen). The p53 reporter (Addgene: 90363)39and Cas9-EGFP plasmid (Addgene: 82416) were purchased from Addgene70. DNA oligos encoding the TP53 sgRNA (top strand: CACCGCAGAATGCAAGAAGCCCAGA (SEQ ID NO: 1), bottom strand: AAACTCTGGGCTTCTTGCATTCTGC (SEQ ID NO: 2)) were ordered from Azenta and restriction cloned into the Cas9-EGFP plasmid. Sequences were verified through PlasmidSaurus whole-plasmid sequencing.

[0218] Transient Transfection and Stable Cell Line Creation. Plasmids were transfected into 293T cells using TransIT-LTl transfection reagent following the manufacturer’s protocol. Lentivirus was generated transfecting psPAX2 (Addgene: 12260), pMD2.G (Addgene: 12259), and the cloned pLEX307 / pLIX403 plasmid (Addgene: 41392) (3:3:2 ratio) into 293T cells. Lentivirus was collected 2 days after transfection and stable cell lines were established infecting with filtered lentivirus and polybrene (10 pg / mL). Cells were switched to selection media 2 days after infection.

[0219] Cell Titer Gio. Cells were plated in 384-well plates (typically 1500 cells / well) with varying concentrations of compounds with a total volume of 50 pL / well. Cell titer gio (CTG)reagent was added (25 pL) to the solutions, mixed, and readout using an EnVision 2105 multimode plate reader.

[0220] Crystal Violet. 293T cells were plated in 6- or 12-well plates at low density (-10% confluence) and treated with compound for the indicated duration. Cells were rinsed once with PBS then stained with crystal violet (0.5% m / v) in 20% methanol / water for 10 minutes. Cells were washed with water five times and air-dried overnight.

[0221] Flow Cytometry-Based Competition Assays. Cells with and without a fluorescent marker (e.g. Halo-p53-mCherry) were mixed and the resulting solution was plated in 6-well plates or 10 cm dishes at low density and compound was added at varying concentrations. After reaching confluence, cells were passaged and re-treated with compound if needed. Otherwise, cells were trypsinized, washed, and resuspended in complete growth media in 96-well plates or tubes for flow cytometry. Untreated cell mixtures were used to establish gates separating the fluorophore+ / - populations. Analysis was conducted on a CytoFLEX LX Flow Cytometer.

[0222] NanoBiT Assay. 293T cells were seeded in 6-well plates and co-transfected with NLS- LgBiT-p53Y220C(DBD) and mEGFP-PLKl-SmBiT (1 : 1). After one day, the cells were passaged into 384-well plates and treated with varying concentrations of compound. One day after treatment, nanoluciferase substrate was added to the cells and luminescence was monitored using an EnVision 2105 multimode plate reader.

[0223] Colocalization Assay and Microscopy. 293T cells were seeded in 6-well plates and cotransfected with Halo-p53Y220CATAD-mCherry and mEGFP-PLKl-SmBiT (1 : 1). After one day, the cells were passaged into 96-well plates in FluoroBrite DMEM for microscopy. The cells were imaged with the Opera Phenix Plus High-Content Screening System (PerkinElmer) before compound treatment and as a time series following compound treatment.

[0224] Caspase 3 / 7 Gio. Cells were plated in 384-well plates (typically 1500 cells / well) with varying concentrations of compounds with a total volume of 50 pL / well. After 1 day, caspase-3 / 7 gio reagent (Promega) was added following the manufacturers’ protocol and readout using an EnVision 2105 multimode plate reader.

[0225] Annexin / PI Staining. Cells were plated in 6 well plates and treated with varying concentrations of compounds for 1 day. Cells were stained with Annexin V-AF488 and PIfollowing the manufacturers’ instructions (Thermo Fisher, VI 3241) and analyzed by flow cytometry (Beckman CytoFLEX LX), using untreated cells to establish gates.

[0226] Cell Cycle Analysis. Cells were split into a 10 cm dish at low confluency (20%) and grown overnight. Cells were synchronized using overnight treatment with palbociclib (150 nM), then washed, and split into a 6-well plate for treatment with compound for 24 hours. Cells were harvested by trypsinization, washed twice with cold lx PBS, fixed by dropwise addition of ice- cold 70% ethanol while vortexing, and incubated overnight (4°C). Fixed samples were centrifuged at 1000 g x 5 minutes and 70% ethanol was removed. Cells were washed twice with IX PBS + 1% BSA prior to DNA labeling with 1 pg / mL DAPI for 10 minutes at room temperature, before being analyzed for DNA content by flow cytometry (Beckman CytoFLEX LX).

[0227] Western Blotting. Cells were split into a 10 cm dish at low confluency (20%) and grown overnight. Cells were synchronized with double thymidine block. Cells were treated with thymidine (2 mM) overnight and released into fresh media for 8.5 hours, then retreated with thymidine (2 mM) overnight. Cells were split into a 6-well plate, and released into media containing compound for 8.5 hours. Cells were pelleted and protein lysates were created using RIPA buffer containing Halt phosphatase / protease inhibitor (ThermoFisher #78440). Lysates were clarified by centrifugation (21000g x 15 min) and the supernatant was denatured in IX Lamelli buffer containing DTT by heating at 95C for 5 minutes. The resulting protein was loaded onto a Tris-acetate gel, transferred onto a PVDF membrane, and treated with primary antibodies: cyclin- B1 (D5C10, CST #12231T, 1 : 1000) and phospho PLK binding motif (D73F6, CST #5243T, 1 : 1000). The membrane was stained with IRDye 800CW Goat anti -Rabbit IgG Secondary Antibody (Licor Biosciences, 1:20000) and imaged on an Odyssey DLx.

[0228] Huh7 RNA-sequencing and Analysis. Huh7 cells were passaged into 6-well plates and treated with PMV6 (4 pM), Compound 1 (4 pM), or DMSO for 24 hours. Cells were washed once with cold PBS. Subsequently, TRIzol (Invitrogen) was added to cells, and following the manufacturer’s protocol, RNA was extracted. RNA concentration was monitored using a Qubit Fluorometer (ThermoFisher), and RNA integrity was analyzed using an Agilent Bioanalyzer. The NEBNext Ultra II RNA Library Prep Kit (Illumina) was used to prepare a RNA-seq library. A NovaSeq 6000 machine (Illumina) was used for paired-end 150 bp RNA-sequencing. STAR / RSEM68’71was used to align RNA-seq reads to the GENCODE v38 transcript reference72and generate a count matrix. Raw counts were rounded and DESeq2 was used for downstream analysis73. A pre-ranked GSEA74was performed using the DESeq2 t-statistic (vs. DMSO-treated cells) as a rank metric using the Fisher p53 targets geneset75.

[0229] P53 Reporter Assay. Huh7 and MFE319 cell lines stably expressing a p53 reporter(Addgene: 90363)59were generated. Cells were plated in 384-well plates (1500 cells / well) and treated with varying concentrations of compound. 16 hours after treatment, firefly luciferase substrate was added to the cells and luminescence was monitored using an EnVision 2105 multimode plate reader.

[0230] RT-qPCR. Calul cells stably expressing Halo-p53(FL)-mCherry-2A-mTagBFP2-V5 were passaged into 6-well plates. RNA was extracted using a RNeasy Plus Mini Kit (Qiagen) following the manufacturer’s instructions. RNA (500 ng) was reverse transcribed to cDNA using SuperScript VILO Master Mix following the manufacturer’s instructions (total volume: 20 pL). The resulting solution was diluted 1 :5 with water and 2 pL of cDNA was used in each qPCR reaction in 384-well PCR plates (AB1384W). 2X Power SYBR Green PCR Master Mix (Fisher) and primers (150 nM final concentration) were added to a total volume of 15 pL. Primers used - Halo-p53(FL)-mCherry-2A-mTagBFP2-V5 forward: CAGGACGGCTGCCTTATTTA (SEQ ID NO: 3), Halo-p53(FL)-mCherry-2A-mTagBFP2-V5 reverse: AGACGGCAGATCGCAATATC (SEQ ID NO: 4), GAPDH forward: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 5), GAPDH reverse: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 6). Amplification was performed following the manufacturer’s protocol on a QuantStudio 7 Flex Real-Time PCR System.Table A - Compound Reference TableReferences1. ICGC / TCGA Pan-Cancer Analysis of Whole Genomes Consortium. Pan-cancer analysis of whole genomes. Nature 578, 82-93 (2020).2. Donehower, L. A. et al. Integrated Analysis of TP53 Gene and Pathway Alterations in The Cancer Genome Atlas. Cell Rep. 28, 1370-1384. e5 (2019).3. AACR Project GENIE Consortium. AACR Project GENIE: Powering Precision Medicine through an International Consortium. Cancer Discov. 7, 818-831 (2017).4. Ozaki, T. & Nakagawara, A. Role of p53 in Cell Death and Human Cancers. Cancers 3, 994-1013 (2011).5. Petitjean, A., Achatz, M. I. W ., Borresen-Dale, A. L., Hainaut, P. & Olivier, M. TP53 mutations in human cancers: functional selection and impact on cancer prognosis and outcomes. Oncogene 26, 2157-2165 (2007).6. Robles, A. I. & Harris, C. C. Clinical outcomes and correlates of TP53 mutations and cancer. Cold Spring Harb. Perspect. Biol. 2, a001016 (2010).7. Cerami, E. et al. The eBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2, 401-404 (2012).8. Gao, J. et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci. Signal. 6, 11 (2013).9. Hassin, O. & Oren, M. Drugging p53 in cancer: one protein, many targets. Nat. Rev. Drug Discov. 22, 127-144 (2023).10. Wilson J. M. Gendicine: the first commercial gene therapy product. Hum. Gene Ther. 16, 1014-1015 (2005).11. Kong, N. et al. Synthetic mRNA nanoparticle-mediated restoration of p53 tumor suppressor sensitizes p53 -deficient cancers to mTOR inhibition. Sci. TransL Med. 11, (2019).12. Chikamatsu, K. et al. Generation of anti-p53 cytotoxic T lymphocytes from human peripheral blood using autologous dendritic cells. Clin. Cancer Res. 5, 1281-1288 (1999).13. Speetjens, F. M. et al. Induction of p53-specific immunity by a p53 synthetic long peptide vaccine in patients treated for metastatic colorectal cancer. Clin. Cancer Res. 15, 1086- 1095 (2009).14. Hsiue, E. H.-C. et al. Targeting a neoantigen derived from a common TP53 mutation. Science 371, (2021).15. Foster, B. A., Coffey, H. A., Morin, M. J. & Rastinejad, F. Pharmacological rescue of mutant p53 conformation and function. Science 286, 2507-2510 (1999).16. Bykov, V. J. N. et al. Restoration of the tumor suppressor function to mutant p53 by a low-molecular-weight compound. Nat. Med. 8, 282-288 (2002).17. Fujihara, K. M. etal. SLC7A11 Is a Superior Determinant of APR-246 (Eprenetapopt) Response than Mutation Status. Mol. Cancer Ther. 20, 1858-1867 (2021).18. Rippin, T. M. et al. Characterization of the p53-rescue drug CP-31398 in vitro and in living cells. Oncogene 21, 2119-2129 (2002).19. de Vries, A. etal. Targeted point mutations of p53 lead to dominant-negative inhibition of wild-type p53 function. Proc. Natl. Acad. Sci. U. S. A. 99, 2948-2953 (2002).20. Kern, S. E. et al. Oncogenic forms of p53 inhibit p53-regulated gene expression. Science 256, 827-830 (1992).21. Milner, I. & Medcalf, E. A. Cotranslation of activated mutant p53 with wild type drives the wild-type p53 protein into the mutant conformation. Cell 65, 765-774 (1991).22. Giacomelli, A. O. et al. Mutational processes shape the landscape of TP53 mutations in human cancer. Nat. Genet. 50, 1381-1387 (2018).23. Harris, S. L. & Levine, A. J. The p53 pathway: positive and negative feedback loops. Oncogene 24, 2899-2908 (2005).24. Vousden, K. H. & Lane, D. P. p53 in health and disease. Nat. Rev. Mol. Cell Biol. 8, 275-283 (2007).25. Midgley, C. A. & Lane, D. P. p53 protein stability in tumour cells is not determined by mutation but is dependent on Mdm2 binding. Oncogene 15, 1179-1189 (1997).26. Maki, C G., Huibregtse, J. M. & Howley, P. M. In vivo ubiquitination and proteasome- mediated degradation of p53(l). Cancer Res. 56, 2649-2654 (1996).27. Haupt, Y., Maya, R., Kazaz, A. & Oren, M. Mdm2 promotes the rapid degradation of p53. Nature 387, 296-299 (1997).28. Giaccia, A. J. & Kastan, M. B. The complexity of p53 modulation: emerging patterns from divergent signals. Genes Dev. 12, 2973-2983 (1998).29. Finlay, C. A. et al. Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life. Mol. Cell. Biol. 8, 531-539 (1988).30. Gourisankar, S. et al. Rewiring cancer drivers to activate apoptosis. Nature 620, 417— 425 (2023).31. Lee, S. etal. Velcrin-induced selective cleavage of tRNALeu(TAA) by SLFN12 causes cancer cell death. Nat. Chem. Biol. 19, 301-310 (2023).32. Basu, A. A. et al. Harnessing the FBXW7 somatic mutant R465C for targeted protein degradation. J. Am. Chem. Soc. 147, 6108-6115 (2025).33. Raina, K. et al. Regulated Induced Proximity Targeting Chimeras (RIPTACs): a Novel Heterobifunctional Small Molecule Therapeutic Strategy for Killing Cancer Cells Selectively. bioRxiv (2023) doi : 10.1101 / 2023.01.01.522436.34. Behan, F. M. et al. Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens. Nature 568, 511-516 (2019).35. Ghandi, M. et al. Next-generation characterization of the Cancer Cell Line Encyclopedia. Nature 569, 503-508 (2019).36. Nusinow, D. P. et al. Quantitative Proteomics of the Cancer Cell Line Encyclopedia. Cell 180, 387-402.el6 (2020).37. Tsherniak, A. et al. Defining a Cancer Dependency Map. Cell 170, 564-576. el6 (2017).38. Cho, N. H. et al. OpenCell: Endogenous tagging for the cartography of human cellular organization. Science 375, eabi6983 (2022).39. Hu, R. et al. Identification of a selective BRD4 PROTAC with potent antiproliferative effects in AR-positive prostate cancer based on a dual BET / PLK1 inhibitor. Eur. J. Med. Chem. 227, 113922 (2022).40. Mu, X., Bai, L., Xu, Y., Wang, J. & Lu, H. Protein targeting chimeric molecules specific for dual bromodomain 4 (BRD4) and Polo-like kinase 1 (PLK1) proteins in acute myeloid leukemia cells. Biochem. Biophys. Res. Commun. 521, 833-839 (2020).41. Aublette, M. C., Harrison, T. A., Thorpe, E. J. & Gadd, M. S. Selective Weel degradation by PROTAC degraders recruiting VHL and CRBN E3 ubiquitin ligases. Bioorg. Med. Chem. Lett. 64, 128636 (2022).42. Hirai, H. et al. Small-molecule inhibition of Weel kinase by MK-1775 selectively sensitizes p53-deficient tumor cells to DNA-damaging agents. Mol. Cancer Ther. 8, 2992-3000 (2009).43. Lenart, P. et al. The small-molecule inhibitor BI 2536 reveals novel insights into mitotic roles of polo-like kinase 1. Curr. Biol. 17, 304-315 (2007).44. Lv, F. L. et al. Cabozantinib selectively induces proteasomal degradation of p53 somatic mutant Y220C and impedes tumor growth. J. Biol. Chem. 301, 108167 (2025).45. Joerger, A. C., Ang, H. C. & Fersht, A. R. Structural basis for understanding oncogenic p53 mutations and designing rescue drugs. Proc. Natl. Acad. Sci. U. S. A. 103, 15056-15061 (2006).46. Boeckler, F. M. et al. Targeted rescue of a destabilized mutant of p53 by an in silico screened drug. Proc. Natl. Acad. Sci. U. S. A. 105, 10360-10365 (2008).47. Bauer, M. R. et al. A structure-guided molecular chaperone approach for restoring the transcriptional activity of the p53 cancer mutant Y220C. Future Med. Chem. 11, 2491-2504 (2019).48. Bauer, M. R. et al. Targeting Cavity-Creating p53 Cancer Mutations with Small- Molecule Stabilizers: the Y220X Paradigm. ACS Chem. Biol. 15, 657-668 (2020).49. Guiley, K. Z. & Shokat, K. M. A Small Molecule Reacts with the p53 Somatic Mutant Y220C to Rescue Wild-type Thermal Stability. Cancer Discov. 13, 56-69 (2023).50. Stephenson Clarke, J. R. et al. Discovery of Nanomolar-Affinity Pharmacological Chaperones Stabilizing the Oncogenic p53 Mutant Y220C. ACS Pharmacol Transl Sci 5, 1169— 1180 (2022).51. Kabir, M. et al. Acetylation Targeting Chimera Enables Acetylation of the Tumor Suppressor p53. J. Am. Chem. Soc. 145, 14932-14944 (2023).52. Dumble, M. et al. Abstract LB006: PC 14586: The first orally bioavailable small molecule reactivator of Y220C mutant p53 in clinical development. Cancer Res. 81, LB006- LB006 (2021).53. Shao, Q., Duong, T. N., Park, I. & Nomura, D. K. Covalent 14-3-3 Molecular Glues and Heterobifunctional Molecules Against Nuclear Transcription Factors and Regulators. bioRxiv (2023) doi: 10.1101 / 2023.11.06.565850.54. Kumar, S. & Nabet, B. A chemical magnet: Approaches to guide precise protein localization. Bioorg. Med. Chem. 102, 117672 (2024).55. Gibson, W. J. et al. Bifunctional small molecules that induce nuclear localization and targeted transcriptional regulation. Journal of the American Chemical Society 145, 26028-26037 (2023).56. Ng, C. S. C., Liu, A., Cui, B. & Banik, S. M. Targeted Protein Relocalization via Protein Transport Coupling. bioRxiv 2023.10.04.560943 (2023) doi: 10.1101 / 2023.10.04.560943.57. Kishi, K., van Vugt, M. A. T. M., Okamoto, K.-L, Hayashi, Y. & Yaffe, M. B. Functional dynamics of Polo-like kinase 1 at the centrosome. Mol. Cell. Biol. 29, 3134-3150 (2009).58. Steegmaier, M. et al. BI 2536, a potent and selective inhibitor of polo-like kinase 1, inhibits tumor growth in vivo. Curr. Biol. 17, 316-322 (2007).59. O’Connell, D. J. et al. Simultaneous Pathway Activity Inference and Gene Expression Analysis Using RNA Sequencing. Cell Syst 2, 323-334 (2016).60. Cancer Genome Atlas Research Network et al. The Cancer Genome Atlas Pan-Cancer analysis project. Nat. Genet. 45, 1113-1120 (2013).61. Isobe, Y. etal. Manumycin polyketides act as molecular glues between UBR7 and P53. Nat. Chem. Biol. 16, 1189-1198 (2020).62. Klett, T. et al. Evaluation of a Covalent Library of Diverse Warheads (CovLib) Binding to JNK3, USP7, or p53. Drug Des. Devel. Ther. 18, 2653-2679 (2024).63. Razumkov, H. et al. Discovery of CRBN-dependent WEE1 Molecular Glue Degraders from a Multicomponent Combinatorial Library. bioRxiv (2024) doi: 10.1101 / 2024.05.04.592550.64. Rufini, A., Tucci, P., Celardo, I. & Melino, G. Senescence and aging: the critical roles of p53. Oncogene 32, 5129-5143 (2013).65. Lessel, D. et al. Dysfunction of the MDM2 / p53 axis is linked to premature aging. J. Clin. Invest. 127, 3598-3608 (2017).66. Thul, P. J. & Lindskog, C. The human protein atlas: A spatial map of the human proteome. Protein Sci. 27, 233-244 (2018).67. Bausch-Fluck, D. et al. A mass spectrometric-derived cell surface protein atlas. PLoS One 10, e0121314 (2015).68. Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013).69. Robinson, J. T. et al. Integrative genomics viewer. Nat. Biotechnol. 29, 24-26 (2011).70. Walter, D. M. et al. Systematic In Vivo Inactivation of Chromatin-Regulating Enzymes Identifies Setd2 as a Potent Tumor Suppressor in Lung Adenocarcinoma. Cancer Res. 77, 1719— 1729 (2017).71. Li, B. & Dewey, C. N. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12, 323 (2011).72. Frankish, A. etal. GENCODE: reference annotation for the human and mouse genomes in 2023. Nucleic Acids Res. 51, D942-D949 (2023).73. Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).74. Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. U. S. A. 102, 15545-15550 (2005).75. Fischer, M., Grossmann, P., Padi, M. & DeCaprio, J. A. Integration of TP53, DREAM, MMB-F0XM1 and RB-E2F target gene analyses identifies cell cycle gene regulatory networks. Nucleic Acids Res. 44, 6070-6086 (2016).

[0231] Various modifications and variations of the described methods, pharmaceutical compositions, and kits of the disclosure will be apparent to those skilled in the art without departing from the scope and spirit of the disclosure. Although the disclosure has been described in connection with specific embodiments, it will be understood that it is capable of further modifications and that the disclosure, as claimed, should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the disclosure that are obvious to those skilled in the art are intended to be within the scope of the disclosure. This application is intended to cover any variations, uses, or adaptations of the disclosure following, in general, the principles of the disclosure and including such departures from the present disclosure that come within known customary practice within the art to which the disclosure pertains and may be applied to the essential features herein before set forth.

Claims

1. CLAIMSWhat is claimed is:

1. A compound of Formula (I):M-L-T(I) or a pharmaceutically acceptable salt thereof, wherein:M is a ligand that binds p53;T is a ligand that binds a target protein; and L is a linker.

2. The compound of claim 1, wherein M is a ligand that binds mutant p53.

3. The compound of claim 2, wherein the mutant p53 is p53 Y220C.

4. The compound of any one of claims 1-3, wherein T binds a target protein whose function is essential for proliferation of a cell.

5. The compound of claim 4, wherein the cell is a cancer cell.

6. The compound of any one of claims 1-5, wherein T binds a target protein selected fromBRD4, BUB1, BUB IB, CDC7, CDK1, CDK2, CDK4, CDK6, CDK7, CDK9, PLK1, PLK4, WEE1, and XP01.

7. The compound of any one of claims 1-6, wherein T binds PLK1.

8. The compound of any one of claims 1-7, wherein M is a compound of Formula (II):whereinRi is H, substituted or un substituted alkyl, or substituted or unsubstituted alkenyl, -C(O)R4, or -SO2R5;R2 is H, halo, substituted or unsubstituted alkyl, or substituted or unsubstituted haloalkyl;R3is halo, -NO, -CN, -S(O)2R6, -C(O)NR7, or -COR8R4andRs are each independently selected from substituted or unsubstituted alkyl, haloalkyl, and substituted or unsubstituted alkenyl;Re and R7 are each independently substituted or unsubstituted alkyl; andRs is H or substituted or unsubstituted alkyl; the attachment point of M to L.

9. The compound of claim 8, wherein M is a compound of Formula (IIA):(HA).

10. The compound of claim 8, wherein M is a compound of Formula (IIB):11 . The compound of any one of claims 8-10, wherein Ri is substituted or unsubstituted lower alkyl.

12. The compound of claim 11, wherein Ri is substituted lower alkyl.

13. The compound of any one of claims 8—12, wherein Ri is substituted with a haloalkyl group.

14. The compound of claim 13, wherein Ri is substituted with CF3.

15. The compound of claim 13, wherein Ri is CH2CF3.

16. The compound of any one of claims 8-12, wherein Ri is substituted with epoxy.

17. The compound of any one of claims 8-10, wherein Ri is substituted or unsubstituted lower alkenyl.

18. The compound of claim 17, wherein Ri is unsubstituted lower alkenyl.

19. The compound of claim 18, wherein Ri is -CHCH2.

20. The compound of any one of claims 8-10, wherein Ri is -SO2R9, wherein R9 is substituted or unsubstituted lower haloalkyl.

21. The compound of claim 20, wherein R9 is unsubstituted lower haloalkyl.

22. The compound of claim 21, wherein R9 is halomethyl.

23. The compound of any one of claims 8-10, wherein Ri is -SO2R10, wherein Rio is substituted or unsubstituted alkenyl.

24. The compound of claim 23, wherein Rio is substituted lower alkenyl.

25. The compound of claim 24, wherein Rio is -CHCH2.

26. The compound of any one of claims 8-10, wherein Ri is -C(O)R4, wherein R4is substituted or unsubstituted lower alkenyl.

27. The compound of claim 26, wherein R4 is unsubstituted lower alkenyl.

28. The compound of claim 27, wherein R4 is -CHCH2.

29. The compound of any one of claims 8-10, wherein Ri is -C(O)Rn, wherein Rn is substituted or unsubstituted lower alkyl.

30. The compound of claim 29, wherein Rn is unsubstituted lower alkyl.

31. The compound of claim 30, wherein Rn is methyl.

32. The compound of any one of claims 8-10, wherein Ri is -C(O)Rn, wherein Rn is substituted or unsubstituted lower haloalkyl.

33. The compound of claim 32, wherein Rn is unsubstituted lower haloalkyl.

34. The compound of claim 33, wherein Rn is halomethyl.

35. The compound of any one of claims 1-34, wherein T is a compound of Formula (III):whereinis the attachment point of T to L.

36. The compound of any one of claims 1-34, wherein T is a compound of Formula (IV):

37. The compound of any one of claims 1-36, wherein L is a length of about 4.33A to about 22.22A.

38. The compound of any one of claims 1-36, wherein L is a compound of Formula (V):whereinX is C=O or CH2;Y is C=O or CH2; n is 0-15; and x'' is the attachment point of X and Y to M and T.

39. The compound of any one of claims 1-36, wherein L is a compound of Formula (VI):whereinX is C=0 or CH2;Y is C=O or CH2; m is 0-15; n is 0-15; o is 0-15; and the attachment point of X and Y to M and T.

40. The compound of any one of claims 1-36, wherein L is a compound of Formula (VII):whereinX is C=O or CH2;Y is C=O or CH2; m is 0-15; n is 0-15; and % x'' is the attachment point of X and Y to M and T.

41. The compound of any one of claims 1-36, wherein L is a compound of Formula (VIII):VX(z,Ay(VIII)whereinX is C=0 or CH2;Z is CH2n is 0-15; x ' is the attachment point of X and A to M and T; and the attachment point of A to Z andx'' .

42. A compound that isor a pharmaceutically acceptable salt thereof.

43. A pharmaceutical composition comprising the compound of any one of claims 1-42 and a pharmaceutically acceptable carrier.

44. The pharmaceutical composition of claim 43, further comprising one or more additional anticancer agents.

45. A method of treating cancer comprising administering an effective amount of the compound of any one of claims 1-42 or the pharmaceutical composition of claims 43 or 44 to a subject.

46. The method of claim 45, wherein the cancer is associated with p53 overexpression.

47. The method of claim 46, wherein the cancer is selected from endometrial cancer, ovarian cancer, uterine cancer, lung cancer, colon cancer, rectal cancer, colorectal cancer, breast cancer, prostate cancer, liver cancer, pancreatic cancer, brain cancer, pancreatic cancer, kidney cancer, stomach cancer, skin cancer, gastric cancer, glioma, bone cancers, hepatocellular carcinoma, papillary renal carcinoma, head and neck cancer, squamous cell carcinoma, leukemias, lymphomas, myelomas, larynx cancer, sarcoma, esophageal cancer, and solid tumors.

48. The method of any one of claims 45-47, comprising administering the effective amount of the compound or the pharmaceutical composition to the subject using a pulse dose regimen.

49. The method of any one of claims 45-48, wherein the subject is human.

50. A pulse dose regimen comprising administering an effective amount of the compound of any one of claims 1-42 or the pharmaceutical composition of claims 43 or 44 to a subject.

51. The pulse dose regimen of claim 50, wherein the subject is human.

52. A method of treating aging or an aging-related disease comprising administering an effective amount of the compound of any one of claims 1-42 or the pharmaceutical composition of claims 43 or 44 to a subject.

53. The method of claim 52, wherein the aging or aging-related disease is associated with senescent cells having elevated p53 protein levels.

54. The method of claim 53, wherein the compound selectively eliminates senescent cells.

55. The method of any one of claims 52-54, wherein the aging-related disease is selected from age-related frailty, sarcopenia, osteoarthritis, atherosclerosis, pulmonary fibrosis, kidney fibrosis, liver fibrosis, age-related macular degeneration, diabetic complications, metabolic dysfunction, neurodegeneration, skin aging, wound healing impairment, and progeroid syndromes.

56. The method of claim 55, wherein the progeroid syndrome is associated with MDM2 deficiency.

57. The method of any one of claims 52-56, wherein the method reduces the amount of senescent cells in the subject.

58. The method of any one of claims 52-57, comprising administering the effective amount of the compound or the pharmaceutical composition to the subject using a pulse dose regimen.

59. The method of any one of claims 52-58, wherein the subject is human.

60. The method of any one of claims 52-59, wherein the senescent cells are present in tissue selected from adipose tissue, muscle tissue, liver tissue, kidney tissue, skin tissue, lung tissue, and vascular tissue.

Images