Novel double-stranded RNA based on l-pgds RNA sequence, and use thereof
Double-stranded RNA targeting the signal peptide region of lipocalin-type prostaglandin D synthase induces RNA interference to inhibit cell proliferation, addressing the limitations of existing therapies and effectively suppressing tumor growth.
Patent Information
- Application Number
- PCT/JP2025/026608
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-02
- Filing Date
- 2025-07-28
- Publication Date
- 2026-02-05
AI Technical Summary
Existing therapies targeting lipocalin-type prostaglandin D synthase, such as antibodies, are expensive and difficult to maintain consistent quality, while nucleic acid drugs are not effectively utilized for suppressing diseases associated with this enzyme.
Development of double-stranded RNA comprising a first and second strand, where the first strand includes a main sequence encoding a part of the lipocalin-type prostaglandin D synthase, particularly targeting its signal peptide region, to induce RNA interference and inhibit gene expression.
The double-stranded RNA effectively suppresses the proliferation of cells overexpressing lipocalin-type prostaglandin D synthase, including tumor cells, by specifically inhibiting gene expression, thus providing a reliable and cost-effective therapeutic option.
Smart Images

Figure JP2025026608_05022026_PF_FP_ABST
Abstract
Description
Novel double-stranded RNA based on L-PGDS RNA sequence and its use
[0001] The present disclosure relates to double-stranded RNA, compositions containing the double-stranded RNA, and methods of using the same. Specifically, the present disclosure relates to double-stranded RNA used to suppress or inhibit abnormal cell proliferation or metastasis, and compositions comprising the double-stranded RNA. This application claims priority to Japanese Patent Application No. 2024-126470, filed August 2, 2024, the entire contents of which are incorporated herein by reference.
[0002] Prostaglandins (PGs) are a type of inflammatory mediator involved in the regulation of various physiological systems, such as the central nervous system, respiratory system, cardiovascular system, gastrointestinal system, urogenital system, endocrine system, and immune system. Prostaglandins are produced from arachidonic acid via the arachidonic acid cascade. In the arachidonic acid cascade, prostaglandins with various specific roles are produced by enzymatic reactions. For example, prostaglandin D2 is produced by prostaglandin D synthase. Prostaglandin D2 is known to regulate sleep, pain sensation, inflammation, allergies, and other conditions.
[0003] Prostaglandin D synthases are divided into two types: hematopoietic and lipocalin. Hematopoietic prostaglandin D synthases are distributed in mast cells and Th2 lymphocytes. Lipocalin prostaglandin D synthases are localized in the central nervous system, male reproductive organs, and the heart. Lipocalin prostaglandin synthases are known to be overexpressed in various diseases and disorders involving abnormal cell proliferation, such as cancer and retinal degeneration. Therefore, they are being investigated as markers or therapeutic agents for these diseases and disorders. For example, JP 2007-528371 A discloses a method for detecting and / or treating age-related macular degeneration (AMD) using an oligonucleotide targeting lipocalin prostaglandin synthase or an antibody that specifically binds to lipocalin prostaglandin synthase. Furthermore, JP 2021-38990 A discloses a method for using lipocalin prostaglandin D synthase as an indicator for assessing colorectal cancer risk.
[0004] Some prostaglandins, such as prostaglandin E2, are known to promote tumor cell proliferation through their production. On the other hand, prostaglandin D2 is known to inhibit tumor proliferation through its production. For example, Japanese Patent Application Laid-Open No. 2015-124163 discloses a therapeutic agent for treating digestive cancer that uses prostaglandin D2 synthase to promote the production of prostaglandin D2 and treat digestive cancer.
[0005] JP-T-2007-528371 A JP-A-2021-38990 A JP-A-2015-124163 A
[0006] The present inventors wish to provide nucleic acids that suppress various diseases and disorders associated with lipocalin-type prostaglandin D synthase, or nucleic acid drugs that utilize such nucleic acids. Drugs that utilize antibodies, such as those disclosed in the above-mentioned JP-A No. 2007-528371, are expensive and it is difficult to maintain consistent quality. On the other hand, nucleic acid drugs can be mass-produced by organic synthesis, making it easy to control the consistency of quality.
[0007] Therefore, a main object of the present disclosure is to provide a technique for suppressing or inhibiting cell proliferation involving gene expression of lipocalin-type prostaglandin D synthase by using double-stranded RNA.
[0008] The double-stranded RNA disclosed herein comprises a first strand and a second strand complementary to the first strand. The first strand comprises a main sequence consisting of 19 to 23 bases, the 5'-terminal of which is a guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal of the main sequence. The main sequence is a part of a base sequence encoding a lipocalin-type prostaglandin D synthase, and includes at least a part of a base sequence encoding a signal peptide region of the lipocalin-type prostaglandin D synthase.
[0009] In another preferred embodiment of the double-stranded RNA disclosed herein, the double-stranded RNA comprises a first strand and a second strand. The first strand comprises a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C). The second strand comprises a main sequence complementary to the main sequence. The main sequence of the first strand is a part of a base sequence encoding a lipocalin-type prostaglandin D synthase, and comprises at least a part of a base sequence encoding a signal peptide region of the lipocalin-type prostaglandin D synthase.
[0010] As described above, lipocalin-type prostaglandin D synthase has been investigated for use in cancer risk assessment and treatment. However, as a result of extensive research by the inventors, it was surprisingly found that suppressing expression of the lipocalin-type prostaglandin D synthase gene significantly inhibits tumor cell proliferation. The double-stranded RNA can function as at least small interfering RNA (siRNA). That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). This effect is due to the suppression of at least the expression of the lipocalin-type prostaglandin D synthase gene, thereby inhibiting the proliferation of abnormal cells in which lipocalin-type prostaglandin D synthase is involved.
[0011] In one embodiment of the double-stranded RNA disclosed herein, the first strand comprises the main sequence and an additional sequence of 2 to 4 bases added to the 3'-end of the main sequence. Additionally, the second strand comprises a main sequence complementary to the first strand and an additional sequence of 2 to 4 bases added to the 3'-end of the complementary main sequence. This double-stranded RNA can function favorably as an siRNA. This allows for more reliable inhibition of cell proliferation involving lipocalin-type prostaglandin D synthase.
[0012] In one embodiment of the double-stranded RNA disclosed herein, at least three of the five bases on the 3'-end of the main sequence are adenine (A) and / or uracil (U), thereby more sufficiently suppressing the expression of the lipocalin-type prostaglandin D synthase gene and inhibiting the proliferation of cells in which lipocalin-type prostaglandin D synthase is involved.
[0013] In one embodiment of the double-stranded RNA disclosed herein, the base sequence comprising at least a portion of the base sequence encoding the signal peptide region of the lipocalin-type prostaglandin D synthase is any of the following base sequences: GCTACTCATCACACGCTGT (SEQ ID NO: 1); CTACTCATCACACGCTGTGGA (SEQ ID NO: 2); CTCATCACACGCTGTGGAT (SEQ ID NO: 3); or CATCACACGCTGTGGATGGGA (SEQ ID NO: 4). Such double-stranded RNA more specifically suppresses expression of the lipocalin-type prostaglandin D synthase gene, thereby inhibiting the proliferation of cells in which the expression level of lipocalin-type prostaglandin D synthase is increased.
[0014] In one embodiment of the double-stranded RNA disclosed herein, the base sequence constituting the additional sequence is thymine-thymine (TT), which can improve the stability of the double-stranded RNA.
[0015] The present disclosure provides a composition capable of inhibiting the proliferation of at least one type of cell. One embodiment of the composition disclosed herein comprises a first strand and a second strand complementary to the first strand, wherein the first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Here, the main sequence comprises a part of a base sequence encoding a lipocalin-type prostaglandin D synthase, including double-stranded RNA containing at least a part of a base sequence encoding a signal peptide region of the lipocalin-type prostaglandin D synthase. When supplied to cells, such a composition inhibits the proliferation of cells in which lipocalin-type prostaglandin D synthase is involved, by suppressing the expression of at least the lipocalin-type prostaglandin D synthase gene.
[0016] In one embodiment of the composition disclosed herein, the cell type whose proliferation is inhibited by the composition is tumor cells, thereby enabling more reliable inhibition of cell proliferation.
[0017] One embodiment of the composition disclosed herein comprises a peptide fragment having cell membrane permeability that allows a foreign substance to be introduced into the cytoplasm by passing through the cell membrane from the outside of the cell, thereby facilitating the introduction of double-stranded RNA into a target cell.
[0018] The present disclosure provides a method for inhibiting the proliferation of at least one type of cell. One embodiment of the method disclosed herein comprises the steps of (1) preparing a composition disclosed herein and (2) supplying the composition to a target cell in vivo or in vitro. This allows the inhibition of cell proliferation in which lipocalin-type prostaglandin D synthase is involved.
[0019] In one embodiment of the method disclosed herein, the biological species of the cells is the same as the biological species containing lipocalin-type prostaglandin D synthase, thereby more reliably inhibiting the proliferation of cells in which lipocalin-type prostaglandin D synthase is involved.
[0020] Fig. 1 is an explanatory diagram for explaining the arachidonic acid cascade, and Fig. 2 is a graph showing the cell viability of neuroblastoma cells in Samples 1 to 4 and a comparative example.
[0021] <Definition of Terms> The technology disclosed herein is described in detail below. Matters other than those specifically mentioned in this specification (e.g., the structure of double-stranded RNA) that are necessary for implementing this technology (e.g., general matters such as methods for synthesizing polynucleotides, cell culture techniques, and constructs mainly composed of peptides or nucleic acids) can be understood as design matters of a person skilled in the art based on conventional technology in the fields of cell engineering, physiology, medicine, pharmacology, organic chemistry, biochemistry, genetic engineering, protein engineering, molecular biology, genetics, etc. The technology disclosed herein can be implemented based on the content disclosed in this specification and common general technical knowledge in the relevant field.
[0022] As used herein, the term "polynucleotide" refers to a polymer in which multiple (two or more) nucleotides are linked by phosphodiester bonds, and is not limited by the number of nucleotides. For example, a "polynucleotide" herein also encompasses those containing both deoxyribonucleotides and nucleotides. Furthermore, as used herein, the term "artificially designed polynucleotide" refers to a polynucleotide whose nucleotide chain (full length) does not exist alone in nature, but is artificially synthesized by chemical synthesis or biosynthesis (i.e., production based on genetic engineering).
[0023] As used herein, the terms "first strand" and "second strand" refer to one being a sense strand (or coding strand or passenger strand) and the other being an antisense strand (or template strand or non-coding strand or guide strand). That is, if the first strand is a sense strand, the second strand refers to an antisense strand. Also, if the second strand is a sense strand, the first strand refers to an antisense strand. The first strand and the second strand may be completely complementary to each other, or may be at least partially complementary. That is, they may be capable of hybridizing at least under physiological conditions.
[0024] In the present specification, unless the notation "5'" and "3'" is used, the left side of a base sequence always indicates the 5'-terminal side and the right side indicates the 3'-terminal side. Furthermore, in the present specification, the term "amino acid residue" includes the N-terminal amino acid and the C-terminal amino acid of a peptide chain, unless otherwise specified. Furthermore, in the amino acid sequences described in the present specification, the left side always indicates the N-terminal side and the right side indicates the C-terminal side.
[0025] As used herein, the term "tumor" is broadly interpreted and refers to tumors in general (typically malignant tumors), including carcinomas and sarcomas, as well as lesions of the blood or hematopoietic tissues (leukemia, lymphoma, etc.). Furthermore, "tumor cells" are synonymous with "cancer cells," and refer to cells that form such tumors, typically cells that have reached the stage of abnormal proliferation independent of surrounding normal tissues (so-called cancerous cells). Therefore, unless otherwise specified, any cell that is classified as a tumor cell (cancer cell) rather than a normal cell is referred to as a tumor cell, regardless of its origin or properties.
[0026] In this specification, when a numerical range is described as "A to B (where A and B are any numerical values)," it means "A or more and B or less," and also includes the meanings of "greater than A and less than B," "greater than A and B or less," and "greater than A and less than B."
[0027] <Lipocalin-type prostaglandin D2 synthase> In this specification, "lipocalin-type prostaglandin D synthase" is also referred to as L-PGDS, lipocalin-type prostaglandin D2 synthase, or lipocalin-type prostaglandin D synthase. However, this term is not limited to these terms and encompasses all synonyms (e.g., β-trace) and includes naturally occurring lipocalin-type prostaglandin D synthases and their variants. The biological species from which L-PGDS is derived is not particularly limited. However, it is preferably the same as the animal species to which the double-stranded RNA or composition disclosed herein is to be delivered. For example, when delivering the double-stranded RNA or composition disclosed herein to human-derived cells, it is preferable to use a base sequence based on the base sequence of human L-PGDS as the main sequence. Note that human-derived L-PGDS will be described as a preferred example. However, the present technology can also be applied to L-PGDS derived from biological species, including mammals other than humans and other animal species.
[0028] Prostaglandins (PGs) are known to function as inflammatory mediators involved in the regulation of various physiological systems, such as the central nervous system, respiratory system, cardiovascular system, gastrointestinal system, urogenital system, endocrine system, and immune system. Examples of prostaglandins include prostaglandin D2 (PGD2), prostaglandin E2 (PGE2), prostaglandin F2α (PGF2), and prostaglandin I2 (PGI2). These prostaglandins, together with the structurally similar thromboxane (TXA), are referred to as prostanoids. The primary function of prostanoids (specifically, prostaglandins) is vasodilation. However, prostanoids have been suggested to be involved in various physiological and pathophysiological functions via specific G protein-coupled receptors (e.g., DP, EP, FP, IP, etc.). Prostanoids are synthesized from arachidonic acid via the arachidonic acid cascade. Figure 1 is an explanatory diagram illustrating the arachidonic acid cascade. First, free arachidonic acid is converted by cyclooxygenase (COX) to prostaglandin G2 (PGG2) and then to prostaglandin H2 (PGH2). Next, various synthetic enzymes (e.g., prostaglandin D synthase) produce prostaglandins or thromboxane.
[0029] Prostaglandin D2 is known to be primarily involved in platelet aggregation and sleep. Prostaglandin D synthase (PGDS) is divided into two types: hematopoietic PGDS (H-PGDS) and lipocalin PGDS (L-PGDS). L-PGDS is known to be involved in the central nervous system, male reproductive organs, and heart. Overexpression of L-PGDS has been suggested to be associated with retinopathy, retinal vein occlusion (macular edema), and the uncontrolled proliferation of abnormal cells, such as cancer. Examples of cancers associated with L-PGDS expression include pancreatic cancer, urothelial carcinoma, prostate cancer, breast cancer, ovarian cancer, lung cancer, neuroblastoma, liver cancer, colon cancer, and gastric cancer. It may also be involved in the inflammatory responses, migration, and infiltration associated with these diseases. Specifically, increased L-PGDS expression has been suggested in cells associated with the aforementioned diseases. That is, the double-stranded RNA and composition disclosed herein act favorably on cells in which the expression level of L-PGDS is increased due to the above-mentioned diseases and disorders, and can inhibit their proliferation.
[0030] <Signal Peptide Region> The nucleotide sequence of L-PGDS can be obtained from international databases. For example, international databases include the National Center for Biotechnology Information (NCBI), the European Nucleotide Archive (ENA), the DNA Data Bank of Japan (DDBJ), UniPlot, Ensembl, etc. Specifically, the nucleotide sequence of human L-PGDS is provided by NCBI under accession number NM_000954.6, etc. Furthermore, the amino acid sequence of L-PGDS is provided by Uniprot under accession number P41222, etc. Information on the signal peptide region of L-PGDS, etc., can also be obtained from the above-mentioned international databases.
[0031] L-PGDS consists of approximately 190 amino acid residues and has a signal peptide region at the N-terminus.
[0032] The amino acid sequence shown in SEQ ID NO: 5 consists of 190 amino acid residues and is the entire amino acid sequence of human L-PGDS. The amino acid sequence shown in SEQ ID NO: 6 consists of 22 amino acid residues and represents the amino acid sequence of the signal peptide of human L-PGDS. The nucleotide sequence shown in SEQ ID NO: 7 consists of 66 bases and represents the nucleotide sequence of the signal peptide of human L-PGDS.
[0033] <Double-Stranded RNA> The double-stranded RNA of the present disclosure is a double-stranded RNA having a first strand and a second strand complementary to the first strand. Hereinafter, the first strand will be referred to as the sense strand and the second strand as the antisense strand, as will be described in detail. The sense strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Furthermore, the main sequence is a portion of the base sequence encoding L-PGDS, and includes at least a portion of the base sequence encoding the signal peptide region of L-PGDS.
[0034] The main sequence is typically composed of a polynucleotide, which is a polymer of ribonucleotides. In other words, the main sequence is composed of RNA. That is, the base sequence of the main sequence is typically represented by the four letters A (adenine), U (uracil), G (guanine), and C (cytosine), or the four letters a, u, g, and c. However, in the attached sequence listing, uracil may be represented by T (thymine).
[0035] The main sequence of the sense strand may be, for example, a base sequence including a portion of the base sequence encoding the signal peptide region of L-PGDS. This allows the double-stranded RNA to function as an siRNA (small interfering RNA) targeting L-PGDS. Furthermore, because the base sequence of the signal peptide region of L-PGDS is located upstream of the mRNA, the double-stranded RNA may be able to effectively suppress the expression of L-PGDS when functioning as an siRNA.
[0036] The double-stranded RNA disclosed herein can at least function as an siRNA. That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). RNAi is a gene silencing process in which short double-stranded RNAs such as siRNAs suppress gene expression in a sequence-specific manner. When siRNAs are introduced into cells, they form a complex called RISC (RNA-induced silencing complex) with intracellular proteins. RISC binds to homologous sequences in mRNA transcribed from the target gene (here, the L-PGDS gene) and specifically cleaves the mRNA, thereby inhibiting translation.
[0037] The main sequence is preferably selected so as to include the signal peptide region of L-PGDS or a base sequence encoding the signal peptide region of L-PGDS, but one or more bases (e.g., two bases) may be substituted with other bases, deleted, and / or added (inserted) within the scope in which the effects of the present technology are exhibited.
[0038] The proportion of the signal peptide region of L-PGDS or the nucleotide sequence encoding the signal peptide region of L-PGDS in the main sequence is not particularly limited, and when the entire main sequence is taken as 100%, it is preferably 5% or more, but may also be 10% or more, 15% or more, 90% or more, or 100% or more.
[0039] The 5' end of the main sequence is preferably guanine or cytosine. Because guanine and cytosine have stronger binding strength with complementary strands than adenine and uracil, the stability of the 5' end of the sense strand (i.e., the 3' end of the antisense strand) is increased. In other words, the stability of the 5' end of the antisense strand is relatively reduced. Although the details of the mechanism are unclear, RISC, an RNAi-related protein, tends to preferentially incorporate the strand with the more energetically unstable 5' end between the sense strand and the antisense strand. Therefore, by having guanine or cytosine at the 5' end of the main sequence, the antisense strand can be more easily incorporated into RISC, thereby more effectively inducing RNAi. This allows the double-stranded RNA to function favorably as siRNA.
[0040] Of the five bases on the 3'-end of the main sequence, adenine and / or uracil preferably account for 40% or more (i.e., two or more bases), but may also account for 60% or more (i.e., three or more bases), or even 100% (i.e., five bases). This makes the 5'-end of the antisense strand less stable than the 3'-end. As a result, the antisense strand is more easily incorporated into RISC, allowing for more effective induction of RNAi.
[0041] The GC content of the entire main sequence (the total proportion of G and C in the entire base sequence constituting the main sequence) is not particularly limited, but may be, for example, 30% to 70% or less, preferably 40% to 65% or less, or may be 50% to 60% or less. The GC content is a parameter related to the binding strength between the antisense strand incorporated into RISC and RNA having the main sequence, the ease of cleavage of RNA, etc. The above GC content allows the RNAi effect to be efficiently exerted.
[0042] The main sequence can be selected from 19 to 23 bases from G or C of the gene encoding L-PGDS. For example, the main sequence can be any of the following base sequences: GCUACUCAUCACACGCUGU (SEQ ID NO: 16); CUACUCAUCACACGCUGUGGA (SEQ ID NO: 17); CUCAUCACACGCUGUGGAU (SEQ ID NO: 18); or CAUCACACGCUGUGGAUGGGA (SEQ ID NO: 19). The base sequences shown in SEQ ID NOs: 16 to 19 are all composed of RNA. Double-stranded RNAs having the base sequences shown in SEQ ID NOs: 16 to 19 as their main sequences significantly suppress the growth of abnormally proliferating cells even at low concentrations, and can therefore avoid nonspecific inhibition of expression, nonspecific inhibition of cell growth, stress on cells, and the like.
[0043] The base sequence shown in SEQ ID NO: 1 is the 4th to 22nd bases of the base sequence encoding human L-PGDS (i.e., the sequence from the start codon to the stop codon). The base sequence shown in SEQ ID NO: 2 is the 5th to 25th bases of the base sequence encoding human L-PGDS (i.e., the sequence from the start codon to the stop codon). The base sequence shown in SEQ ID NO: 3 is the 8th to 26th bases of the base sequence encoding human L-PGDS. The base sequence shown in SEQ ID NO: 4 is the 10th to 30th bases of the base sequence encoding human L-PGDS. The base sequences shown in SEQ ID NOs: 1 to 4 are the base sequences of parts of the signal peptide region of human L-PGDS.
[0044] Double-stranded RNAs composed of the main sequences shown in SEQ ID NOs: 1 to 4 can suppress or inhibit the proliferation of at least one type of cell by supplying them to tumor cells (e.g., neuroblastoma, etc.). Typically, supplying them to tumor cells (e.g., neuroblastoma) can suppress or inhibit the proliferation of the tumor cells. L-PGDS is expressed at low levels in normal cells other than tumor cells, but is overexpressed in tumor cells. Therefore, even if the double-stranded RNA disclosed herein is supplied to normal cells, the amount of L-PGDS present in normal cells is relatively small, and therefore the double-stranded RNA is thought to have little effect.
[0045] <Additional Sequence> The sense strand of the double-stranded RNA disclosed herein may have an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the main sequence. Preferably, the additional sequence is added to the 3'-end of the main sequence. The addition of an additional sequence can more effectively induce RNAi.
[0046] The additional sequence is composed of a polynucleotide (dimer, trimer, or tetramer). The polynucleotide constituting the additional sequence may be composed of only ribonucleotides, only deoxynucleotides, or both ribonucleotides and deoxynucleotides. That is, the sense strand and the antisense strand may be entirely RNA, or may be chimeric polynucleotides of RNA and DNA. The additional sequence may also contain modified deoxyribonucleotides, modified ribonucleotides, other known nucleotide analogs, and the like.
[0047] The base sequence constituting the additional sequence is not particularly limited, but preferably contains at least one base of adenine, uracil, or thymine. From the viewpoint of improving the stability of the double-stranded RNA, the base sequence constituting the additional sequence is more preferably TT (thymine-thymine).
[0048] <Sense strand and antisense strand> The sense strand is composed of a base sequence of, for example, 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. In a preferred example, the sense strand is composed of 21 to 23 bases, consisting of a main sequence of 19 to 21 bases and an additional sequence of 2 bases. In such an example, RNAi can be effectively induced.
[0049] The antisense strand has a base sequence complementary to the main sequence of the sense strand. This allows the antisense strand to hybridize with the sense strand, forming a double-stranded structure. The base sequence of the antisense strand may also be partially complementary to the main sequence of the sense strand. That is, one or more bases (e.g., two bases) of the antisense strand may be substituted, deleted, and / or added (inserted) with other bases. As long as the sense strand and the antisense strand can hybridize at least under physiological conditions, they can function as siRNA. The complementary base sequence is typically composed of a ribonucleotide polymer (RNA).
[0050] In the double-stranded RNA disclosed herein, the sense strand or antisense strand is typically composed of chemically unmodified ribonucleotides (RNA). However, the double-stranded RNA of the present disclosure may also contain DNA, as well as chemically modified DNA or RNA, or other known nucleotide analogs, to the extent that the technology of the present disclosure is not significantly impaired. That is, one or more bases (e.g., two or more to five or less bases) in the sense strand or antisense strand may be substituted with chemically modified RNA (or DNA) such as methylated or pseudouridylated. Examples of such chemically modified RNA or DNA include pseudouridine, N1-methylpseudouridine, 5-methylcytosine, inosine, and acyclic artificial nucleic acids. For example, one or more uridine bases (e.g., two bases) in the double-stranded RNA of the present disclosure can be substituted with pseudouridine. Furthermore, the sense strand or antisense strand may have a ligand that binds to a receptor specifically expressed in the target cells. The ligand can be added, for example, to the 5'-end and / or 3'-end of the sense strand or antisense strand. The ligand can be, for example, N-acetylgalactosamine (GalNAc) or a derivative thereof. Having GalNAc as the ligand can improve delivery to hepatocytes.
[0051] In the double-stranded RNA of the present disclosure, the antisense strand may have a main sequence complementary to the sense strand and an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the complementary main sequence. From the viewpoint of improving the function as siRNA, the additional sequence may be added to the 3'-end of the complementary base sequence. In a preferred example, when the additional sequence of the sense strand is added to the 3'-end of the main sequence, the additional sequence of the antisense strand is added to the 3'-end of the complementary base sequence. The configuration of the additional sequence in the antisense strand may be the same as the configuration of the additional sequence in the sense strand described above. Typically, the base sequence of the additional sequence in the antisense strand is the same as the additional sequence in the sense strand to which it hybridizes, but it may also be a different base sequence.
[0052] The antisense strand is composed of, for example, a base sequence of 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. The antisense strand is composed of a base sequence of the same length as the sense strand, and all or part of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand. In a preferred example, the antisense strand is composed of a base sequence of the same length as the sense strand, and all of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand.
[0053] <Method for Producing Double-Stranded RNA> The sense strand and antisense strand constituting the double-stranded RNA disclosed herein can be produced according to a general chemical synthesis method. For example, they can be synthesized using a commercially available DNA / RNA automatic synthesizer. Alternatively, the sense strand and antisense strand may be synthesized in vitro or in vivo based on genetic engineering techniques. The synthesized sense strand and antisense strand are preferably purified, and can be purified, for example, by HPLC or the like.
[0054] The double-stranded RNA disclosed herein can be produced, for example, by annealing (hybridizing) a sense strand and an antisense strand. Annealing can be performed according to conventional methods. For example, annealing can be performed by mixing equal amounts of the sense strand and the antisense strand in a solvent, heating at 90°C for 1 to 5 minutes, and then cooling to 4°C to room temperature. Examples of such solvents that can be used include distilled water, pure water, ultrapure water, and buffers (e.g., HEPES-KOH buffer at pH 7.4, PBS, etc.). To prevent active RNase (RNA degrading enzyme) from being mixed into the solvent, solvents that have been treated with, for example, DEPC or autoclaved are preferably used.
[0055] <Other Embodiments of Double-Stranded RNA> The double-stranded RNA disclosed herein also includes those in which the first strand and the second strand form a locally double-stranded structure via a loop structure. That is, the double-stranded RNA can also be used as an shRNA (short hairpin RNA) in another embodiment. shRNA is an RNA in which a main sequence and its complementary sequence exist on a single strand, and a loop sequence exists to form these loop structures. By having the loop structure, the shRNA hybridizes with the main sequence and its complementary sequence to form a locally double-stranded structure. This allows the shRNA to be processed by Dicer, an enzyme present in cells, to form the siRNA of the above-mentioned embodiment.
[0056] The structure of the shRNA may be the same as that of conventionally known shRNAs. The length of the shRNA may be, for example, 50 to 70 bases. The length of the loop sequence may be, for example, 19 to 29 bases. The shRNA may be incorporated into a vector (e.g., a lentivirus expression vector). Use of the shRNA can stably induce RNAi in cells and stably suppress viral proliferation.
[0057] <Composition> The composition disclosed herein contains the double-stranded RNA described above. In addition to the double-stranded RNA described above, the composition may contain various pharmaceutically acceptable carriers depending on the intended use. Preferred carriers include those commonly used in medicines as diluents, excipients, etc. The carriers vary depending on the intended use and form of the composition. Typical examples include water, physiological buffer solutions, various organic solvents, etc. The carrier may also be an aqueous solution of an appropriate concentration of alcohol (e.g., ethanol), glycerol, a non-drying oil such as olive oil, or liposomes. Examples of secondary components that may be contained in the pharmaceutical composition include various fillers, extenders, binders, humectants, surfactants, dyes, fragrances, etc. The composition may also contain carriers used in conventional drug delivery systems (DDS).
[0058] The form of the composition disclosed herein is not particularly limited. For example, typical composition forms include solutions, suspensions, emulsions, aerosols, foams, granules, powders, tablets, capsules, and ointments. Furthermore, for use in injections, etc., the composition can be made into a lyophilized product or granulated product that is dissolved in physiological saline or an appropriate buffer solution (e.g., PBS) immediately before use to prepare a medicinal solution. Furthermore, the process of preparing various forms of drugs (compositions) using double-stranded RNA (main component) and various carriers (secondary components) can be based on conventionally known methods. Since such formulation methods do not characterize the present disclosure, detailed explanations are omitted. For example, a detailed source of information regarding formulations is "Comprehensive Medicinal Chemistry," edited by Corwin Hansch, published by Pergamon Press (1990).
[0059] The compositions disclosed herein inhibit the proliferation of at least one type of cell. The cells whose proliferation is inhibited are cells involved in the expression of L-PGDS, such as brain cells, retinal cells, and tumor cells (e.g., pancreatic cancer, urothelial carcinoma, prostate cancer, breast cancer, ovarian cancer, lung cancer, neuroblastoma, liver cancer, pharyngeal cancer, gastric cancer, etc.). Among these, the compositions disclosed herein preferably inhibit the proliferation of tumor cells. In other words, the double-stranded RNA and compositions disclosed herein can be preferably used as antitumor agents (anticancer agents) that suppress the proliferation of tumor cells.
[0060] One embodiment of the composition disclosed herein includes, in addition to the double-stranded RNA described above, a peptide fragment (cell-penetrating peptide, CPP) that has cell membrane permeability and can pass through the cell membrane from the outside of a cell to introduce a foreign substance into the cytoplasm. The peptide fragment is directly or indirectly linked to the double-stranded RNA of the present disclosure to construct a construct of the peptide fragment and double-stranded RNA. Generally, double-stranded RNA is negatively charged and therefore cannot pass through the cell membrane. However, for example, by directly or indirectly linking the double-stranded RNA disclosed herein to the N-terminus and / or C-terminus of the peptide fragment, the construct of the peptide fragment and the double-stranded RNA can be introduced into the cytoplasm. The number of amino acid residues in the peptide fragment is not limited as long as cell membrane permeability is not impaired.
[0061] When the peptide fragment and the double-stranded RNA are indirectly bound, for example, a linker is placed between the peptide fragment and the double-stranded RNA. The type of linker is not particularly limited. Typically, it is a peptidic linker, a non-peptidic linker, or the like. Furthermore, the method for binding the peptide fragment and the double-stranded RNA is not particularly limited, and can be carried out according to various conventionally known scientific techniques.
[0062] One embodiment of the composition disclosed herein comprises a peptide fragment and the double-stranded RNA of the present disclosure. However, the double-stranded RNA does not necessarily have to be bound to the N- or C-terminus of the peptide fragment. In such an embodiment, the double-stranded RNA and the peptide fragment may form a complex, for example, through electrical or molecular interaction. Such a complex is more easily introduced into eukaryotic cells, thereby enabling efficient introduction of the double-stranded RNA. Nucleic acids such as double-stranded RNA are typically negatively charged. Therefore, the peptide fragment used preferably has a high proportion of basic amino acids and is positively charged. Furthermore, the proportion of the peptide fragment in this case may be 5 to 100 times, preferably 40 to 60 times, the molar ratio of the double-stranded RNA.
[0063] <Method for producing the composition disclosed herein and use thereof> The present disclosure may provide a method for inhibiting the proliferation of at least one type of cell using the composition disclosed herein. The method disclosed herein includes the steps of preparing the composition disclosed herein and supplying the composition to a target cell.
[0064] In the preparation step, for example, as described above, the composition disclosed herein may be prepared by a conventionally known method.
[0065] In the supplying step, the composition disclosed herein is supplied to at least one type of cell (e.g., tumor cells) in a living body (in vivo) or outside a living body (in vitro). The animal species of the supplied cells is not particularly limited and may be, for example, mammals, birds, amphibians, reptiles, fish, etc. Preferably, the animal species from which the L-PGDS, which is the basis of the main sequence of the double-stranded RNA contained in the composition, is derived is the same as the animal species of the target cells. The type of target cells is also not particularly limited, but is preferably tumor cells, more preferably neuroblastoma cells. Note that, although cells other than tumor cells may be present at the destination of the composition, the composition may be supplied only to the target cells (i.e., tumor cells).
[0066] The method of administering the composition may be similar to methods conventionally used in animal treatments and is not particularly limited. The composition can be used in vivo in a manner and dosage appropriate for its form and purpose. For example, as a liquid formulation, it can be administered in a desired amount to the affected area (e.g., malignant tumor tissue, virus-infected tissue, inflammatory tissue, etc.) of a patient or animal (i.e., living body) by intravenous, intralymphatic, intramuscular, subcutaneous, intradermal, or intraperitoneal injection. Alternatively, a solid form such as a tablet, or a gel or aqueous jelly such as an ointment, can be administered directly to a specific tissue (e.g., an affected area such as a tissue or organ containing tumor cells, inflammatory cells, etc.). Alternatively, a solid form such as a tablet can be administered orally. For oral administration, encapsulation or application of a protective (coating) material is preferred to prevent degradation by digestive enzymes in the digestive tract.
[0067] The amount of the composition to be supplied in vivo is not particularly limited. For example, the lower limit of the amount of double-stranded RNA per kg of animal may be 0.01 mg or more, 0.05 mg or more, or 0.1 mg or more. The upper limit of the amount of double-stranded RNA per kg of animal may be, for example, 10 mg or less, 5 mg or less, or 1 mg or less. The amount of the composition to be supplied in vitro is not particularly limited. In the culture medium of the subject to be supplied, such as cells, the lower limit of the double-stranded RNA concentration may be, for example, 1 nM or more, 5 nM or more, or 10 nM or more. The upper limit of the double-stranded RNA concentration in such culture medium may be, for example, 10 μM or less, 5 μM or less, 2 μM or less, 1 μM or less, or 100 nM or less.
[0068] The compositions disclosed herein can be delivered to the interior of target cells by known transfection methods. Examples include chemical gene transfer methods using cationic molecules (e.g., commercially available transfection reagents), physical transfer methods such as microinjection and electroporation, and biological gene transfer methods using viruses. Alternatively, as described above, the compositions may be delivered to the interior of cells using cell membrane-permeable peptide fragments.
[0069] Below, several test examples relating to the technology disclosed herein will be described, but it is not intended that the technology disclosed herein be limited to those shown in these test examples.
[0070] <Preparation of siRNA> Polynucleotides having the base sequences shown in SEQ ID NOS: 8 to 15 were artificially synthesized. The base sequences of each polynucleotide are shown in Table 1. In each polynucleotide, the "TT" (additional sequence) at the 3' end is DNA, and the remaining sequence (main sequence) is composed of RNA. The obtained polynucleotides were annealed with a sense strand and an antisense strand having complementary sequences to prepare the siRNAs used in Samples 1 to 4 shown in Table 1. Each of the siRNAs shown in Samples 1 to 4 was dissolved in PBS to give an RNA concentration of 2 mM, preparing an RNA solution.
[0071]
[0072] As shown in Table 1, the sense strand of siRNA in Sample 1 is composed of a main sequence consisting of SEQ ID NO: 1 (a base sequence that is a portion of the base sequence that encodes the signal peptide region of L-PGDS) and an additional sequence consisting of TT added to the 3'-end of the main sequence. Similarly, the sense strands of siRNA in Samples 2 to 4 shown in Table 1 are composed of a main sequence consisting of SEQ ID NOs: 2 to 4 (a base sequence that includes a portion of the base sequence that encodes the signal peptide region of L-PGDS) and an additional sequence consisting of TT added to the 3'-end of the main sequence. The antisense strand in each example is composed of a sequence complementary to the main sequence and an additional sequence consisting of TT added to the 3'-end of the sequence.
[0073] <Cell proliferation test of human neuroblastoma cells> Human neuroblastoma cells, the SK-N-SH strain, were used as tumor cells. SK-N-SH cells were pre-cultured in a culture medium containing 10% FBS (fetal bovine serum) + E-MEM (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 051-07615) + 1% MEM non-essential amino acid solution (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 139-15651). Note that 0.5% penicillin-streptomycin (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 168-23191) was added to the culture medium only during pre-culture, but was not added during the following culture and evaluation.
[0074] On day 1, the SK-N-SH cells that had adhered to the culture plate were washed with PBS, and then a 0.25% trypsin / EDTA solution was added and incubated at 37°C for 2 minutes. After this incubation, the above-mentioned culture medium was added to inactivate the trypsin. The cells were then precipitated by centrifugation at 150 x g for 5 minutes. After removing the supernatant resulting from centrifugation, the above-mentioned culture medium was added to the precipitate (cell pellet), and approximately 5 x 10 4 A cell suspension of 5 × 10 cells / mL was prepared. One commercially available 96-well plate was prepared, and the cell suspension was added to each well at a concentration of 5 × 10 3 The cells were seeded at 100 μL per well and incubated at 37°C, 5% CO 2 and incubated overnight under
[0075] (Sample 1) On the second day, 3 μL of RNA solution adjusted to 2 mM with PBS was mixed with 75 μL of Opti-MEM™ to prepare Solution A. Furthermore, 4.5 μL of Lipofectamine™ RNAiMAX was mixed with 75 μL of Opti-MEM™ to prepare Solution B. Next, equal amounts of Solution A and Solution B were mixed to prepare Solution C, which was then incubated at room temperature for 5 minutes. The prepared Solution C was added to wells where SK-N-SH cells had been cultured, at 11 μL / well (final concentration of double-stranded RNA: 4 μM). The mixture was then incubated at 37°C, 5% CO 2 The mixture was incubated under reduced pressure for 3 days.
[0076] Cell proliferation was evaluated using Cell Counting Kit-8 (CCK-8, Dojin Kagaku Kenkyusho). On day 5 (day 3 after siRNA addition), the 96-well plate in which SK-N-SH cells had been cultured was removed, 10 μL of CCK-8 was added to each well, and the cells were incubated at 37°C, 5% CO 2 The wells were incubated for 3.0 hours under reduced pressure. The absorbance at 450 nm of each well was measured. The absorbance was calculated as the average of the absorbances of three wells. In addition, a blank well was prepared containing only the culture medium and CCK-8 reagent. The absorbance of Sample 1 minus the absorbance of the blank was used as the measured value for Sample 1.
[0077] (Samples 2 to 4) Samples 2 to 4 were prepared in the same manner as Sample 1, except that the siRNA in Sample 1 was changed to the siRNAs in Samples 2 to 4 shown in Table 1.
[0078] Comparative Example In the comparative example, the same procedure was followed as in sample 1, except that a PBS solution was used instead of the RNA solution in sample 1. In other words, no siRNA was introduced in the comparative example.
[0079] Untreated wells were prepared in the same manner as Sample 1, except that the RNA solution and Lipofectamine™ RNAiMAX were not added. The cell viability in each test example is expressed as a percentage, with the measured value for the untreated well set at 100%, and is shown in Figure 2. Figure 2 shows the results of a test using the siRNAs shown in Table 1, i.e., siRNAs whose main sequence is a nucleotide sequence (SEQ ID NOS: 1 to 4) containing a portion of the nucleotide sequence encoding the signal peptide region of lipocalin-type prostaglandin D synthase, on neuroblastoma cells.
[0080] As shown in Figure 2, the cell viability of Samples 1 to 4 was reduced, and was significantly lower than that of the comparative example. From the above test results, it is believed that the siRNAs of Samples 1 to 4 have the function of inhibiting the proliferation of tumor cells (neuroblastoma cells). Furthermore, although not shown in detail, the sequences of Samples 1 to 4 are specific to the L-PGDS gene. Therefore, the siRNAs of Samples 1 to 4 can avoid off-target effects, do not affect other organs, and are therefore expected to be suitable for clinical application.
[0081] Although specific examples of the technology disclosed herein have been described in detail above, these are merely examples and do not limit the scope of the claims. The technology described in the claims includes various modifications and alterations of the specific examples exemplified above.
[0082] In the technology disclosed herein, each component and each process described herein may be omitted or combined as appropriate, unless a particular problem arises. This specification also includes the disclosures described in the following sections.
[0083] Item 1: A double-stranded RNA having a first strand and a second strand complementary to the first strand, wherein the first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence, wherein the main sequence is a part of a base sequence encoding a lipocalin-type prostaglandin D synthase and includes at least a part of a base sequence encoding a signal peptide region of the lipocalin-type prostaglandin D synthase.
[0084] Item 2: The double-stranded RNA according to Item 1, wherein the second strand is composed of a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence.
[0085] Item 3: A double-stranded RNA having a first strand and a second strand, wherein the first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and the second strand has a main sequence complementary to the main sequence, wherein the main sequence of the first strand is a part of a base sequence encoding a lipocalin-type prostaglandin D synthase, and includes at least a part of a base sequence encoding a signal peptide region of the lipocalin-type prostaglandin D synthase.
[0086] Item 4: The double-stranded RNA according to Item 3, wherein the first strand comprises an additional sequence consisting of 2 to 4 bases added to the 3'-end of the main sequence, and the second strand comprises an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence.
[0087] Item 5: The double-stranded RNA according to any one of Items 1 to 4, wherein at least two of the five bases on the 3'-terminal side of the main sequence are adenine (A) and / or uracil (U).
[0088] Item 6: The double-stranded RNA according to any one of Items 1 to 5, wherein the base sequence comprising at least a part of the base sequence encoding the signal peptide region of lipocalin-type prostaglandin D synthase consists of any one of the following base sequences: GCTACTCATCACACGCTGT (SEQ ID NO: 1); CTACTCATCACACGCTGTGGA (SEQ ID NO: 2); CTCATCACACGCTGTGGAT (SEQ ID NO: 3); or CATCACCGCTGTGGATGGGA (SEQ ID NO: 4).
[0089] Item 7: The double-stranded RNA according to any one of Items 1 to 6, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).
[0090] Item 8: A composition that inhibits the proliferation of at least one type of cell, comprising the double-stranded RNA of any one of Items 1 to 7.
[0091] Item 9: The composition of Item 8, wherein the cells are tumor cells.
[0092] Item 10: The composition according to Item 8 or 9, wherein the composition comprises a peptide fragment having cell membrane permeability that can pass through the cell membrane from the outside of the cell and introduce a foreign substance into the cytoplasm.
[0093] Item 11: A method for suppressing the proliferation of at least one type of cell, comprising: preparing the composition according to any one of Items 8 to 10; and supplying the composition to the cell in vitro or in vivo.
[0094] Item 12: The method according to Item 11, wherein the biological species of the cells is the same as the biological species containing the lipocalin-type prostaglandin D synthase.
[0095] As described above, the double-stranded RNA disclosed herein can inhibit (or suppress) cell proliferation, and therefore, by using the double-stranded RNA, a composition (e.g., an anti-tumor agent) that inhibits the proliferation of at least one type of cell (e.g., tumor cell) can be provided.
Claims
1. A double-stranded RNA having a first strand and a second strand, wherein the first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and the second strand has a complementary main sequence that binds to the main sequence, wherein the main sequence of the first strand is a part of a base sequence encoding a lipocalin-type prostaglandin D synthase, and includes at least a part of a base sequence encoding a signal peptide region of the lipocalin-type prostaglandin D synthase.
2. The double-stranded RNA according to claim 1, wherein the first strand comprises an additional sequence consisting of 2 to 4 bases added to the 3' end of the main sequence, and the second strand comprises an additional sequence consisting of 2 to 4 bases added to the 3' end of the complementary main sequence.
3. The double-stranded RNA according to claim 1, wherein at least two of the five bases on the 3'-terminal side of the main sequence are adenine (A) and / or uracil (U).
4. The double-stranded RNA according to claim 1, wherein the base sequence comprising at least a portion of the base sequence encoding the signal peptide region of the lipocalin-type prostaglandin D synthase consists of any of the following base sequences: GCTACTCATCACACACGCTGT (SEQ ID NO: 1); CTACTCATCACACGCTGTGGA (SEQ ID NO: 2); CTCATCACACGCTGTGGAT (SEQ ID NO: 3); or CATCACACGCTGTGGATGGGA (SEQ ID NO: 4).
5. The double-stranded RNA according to claim 1, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).
6. A composition for inhibiting the proliferation of at least one type of cell, comprising the double-stranded RNA according to any one of claims 1 to 5.
7. The composition of claim 6, wherein the cells are tumor cells.
8. The composition according to claim 7, comprising a peptide fragment having cell membrane permeability that can pass through the cell membrane from the outside of the cell and introduce a foreign substance into the cytoplasm.
9. A method for inhibiting the proliferation of at least one type of cell, comprising the steps of: providing a composition according to claim 8; and delivering said composition to said cells in vitro.
10. The method according to claim 9, wherein the biological species of the cells is the same as the biological species containing the lipocalin-type prostaglandin D synthase.
Citation Information
Patent Citations
Methods and compositions for detecting and treating retinal diseases
JP2007528371A
Medicinal composition
JP2010202529A
RNA interference mediated inhibition of prostaglandin D2 receptor (PTGDR) and prostaglandin D2 synthetase (PTGDS) gene expression using short interfering RNA
US20030148507A1
Methods and compositions for inhibiting or reducing hair loss, acne, rosacea, prostate cancer, and bph
US20110021599A1