Methods of treating bladder cancer

Intravesical administration of a nucleic acid polyplex encoding IL-12 and RIG-I agonists addresses the limitations of BCG and IL-12 treatments for NMIBC, providing a localized immune response and reducing systemic toxicity, thus offering a viable alternative to radical cystectomy.

WO2026029772A1PCT designated stage Publication Date: 2026-02-05ENGENE INC +7
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/040410
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-07-31
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

Current treatments for non-muscle invasive bladder cancer (NMIBC), such as Bacillus Calmette-Guerin (BCG), have a high failure rate and limited supply, leading to unmet medical needs for more effective intravesical therapies that can prevent cancer spread while preserving the bladder, and existing IL-12 immunotherapies face challenges with systemic toxicities and delivery limitations.

Method used

A method involving intravesical administration of a nucleic acid polyplex comprising a cationic polymer and therapeutic nucleic acid constructs encoding IL-12 and RIG-I agonists, such as detalimogene voraplasmid, in a specific dosing regimen to induce localized immune response and treat bladder cancer.

Benefits of technology

The method provides a safe and effective treatment for NMIBC by inducing a potent localized immune response, reducing systemic toxicity, and maintaining bladder integrity, offering an alternative to radical cystectomy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024040410_05022026_PF_FP_ABST
    Figure US2024040410_05022026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates to methods for treating bladder cancer in a patient in need thereof, comprising intravesically administering a pharmaceutical composition comprising a nucleic acid polyplex comprising (a) a dually derivatized chitosan and (b) a therapeutic nucleic acid construct encoding interleukin-12 (IL-12) and one or more RIG-I agonists, in one or more treatment cycles to the patient, wherein each treatment cycle comprises a first dose, a second dose administered at least 5-9 days after the first dose, a third dose administered at least 18-24 days after the second dose, and a fourth dose administered at least 5-9 days after the third dose; preferably wherein the pharmaceutical composition comprises from about 30 mg to about 50 mg, more preferably about 40 mg, of detalimogene voraplasmid.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS OF TREATING BLADDER CANCER FIELD OF THE INVENTION

[0001] The present disclosure relates to methods of treating bladder cancers by the localizeddelivery and expression of IL-12 and one or more RIG-1 agonists. BACKGROUND

[0002] Cancerous diseases and tumors are among the major causes for human deaths andsevere illness. Bladder cancer represents a serious, life-threatening condition. Based on data reported through 2020, bladder cancer is expected to result in an estimated 2.7% of all cancer deaths in 2023 while comprising an estimated 4.2% of all new cancer cases according to the National Institutes of Health. Overall, according to the American Cancer Society and the National Institutes of Health, the chance men will develop this cancer during their life is about 1 in 28; and for women, the chance is about 1 in 91.

[0003] Non-muscle invasive bladder cancer (NMIBC) is a major type of bladder cancer witha high incidence worldwide, resulting in a great disease burden. Due to early warning signals such as hematuria, many instances of bladder cancer can be diagnosed while still localized to the bladder urothelium, and NMIBCs represent approximately 80% of newly diagnosed bladder tumors. Carcinoma in situ, or Cis, is a form of NMIBC: a flat, high-grade, sessile tumor that has a high likelihood of invading the deeper layers of the bladder wall. A “high-” or “low-” tumor risk describes the degree to which the tumor pathology appears more likely to grow quickly and invade non-cancerous tissue. NMIBC with Cis is typically initially treated with a solution containing the bacterium Bacillus Calmette-Guerin (BCG) that is instilled into the bladder multiple times over the course of several months to years. Despite this treatment, many of these cancers recur and are unresponsive to additional BCG, allowing the cancer to spread throughout and deeper into the bladder and often requiring surgical removal of the bladder (radical cystectomy).

[0004] BCG has been the primary therapy for high-risk NMIBC since the 1970s, despite theadverse effects with which it is associated and a >50% failure rate. Unfortunately, due to the increased use of BCG in this setting and the loss of several manufacturers of BCG, supply constraints have resulted in a shortage of BCG for clinical use. To manage the limited supply available in the United States, as of February 2019 the American Urological Association and their - 1 - 1102248259\1\AMERICAScollaborative physician groups revised their treatment guidelines to recommend that BCG should be prioritized for patients with high-risk disease and they should receive full-strength BCG induction, but subsequent maintenance doses could be one-half to one-third the standard dose. This situation is projected to continue into 2026 and has brought additional urgency to the unmet medical need for more effective intravesical treatments for patients with high grade NMIBC, according to the American Urological Association.

[0005] In general, as many as 75% of the patients treated with BCG develop a new tumor infive years and unfortunately a second course of BCG is unlikely to provide further benefit. This population represents a profound medical need to keep their cancer from becoming invasive while being able to preserve their bladders. In addition, patients receiving local salvage therapy for NMIBC with Cis who failed BCG induction and maintenance generally do not respond to more BCG, or to other intravesical chemotherapy agents. Accordingly, for patients with BCG- unresponsive NMIBC, the only currently available treatment option is radical cystectomy, which is associated with significant complications, including a lower quality of life, and risk of death.

[0006] IL-12 is a cytokine that has demonstrated remarkable antitumor activity against a range of cancers in pre-clinical studies. Unfortunately, however, severe toxicities associated with systemic injections of IL-12 have limited its clinical use, and the efficacy of IL-12 at tolerated doses has been minimal. Prior art attempts to treat bladder cancer patients by way of intravesical delivery of recombinant IL-12 protein ultimately provided “no clinically relevant evidence of antitumor or immunologic effect (Weiss et al., J Immunother. 2003 Jul-Aug;26(4):343-8)”. More recently developed IL-12 treatments also face their challenges. For example, intra-tumoral injection of IL- 12-encoding DNA or RNA is limited by variable transfection rates, and virus-based delivery systems suffer from host’s immune response to the viral vector as well as viral dissemination and liver infection.

[0007] Accordingly, there remains a need in the art for improved IL-12 immunotherapies fortreating bladder cancers (e.g., NMIBC) and other cancers. Fortunately, the present disclosure provides for these and other needs. - 2 - 1102248259\1\AMERICASSUMMARY OF THE INVENTION

[0008] The present disclosure resolves the still unmet need in the art for treating bladdercancers, e.g., NMIBC, by providing a safe and effective dose and administration regimen for nucleic acid constructs encoding IL-12 and at least one RIG-1 agonist.

[0009] In one aspect, the present disclosure provides a method for treating bladder cancer in apatient in need thereof, comprising intravesically administering a pharmaceutical composition comprising a nucleic acid polyplex comprising a cationic polymer and / or lipid and one or more therapeutic nucleic acid constructs encoding interleukin-12 (IL-12) and at least one RIG-I agonist, in one or more treatment cycles to the patient. In another aspect, the present disclosure provides a pharmaceutical composition comprising a nucleic acid polyplex comprising a cationic polymer and / or lipid and one or more therapeutic nucleic acid constructs encoding interleukin-12 (IL-12) and at least one RIG-I agonist, for use in one or more treatment cycles for treating bladder cancer.

[0010] In embodiments, each treatment cycle comprises a first dose, a second doseadministered at least 5-9 days after the first dose, preferably 6-8 days after the first dose, more preferably 6, 7, or 8 days after the first dose, a third dose administered at least 18-24 days after the second dose, preferably 19-23 days after the second dose, more preferably 20, 21, or 22 days after the second dose, and a fourth dose administered at least 5-9 days after the third dose, preferably 6- 8 days after the third dose, more preferably 6, 7, or 8 days after the third dose.

[0011] In embodiments, the therapeutic nucleic acid constructs encoding IL-12 and the at leastone RIG-I agonist are different nucleic acid constructs. In embodiments, the at least one RIG-I agonist is selected from the group consisting of eRNA11a, VA RNA1, eRNA41H, MK4621, SLR10, SLR14, and SLR20, and more preferably comprises eRNA41H or eRNA11a.

[0012] In embodiments, the cationic polymer is selected from the group consisting ofpolyethyleneimine (PEI), PAMAM, polylysine (PLL), polyarginine, chitosan, and derivatives thereof. In embodiments, the cationic polymer comprises a derivatized chitosan, preferably an amino-functionalized chitosan comprising arginine; optionally further comprising or functionalized with a hydrophilic polyol, preferably glucose.

[0013] In embodiments, the derivatized chitosan has the structure of Formula II- 3 - 1102248259\1\AMERICASI). In emb , has an average molecular weight from 5 about kDa to about 10 kDa, preferably about 7 kDa. In embodiments, the derivatized chitosan has an average molecular weight of about 10 kDa.

[0014] In embodiments, the derivatized chitosan comprises from about 50% to about 77% non-functionalized glucosamine monomer unit, and preferably from about 20% to about 35% glucosamine monomer unit conjugated with arginine, and from about 3% to about 15% glucosamine monomer unit conjugated with glucose. In embodiments, the derivatized chitosan comprises about 62% non-functionalized glucosamine monomer unit, and preferably about 28% glucosamine monomer unit conjugated with arginine, and about 10% glucosamine monomer unit conjugated with glucose.

[0015] In embodiments, the nucleic acid polyplex has an average hydrodynamic diameter fromabout 100 nm to about 150 nm, preferably about 118 nm. In embodiments, the nucleic acid polyplex has an average polydispersity index (PDI) of less than about 0.22, preferably about 0.13. In embodiments, the nucleic acid polyplex has an average zeta potential from about -1 mV to about +6 mV, preferably about +2.5 mV. In embodiments, the nucleic acid polyplex has at least about 70%, preferably about 84%, supercoil DNA.

[0016] In embodiments, the nucleic acid polyplex in the pharmaceutical composition is orcomprises detalimogene voraplasmid. In embodiments, the pharmaceutical composition comprises between about 30 mg and about 50 mg, preferably between about 35 mg and about 45 mg, more preferably about 40 mg, of detalimogene voraplasmid. In embodiments, each dose comprises concentrations between about 700 µg / mL and about 900 µg / mL of detalimogene voraplasmid, preferably between about 750 µg / mL and 850 µg / mL of detalimogene voraplasmid, more preferably about 800 µg / mL of detalimogene voraplasmid. In embodiments, the volume of - 4 - 1102248259\1\AMERICASeach dose is between about 40 and about 60 mL, more preferably between about 45 and about 55 mL, most preferably about 50 mL.

[0017] In embodiments, the method further comprises at least one additional treatment cycle,wherein the additional treatment cycle is commenced about six weeks after the fourth dose of the preceding treatment cycle. In embodiments, the method comprises four treatment cycles.

[0018] In embodiments, the method further comprises a maintenance treatment cycle initiated1year after the start of the first treatment cycle comprising a first maintenance dose and a second maintenance dose administered at least 5-9 days, preferably 7 days after the first maintenance dose. In embodiments, the method comprises at least one additional maintenance treatment cycle, wherein the additional treatment cycle is commenced six weeks after about 11 weeks after the second dose of the preceding maintenance treatment cycle.

[0019] In embodiments, the bladder cancer is non-muscle invasive bladder cancer (NMIBC).In embodiments, the NMIBC is high-risk disease. In embodiments, the NMIBC is or comprises carcinoma in situ, or Cis. In embodiments, the patient has received Bacillus calmette-Guerin (BCG) treatment. In embodiments, the patient is unresponsive or refractory to the BCG treatment.

[0020] Other features, objects and advantages will be apparent from the disclosure thatfollows. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The present disclosure is disclosed with reference to the accompanying drawings,wherein:

[0022] FIG. 1 describes key features of patient cohorts receiving treatment of EG-70 in theclinical study described in Examples 1 and 2.

[0023] FIG. 2 shows treatments of EG-70 administered to patients in the clinical studydescribed in Examples 1 and 2.

[0024] FIG.3 shows concentration of IL-12 in patients treated with EG-70 in the clinical studydescribed in Examples 1 and 2. DETAILED DESCRIPTION

[0025] The present disclosure provides methods for treating cancers (e.g., bladder cancer suchas NMIBC). In one aspect, the methods herein provide a local treatment through bladder - 5 - 1102248259\1\AMERICASinstillation that induces a potent immune response localized at the site of the tumor, resulting in greater therapeutic benefit while reducing undesirable systemic toxicity. In embodiments, the methods comprise sequentially administering to a patient multiple doses of a pharmaceutical composition comprising a nucleic acid polyplex comprising a cationic polymer and / or lipid and one or more therapeutic nucleic acid constructs encoding interleukin-12 (IL-12) and at least one RIG-I agonist. In embodiments, the nucleic acid polyplex is a dually derivatized chitosan comprising one or more therapeutic nucleic acid constructs encoding interleukin-12 (IL-12) and two RIG-I agonists. In exemplary embodiments, the pharmaceutical composition is detalimogene voraplasmid described herein. The doses may be administered intravesically and in one or more treatment cycles. Each of the treatment cycle may comprise four doses. For example, in such a treatment cycle, the second dose may be administered at least 5-9 days (e.g., 7 days) after the first dose, the third dose may be administered at least 18-24 days (e.g., 21 days) after the second dose, and the fourth dose may be administered at least 5-9 days (e.g., 7 days) after the third dose. DEFINITIONS

[0026] Unless otherwise defined, all terms of art, notations and other scientific terminologyused herein are intended to have the meanings commonly understood by those of skill in the art to which this disclosure pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a difference over what is generally understood in the art. The techniques and procedures described or referenced herein are generally well understood and commonly employed using conventional methodologies by those skilled in the art, such as, for example, the widely utilized molecular cloning methodologies described in Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. As appropriate, procedures involving the use of commercially available kits and reagents are generally carried out in accordance with manufacturer defined protocols and / or parameters unless otherwise noted.

[0027] As used herein, the singular forms “a,” “an,” and “the” include the plural referentsunless the context clearly indicates otherwise.

[0028] The term “about” indicates and encompasses an indicated value and a range above andbelow that value. In embodiments, the term “about” indicates the designated value ± 10%, ± 5%, - 6 - 1102248259\1\AMERICASor ± 1%. In embodiments, where indicated, the term “about” indicates the designated value ± one standard deviation of that value.

[0029] The term “combinations thereof” includes every possible combination of elements towhich the term refers.

[0030] The term “primary tumor” or “primary cancer” as used herein, refers to a tumor presentat the anatomical site where tumor progression began and proceeded to yield a cancerous mass. Exemplary primary cancers include a primary tumor of the bladder, the colon, the lung, the vagina, the ovaries, the cervix, the kidney, the stomach, gastrointestinal tract, the prostate, the brain, the breast, the pancreas, the lung, the thyroid, the endometrium, the esophagous, the larynx, nasal cancer, oral cancer, melanoma, pharyngeal cancer, retinoblastoma, testicular cancer, etc.

[0031] Thus, “treating” or “treatment” of any disease or disorder refers, in certainembodiments, to ameliorating a disease or disorder that exists in a subject. “Treating” or “treatment” includes ameliorating at least one physical parameter, which may be indiscernible by the subject. In another embodiment, “treating” or “treatment” includes modulating the disease or disorder, either physically (e.g., stabilization of a discernible symptom) or physiologically (e.g., stabilization of a physical parameter) or both. In another embodiment, “treating” or “treatment” includes delaying or preventing the onset of the disease or disorder. For example, in embodiments, the phrase “treating cancer” refers to inhibition of cancer cell proliferation, inhibition of cancer spread (e.g., metastasis), inhibition of tumor growth, reduction of cancer cell number or tumor growth, decrease in the malignant grade of a cancer (e.g., increased differentiation), or improved cancer-related symptoms. Further, as used herein, “treatment” includes preventing or delaying the recurrence of the disease, delaying or slowing the progression of the disease, ameliorating the disease state, providing a remission (partial or total) of the disease, decreasing the dose of one or more other medications required to treat the disease, delaying the progression of the disease, increasing or improving the quality of life, increasing weight gain, and / or prolonging survival. Also encompassed by “treatment” is a reduction of pathological consequence of cancer.

[0032] As used herein, the term “therapeutically effective amount” or “effective amount”refers to an amount of the subject compositions that when administered to a subject is effective to treat a disease or disorder. For example, in an exemplary embodiment, the phrase “effective amount” is used interchangeably with "therapeutically effective amount" or “therapeutically effective dose” and the like, and means an amount of a therapeutic agent that is effective for - 7 - 1102248259\1\AMERICAStreating cancer. Effective amounts of the compositions provided herein may vary according to factors such as the disease state, age, sex, weight of the animal.

[0033] The term “dose” and its grammatical derivatives and equivalents refer to the amount ofa therapeutic composition administered to a subject. A dose may be described in terms of mass of a therapeutic composition administered per day, in terms of the weight of the therapeutic composition per volume, or in equivalent types of measurements.

[0034] As used herein, the term “patient,” “subject,” or “individual” means a mammaliansubject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, avians, goats, and sheep. In embodiments, the subject is a human.

[0035] “Chitosan” is a partially or entirely deacetylated form of chitin, a polymer of N-acetylglucosamine. For example, chitosan may have any degree of deacetylation greater than 50%.

[0036] Chitosan may be derivatized by functionalizing free amino groups at the sites ofdeacetylation. The derivatized chitosans described herein have a number of properties which are advantageous for a nucleic acid delivery vehicle, including: they effectively bind and complex the negatively charged nucleic acids, they can be formed into nanoparticles of a controllable size, they can be taken up by the cells and they can release the nucleic acids at the appropriate time within the cells. Chitosans may be with any degree of functionalization between 1% and 50%. (Percent functionalization is determined relative to the number of free amino moieties on the chitosan polymer prior-to or in the absence of functionalization.) The degrees of deacetylation and functionalization may impart a specific charge density to the functionalized chitosan derivative.

[0037] A polyol described herein may have a 3, 4, 5, 6, or 7 carbon backbone and may have atleast 2 hydroxyl groups. Such polyols, or combinations thereof, may be useful for conjugation to a chitosan backbone, such as a chitosan that has been functionalized with a cationic moiety (e.g., a molecule comprising an amino group such as, lysine, ornithine, a molecule comprising a guanidinium group, arginine, or a combination thereof).

[0038] The term “C2-C6 alkylene” as used herein refers to a linear or branched divalenthydrocarbon radical optionally containing one or more carbon-carbon multiple bonds. For the avoidance of doubt, the term “C2-C6 alkylene” as used herein encompasses divalent radicals of alkanes, alkenes and alkynes.

[0039] The term “polypeptide” is used in its broadest sense to refer to conventionalpolypeptides (e.g., short polypeptides containing L or D-amino acids), as well as peptide - 8 - 1102248259\1\AMERICASequivalents, peptide analogs and peptidomimetics that retain the desired functional activity. Peptide equivalents can differ from conventional peptides by the replacement of one or more amino acids with related organic acids, amino acids or the like, or the substitution or modification of side chains or functional groups. As used herein, unless otherwise indicated, the term “peptide” and “polypeptide” are used interchangeably.

[0040] Peptidomimetics may have one or more peptide linkages replaced by an alternativelinkage, as is known in the art. Portions or all of the peptide backbone can also be replaced by conformationally constrained cyclic alkyl or aryl substituents to restrict mobility of the functional amino acid sidechains, as is known in the art.

[0041] The polypeptides of this disclosure may be produced by recognized methods, such asrecombinant and synthetic methods that are well known in the art. Techniques for the synthesis of peptides are well known and include those described in Merrifield, J. Amer. Chem. Soc. 85:2149-2456 (1963), Atherton, et al., Solid Phase Peptide Synthesis: A Practical Approach, IRL Press (1989), and Merrifield, Science 232:341-347 (1986).

[0042] As used herein, “linear polypeptide” refers to a polypeptide that lacks branching groupscovalently attached to its constituent amino acid side chains. As used herein, “branched polypeptide” refers to a polypeptide that comprises branching groups covalently attached to its constituent amino acid side chains.

[0043] The “final functionalization degree” of cation or polyol as used herein refers to thepercentage of cation (e.g., amino) groups on the chitosan backbone functionalized with cation (e.g., amino) or polyol, respectively. Accordingly, “α:β ratio,” “final functionalization degree ratio” (e.g., Arginine final functionalization degree: polyol final functionalization degree ratio) and the like may be used interchangeably with the term “molar ratio” or “number ratio.”

[0044] Dispersed systems have particulate matter, known as the dispersed phase, distributedthroughout a continuous medium. A “dispersion” of chitosan nucleic acid polyplexes is a composition comprising hydrated chitosan nucleic acid polyplexes, wherein polyplexes are distributed throughout the medium.

[0045] As used herein, a “pre-concentrated” dispersion is one that has not undergone theconcentrating process to form a concentrated dispersion.

[0046] As used herein, “substantially free” of polyplex precipitate means that the compositionis essentially free from particles that can be observed on visual inspection. - 9 - 1102248259\1\AMERICAS

[0047] As used herein, physiological pH refers to a pH between 6 to 8.

[0048] By “chitosan nucleic acid polyplex” or its grammatical equivalents is meant a complexcomprising a plurality of chitosan molecules and a plurality of nucleic acid molecules. In a preferred embodiment, the (e.g., dually-) derivatized-chitosan is complexed with said nucleic acid.

[0049] The term “polyethylene glycol” (“PEG”) as used herein is intended to mean a polymerof ethylene oxide having repeat units of —(CH2CH2—O)— and the general formula of HO— (CH2CH2—O)n—H.

[0050] The term “monomethoxy polyethylene glycol” (“mPEG”) as used herein is intended tomean a polymer of ethylene oxide having repeat units of —(CH2CH2—O)— and the general formula of CH3O—(CH2CH2—O)n—H, for example, a PEG capped at one end with a methoxy group.

[0051] The term “reversible” refers to a polymer coating attached to other components of apolyplex via non-covalent or dynamic covalent bonds that can reversibly form and dissociate. In embodiments, a polymer coating (e.g., PEG-b-PLE) on a polyplex is attached to the polyplex via a non-covalent bond. PHARMACEUTICAL COMPOSITIONS

[0052] The pharmaceutical composition administered by the method herein may comprise atherapeutic composition comprising a nucleic acid polyplex comprising a cationic polymer and / or lipid, and one or more therapeutic nucleic acid constructs encoding interleukin-12 (IL-12) and at least one RIG-I agonist. In embodiments, the cationic polymer is a chitosan or a chitosan derivative. In embodiments, the nucleic acid polyplex is a dually chitosan derivative nucleic acid nanoparticle.

[0053] The therapeutic composition may further comprise a polyanion-containing block co-polymer, e.g. a diblock and / or triblock co-polymer coating of the nucleic acid polyplex, where individual polymer molecules comprise a negatively charged anchor region and one or more non- charged hydrophilic tail regions. Exemplary polymer molecules include “PEG-PA” polymer molecules comprising a polyethylene glycol (PEG) portion and a polyanion (PA) portion. In embodiments, the nucleic acid polyplexes of the subject disclosure function to condense and protect the nucleotides from enzymatic degradation. - 10 - 1102248259\1\AMERICASChitosan

[0054] The chitosan component of the chitosan-derivative nucleic acid nanoparticle can befunctionalized with a cationic functional group and / or a hydrophilic moiety. Chitosan functionalized with two different functional groups is referred to as dually derivatized chitosan (DD-chitosan). In some examples, DD-chitosans are functionalized with both a hydrophilic moiety (e.g., a polyol) and a cationic functional group (e.g., an amino group). Exemplary chitosan derivatives are also described in, e.g., U.S.2007 / 0281904; and U.S.2016 / 0235863, each of which is incorporated by reference herein in its entirety.

[0055] In embodiments, the dually derivatized chitosan comprises chitosan having a degree ofdeacetylation of at least 50%, e.g., at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%. In an example, the dually derivatized chitosan comprises chitosan having a degree of deacetylation of at least 98%.

[0056] In embodiments, the chitosan derivatives have a range of average molecular weightsthat are soluble at neutral and physiological pH, e.g., molecular weights ranging from 3 kDa to 110 kDa. Embodiments described herein feature lower average molecular weight of derivatized chitosans (<25 kDa, e.g., from about 5kDa to about 25kDa), which can have desirable delivery and transfection properties, and are small in size and have favorable solubility.

[0057] An ordinarily skilled artisan will recognize that chitosan refers to a plurality ofmolecules having a structure of Formula I, wherein n is any integer, and each R1 is independently selected from acetyl or hydrogen, wherein the degree of R1 selected from hydrogen is between 50% to 100%. Also, chitosan referred to as having an average molecular weight, e.g., of 3kD to 110kD, generally refers to a plurality of chitosan molecules having a weight average molecular weight of, e.g., 3kD to 110kD, respectively, wherein each of the chitosan molecules may have different chain lengths (n+2). It is also well recognized that chitosan referred to as “n-mer chitosan,” does not necessarily comprise chitosan molecules of Formula I, wherein each chitosan molecule has a chain length of n+2. Rather, “n-mer chitosan” as used herein refers a plurality of chitosan molecules, each of which may have different chain lengths, wherein the plurality has an average molecule weight substantially similar to or equal to a chitosan molecule having a chain length of n. For example, 24-mer chitosan may comprise a plurality of chitosan molecules, each having different chain lengths ranging from, e.g.7-50, but which has a weight average molecular weight substantially similar or equivalent to a chitosan molecule having a chain length of 24. - 11 - 1102248259\1\AMERICAS

[0058] A dually derivatized chitosan of the disclosure may also be functionalized with apolyol, or a hydrophilic functional group such as a polyol. Without wishing to be bound by theory, it is hypothesized that functionalization with a hydrophilic group such as a polyol may increase the hydrophilicity of chitosan (including Arginine-chitosan) and / or may donate a hydroxyl group. In some embodiments, the hydrophilic functional group of the chitosan-derivative nanoparticles is or comprises gluconic acid. See, e.g., WO 2013 / 138930. In some embodiments, the hydrophilic functional group of the chitosan-derivative nanoparticles is or comprises glucose. Additionally or alternatively, the hydrophilic functional group can comprise a polyol. See, e.g., U.S. 2016 / 0235863. Exemplary polyols for functionalization of chitosan are further described below.

[0059] The functionalized chitosan derivatives described herein include dually derivatized-chitosan compounds, e.g., cation-chitosan-polyol compounds. In general, the cation-chitosan- polyol compounds are functionalized with an amino-containing moiety, such as an arginine, lysine, ornithine, or molecule comprising a guanidinium, or a combination thereof. In certain embodiments, the cation-chitosan-polyol compounds have the following structure of Formula I:^ is the final functionalization degree of the cation moiety (e.g., a molecule comprising an amino group such as, lysine, ornithine, a molecule comprising a guanidinium group, arginine, or a combination thereof), ^ is the final functionalization degree of polyol; and each R1is independently selected from hydrogen, acetyl, a cation (e.g., arginine), and a polyol. In embodiments, the chitosan is functionalized with arginine and glucose. In one example, the functionalized chitosan has a structure shown in Formula II. - 12 - 1102248259\1\AMERICASII)

[0060] In be functionalizedwith the cationic amino acid, arginine. In embodiments, a dually derivatized chitosan of the disclosure may be functionalized with arginine and glucose.

[0061] In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupledwith glucose at a final functionalization degree of 1%, 2%, 4%, 7%, 8%, 10%, 15%, 20%, 25%, 30%, or greater. In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupled with a cationic moiety (e.g., arginine) at a final functionalization degree of from about 1% to about 25%. In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupled with a cationic moiety (e.g., arginine) at a final functionalization degree of from about 10% to about 40%.

[0062] In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupledwith a cationic moiety (e.g., arginine) at a final functionalization degree of from about 10% to about 35%. In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupled with a cationic moiety (e.g., arginine) at a final functionalization degree of from about 20% to about 35%. In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupled with a cationic moiety (e.g., arginine) at a final functionalization degree of from about 25% to about 35%. In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupled with a cationic moiety (e.g., arginine) at a final functionalization degree of from about 25% to about 30%.

[0063] In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupledwith a cationic moiety (e.g., arginine) at a final functionalization degree of from about 15% to about 40%. In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupled - 13 - 1102248259\1\AMERICASwith a cationic moiety (e.g., arginine) at a final functionalization degree of from about 15% to about 35%. In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupled with a cationic moiety (e.g., arginine) at a final functionalization degree of from about 15% to about 30%. In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupled with a cationic moiety (e.g., arginine) at a final functionalization degree of from about 15% to about 28%.

[0064] In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupledwith a cationic moiety (e.g., arginine) at a final functionalization degree of from about 10% to about 35%. In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupled with a cationic moiety (e.g., arginine) at a final functionalization degree of from about 10% to about 30%. In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupled with a cationic moiety (e.g., arginine) at a final functionalization degree of from about 10% to about 28%. In one embodiment, the chitosan derivative nanoparticle comprises chitosan coupled with a cationic moiety (e.g., arginine) at a final functionalization degree of about 28%.

[0065] In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupledwith glucose at a final functionalization degree of from about 2% to about 30%, from about 5% to about 30%, from about 7.5% to about 30%, from about 5% to about 25%, from about 5% to about 22%, from about 5% to about 20%, from about 3% to about 15%, from about 5% to about 15%, or from about 5% to about 10%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with glucose at a final functionalization degree of from about 7.5% to about 25%, from about 7.5% to about 20%, from about 7.5% to about 15%, or from about 7.5% to about 12%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with glucose at a final functionalization degree of about 10%.

[0066] In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupledwith cation (e.g., arginine) at a final functionalization degree of from about 2% to about 40% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 2% to about 30%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of from about 5% to about 40% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 5% to about 25%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of from about 7.5% to about 40% - 14 - 1102248259\1\AMERICASand hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 7.5% to about 20%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of from about 10% to about 40% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 7.5% to about 15%, or about 10%.

[0067] In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupledwith cation (e.g., arginine) at a final functionalization degree of from about 2% to about 35% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 2% to about 30%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of from about 5% to about 35% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 5% to about 25%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of from about 7.5% to about 35% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 7.5% to about 20%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of from about 10% to about 35% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 7.5% to about 15%, or about 10%.

[0068] In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupledwith cation (e.g., arginine) at a final functionalization degree of from about 10% to about 30% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 2% to about 30%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of from about 12% to about 30% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 5% to about 25%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of from about 14% to about 30% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 7.5% to about 20%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of from about 15% to about 30% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 7.5% to about 15%, or about 10%. - 15 - 1102248259\1\AMERICAS

[0069] In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupledwith cation (e.g., arginine) at a final functionalization degree of about 25% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 7.5% to about 15%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of about 28% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 7.5% to about 15%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of about 25% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 5% to about 20%. In one embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of about 28% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of from about 5% to about 20%. In one embodiment, the chitosan- derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of about 28% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree from about 3% to about 15%.

[0070] In a preferred embodiment, the chitosan-derivative nanoparticle comprises chitosancoupled with cation (e.g., arginine) at a final functionalization degree of about 14% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of about 10%. In a preferred embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with cation (e.g., arginine) at a final functionalization degree of about 15% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of about 12%. In another preferred embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with arginine at a final functionalization degree of about 14% and glucose at a final functional degree of about 10%. In another preferred embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled with arginine at a final functionalization degree of about 15% and glucose at a final functional degree of about 12%.

[0071] In a preferred embodiment, the chitosan-derivative nanoparticle comprises chitosancoupled with cation (e.g., arginine) at a final functionalization degree of about 28% and hydrophilic polyol (e.g., glucose or gluconic acid) at a final functional degree of about 10%. In another preferred embodiment, the chitosan-derivative nanoparticle comprises chitosan coupled - 16 - 1102248259\1\AMERICASwith arginine at a final functionalization degree of about 28% and glucose at a final functional degree of about 10%.

[0072] In embodiments, where appropriate, DD-chitosan includes DD-chitosan derivatives,e.g., DD chitosan that incorporate an additional functionalization, e.g., DD-chitosan with an attached ligand. “Derivatives” will be understood to include the broad category of chitosan-based polymers comprising covalently modified N-acetyl-D-glucosamine and / or D-glucosamine units, as well as chitosan-based polymers incorporating other units, or attached to other moieties. Derivatives are frequently based on a modification of the hydroxyl group or the amine group of glucosamine, such as done with arginine-functionalized chitosan. Examples of chitosan derivatives include trimethylated chitosan, thiolated chitosan, galactosylated chitosan, alkylated chitosan, PEI-incorporated chitosan, uronic acid modified chitosan, glycol chitosan, and the like. For furtherteaching on chitosan derivatives, see, e.g., pp.63-74 of “Non-viral Gene Therapy,” K. Taira, K.Kataoka, T. Niidome (editors), Springer-Verlag Tokyo, 2005, ISBN 4-431-25122-7; Zhu et al., Chinese Science Bulletin, December 2007, vol. 52 (23), pp. 3207-3215; and Varma et al., Carbohydrate Polymers 55 (2004) 77–93. Chitosan (or chitosan derivative) Nucleic Acid Polyplex

[0073] The chitosan-derivative nanoparticle compositions generally contain at least onenucleic acid molecule, and preferably a plurality of such nucleic acid molecules. Typical nucleic acid molecules comprise phosphorous as a component of the nucleic acid backbone, e.g., in the form of a plurality of phosphodiesters or derivatives thereof (e.g., phosphorothioate). The proportion of cation-functionalized chitosan-derivative to nucleic acid can be characterized by a cation (+) to phosphorous (P) molar ratio, wherein the (+) refers to the cation of the cation- functionalized chitosan-derivative and the (P) refers to the phosphorous of the nucleic acid backbone. Typically, the (+):(P) molar ratio is selected such that the chitosan-derivative-nucleic acid complex has a positive charge in the absence of the polyanion-containing block co-polymer reversible coating. Thus, the (+):(P) molar ratio is generally greater than 1. In preferred embodiments, the (+):(P) molar ratio is greater than 1.5, at least 2, or greater than 2. In certain preferred embodiments, the (+):(P) molar ratio is greater than 2.

[0074] In some cases, the (+):(P) molar ratio is, or is about, 3:1. In some cases, the (+):(P)molar ratio is, or is about, 4:1. In some cases, the (+):(P) molar ratio is, or is about, 5:1. In some cases, the (+):(P) molar ratio is, or is about, 6:1. In some cases, the (+):(P) molar ratio is, or is - 17 - 1102248259\1\AMERICASabout, 7:1. In some cases, the (+):(P) molar ratio is, or is about, 8:1. In some cases, the (+):(P) molar ratio is, or is about, 9:1. In some cases, the (+):(P) molar ratio is, or is about, 10:1.

[0075] In some cases, the (+):(P) molar ratio is from greater than 1 to no more than about 20:1,from about 2 to no more than about 20:1, or from about 2 to no more than about 10:1. In some cases, the (+):(P) molar ratio is from greater than about 2 to no more than about 20:1, or from greater than about 2 to no more than about 10:1. In some cases, the (+):(P) molar ratio is from about 3 to no more than about 20:1, from about 3 to no more than about 10:1, from about 3 to no more than about 8:1, or from about 3 to no more than about 7:1. In some cases, the (+):(P) molar ratio is from about 3 to no more than 20:1, from about 3 to no more than 10:1, from about 3 to no more than 8:1, or from about 3 to no more than 7:1.

[0076] In embodiments, the (+):(P) molar ratio is 100:1, preferably less than 100:1. Forexample, (+):(P) molar ratio can be from greater than 1 to less than or equal to 100:1. In some cases, the (+):(P) molar ratio can be from greater than 2 to less than or equal to 100:1. In some cases, the (+):(P) molar ratio can be from greater than or equal to 3 to less than or equal to 100:1. In some cases, the (+):(P) molar ratio can be from greater than or equal to 5 to less than or equal to 100:1. In some cases, the (+):(P) molar ratio can be from greater than or equal to 7 to less than or equal to 100:1. In some cases, the (+):(P) molar ratio can be from greater than 2 to less than or equal to 50:1. In some cases, the (+):(P) molar ratio can be from greater than or equal to 3 to less than or equal to 50:1. In some cases, the (+):(P) molar ratio can be from greater than or equal to 5 to less than or equal to 50:1. In some cases, the (+):(P) molar ratio can be from greater than or equal to 7 to less than or equal to 50:1. In some cases, the (+):(P) molar ratio can be from greater than 2 to less than or equal to 25:1. In some cases, the (+):(P) molar ratio can be from greater than or equal to 3 to less than or equal to 25:1. In some cases, the (+):(P) molar ratio can be from greater than or equal to 5 to less than or equal to 25:1. In some cases, the (+):(P) molar ratio can be from greater than or equal to 7 to less than or equal to 25:1.

[0077] In embodiments, the (+) : (P) ratio is the same as the N:P ratio described herein.

[0078] In embodiments, the cationic functional group of the chitosan-derivative nanoparticlesis or comprises an amino group. Examples of such amino-functionalized chitosan-derivative nanoparticles include those containing chitosan that is functionalized with: a guanidinium or a molecule comprising a guanidinium group, a lysine, an ornithine, an arginine, or a combination thereof. In embodiments, the cationic functional group is an arginine. The proportion of amino- - 18 - 1102248259\1\AMERICASfunctionalized chitosan-derivative to nucleic acid can be characterized by an amino (N) to phosphorous (P) molar ratio, wherein the (N) refers to the nitrogen atom of the amino group in the amino-functionalized chitosan-derivative and the (P) refers to the phosphorous of the nucleic acid backbone. Typically, the N:P molar ratio is selected such that the chitosan-derivative-nucleic acid complex, in the absence of PEG-PA polymer molecules, has a positive charge at a physiologically relevant pH. Thus, the N:P molar ratio is generally greater than 1. In embodiments, the N:P molar ratio is greater than 1.5, at least 2, or greater than 2. In embodiments, the N:P molar ration is greater than 2.

[0079] In some cases, the N:P molar ratio is, or is about, 3:1. In some cases, the N:P molarratio is, or is about, 4:1. In some cases, the N:P molar ratio is, or is about, 5:1. In some cases, the N:P molar ratio is, or is about, 6:1. In some cases, the N:P molar ratio is, or is about, 7:1. In some cases, the N:P molar ratio is, or is about, 8:1. In some cases, the N:P molar ratio is, or is about, 9:1. In some cases, the N:P molar ratio is, or is about, 10:1.

[0080] In some cases, the N:P molar ratio is from greater than 1 to no more than about 20:1,from about 2 to no more than about 20:1, or from about 2 to no more than about 10:1. In some cases, the N:P molar ratio is from greater than about 2 to no more than about 20:1, or from greater than about 2 to no more than about 10:1. In some cases, the N:P molar ratio is from about 3 to no more than about 20:1, from about 3 to no more than about 10:1, from about 3 to no more than about 8:1, or from about 3 to no more than about 7:1. In some cases, the N:P molar ratio is from about 3 to no more than 20:1, from about 3 to no more than 10:1, from about 3 to no more than 8:1, or from about 3 to no more than 7:1. In some examples, the N:P molar ratio is from about 9:1 to 11:1, e.g., from about 9.2:1 to 10.8:1, from about 9.4:1 to 10.6:1, from about 9.6:1 to 10.4:1, or from about 9.8:1 to 10.2:1.

[0081] In embodiments, the N:P molar ratio is 100:1, preferably less than 100:1. For example,N:P molar ratio can be from greater than 1 to less than or equal to 100:1. In some cases, the N:P molar ratio can be from greater than 2 to less than or equal to 100:1. In some cases, the N:P molar ratio can be from greater than or equal to 3 to less than or equal to 100:1. In some cases, the N:P molar ratio can be from greater than or equal to 5 to less than or equal to 100:1. In some cases, the N:P molar ratio can be from greater than or equal to 7 to less than or equal to 100:1. In some cases, the N:P molar ratio can be from greater than 2 to less than or equal to 50:1. In some cases, the N:P molar ratio can be from greater than or equal to 3 to less than or equal to 50:1. In some cases, the - 19 - 1102248259\1\AMERICASN:P molar ratio can be from greater than or equal to 5 to less than or equal to 50:1. In some cases, the N:P molar ratio can be from greater than or equal to 7 to less than or equal to 50:1. In some cases, the N:P molar ratio can be from greater than 2 to less than or equal to 25:1. In some cases, the N:P molar ratio can be from greater than or equal to 3 to less than or equal to 25:1. In some cases, the N:P molar ratio can be from greater than or equal to 5 to less than or equal to 25:1. In some cases, the N:P molar ratio can be from greater than or equal to 7 to less than or equal to 25:1.

[0082] In embodiments, the subject polyplexes have amine to phosphate (N / P) ratio of 2 to100, e.g., 2 to 50, e.g., 2 to 40, e.g., 2 to 30, e.g., 2 to 20, e.g., 2 to 5. In embodiments, the N / P ratio is inversely proportional to the molecular weight of the chitosan, i.e., a smaller molecular weight (e.g., dually) derivatized-chitosan requires a higher N / P ratio, and vice versa.

[0083] A nucleic acid herein may generally contain phosphodiester bonds, although in somecases nucleic acid analogs are included that may have alternate backbones or other modifications or moieties incorporated for any of a variety of purposes, e.g., stability and protection. Other analog nucleic acids contemplated include those with non-ribose backbones. In addition, mixtures of naturally occurring nucleic acids, analogs, and both can be made. The nucleic acids may be single stranded or double stranded or contain portions of both double stranded or single stranded sequence. Nucleic acids include DNA, RNA and hybrids where the nucleic acid contains any combination of deoxyribo- and ribo-nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthanine, hypoxanthanine, isocytosine, isoguanine, etc. Examples of nucleic acids include DNA in any form, RNA in any form, including triplex, duplex or single-stranded, anti-sense, siRNA, ribozymes, deoxyribozymes, polynucleotides, oligonucleotides, chimeras, microRNA, and derivatives thereof. Nucleic acids include artificial nucleic acids, including but not limited to, peptide nucleic acid (PNA), phosphorodiamidate morpholino oligo (PMO), locked nucleic acid (LNA), glycol nucleic acid (GNA) and threose nucleic acid (TNA). It will be appreciated that, for artificial nucleic acids that do not comprise phosphorous, an equivalent measure of the (+):P or N:P ratio can be approximated by the number of nucleotide (or nucleotide analog) bases.

[0084] In a preferred embodiment, the polyplexes of the compositions comprise chitosanmolecules having an average molecular weight of less than 110 kDa, more preferably less than 65 kDa, more preferably less than 50 kDa, more preferably less than 40 kDa, and most preferably less than 30 kDa before functionalization. In some embodiments, polyplexes of the compositions - 20 - 1102248259\1\AMERICAScomprise chitosan having an average molecular weight of less than 15 kDa, less than 10 kDa, less than 7 kDa, or less than 5 kDa before functionalization.

[0085] In embodiments, the chitosan portion in the polyplexes has an average molecularweight from about 1 kDa to about 20 kDa, e.g., from about 3 kDa to about 15 kDa, from about 4 kDa to about 12 kDa, from about 5 kDa to about 10 kDa, or from about 6 kDa to about 8 kDa. In one example, the chitosan portion in the polyplexes has a average molecular weight from about 5 kDa to about 10 kDa. In another example, the chitosan portion in the polyplexes has an average molecular weight from about 6 kDa to about 8 kDa. In embodiments, the chitosan portion in the polyplexes has a weight-average molecular weight of about 1 kDa, about 2 kDa, about 3 kDa, about 4 kDa, about 5 kDa, about 6 kDa, about 7 kDa, about 8 kDa, about 9 kDa, about 10 kDa, about 11 kDa, about 12 kDa, about 13 kDa, about 14 kDa, or about 15 kDa. In one example, the chitosan portion in the polyplexes has an average molecular weight of about 7 kDa.

[0086] In embodiments, the chitosan functionalized with arginine and glucose has an averagemolecular weight from about 1 kDa to about 30 kDa, e.g., from about 1 kDa to about 25 kDa, from about 5 kDa to about 25 kDa, from about 1 kDa to about 20 kDa, from about 5 kDa to about 20 kDa, from about 1 kDa to about 15 kDa, from about 5 kDa to about 15 kDa, from about 6 kDa to about 15 kDa, from about 7 kDa to about 15 kDa, from about 8 kDa to about 15 kDa, from about 9 kDa to about 15 kDa, from about 10 kDa to about 15 kDa, from about 6 kDa to about 11 kDa, from about 7 kDa to about 12 kDa, from about 8 kDa to about 13 kDa, from about 9 kDa to about 14 kDa, or from about 10 kDa to about 15 kDa. In embodiments, the chitosan functionalized with arginine and glucose has an average molecular weight of about 1 kDa, about 2 kDa, about 3 kDa, about 4 kDa, about 5 kDa, about 6 kDa, about 7 kDa, about 8 kDa, about 9 kDa, about 10 kDa, about 11 kDa, about 12 kDa, about 13 kDa, about 14 kDa, about 15 kDa, about 16 kDa, about 17 kDa, about 18 kDa, about 19 kDa, or about 20 kDa. In one example, the chitosan functionalized with arginine and glucose has an average molecular weight of about 10 kDa.

[0087] In a preferred embodiment, the polyplexes comprise chitosan molecules having onaverage less than 680 glucosamine monomer units, more preferably less than 400 glucosamine monomer units, more preferably less than 310 glucosamine monomer units, more preferably less than 250 glucosamine monomer units, and most preferably less than 190 glucosamine monomer units. In some embodiments, the polyplexes comprise chitosan molecules having on average less - 21 - 1102248259\1\AMERICASthan 95 glucosamine monomer units, less than 65 glucosamine monomer units, less than 45 glucosamine monomer units, or less than 35 glucosamine monomer units.

[0088] In embodiments, the polyplexes comprise dually derivatized chitosan functionalizedwith arginine and glucose having from about 15% to about 40%, e.g., from about 20% to about 35%, from about 22% to about 32%, from about 24% to about 30%, or from about 26% to about 30% glucosamine monomer units conjugated with arginine. In one example, the polyplexes comprise dually derivatized chitosan functionalized with arginine and glucose having from about 20% to about 35% glucosamine monomer units conjugated with arginine. In embodiments, the polyplexes comprise dually derivatized chitosan functionalized with arginine and glucose having about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, or about 35% glucosamine monomer units conjugated with arginine. In one example, the polyplexes comprise dually derivatized chitosan functionalized with arginine and glucose having about 28% glucosamine monomer units conjugated with arginine.

[0089] In embodiments, the polyplexes comprise dually derivatized chitosan functionalizedwith arginine and glucose having from about 1% to about 20%, e.g., from about 2% to about 18%, about 3% to about 15%, about 5% to about 15%, about 6% to about 14%, about 7% to about 13%, about 8% to about 12%, or about 9% to about 11% glucosamine monomer units conjugated with glucose. In one example, the polyplexes comprise dually derivatized chitosan functionalized with arginine and glucose having from 3% to 15% glucosamine monomer units conjugated with glucose. In embodiments, the polyplexes comprise dually derivatized chitosan functionalized with arginine and glucose having about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, or about 15% glucosamine monomer units conjugated with glucose. In one example, the polyplexes comprise dually derivatized chitosan functionalized with arginine and glucose having about 10% glucosamine monomer units conjugated with glucose.

[0090] In embodiments, the polyplexes comprise dually derivatized chitosan functionalizedwith arginine and glucose having from about 40% to about 80%, e.g., from about 50% to about 80%, from about 50% to about 77%, from about 52% to about 76%, from about 54% to about 74%, from about 56% to about 72%, from about 58% to about 70%, from about 60% to about 68%, from about 60% to about 66%, or from about 60% to about 64% non-functionalized - 22 - 1102248259\1\AMERICASglucosamine monomer units. In one example, the polyplexes comprise dually derivatized chitosan functionalized with arginine and glucose having from about 50% to about 77% non-functionalized glucosamine monomer units. In embodiments, the polyplexes comprise dually derivatized chitosan functionalized with arginine and glucose having about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, or about 77% non-functionalized glucosamine monomer units. In one example, the polyplexes comprise dually derivatized chitosan functionalized with arginine and glucose having about 62% non- functionalized glucosamine monomer units.

[0091] In embodiments, the polyplexes comprise dually derivatized chitosan functionalizedwith arginine and glucose having from about 20% to about 35% glucosamine monomer units conjugated with arginine, from about 3% to about 15% glucosamine monomer units conjugated with glucose, and from about 50% to about 77% non-functionalized glucosamine monomer units. In some examples, the polyplexes comprise dually derivatized chitosan functionalized with arginine and glucose having about 28% glucosamine monomer units conjugated with arginine, about 10% glucosamine monomer units conjugated with glucose, and about 62% non- functionalized glucosamine monomer units.

[0092] Chitosan, and (e.g., dually) derivatized-chitosan nucleic acid polyplexes may beprepared by any method known in the art, including but not limited to those described herein. Nucleic Acids

[0093] As described above, the chitosan polyplexes may contain one or more nucleic acids. Inone embodiment, the nucleic acid component comprises a therapeutic nucleic acid. The subject (e.g., dually) derivatized-chitosan nucleic acid polyplexes are amenable to the use of any therapeutic nucleic acid known in the art including, e.g., nucleic acids encoding therapeutic proteins such as hormones, enzymes, cytokines, chemokines, antibodies, mitogenic factors, growth factors, differentiation factors, factors influencing cell apoptosis, factors influencing inflammation, factors influencing the immune response (e.g. immunostimulators), and the like.

[0094] A therapeutic nucleic acid may be used to effect genetic therapy by serving as areplacement or enhancement for a defective gene or to compensate for lack of a particular gene product, by encoding a therapeutic product. A therapeutic nucleic acid may also inhibit expression - 23 - 1102248259\1\AMERICASof an endogenous gene. A therapeutic nucleic acid may encode all or a portion of a translation product, and may function by recombining with DNA already present in a cell, thereby replacing a defective portion of a gene. It may also encode a portion of a protein and exert its effect by virtue of co-suppression of a gene product.

[0095] In embodiments, the nucleic acid component comprises a therapeutic nucleic acidconstruct. The therapeutic nucleic acid construct is a nucleic acid construct capable of exerting a therapeutic effect. Therapeutic nucleic acid constructs may comprise nucleic acids encoding therapeutic proteins, as well as nucleic acids that produce transcripts that are therapeutic RNAs. IL-12

[0096] In the preferred embodiments described and exemplified herein, the therapeutic nucleicacid construct comprises a nucleic acid encoding IL-12, either alone or in conjunction with one or more RIG-1 agonists. IL-12 is a heterodimeric type 1 cytokine with a four α-helical bundle structure. The active heterodimer, also known as IL-12 p70, comprises 2 subunits encoded by two separate genes, IL-12A (encoding p35) and IL-12B (encoding p40). There are at least 6 splice variant transcripts of IL-12A (ENST00000305579.6, ENST00000466512.1, ENST00000480787.5, ENST00000468862.5, ENST00000496308.1, and ENST00000480088.1). Nucleic and peptide sequences for the human IL-12A isoform 1 precursor are, for example, NM_000882.4, NM_001354582.2, NM_001354583.2, and NP_000873.2, NP_001341511.1, and NP_001341512.1 respectively. Mouse IL12a nucleic and peptide sequences are, for example, NM_001159424.2 and NP_001152896.1, respectively. Human IL-12B genomic sequence, transcript, and peptide sequences are, for example, NG_009618.1, NM_002187.3, and NP_002178.2, respectively. Mouse IL-12B nucleic and peptide sequences are for example, NM_001303244 and NP_001290173.1.

[0097] In embodiments, the single chain IL-12 protein can be generated by fusing the p40subunit to the p35 subunit through a short amino acid linker sequence. The two subunits can be linked in either the p40-linker-p35 or p35-linker-p40 orientation. The protein can be secreted as a result of the inclusion of the signal peptide from the subunit 5' of the linker, while the signal peptide is removed from the subunit downstream of the linker sequence. In preferred embodiments, the linker sequence comprises a 10 amino acid sequence derived from bovine elastin and comprised of valine (V), proline (P) and glycine (G) residues (VPGVGVPGVG). In some embodiments, the linker sequence may contain G and / or serine (S) residues, such as (GGGGS)n. In other - 24 - 1102248259\1\AMERICASembodiments, the linker sequence may contain G, S and additional amino acids, including but not limited to, P, arginine (R), lysine (K), threonine (T) and glutamic acid (E). In exemplary embodiments the linker is selected from the group consisting of GSGSSRGGSGSGGSGGGGSK (SEQ ID NO: 1), GSTSG(A / S)GKSSEGKG (SEQ ID NO: 2), GSTSGSGKPGSGEGSTKG (SEQ ID NO: 3), GGGGGGS (SEQ ID NO: 4), or GGGGSGGGGSGGGGS (SEQ ID NO: 5).

[0098] In an exemplary embodiment, the nucleic acid sequence encoding hIL-12p40p35comprises: atgtgccatcagcaacttgtcatctcctggttctccctcgtgttcctggcctcccctcttgtcg cgatttgggagctgaagaaagatgtgtacgtcgtggaactcgactggtacccggacgcccccgg ggaaatggtggtgctcacttgtgatactcccgaagaggatggaattacctggaccctcgatcag tcctccgaggtcttgggatccggcaaaactctgaccatccaagtcaaggaattcggcgacgcgg ggcagtacacctgtcacaagggcggagaagtgctgtcgcactcactcctgctccttcacaaaaa ggaggacggcatctggtcgaccgacatcctgaaggaccagaaggaacccaagaacaagaccttt ctgcgctgcgaggccaagaactattcgggaaggttcacctgttggtggctgactaccatctcca ccgacctgactttctccgtgaagtcctctcggggttcgagcgacccgcagggtgttacgtgcgg tgctgcaaccctgtccgcggagagagtgcggggggacaacaaggaatacgagtactcagtggaa tgccaggaagatagcgcctgccctgccgccgaagagtccctgccgattgaagtcatggtggacg cagtgcataagttgaaatatgagaactacacctcgtcgttcttcatccgggacatcatcaagcc tgacccccctaagaatctgcagctcaagcccctcaagaactccagacaggtcgaagtgtcctgg gagtacccagatacgtggagcacaccgcactcgtacttctccttgaccttctgcgtccaagtgc agggaaagtccaaacgggagaagaaggaccgcgtgttcactgataagacttccgctactgtgat ctgccgcaaaaacgccagcatcagcgtgcgcgcgcaagatagatactactcaagctcttggtcc gaatgggcgtccgtgccatgctcggtgcccggcgtgggcgtgcctggagtgggagcccggaact tgccggtggccacccctgaccccggaatgttcccttgcctgcaccactcccaaaaccttctgag ggctgtgtccaacatgctgcagaaggctcggcagaccctggaattctacccctgcacctccgag gagatcgaccacgaagatattaccaaggacaagacctcaaccgtggaagcctgcctgcccctgg aactgaccaagaacgaatcgtgcctgaatagccgggaaacctccttcatcaccaacggctcctg cctggcctcacgaaagaccagctttatgatggccctgtgcctgagctcgatctacgaggacctg aagatgtaccaggtcgagttcaagactatgaacgccaagctgctgatggatccgaagcggcaga tcttcttggaccagaatatgctggcagtgatcgacgagctgatgcaggccctcaacttcaactc cgagactgtgccgcaaaagtcgagcctggaggaaccggacttctacaagaccaagatcaagtta tgtattctcctgcacgcgtttaggattcgcgccgtgaccattgatagagtgatgtcctacctga acgccagctga (SEQ ID NO: 6).

[0099] In an exemplary embodiment, the hIL-12p40p35 amino acid sequence comprises:M C H Q Q L V I S W F S L V F L A S P L V A I W E L K K D V Y V Q V F R E TS S F F I R D I I K P D P P K N L Q L K P L K N S R Q V E V S W E Y P D T W S T P H S Y F S L T F C V Q V Q G K S K R E K K D R V F T D K T S A T V I C R K N A S I S V R A Q D R Y Y S S S W S E W A S V P C S V P G V G V P G V G A R N L P V A T P D P G M F P C L H H S Q N L L R A V S N M L Q K A R Q T L E F Y P C T S E E I D H E D I T K D K T S T V E A C L P L E L T K N E S C L N S R E T S F I T N G S C L A S R K T S F M M A L C L S S I Y E D L K M Y Q V E F K T M N A K L L M D P K R Q I F L D Q N M L A V I D E L M Q A L N F N S E T V P Q K S S L E E P D F Y K T K I K L C I L L H A F R I R A V T I D R V M S Y L N A S Stop (SEQ ID NO: 7).

[0100] In another embodiment, the therapeutic nucleic acid comprises a 4156 bp plasmid DNA(pDNA) (SEQ ID NO: 8) comprised of a codon optimized human interleukin-12 gene termed opt- hIL-12 that encodes a polypeptide having the sequence of SEQ ID NO: 7, linked to a constitutively active cytomegalovirus (CMV) promoter on a NTC9385R backbone with an antibiotic-free selection marker based on sucrose (RNA-OUT). Table 1 shows the 4156 bp plasmid (SEQ ID NO: 8). Table 1 CCGCCTAATG AGCGGGCTTT TTTTTGGCTT GTTGTCCACA ACCGTTAAAC 50 CTTAAAAGCT TTAAAAGCCT TATATATTCT TTTTTTTCTT ATAAAACTTA 100- 26 - 1102248259\1\AMERICASAGCTCAGGTC GAGACCGGGC CTTTGTCCGG CGCTCCCTTG GAGCCTACCT 1300 AGACTCAGCC GGCTCTCCAC GCTTTGCCTG ACCCTGCTTG CTCAACTCTA 1350- 27 - 1102248259\1\AMERICASTTTTCTCCAA GGGATATTTA TAGTCTCAAA ACACACAATT ACTTTACAGT 3650 TAGGGTGAGT TTCCTTTTGT GCTGTTTTTT AAAATAATAA TTTAGTATTT 3700g p p p p ofEscherichia coli (E. coli). The opt-hIL12 gene encodes the two sub-units (p40 and p35) of the cytokine protein, IL-12. To ensure 1:1 stoichiometry of the subunits, the EG-70 plasmid was designed to contain a single open reading frame (ORF) to monomerize p40 to p35 by the addition of a short repeating elastin linker sequence. The plasmid is also comprised of genes for eRNA11a (an immunostimulatory double-stranded ribonucleic acid [dsRNA]) and adenovirus VA RNA1. The two RNA products of these genes stimulate the RIG-I pathway, which recruits more immune cells to the local tissue. In a further embodiment, this therapeutic nucleic acid is packaged in a dually-derivatized chitosan polymer functionalized with arginine and glucose and coated with a detachable PEG-b-PLE excipients, to form the pharmaceutical composition EG-70. The composition is formulated as an aqueous nanoparticle dispersion in 1% w / w mannitol solution, filter sterilized, lyophilized to a dry powder, and stored at 4°C. The average particle size of the nanoparticle dispersion is in the 75 - 175 nanometer range.

[0102] Therapeutic nucleic acids also include therapeutic DNA in the form of a circulardouble-stranded DNA plasmid, minicircle DNA (Science Report 6:2315, 2016) or closed-ended linear duplex DNA (Li et al, PLoS One 8(8): e69879, 2013). RIG-1 agonists

[0103] RIG-I (retinoic acid inducible gene I, encoded by Ddx58) is a cytosolic antiviralhelicase that acts as an RNA sensor, detecting and being activated upon recognition of viral RNAs in the cytoplasm. A pattern recognition receptor, RIG-I contains an RNA helicase domain and two N-terminal caspase recruitment domains (CARDs), which relay a signal to the downstream signaling adaptor MAVS (mitochondrial antiviral-signaling protein). RIG-1 signaling via MAVS - 28 - 1102248259\1\AMERICASleads to a variety of responses including induction of type I IFN responses, including IFNα and IFNβ, via TBK1 and IRF7 / 8, and activation of caspase-8-dependent apoptosis. They are found in most tissues, including cancer cells (Kato et al., Immunol. Rev.243(1):91-98 (2011)).

[0104] RIG-I induced responses differs between cells. While normal healthy cells suchas melanocytes and fibroblasts are quite resistant to RIG-I-induced apoptosis, tumor cells arehighly susceptible to RIG-I-induced cell death (Besch et al., 2009; Kubler et al., 2010). RIG-I’snatural ligands are viral short blunt ends of duplex RNA containing 5’tri or diphosphate (5’ppp or 5’pp). RIG-I-specific ligands are currently being developed for immunotherapy of cancer (Duewell et al., 2014, 2015; Ellermeier et al., 2013; Schnurr & Duewell, Oncoimmunology, 2(5):e24170 (2013) and 2014). Part of the potent antitumor activity of RIG-I ligands is the downstream ability to promote cross-presentation of antigens to CD8+T cells and to induce cytotoxic activity (Hochheiser et al., 2016). RIG-I ligands also show strong therapeutic activity in viral infection models such as influenza (Weber-Gerlach & Weber, 2016).

[0105] Examples of RIG-I agonists include eRNA11a, adenovirus VA RNA1 (VA1),eRNA41H, MK4621 (Merck), SLR10, SLR14, and SLR20. In one example, the RIG-I agonist is eRNA41H. In another example, the RIG-I agonist is eRNA11a. In another example, the RIG-I agonist is VA1. In another example, the nucleic acid encodes both eRNA11a and VA1.

[0106] Plasmid vector backbones expressing RIG-I ligands from RNA polymerase IIIpromoters have been used to identify potent synthetic RIG-I ligands (Luke et al., J. Virol. 85(3):1370-1383). Stem-loop RNA modified with tri-phosphate are of particular use as agonists in the instant disclosure. These include eRNA41H, which combines (i) eRNA11a, an immunostimulatory dsRNA expressed by convergent transcription, with (ii) adenovirus VA RNAI, SLR20, a double-stranded, triphosphorylated 20-base pair stem-loop RNA, modified with a 5’ triphosphate sequence (Elion et al., Cancer Res. 78(21):6183-6195 (2018)), and SLR10 and SLR14, which are alternative polyphosphorylated RNAs with a stable tetraloop at one end (Jiang et al., J. Exp. Med.216:2854-68 (2019)). Expression Control Regions

[0107] In embodiments, a polyplex of the disclosure comprises a therapeutic nucleic acid,which is a therapeutic construct, comprising an expression control region operably linked to a coding region. The therapeutic construct produces therapeutic nucleic acid, which may be therapeutic on its own, or may encode a therapeutic protein. - 29 - 1102248259\1\AMERICAS

[0108] In embodiments, the expression control region of a therapeutic construct possessesconstitutive activity. In embodiments, the expression control region of a therapeutic construct does not have constitutive activity. This provides for the dynamic expression of a therapeutic nucleic acid. By “dynamic” expression is meant expression that changes over time. Dynamic expression may include several such periods of low or absent expression separated by periods of detectable expression. In embodiments, the therapeutic nucleic acid is operably linked to a regulatable promoter. This provides for the regulatable expression of therapeutic nucleic acids.

[0109] Expression control regions comprise regulatory polynucleotides (sometimes referredto herein as elements), such as promoters and enhancers, which influence expression of an operably linked therapeutic nucleic acid.

[0110] Expression control elements included herein can be from bacteria, yeast, plant, oranimal (mammalian or non-mammalian). Expression control regions include full-length promoter sequences, such as native promoter and enhancer elements, as well as subsequences or polynucleotide variants that retain all or part of full-length or non-variant function (e.g., retain some amount of nutrient regulation or cell / tissue-specific expression). As used herein, the term "functional" and grammatical variants thereof, when used in reference to a nucleic acid sequence, subsequence or fragment, means that the sequence has one or more functions of native nucleic acid sequence (e.g., non-variant or unmodified sequence). As used herein, the term "variant" means a sequence substitution, deletion, or addition, or other modification (e.g., chemical derivatives such as modified forms resistant to nucleases).

[0111] As used herein, the term "operable linkage" refers to a physical juxtaposition of thecomponents so described as to permit them to function in their intended manner. In the example of an expression control element in operable linkage with a nucleic acid, the relationship is such that the control element modulates expression of the nucleic acid. Typically, an expression control region that modulates transcription is juxtaposed near the 5' end of the transcribed nucleic acid (i.e., "upstream"). Expression control regions can also be located at the 3' end of the transcribed sequence (i.e., "downstream") or within the transcript (e.g., in an intron). Expression control elements can be located at a distance away from the transcribed sequence (e.g., 100 to 500, 500 to 1000, 2000 to 5000, or more nucleotides from the nucleic acid). A specific example of an expression control element is a promoter, which is usually located 5' of the transcribed sequence. - 30 - 1102248259\1\AMERICASAnother example of an expression control element is an enhancer, which can be located 5' or 3' of the transcribed sequence, or within the transcribed sequence.

[0112] Some expression control regions confer regulatable expression to an operably linkedtherapeutic nucleic acid. A signal (sometimes referred to as a stimulus) can increase or decrease expression of a therapeutic nucleic acid operably linked to such an expression control region. Such expression control regions that increase expression in response to a signal are often referred to as inducible. Such expression control regions that decrease expression in response to a signal are often referred to as repressible. Typically, the amount of increase or decrease conferred by such elements is proportional to the amount of signal present; the greater the amount of signal, the greater the increase or decrease in expression.

[0113] Numerous regulatable promoters are known in the art. Preferred inducible expressioncontrol regions include those comprising an inducible promoter that is stimulated with a small molecule chemical compound. In one embodiment, an expression control region is responsive to a chemical that is orally deliverable but not normally found in food. Particular examples can be found, for example, in U.S. Pat. Nos.5,989,910; 5,935,934; 6,015,709; and 6,004,941.

[0114] Table 2 Promoter / enhancer sequences of particular interest include:Promoter / enhancer Description

[0115] In embodiments, the therapeutic construct is comprised within a plasmid comprisingan origin, a multicloning site and a selectable marker. In some embodiments, plasmids of less than 10 kb are desirable. In some embodiments the plasmids used are suitable for gene therapy in - 31 - 1102248259\1\AMERICAShuman patients, and / or are engineered for high levels of transient gene expression in mammalian tissues. In preferred embodiments, the plasmid is selected from the group consisting of the Nanoplasmid™ (e.g. NTC9385 plasmid, NTC9385R, NTC9385R-RIG-I, NTC9385R (3CpG),NTC9385R-eRNA41H-CpG, NTC8685 plasmid (Nature Technology), gWIZ plasmid(Genlantis), or pVAX1 plasmid (Thermofisher Scientific). See, e.g., U.S. Patent Nos. US 6,027,722, US 6,287,863, US 6,410,220, US 6,573,091, US 9,012,226, US 9,017,966, US 9,018,012, US 9,109,012, US 9,487,788, US 9,487,789, US 9,506,082, US 9,550,998, US 9,725,725, US 9,737,620, US 9,950,081, US 10,047,365, US 10,144,935, and US 10,167,478. In some embodiments, the plasmid has been “retrofitted” to remove antibiotic selection agents and / or to increase expression levels.

[0116] For further teaching, see WO 2008 / 020318, which is expressly incorporated herein inits entirety by reference. In one embodiment, the nucleic acid of the (e.g., dually) derivatized- chitosan nucleic acid polyplex is an artificial nucleic acid.

[0117] In some cases, the one or more RIG-I agonist and / or the IL-12 is encoded by:- said therapeutic nucleic acid construct in said derivatized chitosan nucleic acid polyplex; - a different therapeutic nucleic acid construct in said derivatized chitosan nucleic acid polyplex; - a therapeutic nucleic acid construct in a different derivatized chitosan nucleic acid polyplex (e.g., that does not comprise a construct encoding IL-12); or - a therapeutic nucleic acid construct (e.g., formulated in an alternate nucleic acid delivery formulation, such as a PEI or cationic lipid formulation). Polyols

[0118] The therapeutic composition may further comprise one or more polyols thatfunctionalizes the chitosan-derivative nanoparticle. Polyols useful in the present disclosure in general are typically hydrophilic. In embodiments, the chitosan-derivative nanoparticles are functionalized with a cationic component such as an amino group and with a polyol. Such chitosan-derivative nanoparticles functionalized with a cationic moiety such as an amino group and a polyol are referred to as “dually-derivatized chitosan nanoparticles.”

[0119] In embodiments, the polyol may be compound of Formula IV or Formula V:- 32 - 1102248259\1\AMERICAS

[0120] In a preferred embodiment, the polyol is a compound of Formula IV. In embodiments,the polyol of Formula IV has been coupled to the chitosan by reductive amination.

[0121] A hydrophilic polyol that has a carboxyl group may be coupled to chitosan or a cationfunctionalized chitosan such as an amine-functionalized chitosan (e.g., Arg- coupled chitosan (Arg-chitosan)). In some embodiments, the polyol is coupled at a reaction pH of 6.0 ± 0.3. At this pH, the carboxylic acid group of the hydrophilic polyol may be attacked by uncoupled amines on the chitosan backbone according to a nucleophilic substitution reaction mechanism.

[0122] An ordinarily skilled artisan will recognize that, when coupling such a hydrophilicpolyol to Arg-chitosan, it is also possible that a small amount of the hydrophilic polyol may form a covalent bond with an amine group of the Arg through the same mechanism, although it is likely that the nucleophilic substitution reaction will occur predominantly with the amine group of the chitosan backbone.

[0123] A hydrophilic polyol that is a natural saccharide may be coupled to chitosan, cation-functionalized chitosan, such as amine-functionalized chitosan (e.g., Arg-coupled chitosan (Arg- chitosan)) using reductive amination followed by reduction with NaCBH3 or NaBH. Reversible Coating

[0124] In embodiments, the therapeutic composition may further comprise a reversiblecoating. In embodiments, chitosan polyplexes can be mixed with a plurality of polymers, the polymers comprising a hydrophilic, non-charged portion, and a negatively charged (anionic) portion. As described above, the chitosan polyplexes are formulated to have a positive charge in the absence of, or prior to, complexing with the anionic portion-containing polymer coating. Thus under suitable conditions, the anionic portion of the polymer coating will form a reversible charge:charge complex with the chitosan-derivative nucleic acid polyplexes to form a polyplex:polymer particle composition. In some embodiments, the polymers of the coating are - 33 - 1102248259\1\AMERICASunbranched. In some embodiments, the polymers are branched. In some cases, the coating comprises a mixture of branched and unbranched polymers.

[0125] In embodiments, the coating is released from the chitosan polyplex after administration,after entering a cell, and / or after endocytosis. Without wishing to be bound by theory, it is hypothesized that the polyplex:polymer particle compositions thus formed by complexing polyplex and the anionic portion-containing polymer can provide improved in vitro, in solution, and / or in vivo stability without substantially interfering with transfection efficiency. In some embodiments, the polyplex:polymer particle compositions thus formed can provide reduced muco- adhesive properties as compared to, e.g., otherwise identical, polyplexes without the polymer component.

[0126] In a preferred embodiment, the polyplex:polymer particle compositions have a low netpositive, neutral, or net negative zeta potential (from about +10 mV to about -20 mV) at physiological pH. Such compositions can exhibit reduced aggregation in physiological conditions and reduced non-specific binding to ubiquitous anionic components in vivo. Said properties can enhance migration of such composition (e.g., enhanced diffusion in mucus) to contact the cell and result in enhanced intracellular release of nucleic acid.

[0127] In a preferred embodiment, the polyplex:polymer particle compositions have anaverage hydrodynamic diameter of less than 1000 nm, more preferably less than 500 nm and most preferably less than 200 nm. In certain embodiments, the polyplex:polymer particle compositions have an average hydrodynamic diameter of from 50 nm to no more than 1000 nm, preferably from 50 nm to no more than 500 nm and most preferably from 50 nm to no more than 200 nm. In certain embodiments, the polyplex:polymer particle compositions have an average hydrodynamic diameter of from 50 nm to no more than 175 nm, preferably from 50 nm to no more than 150 nm. In certain embodiments, the polyplex:polymer particle compositions have an average hydrodynamic diameter of from 75 nm to no more than 1000 nm, preferably from 75 nm to no more than 500 nm and most preferably from 75 nm to no more than 200 nm. In certain embodiments, the polyplex:polymer particle compositions have an average hydrodynamic diameter of from 75 nm to no more than 175 nm, preferably from 75 nm to no more than 150 nm. In certain embodiments, the polyplex:polymer particle compositions have an average hydrodynamic diameter of greater than 100 nm and less than 175 nm. - 34 - 1102248259\1\AMERICAS

[0128] In embodiments, the polyplex:polymer particle compositions have an averagehydrodynamic diameter from about 50 nm to about 200 nm, e.g., from about 60 nm to about 190 nm, from about 70 nm to about 180 nm, from about 80 nm to about 170 nm, from about 90 nm to about 160 nm, from about 100 nm to about 150 nm, from about 110 nm to about 140 nm, from about 110 nm to about 130 nm, or from about 110 nm to about 120 nm. In one example, the polyplex:polymer particle compositions have an average hydrodynamic diameter from about 100 nm to about 150 nm. In embodiments, the polyplex:polymer particle compositions have an average hydrodynamic diameter of about 100 nm, about 102 nm, about 104 nm, about 106, about 108 nm, about 110 nm, about 112 nm, about 114 nm, about 116 nm, about 118 nm, about 120 nm, about 122 nm, about 124 nm, about 126 nm, about 128 nm, about 130 nm, about 132 nm, about 134 nm, about 136 nm, about 138 nm, about 140 nm, about 142 nm, about 144 nm, about 146 nm, about 148 nm, or about 150 nm. In one example, the polyplex:polymer particle compositions have an average hydrodynamic diameter of about 118 nm.

[0129] In embodiments, the polyplex:polymer particle compositions have a % supercoiledDNA content of at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95%. In one example, the polyplex:polymer particle compositions have a % supercoiled DNA content of at least about 70%. In one example, the polyplex:polymer particle compositions have a % supercoiled DNA content of at least about 80%. In embodiments, the polyplex:polymer particle compositions have a % supercoiled DNA content of about 70%, about 72%, about 74%, about 76%, about 78%, about 80%, about 82%, about 84%, about 86%, about 88%, about 90%, about 92%, about 94%, about 96%, or about 98%. the polyplex:polymer particle compositions have a % supercoiled DNA content of about 84%.

[0130] In embodiments, the polyplex:polymer particle compositions have an average zetapotential of between +10 mV to -10 mV at a physiological pH, most preferably between +5 mV to -5 mV at a physiological pH. In embodiments, the polyplex:polymer particle compositions have an average zeta potential from about -5 mV to about +10 mV, e.g., from about -4 mV to about +9 mV, from about -3 mV to about +8 mV, from about -2 mV to about +7 mV, or from about -1 mV to about +6 mV at a physiological pH. In one example, the polyplex:polymer particle compositions have an average zeta potential from about -1 mV to about +6 mV at a physiological pH. In embodiments, the polyplex:polymer particle compositions have an average zeta potential about -1 mV, about -0.5 mV, about 0 mV about +0.5 mV, about +1 mV, about +1.5 mV, about +2 mV, - 35 - 1102248259\1\AMERICASabout +2.5 mV, about +3 mV, about +3.5 mV, about +4 mV, about +4.5 mV, about +5 mV, about +5.5 mV, or about +6 mV at a physiological pH. In one example, the polyplex:polymer particle compositions have an average zeta potential of about +2.5 mV at a physiological pH.

[0131] The polyplex:polymer particle compositions are preferably homogeneous in respect ofparticle size. Accordingly, in a preferred embodiment, the composition has a low average polydispersity index (“PDI”). In an especially preferred embodiment, a dispersion of the polyplex:polymer particle composition has a PDI of less than about 0.5, more preferably less than about 0.4, more preferably less than about 0.3, yet more preferably less than about 0.25, and most preferably less than about 0.2. In embodiments, a dispersion of the polyplex:polymer particle composition has a PDI of less than about 0.22. In embodiments, a dispersion of the polyplex:polymer particle composition has a PDI of about 0.21, about 0.19, about 0.17, about 0.15, about 0.13, about 0.11, about 0.09, about 0.07, about 0.05, about 0.03, or about 0.01. In one example, a dispersion of the polyplex:polymer particle composition has a PDI of about 0.13.

[0132] In some cases, a dispersion of the polyplex:polymer particle composition exhibits oneor more of the foregoing PDI, average zeta potential, % supercoil DNA, or average particle size (nm) or size range after one or more freeze thaw cycles. In some cases, a dispersion of the polyplex:polymer particle composition exhibits one or more of the foregoing PDI, average zeta potential, % supercoil DNA, or average particle size (nm) or size range after storage in solution for at least 48 h at 4 °C. In some cases, a dispersion of the polyplex:polymer particle composition exhibits one or more of the foregoing PDI, average zeta potential, % supercoil DNA, or average particle size (nm) or size range after storage in solution for at least 1or 2 weeks, or more at 4 °C.

[0133] In some cases, a dispersion of the polyplex:polymer particle composition exhibits oneor more of the foregoing PDI, average zeta potential, % supercoil DNA, or average particle size (nm) or size range after lyophilization and rehydration. In some cases, a dispersion of the polyplex:polymer particle composition exhibits one or more of the foregoing PDI, average zeta potential, % supercoil DNA, or average particle size (nm) or size range after spray drying and rehydration. In some cases, a dispersion of the polyplex:polymer particle composition exhibits one or more of the foregoing PDI, average zeta potential, % supercoil DNA, or average particle size (nm) or size range when concentrated (e.g., by ultrafiltration such as tangential flow filtration) to a nucleic acid concentration of at least 250 µg / mL. In some cases, a dispersion of the polyplex:polymer particle composition exhibits one or more of the foregoing PDI, average zeta - 36 - 1102248259\1\AMERICASpotential, % supercoil DNA, or average particle size (nm) or size range when concentrated to a nucleic acid concentration of from 125 µg / mL to about 1,000 µg / mL. In some cases, a dispersion of the polyplex:polymer particle composition exhibits one or more of the foregoing PDI, average zeta potential, % supercoil DNA, or average particle size (nm) or size range when concentrated to a nucleic acid concentration of from 125 µg / mL to about 25,000 µg / mL. In some cases, a dispersion of the polyplex:polymer particle composition exhibits one or more of the foregoing PDI, average zeta potential, % supercoil DNA, or average particle size (nm) or size range when concentrated to a nucleic acid concentration of from 125 µg / mL to about 2,000 µg / mL. In some cases, a dispersion of the polyplex:polymer particle composition exhibits one or more of the foregoing PDI, average zeta potential, % supercoil DNA, or average particle size (nm) or size range when concentrated to a nucleic acid concentration of from 125 µg / mL to about 5,000 µg / mL. In some cases, a dispersion of the polyplex:polymer particle composition exhibits one or more of the foregoing PDI, average zeta potential, % supercoil DNA, or average particle size (nm) or size range when concentrated to a nucleic acid concentration of from 125 µg / mL to about 10,000 µg / mL.

[0134] In general, the polyplex:polymer particle compositions described herein, exhibitfavorable solution behavior (e.g., stability and / or non-aggregation) as measured by PDI or mean particle size even in the absence of excipients such as lyoprotectants, cryoprotectants, surfactants, rehydration or wetting agents, and the like. In some cases, the polyplex:polymer particle compositions described herein exhibit favorable solution behavior (e.g., stability and / or non- aggregation) as measured by PDI or mean particle size in physiological fluids or simulated physiological fluids. For example, in some embodiments, the polyplex:polymer particle compositions described herein are stable in simulated intestinal fluid, in mammalian urine, and / or when stored in a mammalian bladder (e.g., and in contact with urine).

[0135] As described above, the polyplex:polymer particle compositions described herein arepreferably substantially size stable in the composition. In a preferred embodiment, a composition of the disclosure comprises polyplex:polymer particles that increase in average diameter by less than 100%, more preferably less than 50%, and most preferably less than 25%, at room temperature for 6 hours, more preferably 12 hours, more preferably 24 hours, and most preferably 48 hours. In a particularly preferred embodiment, a composition of the disclosure comprises polyplex:polymer - 37 - 1102248259\1\AMERICASparticles that increase in average diameter by less than 25% at room temperature for at least 24 hours or at least 48 hours.

[0136] The polyplex:polymer particles of the subject compositions are preferablysubstantially size stable under cooled conditions. In a preferred embodiment, a composition of the disclosure comprises polyplex:polymer particles that increase in average diameter by less than 100%, more preferably less than 50%, and most preferably less than 25%, at 2-8 degrees Celsius for 6 hours, more preferably 12 hours, more preferably 24 hours, and most preferably 48 hours.

[0137] The polyplex:polymer particles of the subject compositions are preferablysubstantially size stable under freeze-thaw conditions. In a preferred embodiment, a composition of the disclosure comprises polyplexes that increase in average diameter by less than 100%, more preferably less than 50%, and most preferably less than 25% at room temperature for 6 hours, more preferably 12 hours, more preferably 24 hours, and most preferably 48 hours following thaw from frozen at -20 to -80 degrees Celsius.

[0138] In a preferred embodiment, the composition has a nucleic acid concentration greaterthan 0.5 mg / ml, and is substantially free of precipitated polyplex. More preferably, the composition has a nucleic acid concentration of at least 0.6 mg / ml, more preferably at least 0.75 mg / ml, more preferably at least 1.0 mg / ml, more preferably at least 1.2 mg / ml, and most preferably at least 1.5 mg / ml, and is substantially free of precipitated polyplex. In another preferred embodiment, the composition has a nucleic acid concentration greater than 2 mg / ml, and is substantially free of precipitated polyplex. More preferably, the composition has a nucleic acid concentration of at least 2.5 mg / ml, more preferably at least 5 mg / ml, more preferably at least 10 mg / ml, more preferably at least 15 mg / ml, and most preferably about 25 mg / ml, and is substantially free of precipitated polyplex. In some embodiments, the composition has a nucleic acid concentration from 0.5 mg / mL to about 25 mg / mL, and is substantially free of precipitated polyplex. In some embodiments, the composition has a nucleic acid concentration of ≤ about 25 mg / mL, and is substantially free of precipitated polyplex. The compositions can be hydrated. In a preferred embodiment, the composition is substantially free of uncomplexed nucleic acid.

[0139] In a preferred embodiment, the polyplex:polymer particle composition is isotonic.Achieving isotonicity, while maintaining polyplex stability, is highly desirable in formulating pharmaceutical compositions, and these preferred compositions are well suited to pharmaceutical formulation and therapeutic applications. - 38 - 1102248259\1\AMERICAS

[0140] In certain embodiments, the polyplex:polymer particle composition can be uncoated torelease all or part of the, e.g., PEG, polymer coating by reducing pH. In certain embodiments, the polymer coating is released by incubating the particle under a pH condition that is below the pKa of the polyanionic anchor region of the polymer. For example, where the polymer coat is polyglutamate, the polymer coating can be released by incubating the particle at a pH below the pKa of polyglutamate, such as a pH of less than about 4.25. In certain embodiments, the polymer coating can be released by incubating the particle under a pH condition that is at least 0.25 pH units or at least 0.5 pH units below the pKa of the polyanion anchor region of the polymer coating.

[0141] In certain embodiments, the polyplex:polymer particle composition can be uncoated torelease all or part of the, e.g., PEG, polymer coating by subjecting the particle to a high ionic strength.

[0142] Without wishing to be bound by theory, it is hypothesized that certain physiologicalconditions can promote partial (e.g.. >5%), substantial (>50%), extensive, (e.g., >90%), or complete (100%) uncoating of reversibly PEGylated chitosan DNA polyplexes described herein. For example, low pH conditions in certain subcellular compartments (e.g., endosome, early endosome, late endosome, or lysosome) can facilitate release of the polymer coat. As another example, certain extracellular conditions can promote partial (e.g., >5%), substantial (>50%), extensive (>90%), or complete (100%) uncoating of reversibly PEGylated chitosan DNA polyplexes described herein. In some cases, the high ionic strength and / or acidic pH conditions typically encountered in certain positions in the alimentary canal can promote partial (e.g. >5%), substantial (>50%), extensive (>90%), or complete (100%) uncoating of reversibly PEGylated chitosan DNA polyplexes described herein.

[0143] In embodiments, PEGylated polyplexes described herein are formulated for delivery toa cell, tissue, or bodily compartment (e.g., intestine, small intestine, large intestine, colon, lung, or bladder) such that the polyplexes remain PEGylated and thereby facilitate transfection of the target cell. In some embodiments, PEGylated polyplexes described herein partially (e.g. >5%), substantially (>50%), extensively (e.g., >90%), or completely (100%) release the polymer coat after or during entry into the intracellular environment. In certain embodiments, PEGylated polyplexes described herein are formulated for delivery to a cell, tissue or bodily compartment (e.g., intestine, small intestine, large intestine, colon, lung, or bladder) such that the PEGylated polyplexes described herein partially (e.g., >5%), substantially (>50%), extensively (e.g., >90%), - 39 - 1102248259\1\AMERICASor completely(100%) release the polymer coat upon delivery to a cell, tissue or bodily compartment (e.g., intestine, small intestine, large intestine, colon, lung or bladder).

[0144] It will be appreciated that anion charge density and / or pKa of the anionic anchor regionof a polymer can be adjusted to promote or inhibit release under intended conditions. It will similarly be appreciated that the pH, volume, and ionic strength, and other conditions of the formulation can be adjusted to promote or inhibit release under intended conditions. For example, for delivery to the intestine through the low pH gastric environment, a PEGylated polyplex formulation can be enteric coated and / or delivered in a buffering agent to increase the pH of the gastric environment. Optimized reversibly PEGylated particle compositions can be identified by assaying for stability and transfection efficiency using assays described herein.

[0145] The compositions comprising chitosan polyplex complexed with the anionic portion-containing polymer can be characterized by the ratio of cationic functional groups of the (e.g., dually) derivatized-chitosan polyplex (+) to anion moieties of the polymer (-), referred to as the “(+):(-) molar ratio.” This (+):(-) molar ratio can vary from greater than about 1:100 to less than about 10:1.

[0146] In certain embodiments, the (+):(-) molar ratio can be from greater than about 1:75 toless than about 8:1. In some cases, the (+):(-) molar ratio can be from greater than 1:10 to less than 10:1. In some cases, the (+):(-) molar ratio can be from, or from about, 1:10 to, or to about, 10:1. In some cases, the (+):(-) molar ratio can be from, or from about, 1:8 to, or to about, 8:1. In certain embodiments, the (+):(-) molar ratio can be from greater than 1:50 to less than about 10:1. In some cases, the (+):(-) molar ratio can be from greater than 1:25 to less than about 10:1. In some cases, the (+):(-) molar ratio can be from greater than 1:10 to less than about 7:1. In some cases, the (+):(-) molar ratio can be from greater than 1:8 to less than about 7:1. In some cases, the (+):(-) molar ratio can be from greater than 1:8 to less than about 6:1.

[0147] In embodiments, the (+) : (-) ratio is the same as the N:A ratio described herein, inwhich the anion moieties in the (+) : (-) ratio is from the polyol, not the phosphorus group.

[0148] In embodiments, where the cationic functional group of the (e.g., dually) derivatized-chitosan polyplex is an amino moiety, the compositions comprising chitosan polyplex complexed with the anionic portion-containing polymer can be characterized by the ratio of amino groups of the (e.g., dually) derivatized-chitosan polyplex (N) to anion (A) moieties of the polymer, referred - 40 - 1102248259\1\AMERICASto as the “N:A molar ratio.” This N:A molar ratio can vary from greater than about 1:100 to less than about 10:1.

[0149] In certain embodiments, the N:A molar ratio can be from greater than about 1:75 to lessthan about 8:1. In some cases, the N:A molar ratio can be from greater than 1:10 to less than 10:1. In some cases, the N:A molar ratio can be from, or from about, 1:10 to, or to about, 10:1. In some cases, the N:A molar ratio can be from, or from about, 1:8 to, or to about, 8:1. In certain embodiments, the N:A molar ratio can be from greater than 1:50 to less than about 10:1. In some cases, the N:A molar ratio can be from greater than 1:25 to less than about 10:1. In some cases, the N:A molar ratio can be from greater than 1:10 to less than about 7:1. In some cases, the N:A molar ratio can be from greater than 1:8 to less than about 7:1. In some cases, the N:A molar ratio can be from greater than 1:8 to less than about 6:1.

[0150] In embodiments, the N:A molar ratio is from about 1:1 to 3:1, e.g., from about 1.2:1 to2.8:1, from about 1.4:1 to 2.6:1, or from about 1.6:1 to 2.8:1. In one example, the N:A molar ratio is 2:1.

[0151] Additionally or alternatively, the compositions comprising chitosan polyplexcomplexed with the anionic portion-containing polymer can be characterized by a three- component ratio of cationic functional groups of the (e.g., dually) derivatized-chitosan polyplex (+) to phosphorus atoms of the nucleic acid (P) to anion moieties of the polymer (-), referred to as the “(+):P:(-) molar ratio.”

[0152] In embodiments, where (+):P is from at least 2:1 to no more than 20:1, the molar ratioof (+):(-) can vary from at least 1:40 to about 40:1. In embodiments, where (+):P is from at least 2:1 to no more than 20:1, the molar ratio of (+):(-) can vary from at least 1:40 to about 1:10. In embodiments, where (+):P is from at least 2:1 to no more than 20:1, the molar ratio of (+):(-) can vary from at least 1:25 to about 25:1. In embodiments, where (+):P is from at least 2:1 to no more than 20:1, the molar ratio of (+):(-) can vary from at least 1:25 to about 1:10. In some cases, where (+):P is from at least 2:1 to no more than 20:1, the molar ratio of (+):(-) can vary from at least 1:20 to about 20:1. In some cases, where (+):P is from at least 2:1 to no more than 20:1, the molar ratio of (+):(-) can vary from at least 1:20 to about 1:10. In some cases, where (+):P is from at least 2:1 to no more than 20:1, the molar ratio of (+):(-) can vary from at least 1:10 to about 10:1. In some cases, where (+):P is from at least 2:1 to no more than 20:1, the molar ratio of (+):(-) can vary from - 41 - 1102248259\1\AMERICASat least 1:25 to about 2:1. In some cases, where (+):P is from at least 2:1 to no more than 20:1, the molar ratio of (+):(-) can vary from at least 1:20 to about 1:1.

[0153] In embodiments, (+):P:(-) is from 3:1:3.5 to 3:1:17.5. In embodiments, (+):P:(-) is from5:1:3.5 to 5:1:17.5. In embodiments, (+):P:(-) is from 7:1:3.5 to 7:1:17.5. In certain preferred embodiments, (+):P:(-) is about 3:1:3.5, 3:1:7, 3:1:10, 3:1:15, 3:1:17.5, or 3:1:20. In certain preferred embodiments, (+):P:(-) is about 5:1:3.5, 5:1:7, 5:1:10, 5:1:15, 5:1:17.5, or 5:1:20. In certain preferred embodiments, (+):P:(-) is about 7:1:3.5, 7:1:7, 7:1:10, 7:1:15, 7:1:17.5, or 7:1:20. In certain preferred embodiments, (+):P:(-) is about 10:1:10, 10:1:15, 10:1:20, 10:1:25, 10:1:30, or 10:1:40.

[0154] In embodiments, the (+):P:(-) is the same as the N:P:A described herein, in which theanion moieties are from the polyol, not the phosphorus group.

[0155] One of skill in the art will appreciate that amino-functionalized chitosan polyplexparticles in complex with the anionic portion-containing polymer can be characterized by a three- component ratio of amino functional groups of the (e.g., dually) derivatized-chitosan polyplex (N) to phosphorus atoms of the nucleic acid (P) to anion moieties of the polymer (A), referred to as the “N:P:A molar ratio.” In embodiments, where N:P is from at least 2:1 to no more than 20:1, the molar ratio of P:A can vary from at least 1:40 to about 40:1. In one example, the N:P:A ratio is 10:1:5.

[0156] In embodiments, where N:P is from at least 2:1 to no more than 20:1, the molar ratioof P:A can vary from at least 1:40 to about 1:10. In embodiments, where N:P is from at least 2:1 to no more than 20:1, the molar ratio of P:A can vary from at least 1:25 to about 25:1. In embodiments, where N:P is from at least 2:1 to no more than 20:1, the molar ratio of P:A can vary from at least 1:25 to about 1:10. In some cases, where N:P is from at least 2:1 to no more than 20:1, the molar ratio of P:A can vary from at least 1:20 to about 20:1. In some cases, where N:P is from at least 2:1 to no more than 20:1, the molar ratio of P:A can vary from at least 1:20 to about 1:10. In some cases, where N:P is from at least 2:1 to no more than 20:1, the molar ratio of P:A can vary from at least 1:10 to about 10:1. In some cases, where N:P is from at least 2:1 to no more than 20:1, the molar ratio of P:A can vary from at least 1:25 to about 2:1. In some cases, where N:P is from at least 2:1 to no more than 20:1, the molar ratio of P:A can vary from at least 1:20 to about 1:1. - 42 - 1102248259\1\AMERICAS

[0157] In embodiments, N:P:A is from 3:1:3.5 to 3:1:17.5. In embodiments, N:P:A is from5:1:3.5 to 5:1:17.5. In embodiments, N:P:A is from 7:1:3.5 to 7:1:17.5. In embodiments, N:P:A is from 10:1:10 to 10:1:40. In embodiments, N:P:A is about 3:1:3.5, 3:1:7, 3:1:10, 3:1:15, 3:1:17.5, or 3:1:20. In embodiments, N:P:A is about 5:1:3.5, 5:1:7, 5:1:10, 5:1:15, 5:1:17.5, or 5:1:20. In embodiments, N:P:A is about 7:1:3.5, 7:1:7, 7:1:10, 7:1:15, 7:1:17.5, or 7:1:20. In embodiment, N:P:A is about 10:1:10, 10:1:15, 10:1:20, 10:1:25, 10:1:30 or 10:1:40. Hydrophilic Non-charged Portion

[0158] The hydrophilic non-charged portion of the polymer can be, or comprise, apolyalkylene polyol or a polyalkyleneoxy polyol portion, or combinations thereof. The hydrophilic non-charged portion of the polymer can be, or comprise, a polyalkylene glycol or polyalkyleneoxy glycol portion. In certain embodiments, the polyalkylene glycol portion is or comprises a polyethylene glycol (PEG) portion and / or a monomethoxy polyethylene glycol portion. In certain preferred embodiments, the non-charged portion of the polymer is, or comprises polyethylene glycol. The hydrophilic non-charged portion of the polymer can be, or comprise, other biologically compatible polymer(s) such as polylactic acid.

[0159] The hydrophilic portion can have a weight average molecular weight of from about 500Da to about 50,000 Da. In some embodiments, the hydrophilic portion has a weight average molecular weight of from about 1,000 Da to about 10,000 Da. In certain embodiments, the hydrophilic portion has a weight average molecular weight of from about 1,500 Da to about 7,500 Da. In certain embodiments, the hydrophilic portion has a weight average molecular weight of from about 3,000 Da to about 5,000 Da. In some cases, the hydrophilic portion has a weight average molecular weight of, or of about, 5,000 Da. Anionic Polymer Portion

[0160] The anionic polymer portion of the polymer can comprise a plurality of functionalgroups that are negatively charged at physiological pH. A wide variety of anionic polymers are suitable for use in the methods and compositions described herein, provided that such anionic polymers can be provided as a component of a polymer having a hydrophilic non-charged polymer portion and are capable of forming a (e.g., reversible) charge:charge complex with the positively charged (e.g., dually) derivatized-chitosan-nucleic acid nanoparticles.

[0161] Exemplary anionic polymers include polypeptides having a net negative charge atphysiological pH. In some cases, the polypeptides, or a portion thereof, consist of amino acids - 43 - 1102248259\1\AMERICAShaving a negatively charged side-chain at physiological pH. For example, the anionic polymer portion of the polymer can be a polyglutamate polypeptide, a polyaspartate polypeptide, or a mixture thereof. In one example, the anionic polymer is poly(L-glutamic acid) (PLE). The PLE may form block copolymer with PEG, e.g., PEG-b-PLE. Additional amino acids, or mimetics thereof, can be incorporated into the polyanionic polypeptide. For example, glycine and / or serine amino acids can be incorporated to increase flexibility or reduce secondary structure.

[0162] The anionic portion of the polymers can have a weight average molecular weight offrom about 500 Da to about 5,000 Da. In some embodiments, the anionic portion has a weight average molecular weight of from about 500 Da to about 3,000 Da. In certain embodiments, the anionic portion has a weight average molecular weight of from about 500 Da to about 2,500 Da. In certain embodiments, the anionic portion has a weight average molecular weight of from about 500 Da to about 2,000 Da. In certain embodiments, the anionic portion has a weight average molecular weight of from about 500 Da to about 1,500 Da. In some embodiments, the anionic portion has a weight average molecular weight of from about 1,000 Da to about 5,000 Da. In some embodiments, the anionic portion has a weight average molecular weight of from about 1,000 Da to about 3,000 Da. In certain embodiments, the anionic portion has a weight average molecular weight of from about 1,000 Da to about 2,500 Da. In certain embodiments, the anionic portion has a weight average molecular weight of from about 1,000 Da to about 2,000 Da. In some cases, the anionic portion has a weight average molecular weight of, or of about, 1,500 Da. In one example, the anion portion is a PLE that has a weight average molecular weight of, or of about 1,500 Da.

[0163] As used herein, “block copolymer,” “block co-polymer,” and the like refers to acopolymer containing distinct homopolymer regions. A diblock copolymer contains two distinct homopolymer regions. A triblock copolymer contains three distinct homopolymer regions. The three distinct regions can each be different (e.g., AAAA-BBBB-CCCC), or two regions can be the same (e.g., AAAA-BBBB-AAAA) similar (e.g., AAAA-BBBB-AAA), wherein “A,” “B,” and “C” represent different monomer subunits that form copolymer is comprised. For example, “A” can represent an ethylene glycol monomer subunit of a polyethylene glycol homopolymer and B can represent a glutamic acid subunit of a polyglutamic acid homopolymer. The block copolymer can be a linear (e.g., di- or tri-) block copolymer. Exemplary embodiments of linear diblock and - 44 - 1102248259\1\AMERICAStriblock copolymers for use in the subject disclosure include those listed in the following non- exhaustive list:

[0164] Table 3cidAlternative Cationic Polymers and Lipids

[0166] Instead of or in addition to chitosan or chitosan derivatives, the nucleic acid polyplexof the therapeutic composition may comprise one or more alternative positively-charged (i.e. cationic) polymers and / or lipids. - 45 - 1102248259\1\AMERICAS

[0167] Examples of cationic polymers that can be used to form polyplexes with the therapeuticnucleic acid constructs of the current disclosure include polyamines; polyorganic amines (e.g., polyethyleneimine (PEI), polyethyleneimine celluloses, and derivatives thereof); poly(amidoamines) (PAMAM and derivatives thereof); polyamino acids (e.g., polylysine (PLL), polyarginine, and derivatives thereof); polysaccharides (e.g., cellulose, dextran, DEAE dextran, starch); spermine, spermidine, poly(vinylbenzyl trialkyl ammonium), poly(4-vinyl-N-alkyl- pyridiumiun), poly(acryloyl-trialkyl ammonium), and Tat proteins. See, e.g., Samal et al., Cationic polymers and their therapeutic potential, Chem Soc Rev.41:7147-94 (2012)

[0168] Examples of positively-charged lipids include esters of phosphatidic acid with anaminoalcohol, such as an ester of dipalmitoyl phosphatidic acid or distearoyl phosphatidic acid with hydroxyethylenediamine. More particular examples of positively charged lipids include 3β- [N--(N', N'-dimethylaminoethyl)carbamoyl) cholesterol (DC-chol); N,N'-dimethyl-N,N'-dioctacyl ammonium bromide (DDAB); N,N'-dimethyl-N,N'-dioctacyl ammonium chloride (DDAC); 1,2- dioleoyloxypropyl-3-dimethyl-hydroxyethyl ammonium chloride (DORI); 1,2-dioleoyloxy-3- [trimethylammonio]-propane (DOTAP); N-(1-(2,3-dioleyloxy)propyI)-N,N,N- trimethylammonium chloride (DOTMA); dipalmitoylphosphatidylcholine (DPPC);1,2- dioctadecyloxy-3- [trimethylammonio]-propane (DSTAP); and the cationic lipids described in e.g. Martin et al., Current Pharmaceutical Design 2005, 11, 375-394.

[0169] Blends of lipids and polymers in any concentration and in any ratio can also be used.Blending different polymer types in different ratios using various grades can result in characteristics that borrow from each of the contributing polymers. Various terminal group chemistries can also be adopted. Detalimogene voraplasmid

[0170] In embodiments, the pharmaceutical composition comprises detalimogene voraplasmid(also referred to as EG-70). The detalimogene voraplasmid comprises a nanoparticle, with a DNA nanoplasmid encapsulated by a non-viral, dually derived chitosan polymer-based delivery vehicle. The dually derived chitosan delivery vehicle of detalimogene voraplasmid comprises a highly derivatized chitosan backbone (functionalized with arginine and glucose) and includes reversible PEGylation to facilitate diffusion through protective epithelial shields, such as mucous in the lung and the GAG (glycosaminoglycan) layer in the bladder. - 46 - 1102248259\1\AMERICAS

[0171] The detalimogene voraplasmid further comprises drug substance plasmid DNA thatencodes multiple open reading frames expressing three distinct transcripts: a single-chain interleukin-12 protein (IL-12) and two non-protein coding RNA products, eRNA11a and VA1, which coordinate to stimulate the retinoic acid-inducible gene I (RIG-I) pathway. Together, this combination of RIG-I activation and IL-12 secretion serves to activate both innate and adaptive immunity, creating a pro-inflammatory, tumor-killing environment.

[0172] Detalimogene voraplasmid further comprises methoxy-poly(ethylene glycol)-block-poly(L-glutamic acid) diblock copolymer (abbreviated as PEG-b-PLE). The detalimogene voraplasmid drug product may be formulated as an aqueous nanoparticle dispersion, filter sterilized, lyophilized to a dry powder, and stored at -20°C.

[0173] Detalimogene voraplasmid comprises a reversible coating comprising one or morepolyanion-containing block co-polymers having at least one polyanionic anchor region and at least one hydrophilic tail region. The polyanion-containing block co-polymer is PEG-b-PLE. The PEG portion has a weight average molecular weight of about 5000 Da. The PLE portion has a weight average molecular weight of about 1500 Da. Detalimogene voraplasmid has an amino to phosphorous (N:P) molar ratio of about 10:1, and an amino to anion molar ratio of about 2:1.

[0174] Detalimogene voraplasmid comprises a nucleic acid comprising a coding sequence forthe polypeptide set forth in SEQ ID NO: 7 and the nucleic acid comprises the sequence set forth in SEQ ID NO: 8.

[0175] Detalimogene voraplasmid is described in Bryce et al., A phase 1 / 2 study of EG-70(detalimogene voraplasmid) intravesical monotherapy for patients with BCG-unresponsive non- muscle invasive bladder cancer with carcinoma in situ. Journal of Clinical Oncology Volume 42, Number 16_suppl. (Meeting Abstract of 2024 ASCO Annual Meeting), which is incorporated by reference herein in its entirety. Pharmaceutical Formulations

[0176] The pharmaceutical compositions herein may further comprise one or more"pharmaceutically acceptable" or "physiologically acceptable" carriers, diluents, excipients and the like. Such formulations can be administered in vivo to a subject in order to practice the disclosed treatment methods.

[0177] As used herein, the terms "pharmaceutically acceptable" and "physiologicallyacceptable" refer to carriers, diluents, excipients and the like that can be administered to a subject, - 47 - 1102248259\1\AMERICASpreferably without producing excessive adverse side-effects (e.g., nausea, abdominal pain, headaches, etc.). Such preparations for administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Liquid formulations include suspensions, solutions, syrups and elixirs. Liquid formulations may be prepared by the reconstitution of a solid.

[0178] Excipients can include a salt, an isotonic agent, a serum protein, a buffer or other pH-controlling agent, an anti-oxidant, a thickener, an uncharged polymer, a preservative or a cryoprotectant. Excipients used in compositions of the disclosure may further include an isotonic agent and a buffer or other pH-controlling agent. These excipients may be added for the attainment of preferred ranges of pH (about 6.0-8.0) and osmolarity (about 50-400 mmol / L). Examples of suitable buffers are acetate, borate, carbonate, citrate, phosphate and sulfonated organic molecule buffer. Such buffers may be present in a composition in concentrations from 0.01 to 1.0% (w / v). An isotonic agent may be selected from any of those known in the art, e.g. mannitol, dextrose, glucose and sodium chloride, or other electrolytes. Preferably, the isotonic agent is glucose or sodium chloride. The isotonic agents may be used in amounts that impart to the composition the same or a similar osmotic pressure as that of the biological environment into which it is introduced. The concentration of isotonic agent in the composition will depend upon the nature of the particular isotonic agent used and may range from about 0.1 to 10%. When glucose is used, it is preferably used in a concentration of from 1 to 5% w / v, more particularly 5% w / v. When the isotonic agent is sodium chloride, it is preferably employed in amounts of up to 1% w / v, in particular 0.9% w / v. The compositions of the disclosure may further contain a preservative. Examples preservatives are polyhexamethylene-biguanidine, benzalkonium chloride, stabilized oxychloro complexes (such as those known as Purite®), phenylmercuric acetate, chlorobutanol, sorbic acid, chlorhexidine, benzyl alcohol, parabens, and thimerosal. Typically, such preservatives are present at concentrations from about 0.001 to 1.0%. Furthermore, the compositions of the disclosure may also contain a cryopreservative agent. Preferred cryopreservatives are glucose, sucrose, mannitol, lactose, trehalose, sorbitol, colloidal silicon dioxide, dextran of molecular weight preferable below 100,000 g / mol, glycerol, and polyethylene glycols of molecular weights below 100,000 g / mol or mixtures thereof. Most preferred are glucose, trehalose and polyethylene glycol. Typically, such cryopreservatives are present at concentrations from about 0.01 to 10%. In embodiments, the pharmaceutical composition comprises mannitol, e.g., as a storage stability agent (lyoprotectant). For example, the mannitol may be present at about 1% w / v in the liquid formulation prior to - 48 - 1102248259\1\AMERICASlyophilization. In embodiments, the pharmaceutical composition comprises Reacted xyloglucan gel (RXG). For example, the RXG may be at a concentration of 30 mM N+. Examples of details about RXG and methods of using RXG in a nanoparticle include those described in Dalvi et al., Rufinamide-Loaded Chitosan Nanoparticles in Xyloglucan-Based Thermoresponsive In Situ Gel for Direct Nose to Brain Delivery, Front Pharmacol.2021; 12: 691936, which is incorporated by reference herein in its entirety.

[0179] A pharmaceutical composition can be formulated to be compatible with its intendedroute of administration. Pharmaceutical compositions can also include carriers to protect the composition against rapid degradation or elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. For example, a time delay material such as glyceryl monostearate or glyceryl stearate alone, or in combination with a wax, may be employed.

[0180] Pharmaceutical compositions may also comprise solvents, dispersion media, coatings,antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with administration to a subject. Such formulations can be contained in a tablet (coated or uncoated), capsule (hard or soft), microbead, emulsion, powder, granule, crystal, suspension, syrup or elixir. Supplementary active compounds and preservatives, among other additives, may also be present, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.

[0181] Additional pharmaceutical compositions appropriate for administration are known inthe art and are applicable in the methods and compositions of the disclosure (see, e.g., Remington's Pharmaceutical Sciences (1990) 18th ed., Mack Publishing Co., Easton, Pa.; The Merck Index (1996) 12th ed., Merck Publishing Group, Whitehouse, N.J.; and Pharmaceutical Principles of Solid Dosage Forms, Technonic Publishing Co., Inc., Lancaster, Pa., (1993)).

[0182] As described above, one of skill in the art will appreciate that the nucleic acid polyplexof the therapeutic composition of the disclosure may be produced by a variety of methods. For example, polyplex particles can be generated and then contacted with polymer. In an exemplary non-limiting embodiment, polyplex particles are prepared by providing and combining functionalized chitosan and nucleotide feedstock. Feedstock concentrations may be adjusted to accommodate various amino-to-phosphate ratios (N / P), mixing ratios and target nucleotide concentrations. In some embodiments, particularly small batches, e.g., batches under 2 mL, the - 49 - 1102248259\1\AMERICASfunctionalized chitosan and nucleotide feedstocks may be mixed by slowly dripping the nucleotide feedstock into the functionalized chitosan feedstock while vortexing the container. In other embodiments, the functionalized chitosan and nucleotide feedstocks may be mixed by in-line mixing the two fluid streams. In other embodiments, the resulting polyplex dispersion may be concentrated by means known in the art such as ultrafiltration (e.g., tangential flow filtration (TFF)), or solvent evaporation (e.g., lyophilization or spray drying). A preferred method for polyplex formation is disclosed in WO 2009 / 039657, which is expressly incorporated herein in its entirety by reference.

[0183] Similarly, polyplex particle feedstock (e.g., an aqueous solution comprising thepolyplex compositions) can be provided (e.g., isolated from the reaction mixtures described above) and combined with polymer feedstock (e.g., an aqueous solution comprising the polymer). Feedstock concentrations may be adjusted to accommodate various amino-to-anion ratios (N / A), amino-to-phosphorous (N:P) ratios, N:P:A ratios, mixing ratios and target nucleotide concentrations. In some embodiments, particularly small batches, e.g., batches under 2 mL, the feedstocks may be mixed by slowly dripping a first feedstock (e.g., polyplex) into a second feedstock (e.g., polymer) while vortexing the container. In other embodiments, the feedstocks may be mixed by in-line mixing the two fluid streams. In other embodiments, the resulting polyplex:polymer complex dispersion may be concentrated by means known in the art such as ultrafiltration (e.g., tangential flow filtration (TFF)), or solvent evaporation (e.g., lyophilization or spray drying).

[0184] In the preferred embodiments exemplified, the therapeutic composition is or comprisesdetalimogene voraplasmid. In embodiments, he pharmaceutical composition may comprise a suitable concentration of the therapeutic composition (e.g., detalimogene voraplasmid). For example, each dose of the pharmaceutical composition may comprise at least about 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, 1.0 mg / mL, 1.1 mg / mL, 1.2 mg / mL, 1.3 mg / mL, 1.4 mg / mL, 1.5 mg / mL, 1.6 mg / mL, 1.7 mg / mL, 1.8 mg / mL, 1.9 mg / mL, or 2.0 mg / mL of the therapeutic composition (e.g., detalimogene voraplasmid). In some examples, the pharmaceutical composition comprises from about 500 µg / mL to about 1100 µg / mL, from about 600 µg / mL to about 1000 µg / mL, from about 700 µg / mL to about900 µg / mL, from about 750 µg / mL to about 850 µg / mL, e.g., about 600 µg / mL, 650 µg / mL, 700 µg / mL, 750 µg / mL, 800 µg / mL, 850 µg / mL, 900 µg / mL, 950 µg / mL, or 1000 µg / mL - 50 - 1102248259\1\AMERICASof the therapeutic composition (e.g., detalimogene voraplasmid). In one example, the pharmaceutical composition comprises about 800 µg / mL of the therapeutic composition (e.g., detalimogene voraplasmid).

[0185] In embodiments, the pharmaceutical composition comprises from about 0.5 mg / mL toabout 1.2 mg / mL, from about 0.6 mg / mL to about 1.0 mg / mL, or from about 0.7 mg / mL to about 0.9 mg / mL of DNA of the therapeutic composition (e.g., detalimogene voraplasmid). In one example, the pharmaceutical composition comprises about 0.8 mg / mL of DNA of the therapeutic composition (e.g., detalimogene voraplasmid). In embodiments, the dose volume may be from about 25 mL to about 75 mL or from about 30 mL to about 70 mL, preferably from about 35 mL to about 65 mL or from about 40 mL to about 60 mL, more preferably from about 45 mL to about 55 mL, or about 45 mL, 46 mL, 47 mL, 48 mL, 49 mL, 50 mL, 51 ml, 52 mL, 53 mL, 54 mL, or 55 mL, most preferably about 50 mL.

[0186] In embodiments, the pharmaceutical composition may comprise a suitable amount ofthe therapeutic composition (e.g., detalimogene voraplasmid). For example, each dose of the pharmaceutical composition may comprise from about 10 mg to about 80 mg, from about 20 mg to about 70 mg, from about 30 mg to about 60 mg, from about 30 mg to about 50 mg, or from about 35 mg to about 45 mg of DNA of the therapeutic composition (e.g., detalimogene voraplasmid). In one example, the pharmaceutical composition comprises from about 30 mg to about 50 mg of DNA of the therapeutic composition (e.g., detalimogene voraplasmid). In embodiments, the pharmaceutical composition comprises about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, or about 60 mg of DNA of the therapeutic composition (e.g., detalimogene voraplasmid). In one example, the pharmaceutical composition comprises about 40 mg of DNA of the therapeutic nucleic acid composition (e.g., detalimogene voraplasmid). METHODS OF TREATMENT

[0187] The methods of treating cancers provided in the disclosure include administering thepharmaceutical composition in multiple in one or more treatment cycles to a patient. Each treatment cycle comprises four doses with certain interval.

[0188] The second dose may be administered at least 5, at least 6, at least 7, at least 8, or atleast 9 days from the first dose. In one example, the second dose is administered at least 6 days from the first dose. In one example, the second dose is administered at least 7 days from the first - 51 - 1102248259\1\AMERICASdose. In one example, the second dose is administered at least 8 days from the first dose. In one example, the second dose is administered 6 days from the first dose. In one example, the second dose is administered 7 days from the first dose. In one example, the second dose is administered 8 days from the first dose.

[0189] The third dose may be administered at least 18, at least 19, at least 20, at least 21, atleast 22, at least 23, or at least 24 days from the second dose. In one example, the third dose is administered at least 18 days from the second dose. In one example, the third dose is administered at least 19 days from the second dose. In one example, the third dose is administered at least 20 days from the second dose. In one example, the third dose is administered at least 21 days from the second dose. In one example, the third dose is administered at least 22 days from the second dose. In one example, the third dose is administered at least 23 days from the second dose. In one example, the third dose is administered at least 24 days from the second dose. In one example, the third dose is administered 18 days from the second dose. In one example, the third dose is administered 19 days from the second dose. In one example, the third dose is administered 20 days from the second dose. In one example, the third dose is administered 21 days from the second dose. In one example, the third dose is administered 22 days from the second dose. In one example, the third dose is administered 23 days from the second dose. In one example, the third dose is administered 24 days from the second dose.

[0190] The fourth dose may be administered at least 5, at least 6, at least 7, at least 8, or atleast 9 days from the second dose. In one example, the fourth dose is administered at least 5 days from the third dose. In one example, the fourth dose is administered at least 6 days from the third dose. In one example, the fourth dose is administered at least 7 days from the third dose. In one example, the fourth dose is administered at least 8 days from the third dose. In one example, the fourth dose is administered at least 9 days from the third dose. In one example, the fourth dose is administered 5 days from the third dose. In one example, the fourth dose is administered 6 days from the third dose. In one example, the fourth dose is administered 7 days from the third dose. In one example, the fourth dose is administered 8 days from the third dose. In one example, the fourth dose is administered 9 days from the third dose.

[0191] In one example treatment cycle, the second dose is administered from 5 to 9 days fromthe first dose, the third dose is administered from 18 to 24 days from the second dose, and the fourth dose is administered from 5 to 9 days from the third dose. In another example treatment - 52 - 1102248259\1\AMERICAScycle, the second dose is administered from 6 to 8 days from the first dose, the third dose is administered from 20 to 22 days from the second dose, and the fourth dose is administered from 6 to 8 days from the third dose. In another example treatment cycle, the second dose is administered 7 days from the first dose, the third dose is administered 21 days from the second dose, and the fourth dose is administered 7 days from the third dose.

[0192] In embodiments, the methods comprise administering the pharmaceutical compositionto the patient in multiple treatment cycles. In one example, the pharmaceutical composition is administered to the patient in two treatment cycles. In another example, the pharmaceutical composition is administered to the patient in three treatment cycles. In another example, the pharmaceutical composition is administered to the patient in four treatment cycles. In another example, the pharmaceutical composition is administered to the patient in five treatment cycles. In another example, the pharmaceutical composition is administered to the patient in six treatment cycles. In another example, the pharmaceutical composition is administered to the patient in seven treatment cycles. In another example, the pharmaceutical composition is administered to the patient in eight treatment cycles. In another example, the pharmaceutical composition is administered to the patient in nine treatment cycles. In another example, the pharmaceutical composition is administered to the patient in ten treatment cycles. In another example, the pharmaceutical composition is administered to the patient in more than ten treatment cycles.

[0193] In embodiments, when there are multiple treatment cycles, the subsequent treatmentcycle may be commenced at least one week, two, three, four, five, six, seven, eight, nine, or ten weeks after the fourth dose of the preceding treatment cycle. In one example, the subsequent treatment cycle is commenced one week after the fourth dose of the preceding treatment cycle. In one example, the subsequent treatment cycle is commenced two weeks after the fourth dose of the preceding treatment cycle. In one example, the subsequent treatment cycle is commenced three weeks after the fourth dose of the preceding treatment cycle. In one example, the subsequent treatment cycle is commenced four weeks after the fourth dose of the preceding treatment cycle. In one example, the subsequent treatment cycle is commenced five weeks after the fourth dose of the preceding treatment cycle. In one example, the subsequent treatment cycle is commenced six weeks after the fourth dose of the preceding treatment cycle. In one example, the subsequent treatment cycle is commenced seven weeks after the fourth dose of the preceding treatment cycle. In one example, the subsequent treatment cycle is commenced eight weeks after the fourth dose of - 53 - 1102248259\1\AMERICASthe preceding treatment cycle. In one example, the subsequent treatment cycle is commenced nine weeks after the fourth dose of the preceding treatment cycle. In one example, the subsequent treatment cycle is commenced ten weeks after the fourth dose of the preceding treatment cycle.

[0194] In embodiments, the methods comprise administering the pharmaceutical compositionto the patient one or more induction treatment cycles followed by one or more maintenance treatment cycles generally comprising fewer doses, e.g. each maintenance cycle has 1 or 2 doses and each induction treatment cycle has 4 doses.

[0195] When there are multiple doses in a maintenance cycle, the subsequent maintenancedose is generally administered from about 5 to about 9 days, e.g., 5, 6, 7, 8, or 9 days after the preceding maintenance dose. In one example, a second maintenance dose is administered 7 days after the first maintenance dose.

[0196] Subsequent maintenance cycles are generally administered about three months apart.In embodiments, when there are multiple maintenance cycles, a subsequent maintenance cycle is commenced about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks after the last dose (e.g., the second dose) of the preceding maintenance cycle. In one example, a subsequent maintenance cycle is commenced about 11 weeks after the last dose (e.g., the second dose) of the preceding maintenance cycle. Hyperproliferative Disorders

[0197] The subject compositions and methods find advantageous use in the treatment ofhyperproliferative disorders. Exemplary hyperproliferative disorders include hyperproliferative disorders of the breast, colon, prostate, pancreas, skin, lung, ovary, kidney, brain, bladder, vagina, cervix, stomach, gastrointestinal tract, kidney, liver, thyroid, esophagous, nasal, laryx, oral, pharyx, retina, endometrium, testes, etc. Of particular interest are compositions and methods for the treatment of hyperproliferative disorders that have metastasized from a primary cancer / tumor to a site distinct from the primary cancer.

[0198] In embodiments, the hyperproliferative disorder is a hyperproliferative disordermucosal tissues or in tissues proximal to mucosal tissue. Methods and compositions of the disclosure may be used in the treatment of gastrointestinal cancers including, but not limited to oral cancers, esophageal cancers, stomach cancers, pancreatic cancers, liver cancers, colorectal cancers, and rectal cancers. Nasal and pulmonary cancers which may be treated by the methods and compositions of the disclosure include paranasal sinus cancer, oropharyngeal cancer, tracheal - 54 - 1102248259\1\AMERICAScancer, and lung cancers. Genitourinary cancers which may be treated by the methods and compositions of the disclosure include bladder cancers, urothelial cancers, urethral cancers, testicular cancers, kidney cancers, prostate cancers, penile cancers, adrenal cancers, uterine cancers, cervical cancers and ovarian cancers.

[0199] In embodiments, the cancer treated using the methods disclosed herein is bladdercancer. In some examples, the cancer is urothelial carcinoma. In some examples, the cancer is squamous cell carcinoma in bladder. In some examples, the cancer is adenocarcinoma in bladder. In some examples, the cancer is small cell carcinoma of the bladder. In some examples, the cancer is muscle-invasive bladder cancer. In some examples, the cancer is non-muscle-invasive bladder cancer (NMIBC).

[0200] In some examples, a patient (e.g., a bladder cancer patient, such as a NMIBC patient)treated with the method herein has previously received a Bacillus calmette-Guerin (BCG) treatment. In some examples, the patient is unresponsive or refractory to the BCG treatment. In some examples, the patient has received an incomplete BCG treatment. For example, in the incomplete BCG treatment, the patient has been exposed to BCG but has not received sufficient amount or number of doses to be considered BCG unresponsive. Incomplete BCG treatments include those described in FDA “BCG-Unresponsive Nonmuscle Invasive Bladder Cancer: Developing Drugs and Biologics for Treatment Guidance for Industry”, February 2018 accessible at www.fda.gov / media / 101468 / download; and Kamat AM et al., Definitions, End Points, and Clinical Trial Designs for Bladder Cancer: Recommendations From the Society for Immunotherapy of Cancer and the International Bladder Cancer Group, J Clin Oncol. 2023 Dec 10;41(35):5437-5447. In some examples, the patient is BCG-naïve.

[0201] In one embodiment, the use of polyplexes:polymer compositions provides forprolonged stability of polyplexes at physiological pH. This provides for effective administration. Administration

[0202] Any of a number of administration routes to contact cells, or tissue are possible and thechoice of a particular route will in part depend on the target cell or tissue. Syringes, endoscopes, cannulas, intubation tubes, catheters, nebulizers, inhalers and other articles may be used for administration.

[0203] In some embodiments, the cancer is bladder cancer. Intravesical administration ofchemotherapeutic agents is standard care for some bladder cancers. Briefly, intravesical therapy - 55 - 1102248259\1\AMERICASinvolves instillation of a therapeutic agent directly into the bladder via insertion of a urethral catheter. In some embodiments, the subject compositions provide for enhanced stability in urine, thereby improving localized expression.

[0204] In embodiments, the doses or “effective amount” for treating a subject are preferablysufficient to ameliorate one, several or all of the symptoms of the condition, to a measurable or detectable extent, although preventing or inhibiting a progression or worsening of the disorder or condition, or a symptom, is a satisfactory outcome. Thus, in the case of a condition or disorder treatable by expressing a therapeutic nucleic acid in target tissue, the amount of therapeutic RNA or therapeutic protein produced to ameliorate a condition treatable by a method of the disclosure will depend on the condition and the desired outcome and can be readily ascertained by the skilled artisan. Appropriate amounts will depend upon the condition treated, the therapeutic effect desired, as well as the individual subject (e.g., the bioavailability within the subject, gender, age, etc.). The effective amount can be ascertained by measuring relevant physiological effects.

[0205] Veterinary applications are also contemplated by the present disclosure. Accordingly,in one embodiment, the disclosure provides methods of treating non-human mammals, which involve administering a polyplex:polymer particle composition of the disclosure to a non-human mammal in need of treatment. The compositions of the disclosure may also be administered to the mucosa. For example, the compositions can be administered to mucosal cells or tissue of the gastrointestinal tract, including but not limited to mucosal cells or tissues of the small intestine and / or large intestine. Other target mucosal cells or tissues include ocular, airway epithelial, lung, vaginal, and bladder cells or tissues. Other target cells or tissues include cells of the breast, colon, prostate, pancreas, skin, lung, ovaries, kidney, brain, bladder, vagina, cervix, stomach, gastrointestinal tract, kidney, liver, thyroid, esophagous, nasal cancer, larynx, oral cancer, pharyngeal cancer, retinoblastoma, endometrium, and testicals, etc.

[0206] Typical formulations for this purpose include liquids, gels, hydrogels, solutions,creams, foams, films, implants, sponges, fibers, powders, and microemulsions.

[0207] In some embodiments, the compositions of the disclosure are administered to themucosa. For example, the compositions can be administered to mucosal cells or tissue of the bladder and gastrointestinal tract, including but not limited to mucosal cells or tissues of the small intestine and / or large intestine and / or colon. Other target mucosal cells or tissues include ocular, airway epithelial, lung, vaginal, and bladder cells or tissues. - 56 - 1102248259\1\AMERICAS

[0208] Typical formulations for this purpose include liquids, gels, hydrogels, solutions,creams, foams, films, implants, sponges, fibres, powders, and microemulsions.

[0209] In an exemplary embodiment for the bladder mucosa, the compounds described hereincan be administered using intravesical therapy. Intravesical therapy involves instillation of a therapeutic agent directly into the bladder via insertion of a urethral catheter. The agent is allowed to sit in the bladder for a period of time, between 0.5 and 6 hours. It is a standard route of administration for bladder cancer chemotherapies. It utilizes the outside anatomical access available for drug delivery directly to the disease site in bladder and thereby avoids unwanted exposure of the instilled drug to healthy tissues elsewhere in the body.

[0210] Formulations for bladder administration may be formulated to be immediate and / ormodified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted, or programmed release. Additional therapeutic agents

[0211] In embodiments according to any one of the methods provided above, the methodfurther comprises administering (such as systemically or locally to the site of the tumor) a non- nucleic acid-based immunostimulatory molecule.

[0212] In embodiments, the immunostimulatory molecule is a modulator of an immunecheckpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2. TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In some embodiments, the immunomodulator is an inhibitor of PD-L1 or PD-L1. In some embodiments, the inhibitor of PD-1 is an anti-PD-1 antibody, such as pembrolizumab or nivolumab. In some embodiments, the immunomodulator is an inhibitor of CTLA-4. In some embodiments, the inhibitor of CTLA-4 is an anti-CTLA-4 antibody, such as ipilimumab or tremelimumab. In some embodiments, the inhibitor of PD-L1 is an anti-PD-L1 antibody, such as atezolizumab.

[0213] In embodiments, the immunomodulator is an IFN-1 agonist, e.g. a RIG-I agonist, aSTING agonist, or a TLR 7 / 9 agonist. RIG-I agonists suitable for co-administration include shortpoly I:C and polyAU compositions (e.g. Poly(I:C) / LyoVec complexes (Invivogen)); RGT100(MK4621, Merck) SLR20 (Elion et al.; SLR10 & SLR14 (Jiang et al.);; and agonists as disclosed in US 8871799, US 8895608, US 8927561, US 9,073,946, US 9458492, US 9555106, US 9884876, US 9956285, US 9775894, US 9861574, US 9937247, US 10167476, US 10350158, US 10434064, US10273484, US9381208B2, US9738680B2, US 9790509, US10059943, - 57 - 1102248259\1\AMERICASUS9109012B2, US9937247B2, US9816091B2, US9133456B2, US9409941B2, US9340789B2, US9040234B2, US 20200071316, US20200063141A1, US20200061097A1, US20200055871A1, US20200016253A1, US20190076463A1, US20180195063A1, US20160287623A1.

[0214] STING agonists suitable for co-administration in conjunction with IL-12 include to c-Di-AMP sodium salt, c-Di-GMP sodium salt, 2',3'-cGAMP sodium salt, 3',3'-cGAMP sodium salt, 10-carboxymethyl-9-acridanone (CMA), DMXAA (Tocris Bioscience, InvivoGen, Nimbus Therapeutics), G10, α-Mangostin, CRD100 (Curadev), cAIMP, 2’2’-c-GAMP, 2’3’- cGAM(PS)2(Rp / Sp), 2’3’-c-di-AMP, c-di-IMP, c-di-UMP, 5,6-dimethylxanthenone-4-acetic acid (DMXAA), MK-1454 (Merck) ML RR-S2 CDG, ML RR-S2 CDA (ADU-S100), SB11285 (Springbank Pharmaceuticals), MAVU (AbbVie), DiABZI, disodium dithio-(Rp1Rp)- [cyclic[A(2’5’)pA(3’5’)p]][Rp,Rp]-cyclic9adenosine-(2’5’)-monophosphorothioate-adenosine- (3’5’)-monophosphorothioate), disodium (RR-S2 CDA, ADU-S100, MIW815)(Corrales et al.,2016) and the compositions disclosed in U.S. 10,176,292, U.S. 9,724,408, U.S. 10,011,630, U.S. 10,435,469, U.S. 10,414,747, U.S. 10,413,612, U.S. 10,131,686, U.S. 10,106,574, U.S. 10,047,115, U.S. 10,045,961, U.S. 10,011,630, U.S.,9,994,607, U.S. 9,937,247, U.S. 9,840,533, U.S.9,770,467, U.S.9,724,408, U.S.9,718,848, and U.S.9,642,830.

[0215] TLR7 and TLR9 agonists suitable for co-administration with IL-12 include:imidazoquinolines and their analogs, including Resiquimod and Imiquimod (Aldara), hydroxycholoroquine, chloroquire, bropirimine, Loxoribine, Isatoribine, CpG oligonucleotides, stabilized immune modulatory RNA (SIMRA) AST-008 (Exicure), MEDI9197 and the compositions disclosed in U.S.434,064, U.S.10,413,612, U.S.10,407,431, U.S.10,370,342, U.S. 10,364,266, U.S.10, 208,037, U.S.10,202,386, U.S.9,944,649, U.S.9,902,730, U.S.9,868,955, U.S. 9,359,360, U.S. 9,295,732, U.S. 9,243,050, U.S. 9,228,184, U.S. 9,216,192, U.S. 9,2206,430, U.S.8,735,421, U.S.8,728,486, U.S.8,399,423 and U.S.8,242,106.

[0216] In embodiments, the non-nucleic acid-based immunomodulator and the subjectcompositions are administered simultaneously, such as in the same composition. In some embodiments, the non-nucleic acid-based immunomodulator and the subject compositions are administered sequentially.

[0217] In further embodiments, the additional therapeutic agent is a chemotherapeutic drug ora radiotherapeutic drug. In some embodiments, the chemotherapeutic drugs include, cisplatin, carboplatin, paclitaxel, docetaxel, 5-fluorouraci 1, bleomycin, methotrexate, ifosamide, - 58 - 1102248259\1\AMERICASoxaliplatin, cyclophosphamide, dacarbazine, temozolomide, gemcitabine, capecitabine, cladribine, clofarabine, cytarabine, floxuridine, fludarabine, hydroxyurea, pemetrexed, pentostatin, thioguanadine, daunorubicin, doxurubicin, epirubicin, idarubicin, topotecan, irinotecan, etoposide, eniposide, colchicine, vincristine, vinblastine, and vinorelbine. Exemplary cancer specific agents and antibodies include Afatinib, Aldesleukin, Alemtuzumab, Axitinib, Belimumab, Bevacizumab, Bortezomib, Bosutinib, Brentuximab vedotin, Cabozantinib, Canakinumab, Carfilzomib, Cetuximab, Crizotinib,Dabrafenib, Dasatinib, Denosumab, Erlotinib, Everolimus, Gefitinib, lbritumomab tiuxetan, lbrutinib, Imatinib, Ipilimumab, Lapatinib, Nilotinib, Obinutuzumab, Ofatumumab, Panitumumab, Pazopanib, Pertuzumab, Ponatinib, Regorafenib, Rituximab, Romidepsin, Ruxolitinib, Sipuleucel-T, Sorafenib, Temsirolimus, Tocilizumab, Tofacitinib, Tositumomab, Trametinib, Trastuzumab, Vandetanib, Vemurafenib, Vismodegib, Vorinostat, Ziv-aflibercept, and any combination thereof. In some embodiments, the additional therapeutic agent is administered to the subject prior to, concurrently with, or subsequent to administration of the immunoconjugate. In some embodiments, the additional therapeutic agent is administered systemically. For example, in some embodiments, the additional therapeutic agent is administered by intravenous injection.

[0218] The examples set out herein illustrate several embodiments of the present disclosurebut should not be construed as limiting the scope of the present disclosure in any manner. EXAMPLES Example 1: Clinical study of intravesical EG-70 in patients with BCG-unresponsive NMIBC – Phase 1

[0219] Examples 1 and 2 show a clinical study of intravesical EG-70 in patients with BCG-unresponsive NMIBC, which has two phases: a Phase 1 dose-escalation to establish safety and recommended the phase 2 dose. Example 1 describes Phase 1 of the study and Example 2 below describes Phase 2 of the study.

[0220] This example evaluated the safety and efficacy of intravesical administration of EG-70and in the bladder and its effect on bladder tumors in patients with NMIBC.

[0221] EG-70 (detalimogene voraplasmid) is a non-viral gene therapy that delivers plasmidDNA to mucosal tissues, such as bladder urothelium. EG-70 is a nanoparticle formulation comprising a plasmid that expresses three genes that simultaneously activate the innate and - 59 - 1102248259\1\AMERICASadaptive immune responses within the bladder. The plasmid encodes both IL-12 and dsRNAs (VA RNA1 and eRNA11a) that activate the intracellular receptor, RIG-I. EG-70 was administered intravesically to elicit bladder-localized, robust anti-tumor immune responses providing efficacy in high grade non-muscle invasive bladder cancer (NMIBC) while avoiding systemic toxicities. EG-70 did not have the safety risks associated with viral-based gene therapy and it was designed to fit into the clinical practice of community urologists without the need for biosafety containment and ultra-low temperature storage.

[0222] This example determined the safety, tolerability, and efficacy of EG-70 in adult patientswith NMIBC with Cis who had failed BCG therapy and were recommended for radical cystectomy, or high-risk NMIBC patients with Cis who were BCG-naïve or had received incomplete BCG treatment. The key objective for the Phase 1 portion of the clinical study was evaluation of safety and tolerability. Eligible BCG-unresponsive NMIBC patients with Cis enrolled in Phase 1 and will continue to be enrolled in Cohort 1 of Phase 2 (see Example 2 below). Eligible high-risk NMIBC patients with Cis who had been incompletely treated or were BCG- naïve will be enrolled starting in Phase 2 in a separate single-arm cohort (Cohort 2) (See Example 2 below). The schema, with key design features, for the cohorts unresponsive to BCG is defined in FIG.1.

[0223] Notably, Weiss et al (2003) published a clinical study assessing IL-12 for bladdercancer. However, unlike our work, Weiss et al delivered recombinant IL-12 protein intravesically. Since no clinically relevant evidence of an anti-tumor or immunological effect was observed in their study, it is likely that majority of the injected IL-12 protein was unable to effectively penetrate the urothelium or be present with sufficient exposure to have a clinically meaningful effect.. Delivery of a recombinant protein intravesically allows for significant exposure at the time of dosing, with exposure decreasing dramatically immediately at the conclusion of dosing due to urinary excretion, thereby functionally limiting exposure. In marked contrast, the present invention delivers its IL-12 and RIG-I agonist payload genetically encoded in a plasmid, such that exposure to therapeutic proteins and expressed RNAs can be maintained over time. Since there is no clinical experience with this approach to date, a dose exploration study was needed to assess both variable doses of EG-70 as well as variable dosing frequencies.

[0224] All patients in Phase 1 received at least one cycle of treatment with EG-70. A cyclewas 12 weeks in duration. Those patients who had complete response or stable disease (SD) at the - 60 - 1102248259\1\AMERICASend of Cycle 1 (Week 10) were allowed to choose (in association and consultation with their physician) to continue receiving treatment for up to a total of 4 cycles, provided they did not have progressive disease (PD) on evaluation for response at the end of each cycle. Patients who completed cycle 1 and the additional 3 cycles without PD were followed until PD or for approximately 2 years following their End-of-Treatment Visit, whichever occurred first.

[0225] METHODS:

[0226] In the study, escalating doses of EG-70 were administered intravesically to patientswith high risk BCG-unresponsive Carcinoma in situ (Cis) NMIBC on weeks 1 and 2 or weeks 1, 2, 5, and 6 of a 12-week treatment cycle. At the week 12 assessment, patients with stable disease (SD) or complete response (CR), as assessed by urine cytology, cystoscopy, and bladder biopsy, were allowed electively to remain on EG-70 for up to 3 additional 12-week cycles. The study was conducted in accordance with the ICH for Good Clinical Practice guidelines and with the principles of the Declaration of Helsinki. Patients enrollment criteria (for Phase 1 and Phase 2)

[0227] Inclusion Criteria:

[0228] BCG-unresponsive Patients:

[0229] BCG-unresponsive NMIBC with carcinoma in situ (CIS) with or without resectedpapillary tumors who are ineligible for or have elected not to undergo cystectomy: persistent high- grade disease (Ta, T1, or Tis) after receiving intravesical BCG induction (at least 5 of 6 induction doses) plus maintenance (at least 2 of 3 doses) or recurrence of high-grade papillary disease within 6 months or Tis within 12 months of BCG instillation, or T1 high grade disease residual at the first evaluation following induction BCG (at least 5 of 6 doses).

[0230] BCG-Naïve or BCG-incompletely treated Patients (Phase 2 Only):

[0231] NMIBC with Cis with or without resected papillary tumors who are ineligible for orhave elected not to undergo cystectomy: persistent high-grade disease (Ta, T1, or Tis): after incomplete BCG treatment (at least 1 dose) or who have not yet received any treatment with BCG, but who have previously been treated with at least 1 dose of intravesical chemotherapy following transurethral resection of bladder tumor (TURBT)

[0232] All Patients:- 61 - 1102248259\1\AMERICAS

[0233] Patients who have previously been treated with an investigational or approvedcheckpoint inhibitor (e.g., pembrolizumab) and failed treatment are eligible for inclusion 30 days post-treatment (Phase 1) or 3 months post-treatment (Phase 2).

[0234] Male or non-pregnant, non-lactating female, 18 years or older.

[0235] Women of childbearing potential must have a negative pregnancy test at Screening. Afemale patient is considered to be of child-producing potential unless she: has had a hysterectomy or bilateral oophorectomy, or is age ≥ 60 years and is amenorrhoeic, or is age < 60 years and has been amenorrhoeic for ≥ 12 months (including no irregular menses or spotting) in the absence of any medication which induces a menopausal state and has documented ovarian failure by serum oestradiol and follicle-stimulating hormone levels within the institutional laboratory postmenopausal range).

[0236] All patients of childbearing potential must be willing to consent to using effectivedouble-barrier contraception, i.e., intrauterine device, birth control pills, depo-provera, and condoms while on treatment and for 3 months after their participation in the study ends.

[0237] In Phase 2, for patients with T1 lesions, Screening biopsy must be considered adequate(contain the muscularis layer).

[0238] Performance Status: Eastern Cooperative Oncology Group (ECOG) 0, 1, and 2.

[0239] Hematologic inclusion within 2 weeks of start of treatment: Absolute neutrophil count>1,500 / mm3, Hemoglobin >9.0 g / dl, Platelet count >100,000 / mm3.

[0240] Hepatic inclusion within 2 weeks of Day 1: Total bilirubin must be ≤1.5 x the upperlimit of normal (ULN), Aspartate aminotransferase (AST) and alanine aminotransferase (ALT) ≤2.5 x ULN for the institution, alkaline phosphatase ≤2.5 x ULN for the institution, unless bone metastasis is present in the absence of liver metastasis.

[0241] Adequate renal function with creatinine clearance >30 mL / min.

[0242] Prothrombin time and partial thromboplastin time within the normal limits atScreening.

[0243] Must have satisfactory bladder function with ability to retain study drug for a minimumof 60 minutes.

[0244] Patient or legally authorized representative (LAR) must be willing and able to complywith all protocol requirements. - 62 - 1102248259\1\AMERICAS

[0245] Patient or LAR must be willing and able to give informed consent and anyauthorizations required by local law for participation in the study.

[0246] Exclusion Criteria:

[0247] Any other malignancy diagnosed within 1 year of study entry (except basal orsquamous cell skin cancers or noninvasive cancer of the cervix) is excluded.

[0248] Concurrent treatment with any chemotherapeutic agent.

[0249] History of partial cystectomy.

[0250] Treatment with pembrolizumab within 30 days (Phase 1) or 3 months (Phase 2) priorto Screening.

[0251] Treatment with last therapeutic agent (including intravesical chemotherapy post-TURBT) within 30 days of Screening (Phase 1 and Phase 2) or treatment with an investigational checkpoint inhibitor within 3 months of Screening (Phase 2 only).

[0252] Evidence of persistent or ongoing renal failure.

[0253] History of unresolved vesicoureteral reflux or an indwelling urinary stent.

[0254] History of unresolved hydronephrosis due to ureteral obstruction.

[0255] Participation in any other research protocol involving administration of aninvestigational agent within 1 month prior to Day 1.

[0256] History of external beam radiation to the pelvis at any time or prostate brachytherapywithin the last 12 months.

[0257] History of interstitial lung disease and / or pneumonitis in patients who have previouslyreceived a PD-1 or PD-L1 inhibitor therapy.

[0258] Evidence of metastatic disease.

[0259] History of difficult catheterization that in the opinion of the Investigator will preventadministration of EG-70.

[0260] History of interstitial cystitis.

[0261] Active, uncontrolled bacterial, viral, or fungal infection(s) requiring systemic therapy.

[0262] Known human immunodeficiency virus (HIV), Hepatitis B, or Hepatitis C infection.

[0263] Significant cardiovascular risk (e.g., coronary stenting within 8 weeks, myocardialinfarction within 6 months).

[0264] Treatment: Phase 1: Dose escalation phase- 63 - 1102248259\1\AMERICAS

[0265] Patients received up to four cycles of EG-70 administered as a bladder instillation of a50 mL volume of study drug via catheter with a targeted retention time of 60 minutes. One cycle lasted approximately 12 weeks and consists of either a 2-dose (Day 1 and Day 8) or 4-dose (Day 1, Day 8, Day 29 and Day 36) regimen.

[0266] Primary outcome measures are described in Table 4.

[0267] Table 4Outcome Measure Measure Description Time FramePhase 1: Nature, incidence, The type, incidence, Approximately 2 years

[0269] Table 5Outcome Measure Measure Description Time FramePhase 1: The number of To identify the number of Approximately 12 Weeks

[0271] The primary endpoint of the Phase 1 study was safety (characterizing the nature,incidence, relatedness and severity of all observed adverse events (“AEs”) and severe adverse events (“SAEs”)), with complete response and pharmacodynamics of biomarkers assessed as exploratory endpoints.

[0272] Result: Safety

[0273] Twenty-four patients had received at least one dose of EG-70 in the Phase 1 study, withthe total number of AEs and most commonly reported AEs across all 22 patients defined in Table 3 below. The majority (97%) of AEs had been Grade 1 or 2 and largely consistent with the same events seen with instrumentation, catheterization, and intravesical instillation of any agent. Four Grade 3 SAEs had been observed in Phase 1. However, on review, it was observed that the renal failure was present at baseline before treatment with EG-70. The other three Grade 3 SAEs were - 64 - 1102248259\1\AMERICASconsidered unrelated to the study drug. There was no association between the severity or incidence of AEs and the dose level. In addition, AEs were not more frequent or severe later cycles of dosing. The following table summarizes the Phase 1 safety results.

[0274] Table 6Reported adverse effects (AE) to date were largely consistent with instrumentation / intravesical administration

[0275] Results: Efficacy

[0276] Efficacy was assessed by the standard three criteria evaluation used for NMIBC,namely urinary cytology, cystoscopic appearance, and biopsy results of suspicious areas. Biopsies in the former area of Cis were required even if the appearance was normal. In Phase 1, patients without progressive disease were allowed to electively continue on study drug after the 3- month visit. In total, 22 patients were dosed with the study drug and evaluable for efficacy at the 3- month visit. One patient included in evaluations for safety evaluation was excluded from efficacy.

[0277] The plot in FIG. 2 captures individual subjects in each row, organized chronologicallyfrom the first patient enrolled (#1) to the last enrolled in Phase 1 (#22). The dose group is captured on the left-hand side of the plot, with DL1, DL2, DL3 reflecting half-log increments in amount of plasmid DNA instilled, as dose. Each of these three regimens reflects delivery of a dose on Weeks 1 and 2 of each 3-month cycle, whereas the “prime” dosing schedule indicated as DL2’ reflects 4 - 65 - 1102248259\1\AMERICASinstillations of EG-70 in each 3-month cycle, namely at Weeks 1, 2, 5, and 6. Expansion cohorts after safety had been demonstrated in the initial cohort of 3 patients is indicated by the suffix “E”. Overall, across all doses, 16 of 22 patients dosed with EG-70 achieved a Complete Response, or “CR” for a best overall CR rate of 73%. Specifically, at the 3-month timepoint, this CR rate was 68% (15 of 22), with 82% (18 of 22) of patients continuing to receive additional doses of the study drug beyond 3 months. Within the dose selected for the pivotal portion of the study (DL2’), the CR rate at 3 and 6 months was 70% and 60%, respectively, with 90% of patients continuing on the study drug beyond 3 months. Of note, patient #1 had maintained a CR for 18 months after the first dose of EG-70.

[0278] Pharmacodynamics

[0279] Urine was monitored during the Phase 1 study to assess expression of our secreted,therapeutic transgene protein product, IL-12. As can be seen in FIG.3, IL-12 was not detected in any patient at the baseline, pre-treatment timepoint. By contrast, after treatment, IL-12 was detected in the urine of all patients dosed, with dose levels (DL) 2 and 3 (800 and 2500 mg of plasmid DNA, respectively) demonstrating about an order of magnitude higher levels of IL-12 than dose level 1. Together, these data demonstrate: 1) the EG-70 drug product was transfecting human cells and expressing therapeutic products; and 2) the route of administration drove local expression, without the liability of systemic exposure to immune-modulating agents. IL-12 is a therapeutic product that is expressed from EG-70, and is a proxy as well for the expression of the intracellular localized RIG-I agonists. The data suggested that increasing the number of doses of EG-70 administered over a 12-week cycle can increase the functional exposure to the therapeutic products. The 4-dose regimen was selected to move forward. Example 2 – Clinical study of intravesical EG-70 in patients with BCG-unresponsive NMIBC – Phase 2

[0280] Example 2 shows Phase 2 of the clinical study of intravesical EG-70 in patients withBCG-unresponsive NMIBC. The Phase 2 portion of the study is open-label and has two independent single arm cohorts of patients with Cis-containing NMIBC (with or without papillary disease). Cohort 1 is BCG-unresponsive patients. Cohort 2 is BCG-naïve or BCG- incompletely treated patients. Although the treatment is the same for each cohort, an independent set of analysis will occur for each cohort. - 66 - 1102248259\1\AMERICAS

[0281] In Phase 2, each cycle is 12 weeks in duration. Patients in either cohort who haveexhibited SD or CR at Week 12 continue to receive treatment with EG-70 until Week 24, whereas patients with PD discontinue to receive treatment. Patients who experience and maintain CR at Week 24 receive additional cycles every 12 weeks until Week 48. Percentage of patients with cystoscopic CR at 48 weeks, based on exam, urine cytology, and appropriate biopsies is the co- primary endpoint together with the nature, incidence, relatedness, and severity of treatment emergent adverse events. Secondary endpoints include progression free survival, CR rates at 12, 24, 36, and 96 weeks, as well as CR rate by 24 weeks, and the duration of response of the responding patients.

[0282] Treatment in Phase 2:

[0283] Cohort 1: Recommended Phase 2 dose (RP2D) with eligible BCG-unresponsiveNMIBC patients, up to 4 cycles of treatment with EG-70.

[0284] Cohort 2: RP2D with eligible high-risk NMIBC patients who have been incompletelytreated with BCG or are BCG-naïve.

[0285] Cohort 1 and Cohort 2: Patients receive up to 4 cycles of EG-70 at the RP2D definedin Phase 1 administered as a bladder instillation of a 50 mL volume of study drug via catheter with a targeted retention time of 60 minutes. One cycle lasts approximately 12 weeks.

[0286] Primary outcome measures are shown in Table 7.

[0287] Table 7Outcome Measure Measure Description Time FramePh 2 P t f C l t t ill A i t l 48 k

[0288] Secondary outcome measures are shown in Table 8.

[0289] Table 8Outcome Measure Measure Description Time Frame- 67 - 1102248259\1\AMERICASPhase 2: Progression-free To evaluate disease-free Approximately 3 years survival (PFS) survival rateEquivalents

[0290] All publications, patents, and patent applications mentioned in this specification areherein incorporated by reference in the entirety and for all purposes and to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. The disclosure set forth above may encompass multiple distinct disclosures with independent utility. Although each of these disclosures has been disclosed in its preferred form(s), the specific embodiments thereof as disclosed and illustrated herein are not to be considered in a limiting sense, because numerous variations are possible. The subject matter of the disclosures includes all novel and nonobvious combinations and subcombinations of the various elements, features, functions, and / or properties disclosed herein. The following claims particularly point out certain combinations and subcombinations regarded as novel and nonobvious. Disclosures embodied in other combinations and subcombinations of features, functions, elements, and / or properties may be claimed in this application, in applications claiming priority from this application, or in related applications. Such claims, whether directed to a different disclosure or to the same disclosure, and whether broader, narrower, equal, or different in scope in comparison to the original claims, also are regarded as included within the subject matter of the disclosures of the present disclosure. - 68 - 1102248259\1\AMERICAS

Claims

CLAIMS:

1. A method for treating bladder cancer in a patient in need thereof, comprisingintravesically administering a pharmaceutical composition comprising a nucleic acid polyplex comprising a cationic polymer and / or lipid and one or more therapeutic nucleic acid constructs encoding interleukin-12 (IL-12) and at least one RIG-I agonist, in one or more treatment cycles to the patient, wherein each treatment cycle comprises a first dose, a second dose administered at least 5-9 days after the first dose, preferably 6-8 days after the first dose, more preferably 6, 7, or 8 days after the first dose, a third dose administered at least 18-24 days after the second dose, preferably 19-23 days after the second dose, more preferably 20, 21, or 22 days after the second dose, and a fourth dose administered at least 5-9 days after the third dose, preferably 6-8 days after the third dose, more preferably 6, 7, or 8 days after the third dose.

2. The method of claim 1, wherein the therapeutic nucleic acid constructs encoding IL-12and the at least one RIG-I agonist are different nucleic acid constructs.

3. The method of any one of the preceding claims, wherein the at least one RIG-I agonist isselected from the group consisting of eRNA11a, VA RNA1, eRNA41H, MK4621, SLR10, SLR14, and SLR20, and more preferably comprises eRNA41H and / or eRNA11a.

4. The method of any one of the preceding claims, wherein the cationic polymer is selectedfrom the group consisting of polyethyleneimine (PEI), PAMAM, polylysine (PLL), polyarginine, chitosan, and derivatives thereof.

5. The method of claim 4, wherein the cationic polymer comprises a derivatized chitosan,preferably an amino-functionalized chitosan comprising arginine; optionally further comprising or functionalized with a hydrophilic polyol, preferably glucose.

6. The method of claim 5, wherein the derivatized chitosan has the structure of Formula II- 69 - 1102248259\1\AMERICASI).

7. , he derivatized chitosan has anaverage molecular weight from 5 about kDa to about 10 kDa, preferably about 7 kDa.

8. The method of claim 7, wherein the derivatized chitosan has an average molecular weightof about 10 kDa.

9. The method of claim 6, wherein the derivatized chitosan comprises from about 50% toabout 77% non-functionalized glucosamine monomer unit; preferably wherein the derivatized chitosan comprises from about 20% to about 35% glucosamine monomer unit conjugated with arginine, and from about 3% to about 15% glucosamine monomer unit conjugated with glucose.

10. The method of any one of the preceding claims, wherein the nucleic acid polyplex has anaverage hydrodynamic diameter from about 100 nm to about 150 nm, preferably about 118 nm.

11. The method of any one of the preceding claims, wherein the nucleic acid polyplex has anaverage polydispersity index (PDI) of less than about 0.22, preferably about 0.13.

12. The method of any one of the preceding claims, wherein the nucleic acid polyplex has anaverage zeta potential from about -1 mV to about +6 mV, preferably about +2.5 mV.

13. The method of any one of the preceding claims, wherein the nucleic acid polyplex has atleast about 70%, preferably about 84%, supercoil DNA. - 70 - 1102248259\1\AMERICAS14. The method of any one of the preceding claims, wherein the nucleic acid polyplex in thepharmaceutical composition is or comprises detalimogene voraplasmid.

15. The method of claim 14, wherein the pharmaceutical composition comprises from about30 mg to about 50 mg, preferably about 40 mg, of detalimogene voraplasmid.

16. The method of claim 14 or 15, wherein each dose comprises between about 700 andabout 900 µg / mL of the detalimogene voraplasmid, more preferably between about 750 and about 850 µg / mL, most preferably about 800 µg / mL of the detalimogene voraplasmid.

17. The method of claim 16, wherein each dose comprises between about 40 and 60 mL,more preferably between about 45 and 55 mL of the detalimogene voraplasmid, most preferably about 50 mL of the detalimogene voraplasmid.

18. The method of any one of the preceding claims, comprising at least one additionaltreatment cycle, wherein the additional treatment cycle is commenced about six weeks after the fourth dose of the preceding treatment cycle.

19. The method of claim 18, comprising four treatment cycles.

20. The method of claim 18, further comprising administering at least one maintenance cycleto a patient who remains in complete remission after four treatment cycles, wherein each maintenance cycle comprises a first maintenance dose and a second maintenance dose administered at least 5-9 days after the first maintenance dose, preferably 6-8 days after the first maintenance dose, more preferably 6, 7, or 8 days after the first maintenance dose.

21. The method of claim 20, wherein consecutive maintenance cycles are administered threemonths apart.

22. The method of any one of the preceding claims, wherein the bladder cancer is non-muscle invasive bladder cancer (NMIBC).

23. The method of claim 22, wherein the bladder cancer is NMIBC with carcinoma in situ.- 71 - 1102248259\1\AMERICAS24. The method of claim 22 or 23, wherein the patient has received Bacillus calmette-Guerin(BCG) treatment.

25. The method of claim 24, wherein the patient is unresponsive or refractory to the BCGtreatment.

26. The method of claim 22, wherein the patient is BCG-naïve.- 72 - 1102248259\1\AMERICAS

Citation Information

Patent Citations

  • Drug delivery compositions and uses thereof

    WO2018045058A1

  • Combination gene therapy for treatment of metastatic cancer

    WO2022178325A1