Mne1 gene for regulating nitrogen use efficiency in maize and use thereof

Abstract

Provided are a nucleic acid molecule and a polypeptide, and also provided are a recombinant vector comprising the nucleic acid molecule, a host cell, and a plant or a part, seed, cell or progeny thereof. Also provided are a method for preparing a transgenic plant, and a method for regulating the nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield in a plant.

Description

Mne1 gene for regulating nitrogen utilization efficiency of corn and use thereof

[0001] Cross-reference to Related Applications

[0002] This application claims priority to Chinese Patent Application No. 202411076358.2, filed August 7, 2024, the entire contents of which are incorporated herein by reference in their entirety. TECHNICAL FIELD

[0003] The present application relates to the field of plant gene mapping and molecular breeding. Specifically, the present application provides a nucleic acid molecule and a polypeptide, and further provides a recombinant vector, a host cell, and a plant or a part, a seed, a cell, or a progeny thereof comprising the nucleic acid molecule. Further, the present application provides a method for preparing a transgenic plant, and a method for regulating nitrogen utilization efficiency, nitrate uptake or transport, biomass, and / or yield of a plant. BACKGROUND

[0004] Nitrogen is the most required mineral element for plants, and occupies the first place. It is also one of the most important factors for promoting crop yield. Nitrogen accounts for 1.5-2% of the total dry weight of plants, and nitrogen element is an important component of macromolecular substances in plants, such as proteins (including enzymes), nucleic acids (DNA, RNA), vitamins (B1, B2, B6, etc.), plant hormones (IAA, CTK), alkaloids, chloroplasts, etc., so nitrogen plays an important role in maintaining normal life activities of plants, and is an important limiting factor affecting plant growth and development. Therefore, plants must absorb sufficient nitrogen nutrition from the soil to meet their own growth and development (Marschner, 1995). Inorganic nitrogen sources such as nitrate nitrogen and ammonium nitrogen are the main forms of nitrogen absorbed and utilized by plants (Hageman, et al., 1988; Lawlor, et al., 1989), and are of great importance to the growth and development of crops, including chloroplast formation, root growth, and yield formation of crops (lam, 1996; Lawler, et al., 2001). However, the content of nitrogen sources that can be directly absorbed and utilized by plants in the natural environment is low, so nitrogen is an important limiting factor affecting plant growth and development.

[0005] In agricultural production, in order to ensure the yield of crops, the amount of nitrogen fertilizer is increasing (Frink, et al., 1999), which provides a basic guarantee for global food security. Under the condition that the global arable land area only increases by 15.5%, the main driving force for the continuous increase of food production is the large amount of fertilizer application. While the fertilizer greatly improves the yield of crops, it increases people's excessive dependence on it. Since the 1980s, the amount of nitrogen fertilizer in China has increased dramatically, even more than 33% of the total consumption of fertilizer in the world. The input of fertilizer in agricultural production plays a crucial role in ensuring the sustained increase of food production, but the nitrogen utilization efficiency has not been improved, which is only about 30%, less than half of that in developed countries. 50-70% of nitrogen fertilizer cannot be absorbed by crops (Peoples, et al., 1995), which not only pollutes the air, soil and water, but also causes the acidification of soil and the eutrophication of water in our country. Excessive use of nitrogen fertilizer also brings great environmental pressure to the sustainable development of agriculture, which to some extent causes the waste of resources and brings certain pressure to the environment, and causes serious environmental nitrogen pollution (Zhu, 2000; Good, et al., 2004). Improving the nutrient utilization efficiency of crops and achieving sustained increase in production while reducing fertilizer input have become major problems to be solved.

[0006] It has been proved in corn that the yield of crops can be maintained or increased by improving the low-nitrogen tolerance of plants and reducing the amount of nitrogen fertilizer (Tollenaar, 1999). Plants have formed a complex and delicate signal regulation network in response to external nitrogen nutrition conditions and integrated their own nitrogen demand in the long-term evolution process.

[0007] Therefore, with the continuous deepening of plant genomics research, it is a good way to find and clone nitrogen absorption regulation related genes and carry out research on the regulation mechanism and signal transduction pathway of plant nitrogen absorption, transport and utilization process to improve nitrogen nutrition efficiency. It is of great significance to improve the nitrogen utilization efficiency of plants, reduce the fertilizer input in agricultural production and realize the sustainable development of agriculture to analyze this regulation network. SUMMARY

[0008] The present inventors have found, through a large number of studies, a key gene for regulating the nitrogen utilization efficiency of corn, further obtained a method for regulating the nitrogen utilization efficiency of corn by overexpressing the gene, and a corn plant capable of efficiently utilizing nitrogen obtained by the method. The gene, method or plant can be used to improve corn elite inbred lines and cultivate new corn varieties that can efficiently utilize nitrogen.

[0009] Nucleic acid molecule

[0010] In a first aspect, the present application provides a nucleic acid molecule comprising a sequence selected from the group consisting of:

[0011] (1) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2;

[0012] (2) a nucleotide sequence encoding an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence shown in SEQ ID NO: 2, which encodes a polypeptide having the function of modulating plant nitrogen use efficiency, nitrate uptake or transport, biomass, and / or yield;

[0013] (3) a nucleotide sequence encoding an amino acid sequence that is obtained by substitution, deletion, and / or addition of one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2, which encodes a polypeptide having the function of modulating plant nitrogen use efficiency, nitrate uptake or transport, biomass, and / or yield.

[0014] In certain embodiments, the nucleotide sequence of (1) to (3) is a nucleotide sequence of Zea mays.

[0015] In a second aspect, the present application provides a nucleic acid molecule comprising a sequence selected from the group consisting of:

[0016] (1) a nucleotide sequence shown in SEQ ID NO: 1 or 3;

[0017] (2) a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 1 or 3, which encodes a polypeptide having the function of modulating plant nitrogen use efficiency, nitrate uptake or transport, biomass, and / or yield;

[0018] (3) a nucleotide sequence that is capable of hybridizing to the sequence shown in SEQ ID NO: 1 or 3 under conditions permitting nucleic acid hybridization.

[0019] As understood by one skilled in the art, two nucleotide sequences that are capable of hybridizing do not need to be perfectly complementary. In certain embodiments, the degree of complementarity between the sequence shown in SEQ ID NO: 1 or 3 and the sequence capable of hybridizing thereto can be at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimally aligned.

[0020] In certain embodiments, the nucleotide sequence of (1) to (3) is a nucleotide sequence of Zea mays.

[0021] In certain embodiments, the position of the nucleic acid molecule in the genome of Zea mays corresponds to 70817154..70825722 of chromosome 5 of the Zea mays reference genome B73.

[0022] In the context of the present application, the nucleic acid molecule is a nucleic acid molecule of the maize gene MNE1.

[0023] In certain embodiments, the nucleic acid molecule comprises a nucleotide sequence that is a coding region sequence of the maize gene MNE1, or both a coding region sequence and a non-coding region sequence of the maize gene MNE1.

[0024] In certain embodiments, the nucleic acid molecule further comprises a promoter.

[0025] In the present context, "promoter" means a nucleic acid sequence that functions to direct transcription of a downstream coding sequence.

[0026] The promoter can be native or homologous to the plant host and / or the nucleic acid molecule of the present application, or it can be foreign or heterologous. Also, the promoter can be a native sequence or a synthetic sequence. In the case where the promoter is "native" or "homologous" to the plant host, the promoter refers to a promoter found in the natural plant into which the promoter is introduced. In the case where the promoter is "foreign" or "heterologous" to the DNA sequence of the present application, the promoter refers to a non-native or non-naturally occurring promoter operably linked to the DNA sequence of the present application. "Heterologous" generally refers to a nucleic acid sequence that is not endogenous to the cell or portion of the natural genome in which it exists, but has been added to the cell by infection, transfection, microinjection, electroporation, microprojection, etc. Generally, "operably linked" means that the nucleic acid sequences are contiguous and, in the case of two protein coding regions, are in the same reading frame.

[0027] In certain embodiments, the promoter is operably linked to the 5' end of the sequence of any one of (1) to (3), and the promoter is capable of regulating the transcription and / or expression (e.g., whether to express, the amount of expression) of the sequence of any one of (1) to (3).

[0028] In certain embodiments, the promoter is selected from a constitutive promoter, an inducible promoter, or a tissue-specific promoter.

[0029] In one embodiment, the promoter is a constitutive promoter. Suitable constitutive promoters for use in plants include: promoters from plant viruses, such as the peanut chlorotic streak caulimovirus (PC1SV) promoter (U.S. Patent No. 5,850,019); the cauliflower mosaic virus (CaMV) 35S promoter (Odell et al. (1985) Nature 313:810-812); the Chlorella virus methyltransferase gene promoter (U.S. Patent No. 5,563,328) and the figwort mosaic virus (FMV) full-length transcription promoter (U.S. Patent No. 5,378,619); the actin gene promoter from rice (McElroy et al. (1990) Plant Cell 2:163-171); the ubiquitin gene promoter (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1992) Plant Mol. Biol. 18:675-689), including the TrpPro5 promoter (U.S. Patent Application No. 10 / 377,318; filed March 16, 2005); the pEMU promoter (Last et al. (1991) Theor. Appl. Genet. 81 :581-588); the MAS promoter (Velten et al. (1984) EMBO J. 3:2723-2730); the maize H3 histone promoter (Lepetit et al. (1992) MoI. Gen. Genet. 231 :276-285 and Atanassova et al. (1992) Plant J. 2(3):291-300); Brassica napus ALS3 (PCT Application WO 97 / 41228); and promoters of various Agrobacterium genes (see U.S. Patent Nos. 4,771,002, 5,102,796, 5,182,200 and 5,428,147).

[0030] In another embodiment, the promoter is a tissue-specific promoter. A list of commonly used tissue-specific promoters can be found in a review by Moore et al. (2006) Plant J. 45(4):651-683, which is incorporated herein by reference in its entirety.

[0031] In certain embodiments, the sequence of the promoter is a natural promoter sequence from an animal, plant or microorganism, or is a man-made promoter sequence.

[0032] In certain embodiments, the artificially engineered promoter sequence is obtained by gene editing.

[0033] In certain embodiments, the sequence of the promoter is a plant-derived promoter sequence.

[0034] In certain embodiments, the promoter has a sequence as set forth in any one of SEQ ID NOs: 4-6.

[0035] It is understood that the present application is not meant to encompass only the particular exemplary sequences, as the skilled artisan will recognize that there are many techniques for making changes to the amino acids at particular positions without affecting the function of the polypeptide of which the amino acid composition is a part. For example, a codon for a hydrophobic amino acid (e.g., alanine) can be substituted by the codon for another less hydrophobic residue (e.g., glycine); or a codon for a more hydrophobic residue such as valine, leucine or isoleucine can be substituted for a codon for a less hydrophobic residue. Similarly, more positively charged residues such as lysine can be substituted for less positively charged residues such as arginine, and vice versa. Such alterations in the nucleotide sequence of the gene encoding the polypeptide are readily made by those of ordinary skill in the art.

[0036] The amino acid sequence of the polypeptide of the present application can also comprise a sequence in which one or more amino acid residues in the sequence set forth in SEQ ID NO: 2 are substituted, deleted, and / or added. In certain embodiments, the substitution is a conservative substitution. By "conservative substitution" is intended substitution of a residue with another residue that has similar physical and chemical properties. Non-limiting examples of conservative substitutions include substitutions between aliphatic, hydrophobic residues such as Ile, Val, Leu, or Ala, and substitutions between polar residues such as Lys-Arg, Glu-Asp, or Gin-Asn.

[0037] Methods for making substitutions, deletions, and / or additions of one or more amino acid residues in an amino acid sequence are known in the art. See, e.g., Nucleic Acid Research 10(20):6487-6500 (1982).

[0038] In certain embodiments, the nitrogen is nitrogen from nitrate nitrogen, nitrogen from ammonium nitrogen, nitrogen from amide nitrogen, or any combination thereof.

[0039] In certain embodiments, the nitrogen comprises: nitrate or a substance capable of forming nitrate, and urea.

[0040] In certain embodiments, the modulating is modulating under low nitrogen conditions or under high nitrogen conditions.

[0041] In certain embodiments, the low nitrogen conditions are nitrogen fertilizer application amount of less than 200 kg / ha (e.g., less than 180 kg / ha, less than 150 kg / ha, less than 120 kg / ha, less than 100 kg / ha, less than 80 kg / ha, less than 50 kg / ha, less than 20 kg / ha) of nitrogen-containing nutrient.

[0042] In certain embodiments, the high nitrogen conditions are nitrogen fertilizer application amount of greater than or equal to 200 kg / ha (e.g., greater than or equal to 220 kg / ha, greater than or equal to 250 kg / ha, greater than or equal to 280 kg / ha, greater than or equal to 300 kg / ha, greater than or equal to 320 kg / ha, greater than or equal to 350 kg / ha, greater than or equal to 400 kg / ha) of nitrogen-containing nutrient.

[0043] In certain embodiments, the modulating biomass is selected from modulating plant height of above ground portion, modulating weight of above ground portion, modulating weight of below ground portion, or any combination thereof.

[0044] In certain embodiments, the modulating yield is modulating grain weight, modulating seed set, modulating total kernel number, modulating thousand kernel weight, or any combination thereof.

[0045] In certain embodiments, the modulating nitrogen use efficiency of the plant comprises modulating one or more aspects selected from:

[0046] (1) modulating canopy nitrate content of the plant; (2) modulating canopy biomass of the plant; (3) modulating nitrogen content of the plant (e.g., stem nitrogen content, leaf nitrogen content, grain nitrogen content); (4) modulating yield per plant.

[0047] In certain embodiments, modulating nitrogen use efficiency of the plant comprises increasing nitrogen use efficiency of the plant.

[0048] In this context, "increased nitrogen use efficiency" means that a transgenic plant comprising a nucleic acid molecule of the first aspect and / or the second aspect described above takes up an increased amount of nitrogen from the environment compared to a plant that does not contain the nucleic acid molecule of the first aspect and / or the second aspect described above. In certain embodiments, the amount of nitrogen taken up from the environment can be increased by about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200%, or more.

[0049] Polypeptide

[0050] In a third aspect, the present application provides a polypeptide obtained by transcription and / or expression of the nucleic acid molecule of the first aspect or the second aspect.

[0051] In certain embodiments, the polypeptide has the amino acid sequence set forth in SEQ ID NO: 2, or the polypeptide has an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence set forth in SEQ ID NO: 2.

[0052] In certain embodiments, the amino acid sequence set forth in SEQ ID NO: 2 and sequences identical thereto are sequences of Zea mays.

[0053] Nucleic acid construct

[0054] In a fourth aspect, the present application provides a nucleic acid construct comprising the nucleic acid molecule of the first aspect or the second aspect.

[0055] In this context, the nucleic acid construct refers to a DNA construct capable of expressing a protein from an open reading frame in a plant cell. In certain embodiments, the nucleic acid construct comprises, in the 5' to 3' transcription direction, a transcription initiation region (i.e., a promoter) operably linked to the nucleotide sequence of the nucleic acid molecule of the present application, and a transcription and translation termination region (i.e., a terminator) functional in plants.

[0056] Thus, in certain embodiments, the nucleic acid construct further comprises a regulatory element operably linked to the nucleotide sequence encoding the polypeptide. In certain embodiments, the regulatory element is capable of regulating the expression of the polypeptide (e.g., whether to express, the amount of expression).

[0057] In certain embodiments, the regulatory element is selected from a 5' UTR, a 3' UTR, a terminator, or any combination thereof.

[0058] In certain embodiments, the nucleic acid construct comprises a nucleotide sequence encoding the polypeptide, and a terminator operably linked to the polypeptide.

[0059] Other elements of the nucleic acid construct

[0060] In certain embodiments, the nucleic acid construct can further comprise one or more other genes, for example, a selectable marker gene (e.g., a herbicide gene, an antibiotic resistance gene).

[0061] In certain embodiments, the nucleic acid construct can further comprise 5' and 3' untranslated regions (i.e., 5' UTR and 3' UTR). In this context, "3' untranslated region" refers to a nucleotide sequence located downstream of a coding sequence. In this context, "5' untranslated region" refers to a nucleotide sequence located upstream of a coding sequence.

[0062] In certain embodiments, the nucleic acid construct can further comprise a "signal sequence" or "leader sequence" to facilitate co- or post-translational transport of the polypeptide to certain intracellular structures such as chloroplasts (or other plastids), endoplasmic reticulum, or Golgi apparatus or for secretion. A "signal sequence" refers to a sequence known or suspected to cause co- or post-translational peptide transport across a cellular membrane. A "leader sequence" refers to a sequence that, when translated, results in an amino acid sequence sufficient to trigger co-translational transport of the peptide chain to a subcellular organelle. Thus, it includes leader sequences that target transport and / or glycosylation by entry into the endoplasmic reticulum, entry into vacuoles, plastids including chloroplasts, mitochondria, and the like.

[0063] In certain embodiments, the nucleic acid construct can further comprise a terminator. In certain embodiments, the terminator can be obtained from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase terminator regions, or the potato proteinase inhibitor II sequence (Pin II), as described in Liu et al. (2004) Acta Biochim Biophys Sin 36(8):553-558. See also Guerineau et al. (1991) MoI. Gen. Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987) Nucleic Acid Res. 15:9627-9639.

[0064] Recombinant vectors

[0065] In a fifth aspect, the present application provides a recombinant vector comprising the nucleic acid molecule of the first or second aspect or the nucleic acid construct of the fourth aspect. In certain embodiments, the nucleotide sequence of the nucleic acid molecule of the present application can be modified to obtain or enhance expression in a plant cell.

[0066] Host cell

[0067] In a sixth aspect, the present application provides a host cell comprising the nucleic acid molecule of the first or second aspect, or comprising the polypeptide of the third aspect, or comprising the nucleic acid construct of the fourth aspect, or comprising the recombinant vector of the fifth aspect.

[0068] As is known to those skilled in the art, there is degeneracy in the code. That is, during translation of a protein, each amino acid can correspond to one or more codons, for example, up to six codons. Different species vary greatly in their use of degenerate codons to encode a given amino acid, with different preferences. This phenomenon of preference is known as "codon bias". Thus, where appropriate, the nucleotide sequence of a nucleic acid molecule can be codon-optimized for increased expression in a host cell, according to the codon bias of the host cell. Methods for codon optimization according to a host cell can be found, for example, in Campbell and Gowri (1990) Plant Physiol. 92: 1-11. Alternatively, codon optimization can be found, for example, in U.S. Pat. Nos. 6,320,100, 6,075,185, 5,380,831, and 5,436,391, U.S. Published Applications Nos. 20040005600 and 20010003849, and Murray et al. (1989) Nucleic Acids Res. 17: 477-498.

[0069] Plant or part, seed, cell, or progeny thereof

[0070] In a seventh aspect, the present application provides a genetically modified plant or part, seed, cell, or progeny thereof, comprising the nucleic acid molecule of the first or second aspect, or comprising the nucleic acid construct of the fourth aspect, or comprising the recombinant vector of the fifth aspect.

[0071] In certain embodiments, the plant is selected from the group consisting of maize, rice, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, and sugarcane.

[0072] Use in breeding methods

[0073] The plants or parts thereof, seeds, cells, or progeny of the invention can be used in plant breeding programs. The goal of plant breeding is to combine various desirable traits in a single variety or hybrid. For field crops, these traits can include, for example, resistance to disease and insects, tolerance to heat and drought, reduced time to crop maturity, higher yield, and better agronomic quality. Traditional plant breeding is an important tool in the development of new and improved commercial crop plants. The invention encompasses methods of producing progeny plants by crossing a transgenic plant of a first parent with a plant of a second parent.

[0074] Plant breeding techniques used in plant breeding programs are well known in the art and include, but are not limited to, recurrent selection, bulk selection, mass selection, backcross, pedigree breeding, free pollination breeding, restriction fragment length polymorphism enhanced selection, genetic marker enhanced selection, double haploids, and transformation.

[0075] Use

[0076] In an eighth aspect, the invention provides use of a nucleic acid molecule of the first or second aspect, or a polypeptide of the third aspect, or a nucleic acid construct of the fourth aspect, or a recombinant vector of the fifth aspect, in modulating nitrogen use efficiency, nitrate uptake or transport, biomass, and / or yield in a plant.

[0077] In certain embodiments, the nitrogen is nitrogen from nitrate nitrogen, nitrogen from ammonium nitrogen, nitrogen from amide nitrogen, or any combination thereof.

[0078] In certain embodiments, the nitrogen comprises: nitrate or a substance capable of forming nitrate, and urea.

[0079] In certain embodiments, the modulating is modulating under low nitrogen conditions or under high nitrogen conditions.

[0080] In certain embodiments, the low nitrogen conditions are nitrogen fertilizer application amount of nitrogen-containing substance less than 200 kg / ha (e.g., less than 180 kg / ha, less than 150 kg / ha, less than 120 kg / ha, less than 100 kg / ha, less than 80 kg / ha, less than 50 kg / ha, less than 20 kg / ha).

[0081] In certain embodiments, the high nitrogen conditions are nitrogen fertilizer application amount of nitrogen-containing substance greater than or equal to 200 kg / ha (e.g., greater than or equal to 220 kg / ha, greater than or equal to 250 kg / ha, greater than or equal to 280 kg / ha, greater than or equal to 300 kg / ha, greater than or equal to 320 kg / ha, greater than or equal to 350 kg / ha, greater than or equal to 400 kg / ha).

[0082] In certain embodiments, the modulating biomass is selected from modulating plant shoot height, modulating shoot weight, modulating root weight, or any combination thereof.

[0083] In certain embodiments, the modulating yield is modulating grain weight, modulating seed set, modulating total kernel number, modulating thousand kernel weight, or any combination thereof.

[0084] In certain embodiments, the modulating nitrogen use efficiency of the plant comprises modulating one or more aspects selected from:

[0085] (1) modulating canopy nitrate content of the plant; (2) modulating canopy biomass of the plant; (3) modulating nitrogen content of the plant (e.g., stem nitrogen content, leaf nitrogen content, grain nitrogen content); (4) modulating yield per plant.

[0086] Methods

[0087] As used herein, "transformation" refers to the introduction of a nucleic acid molecule or a recombinant vector into the interior of a plant cell. Methods for introducing nucleic acid molecules or recombinant vectors into plants are known in the art, including but not limited to stable transformation methods, transient transformation methods, and virus-mediated methods.

[0088] Typically, plant transformation methods involve the transfer of heterologous DNA (e.g., a nucleic acid molecule or a recombinant vector) into target plant cells (e.g., immature or mature embryos, suspension cultures, undifferentiated callus, protoplasts, etc.) followed by recovery of the transformed plant cells from the untransformed group of cells by selection (depending on the selection marker gene). For example, explants are transferred to fresh identical medium for routine culture. Subsequently, transformed cells are differentiated into shoots after being placed on regeneration medium supplemented with a selective agent (e.g., an antibiotic such as spectinomycin and kanamycin). Shoots are then transferred to selective rooting medium to recover rooted shoots or plantlets. The transgenic plantlets are then grown into mature plants and produce fertile seeds (as described in Hiei et al. (1994) The Plant Journal 6: 271-282; Ishida et al. (1996) Nature Biotechnology 14: 745-750). Explants are transferred to fresh supplies of the same medium and cultured routinely. General descriptions of techniques and methods for producing transgenic plants are described in Ayres and Park (1994) Critical Reviews in Plant Science 13: 219-239 and Bommineni and Jauhar (1997) Maydica 42: 107-120.

[0089] Production of transgenic plants can be performed by a number of methods including, but not limited to, introduction of heterologous DNA into plant cells by Agrobacterium (Agrobacterium-mediated transformation), particle gun bombardment of plant cells with heterologous foreign DNA attached to particles, and various other non-particle direct-mediated methods of DNA transfer (e.g., as described by Hiei et al. (1994) The Plant Journal 6:271-282; Ishida et al. (1996) Nature Biotechnology 14:745-750; Ayres and Park (1994) Critical Reviews in Plant Science 13:219-239; Bommineni and Jauhar (1997) Maydica 42:107-120).

[0090] Accordingly, in a ninth aspect, the present application provides a method of making a transgenic plant, part, seed, cell or progeny thereof, the method comprising:

[0091] (i) transforming a plant cell with the nucleic acid molecule of the first or second aspect or the nucleic acid construct of the fourth aspect, or the recombinant vector of the fifth aspect;

[0092] (ii) developing or regenerating a plant from the plant cell.

[0093] In certain embodiments, the plant is selected from the group consisting of maize, rice, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, and sugarcane.

[0094] In certain embodiments, the method further comprises:

[0095] (iii) self-fertilizing or crossing the plant of (ii) with a second plant, respectively, to produce seed of the transgenic plant.

[0096] In certain embodiments, the seed of the transgenic plant comprises genomic DNA of the transgenic plant.

[0097] In certain embodiments, the second plant is selected from the group consisting of maize, rice, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, and sugarcane.

[0098] In certain embodiments, the plant is maize and the second plant is also maize.

[0099] In certain embodiments, the plant of (ii) is crossed as a male with a second plant as a female to produce seed of the transgenic plant.

[0100] In a tenth aspect, the present application provides a method of modulating nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield in a plant, the method comprising: increasing the expression level of the polypeptide of the third aspect in the plant; or, externally applying (e.g., spraying, smearing) the polypeptide of the third aspect to the plant.

[0101] In certain embodiments, the method is achieved by the steps of:

[0102] (a) transforming a plant cell with the nucleic acid molecule of the first or second aspect or the nucleic acid construct of the fourth aspect or the recombinant vector of the fifth aspect;

[0103] (b) expressing the nucleic acid molecule in the plant cell;

[0104] (c) developing or regenerating a plant from the plant cell.

[0105] Optionally, the method further comprises:

[0106] (d) selecting a plant from the plant of step (c) that has increased nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield as compared to a wild-type plant grown under the same conditions.

[0107] In certain embodiments, the plant is selected from the group consisting of corn, rice, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, and sugarcane.

[0108] In certain embodiments, the nitrogen use efficiency, biomass or yield is as defined before or has a characteristic as defined before.

[0109] Article of manufacture

[0110] In an eleventh aspect, the present application provides an article of manufacture comprising the plant or a part, seed, cell or progeny thereof of the seventh aspect.

[0111] In certain embodiments, the article of manufacture comprises genomic DNA of the plant or a part, seed, cell or progeny thereof.

[0112] In certain embodiments, the article of manufacture is selected from one or more of the group consisting of corn ear, corn on the cob, corn silk, corn pollen, corn grits, corn flour, crushed corn, corn meal, corn oil, corn starch, corn syrup, corn malt, corn sugar, corn syrup, margarine made from corn oil, unsaturated corn oil, saturated corn oil, corn flakes, popcorn, ethanol and / or liquor produced from corn, dried distillers grains with solubles (DDGS) produced from corn fermentation, animal feed from corn, cosmetics, and fillers.

[0113] In another aspect, the present application also provides a method of producing the product, comprising obtaining the corn plant or part, seed, cell or progeny thereof of the seventh aspect of the present application and producing the product of the third aspect of the present application therefrom. In certain embodiments, the corn plant or part, seed, cell or progeny thereof is obtained by the method of the ninth aspect or the tenth aspect of the present application.

[0114] In certain embodiments, the part of the corn plant of any of the preceding aspects is selected from the group consisting of kernels, pollen, ovules, flowers, shoots, roots, stalks, silk, tassels, ears and leaves.

[0115] The present application also relates to the use of the corn plant or part, seed, cell or progeny thereof of any of the preceding aspects for the production of food, agricultural products (e.g. feed), cosmetics, pharmaceuticals or industrial products.

[0116] In certain embodiments, the corn plant or part, seed, cell or progeny thereof is used for the production of food, feed, starch or for the production of alcoholic beverages.

[0117] In certain embodiments, the part of the corn plant is selected from the group consisting of kernels, pollen, ovules, flowers, shoots, roots, stalks, silk, tassels, ears and leaves.

[0118] In certain embodiments, the corn plant or part, seed, cell or progeny thereof is used for the production of a product selected from the group consisting of corn ears, corn on the cob, corn silk, corn pollen, corn grits, corn flour, crushed corn, corn meal, corn oil, corn starch, corn syrup, corn malt, corn sugar, corn syrup, margarine produced from corn oil, unsaturated corn oil, saturated corn oil, corn flakes, popcorn, ethanol and / or liquor produced from corn, dried distillers grains with solubles (DDGS) produced from corn fermentation, animal feed from corn, cosmetics and fillers.

[0119] Definitions of terms

[0120] In the present application, unless otherwise indicated, the scientific and technical terms used herein have the meanings that would be generally understood by one of ordinary skill in the art. Also, the techniques used in cell culture, molecular biology, biochemistry, nucleic acid chemistry, immunology, and other related fields are those known to those of ordinary skill in the art. In order to better understand the present application, the following definitions and explanations of related terms are provided.

[0121] As used herein, the term "modulating nitrogen use efficiency" means that there is a measurable change in any nitrogen metabolism-related indicator of the nitrogen assimilation pathway (e.g., nitrate, nitrite, ammonia, glutamate, aspartate, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of plant parts, total nitrogen content of plant parts, and / or chlorophyll content), or that the plant has the same or improved yield at a lower level of applied nitrogen fertilizer, or that the plant has improved yield at the same level of applied nitrogen fertilizer when compared to a plant that has not been transformed with a nitrogen-regulating nucleic acid molecule or recombinant vector of the present application. The "measurable change" includes an increase or decrease in the amount of any nitrogen metabolism-related indicator of the nitrogen assimilation pathway.

[0122] Methods for measuring or assessing nitrogen use efficiency have been reported in the prior art. See, for example, Craswell, E. T. and Godwin, D. C. (1984) The efficiency of nitrogen fertilizers applied to cereals grown in different climates. In Advances in Plant Nutrition (Vol. 1) (Tinker, P. B. and Lauchli, A., eds), pp. 1-55, Praeger Publishers; or see, for example, Steenbjerg, F. and Jakobsen, S. T. (1963) Plant nutrition and yield curves. Soil Sci. 95, 69-90; or see, for example, Siddiqi, M. Y. and Glass, D. M. (1981) Utilization index: a modified approach to the estimation and comparison of nutrient utilization efficiency in plants. J. Plant Nutr. 4, 289-302; or see, for example, Moll, R. H. et al. (1982) Analysis and interpretation of factors which contribute to efficiency of nitrogen utilization. Agron. J. 74, 562-564.

[0123] As used herein, the term "identity" is used in reference to the match between two polypeptide sequences or between two nucleic acid sequences. To determine the percent identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., percent identity = # of identical positions / total # of positions x 100%). In certain embodiments, the two sequences are the same length.

[0124] Determination of percent identity between two sequences can also be accomplished using a mathematical algorithm. One non-limiting example of a mathematical algorithm that is used for the comparison of two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. U.S.A. 87:2264-2268, modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. U.S.A. 90:5873-5877. Such an algorithm is incorporated in the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. Biol. 215:403.

[0125] As used herein, the term "recombinant vector" refers to a nucleic acid vehicle into which a polynucleotide can be inserted. When the vector is capable of mediating expression of the inserted polynucleotide encoded protein, the vector is referred to as an expression vector. The vector can be introduced into a host cell by transformation, transduction or transfection, such that the genetic material elements carried by the vector are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1 -derived artificial chromosomes (PAC); bacteriophages, such as lambda phage or M13 phage, and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, papova viruses (such as SV40). A vector can contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements and reporter genes. In addition, a vector can contain a replication origin.

[0126] As used herein, the term "plant" includes an explant, plant part, plantlet, seedling, or whole plant at any stage of regeneration or development. The term "plant part" refers to any organ or intact tissue of a plant, such as a root, a shoot structure (e.g., stem, leaf), a flower (e.g., pollen, ovule, ear, inflorescence, calyx, petal, stamen, carpel, anther), a fruit, a seed (e.g., embryo, endosperm, seed coat), a protective tissue, a conducting tissue, a nutritive tissue, a mechanical tissue, a meristem, a propagule. The term "propagule" includes any plant part capable of growing into a whole plant.

[0127] As used herein, the term "maize" refers to Zea mays or corn and includes all plant varieties that can be bred with maize, including wild Zea species.

[0128] As used herein, the term "crown" is the portion of the plant that is located on the flower stalk or branch at the top of the main stem. Typically, the crown is at the upper part of the plant and serves a protective function. The crown is the main site of photosynthesis in a plant, capable of absorbing solar energy and using the solar energy to synthesize organic matter. In addition, the crown can attract insect pollinators, facilitating the reproduction of the plant. The shape and size of the crown varies among plant species, with some plants having a round or flat crown and some having a conical or tower shape. The color of the crown also varies among plant species, including green, red, yellow, white, and the like.

[0129] As used herein, the term "gene" refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term includes double- and single-stranded DNA and RNA. It also includes known types of modifications, for instance, methylation, "capping," substitution of one or more of the naturally occurring nucleotides with an analog. Preferably, a gene contains coding sequences encoding a polypeptide. A "coding sequence" is a nucleotide sequence, which when transcribed into mRNA and translated into a polypeptide, or when expressed in a plant, results in the production of a gene product, e.g., a polypeptide. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3'-terminus. A coding sequence can include, but is not limited to, mRNA, cDNA, recombinant nucleic acid sequences, or genomic DNA, and in some instances can include introns.

[0130] As used herein, the term "plant genome" refers to the nuclear genome, the mitochondrial genome, or the plastid (e.g., chloroplast) genome of a plant cell.

[0131] As used herein, the term "nucleic acid" can be any polymer comprising deoxyribonucleotides or ribonucleotides, including but not limited to, modified or unmodified DNA, RNA, which is not limited in length. For nucleic acids used in the construction of recombinant constructs, it is preferred that the nucleic acid be DNA, as DNA is more stable and easier to manipulate than RNA.

[0132] As used herein, the term "transformation" is the process of introducing heterologous nucleic acids (e.g., nucleic acid constructs, vectors, expression cassettes, etc.) into host cells or organisms. Specifically, "transformation" refers to the transient conversion of DNA molecules into an organism, or their stable conversion or integration into the genome of an organism, or their ability to replicate autonomously. Transformation techniques for plants and plant cells are well known in the art and may include, for example, electroporation, microinjection, Agrobacterium-mediated transformation, and ballistic transformation.

[0133] As used herein, the terms "transformed / genetically modified / recombinant" refer to a host organism, such as bacteria or plants, into which a heterologous nucleic acid molecule has been introduced. This nucleic acid molecule can be stably integrated into the host's genome or can exist as an extrachromosomal molecule. Such extrachromosomal molecules can replicate spontaneously. Transformed cells, tissues, or plants should be understood to include not only the final products of the transformation process but also their transgenic progeny. "Non-transformed," "non-genetically modified," or "non-recombinant" hosts refer to wild-type or naturally occurring organisms, such as bacteria or plants.

[0134] As used herein, the term "operably linked" refers to a functional connection between a promoter or other regulatory element and an associated transcribed DNA sequence or coding sequence of a gene (or transgene), such that the promoter or the like plays a role or function in initiating, assisting, influencing, causing, and / or promoting the transcription and expression of the associated transcribed DNA sequence or coding sequence, at least in one or more cellular, tissue, developmental stages, and / or conditions. Two transcribed DNA sequences may also be "operably linked" to each other if the transcription of two transcribed DNA sequences is controlled by a common promoter or other regulatory element.

[0135] As used in this article, the term "promoter" refers to a nucleic acid sequence that guides the transcription of downstream coding sequences.

[0136] As used herein, the term "backcross" refers to a method by which progeny plants are repeatedly backcrossed with one of their parents. In a backcross scheme, the "donor" parent is a parental plant that possesses the desired gene or locus to be introgressed. The "recipient" parent (used once or multiple times) or "recurrent" parent (used twice or more) is a parental plant in which the gene or locus is introgressed.

[0137] As used in this article, the term "hybridization" refers to the fusion of gametes through pollination to produce offspring (e.g., cells, seeds, or plants).

[0138] As used herein, the term "overexpression" refers to a higher level of expression of a gene in a plant, plant cell, or plant tissue as compared to the expression in a wild-type plant, cell, or tissue. Overexpression can occur throughout the plant, or in a particular tissue of the plant, or in the presence or absence of a particular environmental signal. In certain embodiments, the overexpression can occur at the transcriptional level, the translational level, or both, possibly due to altered regulatory control (e.g., a strong promoter) or increased copy number, or both.

[0139] As used herein, the terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues.

[0140] As used herein, the term "complementary" means that two nucleic acid sequences are capable of forming hydrogen bonds between each other according to the principles of base-pairing (Watson-Crick complementarity) and thereby form a duplex. In the present application, the term "complementary" includes "substantially complementary" and "perfectly complementary". As used herein, the term "perfectly complementary" means that every base in one nucleic acid sequence is capable of base pairing with a base in the other nucleic acid sequence without the presence of mismatches or gaps. As used herein, the term "substantially complementary" means that a substantial number of bases in one nucleic acid sequence are capable of base pairing with a base in the other nucleic acid sequence, which allows for the presence of mismatches or gaps (e.g., one or several nucleotide mismatches or gaps). Typically, two nucleic acid sequences that are "complementary" (e.g., substantially complementary or perfectly complementary) will selectively / specifically hybridize or anneal and form a duplex under conditions that allow nucleic acid hybridization, annealing, or amplification. Accordingly, the term "non-complementary" means that two nucleic acid sequences are incapable of hybridizing or annealing and forming a duplex under conditions that allow nucleic acid hybridization, annealing, or amplification. As used herein, the term "not perfectly complementary" means that bases in one nucleic acid sequence are not capable of perfect base pairing with a base in the other nucleic acid sequence, at least one mismatch or gap is present.

[0141] As used herein, the terms "hybridization" and "annealing" mean the process in which complementary single-stranded nucleic acid molecules form double-stranded nucleic acid. In the present application, "hybridization" and "annealing" have the same meaning and are used interchangeably. Typically, two nucleic acid sequences that are perfectly complementary or substantially complementary can hybridize or anneal. The degree of complementarity required for two nucleic acid sequences to hybridize or anneal depends on the hybridization conditions, particularly the temperature, used.

[0142] As used herein, "conditions permitting nucleic acid hybridization" has the meaning generally understood by those skilled in the art and can be determined by routine methods. For example, two nucleic acid molecules having complementary sequences can hybridize under suitable hybridization conditions. Such hybridization conditions can involve factors such as temperature, pH value, ingredients and ionic strength of the hybridization buffer, etc., and can be determined according to the length and GC content of the two complementary nucleic acid molecules. For example, when the length of the two complementary nucleic acid molecules is relatively short and / or the GC content is relatively low, low stringent hybridization conditions can be employed. When the length of the two complementary nucleic acid molecules is relatively long and / or the GC content is relatively high, high stringent hybridization conditions can be employed. Such hybridization conditions are well known to those skilled in the art, and can be found in, for example, Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); and M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y. (1999). In the present application, "hybridization" and "annealing" have the same meaning and can be used interchangeably. Accordingly, the expressions "conditions permitting nucleic acid hybridization" and "conditions permitting nucleic acid annealing" also have the same meaning and can be used interchangeably.

[0143] Advantages of the Invention

[0144] The present inventors have found, through extensive research, a key gene for regulating nitrogen use efficiency in maize, further obtained a method for regulating nitrogen use efficiency in maize by overexpressing the gene, and a maize plant capable of efficiently using nitrogen obtained by the method. Further, the inventors have also confirmed through experiments that the maize plant overexpressing the key gene also improves nitrate uptake or transport capacity, and improves biomass and / or yield.

[0145] Therefore, the above-mentioned key gene and the maize plant overexpressing the key gene can improve the utilization rate of nitrogen fertilizer in maize, thereby reducing the application amount of nitrogen fertilizer, which is conducive to the sustainable development of the environment. Moreover, the gene, method or plant can be used for improving maize inbred lines, or for breeding new maize varieties that can efficiently use nitrogen.

[0146] Embodiments of the present application will be described in detail below with reference to the attached drawings and examples, but those skilled in the art will understand that the following drawings and examples are only used to illustrate the present application, and are not a limitation on the scope of the present application. According to the following detailed description of the drawings and preferred embodiments, various objects and advantageous aspects of the present application will become apparent to those skilled in the art. BRIEF DESCRIPTION OF DRAWINGS

[0147] Figure 1 is a schematic diagram of the structure of the MNE1 gene.

[0148] Figure 2 is the identification of MNE1 overexpression materials and the detection of low nitrogen tolerance phenotype, wherein Figure 2A is the expression analysis result of overexpression of MNE1, and Figure 2B is the phenotype detection result of corn plants overexpressing MNE1 and wild type corn plants after high and low nitrogen treatment.

[0149] Figure 3 is the detection of nitrogen content in stems and leaves of MNE1 overexpression materials under different nitrogen conditions, wherein Figure 3A and Figure 3B are the nitrogen content detection results of leaves and stems of MNE1 overexpression inbred plants and wild type control inbred plants ND101, respectively; Figure 3C and Figure 3D are the nitrogen content detection results of leaves and stems of MNE1 overexpression hybrid plants and control hybrid plants (hybrid of ND101 and T13).

[0150] Figure 4 is the single ear weight trait of MNE1 overexpression materials in inbred and hybrid under different nitrogen treatments, wherein Figure 4A is the single ear weight result of MNE1 overexpression inbred plants and control plants, and Figure 4B is the single ear weight result of MNE1 overexpression hybrid plants and control plants.

[0151] Figure 5 is a comparison of the different regions of the MNE1 gene promoter in inbred CIMBL55 and Mo17.

[0152] Figure 6 is the NIL Mo1 and NIL CIMBL55 phenotype, xylem bleeding sap nitrate content and biomass comparison under different nitrogen treatments, wherein Figure 6A is the phenotype comparison of NIL Mo1 and NIL CIMBL55 under low / high nitrogen conditions; Figure 6B is the xylem bleeding sap nitrate content comparison of the two genotypes under low / high nitrogen conditions; Figure 6C is the biomass comparison of the two genotypes under low / high nitrogen conditions.

[0153] SEQUENCE INFORMATION

[0154] The description of the sequences involved in the present application is provided in the following table.

[0155] Table 1: Sequence Information DETAILED DESCRIPTION

[0156] The present application will now be described in the following non-limiting Examples.

[0157] It is known to those skilled in the art that the examples describe the present application by way of example only, and are not intended to limit the scope of the application as claimed. The experimental methods in the examples are conventional methods unless specifically stated otherwise. Where specific conditions are not specified in the examples, they are carried out under conventional conditions or under conditions recommended by the manufacturer. Where the manufacturer of the reagent or instrument used is not specified, it is a conventional product that can be obtained commercially.

[0158] Example 1: Identification and phenotype analysis of MNE1 overexpression material

[0159] The inventors of the present application found a gene that can improve the nitrogen utilization efficiency of corn in previous studies, and named it MNE1 (maize nitrogen efficiency 1). The amino acid sequence of MNE1 protein is shown as SEQ ID No: 2, the nucleotide sequence encoding the protein is shown as SEQ ID No: 1, and the structure of MNE1 gene is shown in Figure 1. The gene encodes a MYB-type transcription factor. Studies have found that the homologous gene in Arabidopsis thaliana is involved in the regulation of potassium and nitrate ion co-transport.

[0160] Overexpression of MNE1

[0161] The CDS (SEQ ID No: 3) of the MNE1 gene driven by the Ubiquitin promoter (SEQ ID No: 4) was used to transform wild-type material, and the pBCXUN expression vector (Qin YJ, Wu WH, Wang Y. ZmHAK5 and ZmHAK1 function in K+ uptake and distribution in maize under low K+ conditions. J Integr Plant Biol. 2019 Jun; 61(6): 691-705. doi: 10.1111 / jipb.12756. Epub 2019 Feb 1. PMID: 30548401) preserved in the laboratory was used to construct the overexpression material of the corn MNE1 gene:

[0162] The corn B73 leaf is taken to extract RNA, and the obtained RNA is used as a template to obtain cDNA. The obtained cDNA is used as a template, and primers F: 5'-ATGGTGACAGTGAGAGAGGAGACT-3' and R: 5'-TTAGTAATCAGACCCAATATATATGGT-3' are used for PCR amplification to obtain a PCR amplification product, and the PCR amplification product is sequenced. The sequencing results show that the PCR product contains the CDS sequence of the MNE1 gene. The amplified PCR amplification product is recovered and purified to obtain a recovered and purified product. The recovered and purified product is inserted into the XcmI enzyme cutting site of the expression vector pBCXUN by TA cloning to obtain a recombinant expression vector pBCXUN-MNE1, and XcmI enzyme cutting can form two T tails. The recombinant expression vector pBCXUN-MNE1 is transformed into the competent cells of Agrobacterium EHA105, which is cultured at 28°C on YEP medium (containing kanamycin 50 mg / L) for two days, and positive clones are selected. Primers F: 5'-ATGGTGACAGTGAGAGAGGAGACT-3' and R: 5'-TTAGTAATCAGACCCAATATATATGGT-3' are used for PCR identification (the product size is 753 bp). The positive bacteria liquid obtained by PCR identification is named as recombinant Agrobacterium EHA105 / pBCXUN / MNE1, and is stored at -80°C. The recombinant Agrobacterium EHA105 / pBCXUN / MNE1 is transformed into the corn inbred material ND101 to obtain a T0 generation MNE1 transgenic overexpression corn material, and a positive plant is detected by using a PCR amplification method (primers Bar-F: GAAGGCACGCAACGCCTACGA, Bar-R: CCAGAAACCCACGTCATGCCA, and the target fragment is about 262 bp) of a selection marker Bar gene; the T1 generation MNE1 transgenic overexpression corn material obtained from the T0 generation MNE1 transgenic overexpression corn material is planted and identified, and until the T3 generation MNE1 transgenic overexpression corn material MNE1 OE seed is obtained.

[0163] Three overexpression strains are obtained, which are named as MNE1 OE-1, MNE1 OE-2 and MNE1 OE-3 respectively. Uniform size and full grain corn seeds are selected, and then sterilized with 10% H2O2 for 20 min. Then, the seeds are washed with deionized water and germinated at 25°C. After germination, the seeds are sowed on a clean wet sand bed, and when the seedlings have one leaf and one heart, seedlings with consistent growth are selected for soil culture. The Hoggland nutrient solution formula is used, in which 4 mM Ca(NO3)2·4H2O is high nitrogen treatment, and 0.4 mM Ca(NO3)2·4H2O is low nitrogen treatment. The root RNA of the wild type and the overexpression material is extracted, and RT-qPCR is performed after reverse transcription.

[0164] The detection results found that the three overexpression strains all achieved overexpression to different degrees (Figure 2A). The high and low nitrogen phenotype detection of the overexpression materials showed that MNE1 overexpression exhibited delayed yellowing of old leaves compared with the wild type, indicating tolerance to low nitrogen (Figure 2B).

[0165] Example 2: Determination of nitrogen content in leaves and stems of MNE1 overexpression materials

[0166] Obtaining of MNE1 overexpression inbred materials: T3 generation MNE1 overexpression materials were obtained by selfing the corn MNE1 overexpression materials (MNE1 OE-1, MNE1 OE-2 and MNE1 OE-3) for three generations.

[0167] Obtaining of MNE1 overexpression hybrid materials: MNE1 overexpression hybrid materials were obtained by crossing the MNE1 overexpression materials (MNE1 OE-1, MNE1 OE-2 and MNE1 OE-3) with inbred T13 (from the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University).

[0168] The MNE1 overexpression inbred material strains and the wild type control corn inbred ND101, and the MNE1 overexpression hybrid materials and the control hybrid materials (hybrid of ND101 and T13) were planted in the Beijing Shangzhuang test station of China Agricultural University, the Sanya test station in Hainan and the Gongzhuling test station in Jilin, respectively, to determine the nitrogen content in leaves and stems.

[0169] 1. Planting conditions and treatments

[0170] The planting of corn materials in the field: row length 2.5 m, plant spacing 0.25 m, row spacing 0.5 m. The seeds were coated before planting, double-seed planting was implemented, and after germination, the seedlings were grown to 13 plants per row during V3. Three nitrogen gradients were set up in the three test stations, three replicates were set up for each nitrogen treatment, and each replicate included 65 single plants. The fertilization of the plots is as follows in Table 2.

[0171] Table 2: Fertilization scheme of different nitrogen treatments

[0172] The fertilization of different nitrogen treatments was achieved by using different concentrations of urea, and Stanley compound fertilizer was used as basal fertilizer in the early stage, and different concentrations of urea were applied as topdressing at the jointing stage.

[0173] 2. Determination of nitrogen content in leaves and stems

[0174] The nitrogen content of the leaves and stems of the silking stage ear leaves and stems were determined. After sampling, the material was dried at 80°C and ground into powder. 0.1 g of plant sample was weighed into a digestion tube (make sure to pour it into the bottom to prevent sticking to the tube wall), and the specific weight was recorded. A small funnel was placed on each digestion tube, 0.5 mL of distilled water was added, 1 g of catalyst (K2SO4: CuSO4 10:1) was added, and finally 5 mL of concentrated sulfuric acid was added with a pipette. The digestion furnace was heated to 200°C and kept for 30 min, then heated to 380°C and digested until the sample turned peacock green, and continued to keep for 30-60 min. After cooling, add deionized water to 50 mL. Take 1 mL of sample into a 1.5 mL centrifuge tube, centrifuge at 18000 rpm / min for 1 min. Transfer 200 μL of supernatant to a 5 mL centrifuge tube and add 3.80 mL of deionized water. After filtering the sample, it was measured by a flow analyzer.

[0175] The experimental results are shown in Figure 3. Under low nitrogen, both the MNE1 overexpression inbred material and the overexpression hybrid material had significantly higher nitrogen content in the leaves and stems than the control material.

[0176] Example 3: Yield trait detection of MNE1 overexpression inbred and hybrid materials

[0177] The MNE1 overexpression inbred material under different nitrogen treatments in the field was harvested, and the seed yield was found to be 120 kg ha -1 Under low nitrogen conditions, the single ear weight of the MNE1 overexpression inbred material was significantly higher than that of the control material (Figure 4A). Similarly, the single ear weight of the MNE1 overexpression hybrid material under low nitrogen was also significantly higher than that of the control material (Figure 4B). This indicates that MNE1 overexpression can increase the single ear yield of corn under low nitrogen. In production, the nitrogen utilization efficiency of corn can be improved by regulating the expression of MNE1.

[0178] Example 4: NIL CIMBL55 , NIL Mo17 Construction of near-isogenic lines (NIL) and determination of nitrate content

[0179] There was a significant difference in the MNE1 gene promoter region between the inbred variety CIMBL55 and Mo17 (Figure 5). The inbred corn CIMBL55 was used as the donor parent, and Mo17 was used as the recipient parent to construct near-isogenic lines. CIMBL55 was continuously backcrossed with Mo17 for 2 times, and then self-crossed for 10 generations to obtain BC2F 10 , and PCR polymorphic markers distributed on 10 chromosomes were used to identify the backcross progeny to obtain near-isogenic lines containing NILMo17. The NO 3- content of the near-isogenic lines NIL was determined and compared. The results showed that the near-isogenic lines NILMo17 Compared to NIL CIMBL55 , exhibited higher biomass and higher xylem bleeding sap nitrate content (Figures 6A-6C).

[0180] While the specific embodiments of the application have been described in detail, those skilled in the art will appreciate that various modifications and alterations to the details can be made within the scope of the application as disclosed in the teachings of all patents, applications, publications, tests, literature, and other materials referenced herein. The full scope of the application is set forth in the appended claims and any equivalents thereof.

[0181] All patents, applications, publications, test methods, literature, and other materials cited herein are hereby incorporated by reference.

Claims

1. A nucleic acid molecule comprising a sequence selected from the group consisting of: (1) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 2; (2) a nucleotide sequence encoding an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identity to the amino acid sequence set forth in SEQ ID NO: 2, which encodes a polypeptide having a function of regulating plant nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield; (3) a nucleotide sequence encoding an amino acid sequence obtained by substitution, deletion and / or addition of one or more amino acid residues in the amino acid sequence set forth in SEQ ID NO: 2, which encodes a polypeptide having a function of regulating plant nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield. 2.A nucleic acid molecule comprising a sequence selected from the group consisting of: (1) a nucleotide sequence set forth in SEQ ID NO: 1 or 3; (2) a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identity to the nucleotide sequence set forth in SEQ ID NO: 1 or 3, which encodes a polypeptide having a function of regulating plant nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield; (3) a nucleotide sequence capable of hybridizing to the sequence set forth in SEQ ID NO: 1 or 3 under conditions permitting nucleic acid hybridization. The nucleic acid molecule further comprises a promoter; Preferably, the promoter is operably linked to the 5' end of the sequence of any one of (1) to (3), and the promoter is capable of regulating the transcription and / or expression (e.g., whether to express, the amount of expression) of the sequence of any one of (1) to (3); Preferably, the promoter is selected from the group consisting of a constitutive promoter, an inducible promoter or a tissue-specific promoter; Preferably, the sequence of the promoter is a natural promoter sequence derived from an animal, a plant or a microorganism, or an artificially modified promoter sequence; Preferably, the artificially modified promoter sequence is obtained by gene editing; Preferably, the sequence of the promoter is a promoter sequence derived from a plant; 3. The nucleic acid molecule of claim 1 or 2, wherein, Preferably, the promoter has a sequence set forth in any one of SEQ ID NOs: 4 to 6. 4.The nucleic acid molecule of any one of claims 1 to 3, having one or more features selected from the group consisting of: (1) the nitrogen is nitrogen derived from nitrate nitrogen, nitrogen derived from ammonium nitrogen, nitrogen derived from amide nitrogen, or any combination thereof; (2) the nitrogen comprises: nitrate or a substance capable of forming nitrate, and urea; (3) the regulating biomass is selected from the group consisting of regulating the plant height of the aboveground part, regulating the weight of the aboveground part, regulating the weight of the underground part, or any combination thereof. ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ (4) the yield regulation is grain weight regulation, seed set regulation, total kernel number regulation, thousand kernel weight regulation, or any combination thereof; (5) the nitrogen use efficiency regulation of the plant comprises regulating one or more aspects selected from the group consisting of: (1) canopy nitrate content of the plant; (2) canopy biomass of the plant; (3) nitrogen content of the plant (e.g., stem nitrogen content, leaf nitrogen content, grain nitrogen content); (4) yield per plant of the plant.

5. A polypeptide obtained by transcription and / or expression of the nucleic acid molecule of any one of claims 1-4; Preferably, the polypeptide has the amino acid sequence set forth in SEQ ID NO: 2, or the polypeptide has an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence set forth in SEQ ID NO:

2.

6. A nucleic acid construct comprising the nucleic acid molecule of any one of claims 1-4; Preferably, the nucleic acid construct further comprises a regulatory element operably linked to the nucleotide sequence encoding the polypeptide; Preferably, the regulatory element is capable of regulating expression (e.g., whether expression, how much expression) of the polypeptide; Preferably, the regulatory element is selected from the group consisting of a 5’ UTR, a 3’ UTR, a terminator, or any combination thereof.

7. A recombinant vector comprising the nucleic acid molecule of any one of claims 1-4 or the nucleic acid construct of claim 5.

8. A host cell comprising the nucleic acid molecule of any one of claims 1-4, or comprising the polypeptide of claim 5, or comprising the nucleic acid construct of claim 6, or comprising the recombinant vector of claim 7.

9. A genetically modified plant or part, seed, cell, or progeny thereof comprising the nucleic acid molecule of any one of claims 1-4, or comprising the nucleic acid construct of claim 6, or comprising the recombinant vector of claim 7; Preferably, the plant is selected from the group consisting of maize, rice, soybean, sunflower, sorghum, oilseed rape, wheat, alfalfa, cotton, barley, millet, and sugarcane.

10. Use of the nucleic acid molecule of any one of claims 1-4 or the polypeptide of claim 5 or the nucleic acid construct of claim 6 or the recombinant vector of claim 7 in regulating nitrogen use efficiency, nitrate uptake or transport, biomass, and / or yield of a plant; Preferably, the nitrogen use efficiency, biomass, or yield is as defined in claim 4.

11. A method of making a transgenic plant or part, seed, cell, or progeny thereof, the method comprising: (i) transforming a plant cell with the nucleic acid molecule of any one of claims 1-4 or the nucleic acid construct of claim 6 or the recombinant vector of claim 7; (ii) developing or regenerating a plant from the plant cell; Preferably, the plant is selected from the group consisting of maize, rice, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, and sugarcane.

12. The method of claim 11, wherein, The method further comprises: (iii) selfing the plants of (ii) individually or crossing the plants of (ii) with a second plant to produce seeds of transgenic plants; Preferably, the seeds of transgenic plants comprise genomic DNA of the transgenic plants; Preferably, the second plant is selected from the group consisting of maize, rice, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, and sugarcane; Preferably, the plant is maize and the second plant is also maize; Preferably, the plants of (ii) are crossed as the male parent with the second plant as the female parent to produce seeds of transgenic plants.

13. A method of modulating nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield in a plant, the method comprising: increasing the expression level of the polypeptide of claim 5 in the plant in vivo; or, applying (e.g., spraying, smearing) the polypeptide of claim 5 to the plant outside the plant; Preferably, the method is achieved by the following steps: (a) transforming a plant cell with the nucleic acid molecule of any one of claims 1-4 or the nucleic acid construct of claim 6 or the recombinant vector of claim 7; (b) expressing the nucleic acid molecule in the plant cell; (c) developing or regenerating a plant from the plant cell; Optionally, the method further comprises: (d) selecting from the plants of step (c) plants that have increased nitrogen use efficiency, nitrate uptake or transport, biomass, and / or yield as compared to a wild-type plant grown under the same conditions; Preferably, the plant is selected from the group consisting of maize, rice, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, and sugarcane; Preferably, the nitrogen use efficiency, biomass, or yield is as defined in claim 4.

14. An article of manufacture comprising the plant or part, seed, cell, or progeny thereof of claim 9; Preferably, the article of manufacture comprises genomic DNA of the plant or part, seed, cell, or progeny thereof; Preferably, the article of manufacture is selected from one or more of the group consisting of corn ears, corn on the cob, corn husks, corn silk, corn pollen, corn grits, corn flour, crushed corn, corn meal, corn oil, corn starch, corn syrup, corn malt, corn sugar, corn syrup, margarine produced from corn oil, unsaturated corn oil, saturated corn oil, corn flakes, popcorn, ethanol and / or liquor produced from corn, dried distillers grains with solubles (DDGS) produced from corn fermentation, animal feed from corn, cosmetics, and fillers.

15. A method of modulating transcription and / or expression of the nucleic acid molecule of any one of claims 1-4, or the expression of the polypeptide of claim 4, comprising introducing a modification in the nucleic acid molecule of any one of claims 1-4, or a nucleic acid molecule encoding the polypeptide of claim 5; Preferably, the modification is in the promoter; Preferably, the modification comprises a deletion, substitution, insertion, inversion, duplication, or any combination thereof; Preferably, the modification is introduced by gene editing; Preferably, the plant is selected from the group consisting of maize, rice, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, and sugarcane; Preferably, the nitrogen use efficiency, biomass, or yield is as defined in claim 4.

14. An article of manufacture comprising the plant or part, seed, cell, or progeny thereof of claim 9; Preferably, the article of manufacture comprises genomic DNA of the plant or part, seed, cell, or progeny thereof; Preferably, the article of manufacture is selected from one or more of the group consisting of corn ears, corn on the cob, corn husks, corn silk, corn pollen, corn grits, corn flour, crushed corn, corn meal, corn oil, corn starch, corn syrup, corn malt, corn sugar, corn syrup, margarine produced from corn oil, unsaturated corn oil, saturated corn oil, corn flakes, popcorn, ethanol and / or liquor produced from corn, dried distillers grains with solubles (DDGS) produced from corn fermentation, animal feed from corn, cosmetics, and fillers.

15. A method of modulating transcription and / or expression of the nucleic acid molecule of any one of claims 1-4, or the expression of the polypeptide of claim 4, comprising introducing a modification in the nucleic acid molecule of any one of claims 1-4, or a nucleic acid molecule encoding the polypeptide of claim 5; Preferably, the modification is in the promoter; Preferably, the modification comprises a deletion, substitution, insertion, inversion, duplication, or any combination thereof; Preferably, the modification is introduced by gene editing; Preferably, the genome editing comprises the use of at least one site-specific nuclease, such as an RNA-guided nuclease (e.g. Cas nuclease), a zinc finger nuclease, a meganuclease, a TALE nuclease, a recombinase, a transposase, and any combination thereof; Preferably, the genome editing is selected from the group consisting of CRISPR / Cas, TALEN, ZFN, transposon technology, PASTE technology, PE technology, base editor, and any combination thereof; Preferably, the modification is capable of increasing or inhibiting the transcription and / or expression of the nucleic acid molecule of any one of claims 1-4, or the expression of the polypeptide of claim 5.

Images