Fused five-membered and six-membered heterocyclic compound, preparation method therefor and use thereof

By developing five- and six-membered heterocyclic compounds that target the HIF-2α pathway and combining them with proline hydroxylase inhibitors, the problems of insufficient selectivity and side effects of existing drugs have been solved, achieving effective treatment and prevention of HIF-2α-mediated diseases.

WO2026032251A1PCT designated stage Publication Date: 2026-02-12HUAYAO JIYUAN (SHENZHEN) PHARMACEUTICAL CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/112609
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-08
Filing Date
2025-08-05
Publication Date
2026-02-12

AI Technical Summary

Technical Problem

Existing HIF-2α-targeting drugs lack selectivity in treating chronic renal anemia and other HIF-2α-mediated diseases, leading to toxic side effects. Furthermore, existing therapies such as recombinant human erythropoietin and prolyl hydroxylase inhibitors carry the risk of cardiovascular side effects.

Method used

Develop a five-membered and six-membered heterocyclic compound that directly targets the HIF-2α pathway and regulates its protein expression, for use in the preparation of drugs to prevent and treat HIF-2α-mediated diseases, and for combination therapy with proline hydroxylase inhibitors.

Benefits of technology

It significantly enhances the transcriptional activity of HIF-2α, reduces iron absorption, alleviates symptoms of renal fibrosis and anemia, and reduces related disease symptoms, with better selectivity and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025112609_12022026_PF_FP_ABST
    Figure CN2025112609_12022026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the field of medicines and relates to a fused five-membered and six-membered heterocyclic compound, a preparation method therefor, and a use thereof in the field of pharmaceuticals. Specifically, the present invention provides a compound having a structure represented by formula (I), or a stereoisomer, a tautomer, a solvate, a metabolite, a pharmaceutically acceptable salt, or a prodrug thereof. The compound and a pharmaceutical composition thereof of the present invention can be used for preparing a medicament for treating HIF-2α-mediated related diseases, such as renal anemia, chronic kidney disease, chronic metabolic disease, neurodegenerative disease, infection, inflammatory disease, pulmonary edema, and acute respiratory distress syndrome.
Need to check novelty before this filing date? Find Prior Art

Description

A five-membered and six-membered heterocyclic compound and a preparation method and application thereof TECHNICAL FIELD

[0001] The present application belongs to the field of medicine, and relates to a five-membered and six-membered heterocyclic compound and a preparation method and application thereof in the field of pharmacy. Specifically, the compound of the present application has a structure shown in formula (I), or a stereoisomer, a tautomer, a solvate, a metabolite, a pharmaceutically acceptable salt or a prodrug thereof. The compound and a pharmaceutical composition thereof can be used for preparing a medicine for treating HIF-2 alpha-mediated related diseases, such as renal anemia, chronic kidney disease, chronic metabolic disease, neurodegenerative disease, infection, inflammatory disease, pulmonary edema and acute respiratory distress syndrome. BACKGROUND

[0002] In a low oxygen environment, the body can spontaneously occur in hypoxic response to maintain the body's oxygen acquisition ability. In 1992, Semenza et al. found that a protein can specifically bind to the hypoxic response element (HRE) of erythropoietin gene and affect the expression of certain genes, which is called hypoxia-inducible factor (HIF) (Semenza GL et al., Mol. Cell Biol., 1992, 12, 5447-5454). The target genes of HIF are very extensive, which can affect the body's hematopoietic function, angiogenesis, iron ion transport, glucose utilization, resistance to oxidative stress, cell differentiation, cell survival and apoptosis, extracellular matrix homeostasis and tumor occurrence. HIF is a heterodimer composed of α and β subunits, and the α subunit belongs to the functional subunit, which is very sensitive to changes in intracellular oxygen concentration and is highly regulated, and has the function of regulating HIF activity; the β subunit is a structural subunit, also known as aryl hydrocarbon receptor nuclear transporter (ARNT), which is stably expressed in cells, and the mRNA transcription and protein expression level is not affected by the change of oxygen concentration. Both α and β subunits of HIF belong to the basic helix-loop-helix transcription factor superfamily members. There are three subtypes of HIF-1α, HIF-2α and HIF-3α in humans. HIF-1α is widely distributed in the body and plays an important role in angiogenesis triggered by local tissue ischemia or hypoxia, but has less effect on iron metabolism; HIF-2α is distributed locally, which plays an important role in the process of EPO (erythropoietin) gene expression and synthesis in kidney tissue, in addition, it also improves iron absorption in the intestine by up-regulating the expression of cytochrome and divalent metal transporter-1 in the duodenum, and has the effect of reducing the expression of liver bactericidal peptide, and plays a leading role in iron metabolism; HIF-3α has a different structure from other subtypes, and cannot affect gene expression because it has no DNA binding region. Studies have shown that HIF-3α may have a negative regulatory effect on HIF-mediated gene expression. Therefore, HIF-1α and HIF-2α play a certain role in the hypoxic response process. In a HIF-1α and HIF-2α gene deletion mouse experiment, it is confirmed that HIF-1α and HIF-2α are necessary in the hypoxic response process. In the development of compounds for treating chronic renal anemia, the change of HIF-2α is more important than that of HIF-1α.

[0003] Both the HIF-2α subunit and the ARNT subunit belong to the Per-ARNT-Sim (PAS) subfamily within the basic helix-loop-helix (bHLH) family. The two subunits have similar structures, primarily consisting of an N-terminal bHLH (DNA Bonding Domain, DBD) and two adjacent PASA and PASB domains (Ligand Bonding Domain, LBD). The C-terminus binds to transcriptional cofactors, regulating the transcription of downstream genes. Studies have found that the PASB domain of the HIF-2α subunit contains approximately [missing information - likely a specific structure or feature]. The cavity of HIF-2α, when combined with regulators, can influence the heterodimerization of the HIF-2α and ARNT subunits, thereby blocking or activating DNA binding and the transcription of target genes. Downstream target genes of HIF-2α include vascular endothelial growth factor (VEGF), erythropoietin (EPO), cyclin 1, and glucose transporter 1 (GLUT1), which are associated with chronic kidney disease, renal anemia, cardiovascular disease, infection, and cancer.

[0004] Kidney tissue damage in patients with chronic kidney disease (CKD) leads to EPO deficiency and insufficient iron homeostasis, resulting in renal anemia. Renal anemia not only severely reduces patients' quality of life but is also a significant factor contributing to increased cardiovascular disease incidence and mortality. Recombinant human erythropoietin (rHuEPO) or erythropoiesis-stimulating agents (ESAs) can treat renal anemia by increasing hemoglobin levels. However, higher hemoglobin targets in clinical trials are positively correlated with the risk of cardiovascular side effects. Currently, an emerging therapy for renal anemia involves pharmacologically inhibiting prolyl hydroxylase (PHD) to stabilize HIF-2 protein, thereby stimulating the production of endogenous EPO in the kidney or non-renal tissues. However, these drugs lack selectivity and can increase HIF-1α and HIF-3α protein levels, thus posing certain toxic side effects.

[0005] HIF-2α plays a crucial role in maintaining iron homeostasis in organisms by directly regulating the transcription of genes encoding divalent metallotransferase 1 (DMT1, the intestinal iron transporter): activation of HIF-2α may allow iron mobilization, while its inhibition promotes reduced iron absorption. Therefore, directly targeting the HIF-2 pathway to promote HIF-2α protein expression has potential value in the treatment of renal anemia. Studies have also found that HIF-2α may be a potential therapeutic target for emphysema, immunodeficiency diseases, chronic metabolic diseases, and neurodegenerative diseases.

[0006] HIF-2a protein, including but not limited to: renal anemia, primary anemia, and anemia associated with tumor diseases (particularly chemotherapy-induced anemia), anemia due to blood loss, iron deficiency anemia, vitamin deficiency anemia, hypoplastic and aplastic anemia or hemolytic anemia, anemia due to iron utilization disorder (iron deficiency anemia) or due to other endocrine disorders (e.g., hypothyroidism); post-surgical ischemic conditions associated with surgery and their sequelae, particularly cardiac interventions using a heart-lung machine (e.g., shunt surgery, heart valve implantation), carotid interventions, aortic interventions, and interventions using instruments that open or penetrate the skull; wound healing of surgical procedures; chronic kidney diseases, such as primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial lesions (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, hereditary nephropathy (polycystic kidney, hereditary nephritis); inflammatory diseases, such as rheumatoid arthritis, nephritis, pneumonia, bronchitis, enteritis, arthritis; acute and prolonged cerebral ischemic conditions (e.g., stroke, birth asphyxia); immunodeficiency diseases, including systemic lupus erythematosus, psoriasis, rheumatoid arthritis; acute respiratory distress syndrome; chronic metabolic diseases, including diabetes, hypertension, obesity; neurodegenerative diseases, including cerebral ischemia, brain injury, Alzheimer's disease, Parkinson's disease, Huntington's disease; pulmonary edema, etc. SUMMARY

[0007] The present application provides a kind of five-membered and six-membered heterocyclic compound and its preparation method and application in the field of pharmacy.The compound or its pharmaceutical composition can be effectively used to prepare the drug for preventing, treating or reducing HIF-2 alpha mediated related diseases, such as renal anemia, chronic kidney disease, chronic metabolic disease, neurodegenerative disease, infection, inflammatory disease, pulmonary edema and acute respiratory distress syndrome.

[0008] Specifically, in one aspect, the present application provides a kind of compound, it has as shown in formula (I) structure, or its stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt or its prodrug,

[0009] Wherein,

[0010] In formula (I) Part is

[0011] When For X is N or CH; Y is NH, NCH3, O, S or CH2;

[0012] When For example, when X is NH, Y is CH2, and R1is H, then R2is not H, D, F, Cl, Br, I, OH, CN, NH2, NO2, -C(=O)OR

[0013] For example, when X is NH, Y is CH2, and R1is H, then R2is not H, D, F, Cl, Br, I, OH, CN, NH2, NO2, -C(=O)OR For example, when X is NH, Y is CH2, and R1is H, then R2is not H, D, F, Cl, Br, I, OH, CN, NH2, NO2, -C(=O)OR

[0014] A is C 6-12 aryl or 5-12 membered heteroaryl;

[0015] each R 1 and R 2 is independently H, D, F, Cl, Br, I, OH, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -(CH2) p -OR 7 , -NR a R b , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , C 1-4 alkyl, C 2-4 alkenyl, C 2-4 alkynyl, C 1-4 haloalkyl (e.g., -CF3, -CHF2, -CH2F, -CF2CF3), C 2-4 haloalkenyl, C 2-4 haloalkynyl, C 2-4 haloalkynyl, C 3-6 cycloalkyl, or 3-6 membered heterocyclyl;

[0016] R 3 is H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b ​​-S(=O)2NR a R b or -B(OR 7 )2;

[0017] each R 4 and R 5 is independently H, D, F, Cl, Br, I, OH, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -NHS(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , -B(OR 7 )2, -NHS(=O)2R 7 , C 1-4 alkyl, C 1-4 hydroxy-substituted alkyl, C 2-4 alkenyl, C 2-4 alkynyl, C 3-6 cycloalkyl, 3-6 membered heterocyclyl, C 1-4 haloalkyl (e.g., -CF3, -CHF2, -CH2F, -CF2CF3), C 2-4 haloalkenyl, C 2-4 haloalkynyl, C 3-6 halocycloalkyl, or 3-6 membered haloheterocyclyl;

[0018] R 6 is H, D, F, Cl, Br, I, OH, CN, NH2, NO2, C 1-4 alkyl, C 2-4 alkenyl, C 2-4 alkynyl, C 1-4 haloalkyl (e.g., -CF3, -CHF2, -CH2F, -CF2CF3), C 2-4 haloalkenyl, or C 2-4 haloalkynyl;

[0019] R 7 is independently H, D, CN-substituted C 1-4 alkyl, C 1-4 alkyl, C 2-4 alkenyl, C 2-4alkynyl, C 3-6 cycloalkyl, 3-6 membered heterocyclyl, C 1-4 haloalkyl, C 2-4 haloalkenyl, C 2-4 haloalkynyl, C 3-6 halocycloalkyl or 3-6 membered haloheterocyclyl;

[0020] each R a and R b independently H, D, C 1-4 alkyl, C 1-4 alkoxy, C 2-4 alkenyl, C 2-4 alkynyl, C 3-6 cycloalkyl, 3-6 membered heterocyclyl, C 1-4 haloalkyl, C 1-4 haloalkoxy, C 2-4 haloalkenyl, C 2-4 haloalkynyl, C 3-6 halocycloalkyl, 3-6 membered haloheterocyclyl;

[0021] p is 0, 1, 2, or 3; m is 0, 1, 2, or 3.

[0022] In some embodiments, the compounds of the present application have a structure according to Formula (II-1), (II-2), (II-3), (II-4), (II-5), (II-6), (II-7), (II-8), (II-9), (II-10), (II-11), (II-12), (II-13), (II-14), (II-15), (II-16), (II-17), (II-18), (II-19), (II-20), (II-21), (II-22), (II-23), (II-24), (II-25), (II-26), (II-27), (II-28), (II-29), (II-30), (II-31), (II-32), (II-33), (II-34), (II-35), (II-36), (II-37), (II-38), (II-39), (II-40), (II-41), (II-42), (II-43), (II-44), or (II-45), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof,

[0023] wherein each m is independently 1, 2, or 3.

[0024] In some embodiments, the compounds of the present application have a structure according to Formula (III-1), (III-2), (III-3), (III-4), (III-5), (III-6), (III-7), or (III-8), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof,

[0025] wherein each A1is independently a 5-membered heteroaryl, a 5-membered and 5- membered heteroaryl, a 5-membered and 6-membered heteroaryl, or a 6-membered and 6- membered heteroaryl.

[0026] In some embodiments, each A1is independently imidazolyl, pyrazolyl, thienyl, thiazolyl, pyrimidinyl, pyrazinyl, benzo[d][l,3]dioxol, benzofuran, benzimidazole, indolyl, or quinolinyl.

[0027] In some embodiments, each R 1 and R 2 is independently H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -(CH2) p -OR 7 , -NR a R b , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , methyl, ethyl, n-propyl, i-propyl, t-butyl, ethenyl, propenyl, allyl, ethynyl, propynyl, propargyl, -CF3, -CHF2, -CH2F, -CF2CF3, pyrrolidinyl, or tetrahydrofuranyl.

[0028] In some embodiments, R 4 and R 5 is independently H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -NHS(=O)2R 7 , -OR7 -SR 7 -S(=O)R 7 -C(=O)NR a R b -NHS(=O)2R 7 -NR a C(=O)NR a R b -S(=O)2NR a R b -B(OR 7 )2, methyl, ethyl, 2-hydroxyethyl, n-propyl, isopropyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, -CF3, -CHF2, -CH2F, or -CF2CF3.

[0029] In some embodiments, each R 6 is H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, methyl, ethyl, n-propyl, isopropyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, -CF3, -CHF2, -CH2F, or -CF2CF3.

[0030] In some embodiments, each R 7 is independently H, D, -CF3, -CHF2, -CH2F, -CF2CF3, CN-substituted methyl, CN-substituted ethyl, CN-substituted n-propyl, methyl, ethyl, n-propyl, isopropyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, propyl, cyclobutyl, cyclopentyl, or cyclohexyl.

[0031] In some embodiments, each R a and R b is independently H, D, methyl, ethyl, n-propyl, isopropyl, t-butyl, trifluoromethyl, 1-fluoroethyl, 2-fluoroethyl, 1,2-dichloroethyl, 2-fluoropropyl, 3-fluoropropyl, methoxy, ethoxy, n-propoxy, isopropoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl.

[0032] In some embodiments, the present compounds have a structure according to Formula (IV-1), (IV-2), (IV-3), (IV-4), (IV-5), (IV-6), (IV-7), (IV-8), or (IV-9), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof,

[0033] R 1 , R 2 , R3 , R 4 , R 5 , R 6 , R 7 , m and have the meanings as defined in the present application.

[0034] In some embodiments, the compounds of the present application have the structure of Formula (II-1) or (II-2), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof,

[0035] each R 1 is independently F, -OR 7 , -(CH2) p -OR 7 , -NR a R b , methyl, ethyl, n-propyl, i-propyl, t-butyl, ethynyl, propynyl, propargyl, -CF3, -CHF2, -CH2F, -CF2CF3;

[0036] m is 0, 1, 2, or 3;

[0037] p is 0, 1, 2, or 3;

[0038] each R a and R b is independently H, D, C 1-4 alkyl;

[0039] each R 2 is independently H, D, F, Cl, Br, I, -OR 7 , methyl, ethyl, n-propyl, i-propyl, t-butyl, ethenyl, propenyl, allyl, ethynyl, propynyl, propargyl, -CF3, -CHF2, -CH2F, -CF2CF3, pyrrolidinyl, or tetrahydrofuranyl;

[0040] each R 7 is independently H, -CF3, -CHF2, -CH2F, -CF2CF3, CN-substituted methyl, CN-substituted ethyl, CN-substituted n-propyl, methyl, ethyl, n-propyl, i-propyl, t-butyl, ethenyl, propenyl, allyl, ethynyl, propynyl, propargyl, propyl, cyclobutyl, cyclopentyl, or cyclohexyl;

[0041] R 3 is H;

[0042] R 4 and R 5 are independently H, CN, -S(=O)2R 7, -OR 7 , -NHS(=O)R 7 , -C(=O)NR a R b , -NHS(=O)2R 7 , -B(OR 7 )2, -C(=O)OR 7 ;

[0043] R 6 is H.

[0044] In another aspect, the present application provides a compound having one of the following structures, or a stereoisomer, a tautomer, a solvate, a metabolite, a pharmaceutically acceptable salt thereof or a prodrug thereof,

[0045] In another aspect, the present application provides a pharmaceutical composition comprising the compound of the present application.

[0046] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant.

[0047] In some embodiments, the pharmaceutical composition is any one of a tablet, a pill, a capsule, an injection.

[0048] In another aspect, the present application provides a pharmaceutical combination for treating a disease associated with HIF-2α activity, wherein the pharmaceutical combination is a combination of the compound of the present application or the pharmaceutical composition thereof and a prolyl hydroxylase inhibitor.

[0049] In some embodiments, the prolyl hydroxylase inhibitor comprises any one of Roxadustat, Daprodustat, Vadadustat, Enarodustat, Molidustat.

[0050] In another aspect, the present application provides use of the compound of the present application or the pharmaceutical composition in the preparation of a medicament for preventing, treating, alleviating or lessening a disease associated with HIF-2α.

[0051] In another aspect, the present application provides a method for preventing, treating, alleviating or lessening a disease associated with HIF-2α, comprising administering to a patient a therapeutically effective amount of the compound of the present application or the pharmaceutical composition or the pharmaceutical combination of the present application.

[0052] In another aspect, the present application provides use of the compound of the present application or the pharmaceutical composition or the pharmaceutical combination of the present application for preventing, treating, alleviating or lessening a disease associated with HIF-2α.

[0053] In some embodiments, the HIF-2a mediated related disease is selected from the group consisting of hematopoietic disorders, such as renal anemia, primary anemia, and anemia associated with neoplastic diseases (particularly chemotherapy-induced anemia), anemia due to blood loss, iron deficiency anemia, vitamin deficiency anemia, hypoplastic and aplastic anemia or hemolytic anemia, anemia due to disorders of iron utilization (iron deficiency anemia) or due to other endocrine disorders (e.g., hypothyroidism); post-surgical conditions associated with surgery and its sequelae, particularly cardiac interventions using a heart-lung machine (e.g., shunt surgery, heart valve implantation), carotid artery interventions, aortic interventions, and interventions using instruments that open or penetrate the skull; wound healing of surgical procedures; chronic kidney diseases, such as primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial disorders (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, hereditary nephropathy (polycystic kidney, hereditary nephritis); inflammatory diseases, such as rheumatoid arthritis, nephritis, pneumonitis, bronchitis, enteritis, arthritis; acute and prolonged cerebral ischemic conditions (e.g., stroke, birth asphyxia); immunodeficiency diseases, including systemic lupus erythematosus, psoriasis, rheumatoid arthritis; acute respiratory distress syndrome; chronic metabolic diseases, including diabetes, hypertension, obesity; neurodegenerative diseases, including cerebral ischemia, brain injury, Alzheimer's disease, Parkinson's disease, Huntington's disease; pulmonary edema, etc.

[0054] In some embodiments, the HIF-2a mediated related disease is wound healing of surgical procedures.

[0055] In some embodiments, the HIF-2a mediated related disease is a kidney disease, such as primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial disorders (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, hereditary nephropathy (polycystic kidney, hereditary nephritis).

[0056] In some embodiments, the HIF-2a mediated related disease is a cardiovascular disease, particularly cardiac insufficiency, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension, and peripheral arterial occlusive disease.

[0057] In some embodiments, the HIF-2a mediated related disease is an infection, particularly HIV infection.

[0058] In some embodiments, the HIF-2a mediated related disease is an inflammatory disease, such as rheumatoid arthritis, nephritis, pneumonitis, bronchitis, enteritis, arthritis.

[0059] In some embodiments, the HIF-2a mediated related disease is a continuous symptom of acute and prolonged cerebral ischemic state, such as stroke, birth asphyxia.

[0060] In some embodiments, the HIF-2a mediated related disease is an immunodeficiency disease, such as systemic lupus erythematosus, psoriasis, rheumatoid arthritis.

[0061] In some embodiments, the HIF-2a mediated related disease is acute respiratory distress syndrome.

[0062] In some embodiments, the HIF-2a mediated related disease is a chronic metabolic disease, such as diabetes, hypertension, obesity.

[0063] In some embodiments, the HIF-2a mediated related disease is a neurodegenerative disease, including cerebral ischemia, brain injury, Alzheimer's disease, Parkinson's disease, Huntington's disease.

[0064] In some embodiments, the HIF-2a mediated related disease is pulmonary edema or renal edema or chronic kidney disease.

[0065] In some embodiments, the HIF-2a mediated related disease includes anemia, ischemia or ischemic disease, vascular disease, angina pectoris, myocardial infarction, metabolic disorder or cancer.

[0066] In some embodiments, the HIF-2a mediated related disease includes renal anemia, renal fibrosis, renal edema and / or kidney disease.

[0067] In some embodiments, the prevention, alleviation or treatment of the HIF-2a mediated related disease is achieved by acting on the downstream genes regulated by HIF-2a.

[0068] In some embodiments, the compound of the present application or the pharmaceutical composition of the present application or the drug combination of the present application has agonistic activity on the transcription level of HIF-2a protein; preferably, the agonistic activity is on the HRE gene regulated by HIF-2a gene regulation.

[0069] In some embodiments, the compound of the present application or the pharmaceutical composition of the present application or the drug combination of the present application has a regulatory effect on the renal fibrosis gene.

[0070] In some embodiments, the regulatory effect on the renal fibrosis gene is in the form of down-regulating a-smooth muscle actin (a-SMA) gene, down-regulating collagen III gene, and down-regulating connective tissue growth factor (CTGF) gene.

[0071] In some embodiments, the downstream genes regulated by HIF-2a include vascular endothelial cell growth factor, erythropoietin, cyclin, and / or glucose transporter.

[0072] In some embodiments, the compound of the present application or the pharmaceutical composition of the present application or the drug combination of the present application affects the downstream genes regulated by HIF-2a in the manner of: up-regulating EPO gene. Beneficial effects

[0073] The present application provides a kind of five-membered and six-membered heterocyclic compound, by luciferase reporter gene experiment, it is found that this kind of compound has the effect of significantly enhancing the transcriptional activity of HIF-2a, can be used to prevent, reduce or treat the disease related to HIF-2a activity.

[0074] The present application simulates the pathological process of renal fibrosis by activating rat kidney fibroblasts in vitro by TGF-β1.The results show that the five-membered and six-membered heterocyclic compound can significantly inhibit the expression of α-SMA gene induced by TGF-β1, and can reduce the expression of CTGF and Collagen III genes and proteins, confirming the effect of these compounds in alleviating renal fibrosis.

[0075] The present application determines that the five-membered and six-membered heterocyclic compound shows a synergistic effect when used in combination with the proline hydroxylase inhibitor Roxadustat, indicating that the five-membered and six-membered heterocyclic compound and the proline hydroxylase drug can be used in combination to activate the expression of HIF-2a downstream target genes (such as EPO gene), and this activation effect may have potential therapeutic value for treating ischemic diseases or anemia and the like.

[0076] The present application confirms through a series of experiments that the five-membered and six-membered heterocyclic compound can be used to prevent, reduce and / or treat diseases related to HIF-2a activity, especially anemia or kidney disease or renal fibrosis.

[0077] Detailed description of the present application

[0078] Definition of terms

[0079] Now certain embodiments of the present application will be described in detail with examples illustrated by the accompanying structural formula and chemical formula. The present application is intended to cover all alternatives, modifications and equivalents thereof which are included within the scope of the present application as defined by the claims. Those skilled in the art should recognize that many methods and materials similar or equivalent to those described herein can be used to practice the present application. The present application is in no way limited to the methods and materials described herein. In the event that one or more of the incorporated documents, patents and similar materials differs from or contradicts with the present application including but not limited to defined terms, term application, described techniques, etc., the present application shall prevail.

[0080] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. All patents and publications referred to in this application are incorporated in their entirety by reference into this application.

[0081] In the description of the specification, the description using the terms "one embodiment", "some embodiments", "an example", "a specific example", or "some examples" and so on means that a specific feature, structure, material or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present application. Descriptive expressions of the above terms in the specification do not necessarily refer to the same embodiment or example. Also, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in one or more embodiments or examples. Furthermore, the person skilled in the art can combine and combine the different embodiments or examples described in the specification and the features of the different embodiments or examples, without contradiction.

[0082] The term "patient" as used herein means a human (including adults and children) or other animal. In some embodiments, "patient" means a human.

[0083] Unless otherwise indicated, the structural formulae described herein and the compounds described herein include all isomeric forms (e.g., enantiomeric, diastereomeric, geometric isomeric or conformational isomers), hydrates, solvates, metabolites, pharmaceutically acceptable salts, and prodrugs. Accordingly, individual stereochemical isomers, enantiomeric forms, diastereomeric forms, geometric isomers, conformational isomers, hydrates, solvates, metabolites, pharmaceutically acceptable salts, and prodrugs of the compounds of the present application are within the scope of the present application. In addition, unless otherwise indicated, the structural formulae described herein include isotopically enriched atoms.

[0084] As described herein, the compounds of the present application can be independently optionally substituted with one or more substituents. It will be appreciated that the term "independently optionally substituted" is used interchangeably with the term "substituted or unsubstituted". In general, the term "substituted" means that one or more hydrogen atoms in the given structure are replaced by a particular substituting group. Unless otherwise indicated, an optional substituting group can be substituted at any available position of the group. When more than one position in the given structure can be substituted with one or more substituting groups selected from a particular group of substituting groups, the substituting groups can be the same or different at each position.

[0085] The descriptive terms “each…independently”, “…each independently”, and “…independently” used in this invention are interchangeable and should be interpreted broadly. They can mean that the specific options expressed by the same symbols in different groups do not affect each other, or that the specific options expressed by the same symbols in the same group do not affect each other.

[0086] In the compounds described in this invention, when any variable (e.g., R) a R b If a substance (e.g., ) appears more than once in any combination, then the definition of each occurrence is independent of the definitions of the other occurrences. Similarly, combinations of substituents and variables are permitted, provided that such combinations stabilize the compound. It will be understood that those skilled in the art can select the substituents of the compounds of this invention to provide chemically stable compounds that are readily synthesized from starting materials readily available by techniques in the art and by the methods described below.

[0087] The term "room temperature" refers to the ambient temperature, which can be 10℃-35℃, 15℃-30℃, or 20℃-30℃.

[0088] In this invention, "C" q1-q2 "" indicates the number of carbon atoms in the described group, for example, C 1-6 Alkyl groups are alkyl groups containing 1-6 carbon atoms; C 3-6 Cycloalkyl refers to cycloalkyl groups containing 3-6 carbon atoms.

[0089] The terms “q3-q4-membered” or “composed of q3-q4 atoms” indicate the number of cyclic atoms in the described ring. For example, a 3-6-membered heterocyclic group indicates a heterocyclic group containing 3-6 cyclic atoms.

[0090] The term "alkyl" refers to a saturated straight-chain or branched monovalent hydrocarbon group containing 1 to 20 carbon atoms. In another embodiment, the alkyl group contains 1 to 6 carbon atoms; in yet another embodiment, the alkyl group contains 1 to 4 carbon atoms; and in still another embodiment, the alkyl group contains 1 to 3 carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl (s-Bu, -CH(CH3)CH2CH3), tert-butyl, n-pentyl, 2-pentyl, etc.

[0091] The term "alkenyl" refers to a straight-chain or branched monovalent hydrocarbon group containing 2-12 carbon atoms, with at least one unsaturated site, i.e., one carbon-carbon sp. 2double bond, wherein the alkenyl group can optionally be substituted with one or more substituents described herein, including "cis" and "trans" orientation, or "E" and "Z" orientation. In one embodiment, the alkenyl group comprises 2 to 10 carbon atoms; in another embodiment, the alkenyl group comprises 2 to 6 carbon atoms; in yet another embodiment, the alkenyl group comprises 2 to 4 carbon atoms. Examples of alkenyl groups include, but are not limited to, ethenyl (-CH=CH2), allyl (-CH2CH=CH2), propenyl (-C=CHCH3), isopropenyl (-C(CH3)=CH2), and the like.

[0092] The term "alkynyl" denotes a straight or branched chain monovalent hydrocarbon radical containing 2 to 12 carbon atoms, wherein there is at least one site of unsaturation, i.e., a carbon-carbon sp3 bond, wherein the alkynyl group can optionally be substituted with one or more substituents described herein. In one embodiment, the alkynyl group comprises 2 to 6 carbon atoms; in another embodiment, the alkynyl group comprises 2 to 10 carbon atoms; in yet another embodiment, the alkynyl group comprises 2 to 4 carbon atoms. Examples of alkynyl groups include, but are not limited to, ethynyl (-C≡CH), propargyl (-CH2C≡CH), 1-propynyl (-C≡C-CH3), and the like.

[0093] The term "hydroxyalkyl" or "hydroxy-substituted alkyl" denotes an alkyl group substituted with one or more hydroxyl groups. In some embodiments, hydroxyalkyl denotes an alkyl group substituted with 1, 2, 3, or 4 hydroxyl groups. In some embodiments, hydroxyalkyl denotes an alkyl group substituted with 1 or 2 hydroxyl groups. In some embodiments, hydroxyalkyl denotes a C 1-6 hydroxyalkyl, i.e., a C 1-6 alkyl substituted with 1 hydroxyl group. In some embodiments, hydroxyalkyl denotes a C 1-6 hydroxyalkyl, i.e., a C 1-6 alkyl substituted with 1 hydroxyl group. In some embodiments, hydroxyalkyl denotes a C 1-4 hydroxyalkyl. In some embodiments, hydroxyalkyl denotes a C 1-3 hydroxyalkyl. Examples of hydroxyalkyl groups include, but are not limited to, CH2OH-, CH2OHCH2CH2CH2-, CH2OHCH2-, CH2OHCH2CHOHCH2-, CH(CH3)OHCH2CHOHCH2-, and the like.

[0094] The term "haloalkyl" denotes an alkyl group substituted with one or more halogen atoms, examples of which include, but are not limited to, monofluoromethyl, difluoromethyl, trifluoromethyl, monofluoroethyl, 1,2-difluoroethyl, 1,1-difluoroethyl, 2,2-difluoroethyl, monochloromethyl, dichloromethyl, trichloromethyl, monochloroethyl, 1,2-dichloroethyl, 1,1-dichloroethyl, 2,2-dichloroethyl, 1,1-dibromoethyl, and the like.

[0095] The term "halogen" denotes F (fluorine), Cl (chlorine), Br (bromine), or I (iodine), and halo denotes substitution with a corresponding hydrogen with a halogen.

[0096] The term "alkoxy" denotes an alkyl group attached to the remainder of the molecule through an oxygen atom. In one embodiment, the alkoxy group contains 1 to 6 carbon atoms; in another embodiment, the alkoxy group contains 1 to 4 carbon atoms; in yet another embodiment, the alkoxy group contains 1 to 3 carbon atoms. Examples of alkoxy groups include, but are not limited to, methoxy (MeO, -OCH3), ethoxy (EtO, -OCH2CH3), 1-propoxy (n-PrO, n-propoxy, -OCH2CH2CH3), 2-propoxy (i-PrO, i-propoxy, -OCH(CH3)2), 1-butoxy (n-BuO, n-butoxy, -OCH2CH2CH2CH3), 2-methyl-l-propoxy (i-BuO, i-butoxy, -OCH2CH(CH3)2), and the like.

[0097] The term "heterocyclyl" denotes a monovalent, nonaromatic, saturated or partially unsaturated monocyclic ring system of 3 to 12 ring atoms, and which system contains at least one carbon atom and contains one, two, or three heteroatoms selected from O, N, S. Unless otherwise specified, a heterocyclyl group can be carbon-based or nitrogen-based, and a -CH2- group can optionally be replaced by -C(O)-. A sulfur atom of the ring can optionally be oxidized to the S-oxide or the S-oxide can optionally be oxidized to the S-dioxide. In some embodiments, the heterocycle contains 4 to 7 ring atoms, i.e., represents a 4 to 7 membered heterocycle; in other embodiments, the heterocycle contains 4 to 7 ring atoms, i.e., represents a 4 to 7 membered heterocycle. Examples of heterocycles include, but are not limited to, oxiranyl, azirdinyl, oxetanyl, thietanyl, pyrrolidinyl, 2-pyrrolinyl, 3-pyrrolinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, 1,3-dioxolanyl, dithiolanyl, tetrahydropyranyl, dihydropyranyl, 2H-pyranyl, 4H-pyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, dioxanyl, dithianyl, thioxanyl, homopiperazinyl, homopiperidinyl, 1,1-dioxo-l,3-thiomorpholinyl, and the like. Examples of heterocyclyl groups in which a -CH2- group is replaced by -C(O)- include, but are not limited to, 2-oxopyrrolidinyl, oxo-l,3-thiazolidinyl, 2-piperidonyl, 3,5-dioxopiperidinyl. Examples of heterocyclyl groups in which a nitrogen atom is oxidized to an N-oxide include, but are not limited to, 1,1-dioxo-l,3-thiomorpholinyl.

[0098] The term "aryl" denotes a monovalent aromatic ring carbon atom from which one hydrogen atom has been removed. Examples of aryl groups can include phenyl, naphthyl, anthryl, and the like.

[0099] The term "heteroaromatic ring" means a monovalent monocyclic, bicyclic and tricyclic ring system containing 5 to 12 ring atoms, or 5 to 10 ring atoms, or 5 to 6 ring atoms, wherein at least one ring system is aromatic, and at least one ring system contains one or more heteroatoms, wherein each ring system contains 5 to 7 atoms in a ring. In one embodiment, the 5 to 10 membered heteroaryl contains 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In some embodiments, the term "heteroaryl" means a heteroaromatic ring group containing 5 ring atoms, or a 5-membered heteroaryl group, wherein contains 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. Examples of heteroaryl groups include, but are not limited to, 2-furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, N-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, pyridazinyl (such as 3-pyridazinyl), 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, tetrazolyl (such as 5-tetrazolyl), triazolyl (such as 2-triazolyl and 5-triazolyl), 2-thiophenyl, 3-thiophenyl, pyrazolyl (such as 2-pyrazolyl), isothiazolyl, 1,2,3-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,3-triazolyl, 1,2,3-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,5-thiadiazolyl, pyrazinyl, 1,3,5-triazinyl; bicyclic rings are also included, but are in no way limited to, the following: benzo[d][l,3]dioxolyl, benzimidazolyl, benzofuranyl, benzothiophenyl, indolyl (such as 2-indolyl), purinyl, quinolinyl (such as 2-quinolinyl, 3-quinolinyl, 4-quinolinyl), isoquinolinyl (such as 1-isoquinolinyl, 3-isoquinolinyl or 4-isoquinolinyl), imidazo[l,2-a]pyridinyl, pyrazolo[l,5-a]pyridinyl, pyrazolo[l,5-a]pyrimidinyl, imidazo[l,2-b]pyridazinyl, [l,2,4]triazolo[4,3-b]pyridazinyl, [l,2,4]triazolo[l,5-a]pyrimidinyl, [l,2,4]triazolo[l,5-a]pyridinyl, and the like.

[0100] When a chemical group is attached to a polycyclic ring system through a bond, it is meant that the group can be substituted at a position on the ring system that is available for substitution. For example, represents R 2 may be substituted at the a, b, c, d, e positions on the ring system.

[0101] The term "prodrug" as used herein refers to a compound which in vivo is converted to a compound of Formula (I). Such conversion is effected by the hydrolysis of the prodrug in the blood or by enzymatic conversion in the blood or tissues to the parent structure. The prodrugs of the present application can be esters, and among esters useful as prodrugs in the present application are benzoate esters, aliphatic (C 1-24 ) esters, acyloxymethyl esters, carbonates, carbamates and amino acid esters. For example, a compound of the present application containing a hydroxyl group can be acylated to provide a prodrug form of the compound. Other prodrug forms include phosphate esters, such as those compounds which are phosphorylated on a hydroxyl group of the parent.

[0102] "Metabolite" refers to a product produced through metabolism of a specified compound or salt thereof in the body. Metabolites of a compound can be identified using techniques known in the art, and have activities generally similar to those of the compound. Such products can be oxidized, reduced, hydrolyzed, aminated, deaminated, esterified, deesterified, cleaved, or otherwise chemically modified by the body. Accordingly, the present application includes metabolites of compounds of the application, including those produced by the action of mammalian enzymes on the compounds of the present application.

[0103] As used herein, "pharmaceutically acceptable salts" refer to organic and inorganic salts of the compounds of the application. Pharmaceutically acceptable salts are well known in the art, for examples, S. M. Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66: 1-19. Pharmaceutically acceptable non-toxic acid addition salts include, but are not limited to, salts of inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, and salts of organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, malonic acid, or by other methods as those described in literature such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, stearate, sulfocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N + (C 1-4 alkyl)4 salts. The present application also contemplates quaternary ammonium salts of any group containing N in the compound. Water or oil-soluble or dispersible products can be obtained by quaternization. Alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Pharmaceutically acceptable salts further include, where appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed by the addition of inorganic or organic acids to a free amine group of the compound, such as hydrochloric, hydrobromic, phosphoric, sulfuric, nitric, C 1-8 sulfonic, and aromatic sulfonic acids.

[0104] In addition, the compounds disclosed herein, including their salts, can also be obtained in the form of their hydrates or include their solvents of crystallization (for example ethanol, DMSO, and the like), for their crystallization. The compounds disclosed herein can form solvates with pharmaceutically acceptable solvents (including water); thus, the present application is intended to include both solvated and unsolvated forms.

[0105] "Solvate" of the present application refers to an association or complex of one or more solvent molecules with a compound of the present application. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, and aminoethanol. The term "hydrate" refers to the complex where the solvent molecule is water.

[0106] The term "treatment" of any disease or disorder, as used herein, means, in some embodiments, amelioration of the disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). In other embodiments, "treatment" means remission or amelioration of at least one physical parameter including, but not limited to, a parameter not necessarily perceptible to the patient. In other embodiments, "treatment" means modulation (e.g., stabilization) of the disease or disorder either physically, (e.g., stabilization of a perceptible symptom), physiologically, (e.g., stabilization of a physical parameter), or both. In other embodiments, "treatment" means preventing or delaying the onset or development or worsening of a disease or disorder.

[0107] Combination, means either a fixed combination in a single dosage unit form or a kit of parts for the combined administration where the compounds of the disclosure and the combination partner can be administered independently at the same time or separately within a defined time period, particularly in a manner that the combination partner exerts a cooperative, e.g. synergistic effect. The terms "co-administration" or "combined administration" or the like as utilized herein are meant to encompass administration of selected combination partners to a single subject in need thereof (e.g., a patient), and are intended to include treatment regimens in which the agents are not necessarily in the same dosage form, are taken at the same time, or are delivered by the same route of administration.

[0108] The term "pharmaceutical combination" as used herein means a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients. The term "fixed combination" means that the active ingredients, e.g., a compound of the disclosure, and the combination partner, are packaged together in the same primary container, e.g., a tablet of a compound of the disclosure and a tablet of the combination partner are packaged together in the same bottle. The term "non-fixed combination" means that the active ingredients, e.g., a compound of the disclosure, and the combination partner, are packaged separately in individual containers, and are intended to be used in combination under conditions that the two compounds will be present in the body at the same time.

[0109] The term "therapeutically effective amount" of a compound of the disclosure means an amount of the compound of the disclosure that will elicit the biological or medical response of a subject, for example, reduction or inhibition of an enzyme or a protein activity, or ameliorate symptoms, alleviate conditions, slow or delay disease progression, or prevent a disease, etc. BRIEF DESCRIPTION OF DRAWINGS

[0110] Figure 1 is a statistical chart of the down-regulation of the expression of the a-SMA gene by the compound detected by real-time fluorescent quantitative PCR in the experiment of the activation of rat kidney fibroblasts induced by TGF-β1 in Example 146 of the present application. In the figure, relative mRNA level: relative mRNA level.

[0111] Figure 2 is a statistical chart of the down-regulation of the expression of the Collagen III gene by the compound detected by real-time fluorescent quantitative PCR in the experiment of the activation of rat kidney fibroblasts induced by TGF-β1 in Example 146 of the present application. In the figure, relative mRNA level: relative mRNA level.

[0112] Figure 3 is a statistical chart of the down-regulation of the expression of the CTGF gene by the compound detected by real-time fluorescent quantitative PCR in the experiment of the activation of rat kidney fibroblasts induced by TGF-β1 in Example 146 of the present application. In the figure, relative mRNA level: relative mRNA level.

[0113] Figure 4 is a statistical chart of the up-regulation of the transcription of the EPO gene, a target gene downstream of HIF-2, by the compound in combination with Roxadustat detected by real-time fluorescent quantitative PCR on Hep3B cells in Example 147 of the present application. In the figure, relative mRNA level: relative mRNA level.

[0114] Figure 5 is a detection result chart of the significant improvement of kidney edema by the compound 60 on the aristolochic acid-induced kidney injury zebrafish model in Example 148.

[0115] Figure 6 is a detection result chart of the significant increase of the signal intensity of red blood cells in the heart by the compound 60 on the aristolochic acid-induced kidney injury zebrafish model in Example 148.

[0116] Figure 7 is a detection result chart of Example 149. In Example 149 of the present application, the compound 15 increases the number of red blood cells in rats with chronic kidney disease on a 5 / 6 nephrectomy rat model. In the figure, hematological analysis: blood analysis. DETAILED DESCRIPTION

[0117] General synthesis method of the compound of the present application

[0118] In general, the compounds of the present application can be prepared by the methods described herein. The following reaction schemes and examples are intended to further illustrate the present application. Those skilled in the art will appreciate that the examples are merely illustrative and should not be viewed as specific limitations to the present application.

[0119] The following synthetic schemes describe the preparation of the compounds disclosed herein.

[0120] Synthetic Scheme (I):

[0121] Compound Ia can be prepared by the synthetic method of synthetic scheme I, wherein R 1 , R 2 , R 3 , R 4 , R 5 and R 6 each have the definition as described herein. Condensation of compound (Ia-1) with acyl chloride substituted compound (Ia-2) under suitable conditions (e.g. pyridine as base, tetrahydrofuran as solvent) gives amide intermediate (Ia-3); compound Ia-3 undergoes cyclization reaction to give compound Ia, for example, reaction with p-toluenesulfonic acid monohydrate under suitable conditions (e.g. toluene as solvent, elevated temperature) gives dihydrobenzo[d]oxazole compound Ia. Compound Ia can be subjected to different chemical reactions to transform the functional groups to obtain the final product.

[0122] Synthetic Scheme (II):

[0123] Compound Ib can be prepared by the synthetic method of synthetic scheme II, wherein R 1 , R 2 , R 3 , R 4 , R 5 and R 6 each have the definition as described herein. Reaction of compound (Ib-1) with aldehyde substituted compound (Ib-2) under suitable conditions (e.g. sodium bisulfite, ethanol as solvent) gives benzimidazole compound Ib. Compound Ib can be subjected to different chemical reactions to transform the functional groups to obtain the final product.

[0124] Synthetic Scheme (III):

[0125] Compound Ic can be prepared by the synthetic method of synthetic scheme III, wherein R 1 , R 2 , R 3 , R 4 , R 5 and R 6each has the definition as described in the present application. Compound (Ic-1) and boronic acid substituted compound (Ic-2) undergo Suzuki coupling reaction under suitable conditions (such as tetrakis triphenylphosphine palladium as catalyst, potassium phosphate as base, 1,4-dioxane as solvent) to give benz[d]thiazole compound Ic. Compound Ic can be subjected to functional group transformation by different chemical reactions to obtain the final product.

[0126] Synthetic scheme (IV):

[0127] Compound Id can be prepared by the synthetic method of synthetic scheme IV, wherein R 1 , R 2 , R 3 , R 4 , R 5 and R 6 each has the definition as described in the present application. Compound (Id-1) and benzylamine substituted compound (Id-2) react under suitable conditions (such as sulfur powder, pyridine as solvent) to give benz[d]thiazole compound Id. Compound Id can be subjected to functional group transformation by different chemical reactions to obtain the final product.

[0128] Synthetic scheme (V):

[0129] Compound Ie-4 and Ie-5 can be prepared by the synthetic method of synthetic scheme V, wherein R 1 , R 2 , R 3 , R 4 , R 5 and R 6 each has the definition as described in the present application. Compound (Ie-1) and ethynyl substituted compound (Ie-2) react under suitable conditions (such as bis(triphenylphosphine)palladium dichloride, cuprous iodide as catalyst, triethylamine as solvent) to give compound Ie-3. Compound Ie-3 reacts under suitable conditions (such as potassium tert-butoxide as base, N-methyl pyrrolidone as solvent) to give benzindole compound Ie-4. Compound Ie-4 reacts with iodomethane under suitable conditions (such as sodium hydride as base, N,N-dimethylformamide as solvent) to give 1-methyl substituted benzindole compound Ie-5. Compound Ie-4 or Ie-5 can be subjected to functional group transformation by different chemical reactions to obtain the final product.

[0130] Synthetic scheme (VI):

[0131] Compound If can be prepared by the synthetic method of synthetic scheme VI, wherein R 1 , R 2 , R3 , R 4 , R 5 , R 6 each have the definition as described in the application. Compound (If-1) is reacted with aldehyde substituted compound (If-2) under suitable conditions (such as N,N-diisopropylethylamine, tetrabutylammonium fluoride, tetrahydrofuran as solvent) to obtain dihydrobenzofuran compound If. Compound If can be subjected to functional group transformation by different chemical reactions to obtain the final product.

[0132] Synthetic scheme (VII):

[0133] Compound Ig can be prepared by the synthetic method of synthetic scheme VII, wherein R 1 , R 2 , R 3 , R 4 , R 5 , R 6 each have the definition as described in the application. Compound (Ig-1) is reacted with ethynyl substituted compound (Ig-2) under suitable conditions (such as bis(triphenylphosphine)palladium dichloride, cuprous iodide as catalyst, triethylamine as base, tetrahydrofuran as solvent) to obtain compound Ig-3. Compound Ig-3 is reacted under suitable conditions (such as under indium iodide conditions, 1,2-dichloroethane as solvent) to obtain benzofuran compound Ig. Compound Ig can be subjected to functional group transformation by different chemical reactions to obtain the final product.

[0134] Synthetic scheme (VIII):

[0135] Compound Ih can be prepared by the synthetic method of synthetic scheme VIII, wherein R 1 , R 2 , R 3 , R 4 , R 5 , R 6 each have the definition as described in the application. Compound (Ih-1) is reacted with bromine / iodine substituted compound (Ih-2) under suitable conditions (such as palladium acetate and tricyclohexylphosphine as catalyst, under potassium carbonate and pivalic acid conditions, N,N-dimethylformamide as solvent) to obtain benzothiophene compound Ih. Compound Ih can be subjected to functional group transformation by different chemical reactions to obtain the final product.

[0136] Example 1: Synthesis of methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate

[0137] Step 1: Preparation of 4-(3,5-difluorobenzamido)-3-hydroxybenzoic acid

[0138] To 4-amino-3-hydroxybenzoic acid (2 g, 13.07 mmol) and pyridine (3.13 g, 39.20 mmol) was added to 100 mL of tetrahydrofuran. 3,5-difluorobenzoyl chloride (2.3 g, 13.07 mmol) was dissolved in 50 mL of tetrahydrofuran and added dropwise to the above reaction mixture. The reaction was allowed to proceed at room temperature for 10 h. 200 mL of 1 N dilute hydrochloric acid was added and the reaction mixture was extracted with ethyl acetate three times. The organic layers were combined and washed with saturated sodium chloride solution once, dried over anhydrous sodium sulfate and the organic solvent was removed by rotary evaporation to obtain the title compound 4-(3,5-difluorobenzamido)-3-hydroxybenzoic acid 3.4 g (yield 88%) which was used as such for the next step without further purification.

[0139] Step 2: Preparation of methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate

[0140] To 4-(3,5-difluorobenzamido)-3-hydroxybenzoic acid (3.40 g, 11.60 mmol) and p-toluenesulfonic acid monohydrate (11.02 g, 58.02 mmol) was dissolved in xylene. The reaction was allowed to proceed at 160 °C for 12 h. The reaction mixture was cooled to room temperature, aqueous sodium bicarbonate solution was added and the reaction mixture was extracted with ethyl acetate three times. The organic layers were combined and washed with saturated sodium chloride solution once, dried over anhydrous sodium sulfate and the organic solvent was removed by rotary evaporation to obtain the intermediate 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid 900 mg (yield 28%) which was used as such for the next step without further purification.

[0141] Step 3: Preparation of methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate

[0142] To 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid (900 mg, 3.27 mmol) was dissolved in methanol:toluene (1:4) to obtain 50 mL of solvent and (trimethylsilyl)diazomethane (745 mg, 6.54 mmol) was added. The reaction was allowed to proceed at room temperature for 1 h. Aqueous solution was added and the reaction mixture was extracted with ethyl acetate three times. The organic layers were combined and washed with saturated sodium chloride solution once, dried over anhydrous sodium sulfate and the organic solvent was removed by rotary evaporation. The residue was purified by silica gel column chromatography (PE:EA (v:v) = 3:1) to obtain the title compound methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate 470 mg (yield 49%). 1 H NMR (400 MHz, DMSO-d6) δ 8.34 (d, J = 1.6 Hz, 1H), 8.08 (dd, J = 8.4, 1.6 Hz, 1H), 7.99 (d, J = 8.4 Hz, 1H), 7.92-7.90 (m, 2H), 7.77-7.57 (m, 1H), 3.93 (s, 3H).

[0143] Example 2: Synthesis of 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid

[0144] To methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate (100 mg, 0.35 mmol) was added 2 mL of tetrahydrofuran, 2 mL of 2N sodium hydroxide was added dropwise, and the reaction was allowed to proceed at room temperature for 1 h. The tetrahydrofuran solution was removed, the pH was adjusted to 7 with dilute hydrochloric acid, and the mixture was suction filtered, the filter cake was washed with water three times, and the product, 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid, was obtained in 70 mg (73% yield). 1 H NMR (400 MHz, DMSO-d6) δ 13.34 (s, 1H), 8.29 (s, 1H), 8.06 (d, J = 8.3 Hz, 1H), 8.02 - 7.81 (m, 3H), 7.68 - 7.62 (m, 1H).

[0145] Example 3: Synthesis of methyl 2-(3-fluoro-5-methoxyphenyl)benzo[d]oxazole-6- carboxylate

[0146] The synthesis method was the same as in Example 1, except that 3,5-difluorobenzoyl chloride was replaced by 3-fluoro-5-methoxybenzoyl chloride. 1 H NMR (400 MHz, CDCl3) δ 8.31 (d, J = 1.5 Hz, 1H), 8.14 (dd, J = 8.4, 1.5 Hz, 1H), 7.83 (d, J = 8.4 Hz, 1H), 7.66 - 7.57 (m, 2H), 6.88 - 6.84 (m, 1H), 4.00 (s, 3H), 3.95 (s, 3H).

[0147] Example 4: Synthesis of 2-(3-fluoro-5-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid

[0148] The synthesis method was the same as in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3-fluoro-5- methoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.24 (s, 1H), 8.30 (d, J = 1.5 Hz, 1H), 8.05 (dd, J = 8.3, 1.5 Hz, 1H), 7.93 (d, J = 8.3 Hz, 1H), 7.68 - 7.51 (m, 2H), 7.21 (dt, J = 10.9, 2.4 Hz, 1H), 3.92 (s, 3H).

[0149] Example 5: Synthesis of 2-(3-fluoro-5-methoxyphenyl)benzo[d]oxazole-6- carboxamide

[0150] 2-(3-Fluoro-5-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid (200 mg, 0.70 mmol) was dissolved in 5 mL of thionyl chloride and reacted at 50 °C for 2 hours. After cooling to room temperature, the remaining thionyl chloride was removed by rotary evaporation to obtain the acid chloride intermediate. The intermediate was placed in an ice water bath, dry tetrahydrofuran was added as a solvent, and ammonia water (540 μL, 3.5 mmol) was slowly added dropwise at low temperature. The reaction was carried out at room temperature for 2 hours. After removing the solvent by rotary evaporation, the target compound 2-(3-fluoro-5-methoxyphenyl)benzo[d]oxazole-6-carboxamide was obtained by recrystallization using an EA:PE = 1:5 solution. The yield was 74 mg (37%). 1 H NMR (400 MHz, DMSO-d6) δ 8.28 (d, J = 1.5 Hz, 1H), 8.13 (s, 1H), 7.99 (dd, J = 8.4, 1.6 Hz, 1H), 7.88 (d, J = 8.3 Hz, 1H), 7.63 - 7.48 (m, 3H), 7.16 (dt, J = 10.8, 2.4 Hz, 1H), 3.91 (s, 3H).

[0151] Example 6: Synthesis of methyl 2-(3-(trifluoromethoxy)phenyl)benzo[d]oxazole-6- carboxylate

[0152] Step 1: Preparation of methyl 3-hydroxy-4-(3-(trifluoromethoxy)benzamido)benzoate

[0153] Methyl 3-hydroxy-4-(3-(trifluoromethoxy)benzamido)benzoate (2.8 g, 6.87 mmol) was dissolved in 100 mL of dry DCM, and 2 mL of trifluoroacetic acid was slowly added dropwise at room temperature. The reaction was carried out at room temperature for 2 hours. After removing the solvent by rotary evaporation, the target compound 2-(3-(trifluoromethoxy)phenyl)benzo[d]oxazole-6-carboxylic acid was obtained by recrystallization using an EA:PE = 1:5 solution. The yield was 1.8 g (68%). 1H NMR (400 MHz, DMSO-d6) δ 10.38 (s, 1H), 9.77 (s, 1H), 8.03-8.01 (m, 1H), 7.97-7.89 (m, 2H), 7.70 (t, J = 7.9 Hz, 1H), 7.65-7.62 (m, 1H), 7.54 (d, J = 1.9 Hz, 1H), 7.48 (dd, J = 8.3, 2.0 Hz, 1H), 3.84 (s, 3H).

[0154] Step 2: Preparation of methyl 2-(3-(trifluoromethoxy)phenyl)benzo[d]oxazole-6- carboxylate

[0155] Methyl 3-hydroxy-4-(3-(trifluoromethoxy)benzamido)benzoate (500 mg, 1.40 mmol) and p-toluenesulfonic acid monohydrate (802 mg, 4.22 mmol) were dissolved in toluene. The reaction was refluxed for 12 hours. Cooled to room temperature, added aqueous sodium bicarbonate solution, extracted with ethyl acetate three times, combined the organic layers, washed with saturated sodium chloride solution once, dried over anhydrous sodium sulfate, the organic solution was removed by rotary evaporation, the residue was purified by silica gel column chromatography (PE:EA (v:v) = 4:1) to give methyl 2-(3-(trifluoromethoxy)phenyl)benzo[d]oxazole-6-carboxylate 370 mg (yield 49%). 1 H NMR (400 MHz, DMSO-d6) δ 7.55 (s, 1H), 7.54-7.45 (m, 2H), 7.47-7.21 (m, 4H), 3.59 (s, 3H).

[0156] Example 7: Synthesis of 2-(3-(trifluoromethoxy)phenyl)benzo[d]oxazole-6-carboxylic acid

[0157] The synthesis method refers to Example 2, except that methyl 2-(3-(trifluoromethoxy)phenyl)benzo[d]oxazole-6-carboxylate is replaced by methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 13.23 (s, 1H), 8.32 (s, 1H), 8.28 (d, J = 7.8 Hz, 1H), 8.13 (s, 1H), 8.09-8.01 (m, 1H), 7.94 (d, J = 8.3 Hz, 1H), 7.81 (t, J = 8.0 Hz, 1H), 7.72 (dd, J = 8.2, 2.4 Hz, 1H).

[0158] Example 8: Synthesis of methyl 2-(3-methoxyphenyl)benzo[d]oxazole-6-carboxylate

[0159] The synthesis was performed according to the procedure described in Reference Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3- methoxybenzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.31 (d, J = 1.5 Hz, 1H), 8.13 (dd, J = 8.3, 1.6 Hz, 1H), 7.90 (dt, J = 7.7, 1.3 Hz, 1H), 7.87 - 7.77 (m, 2H), 7.48 (t, J = 8.0 Hz, 1H), 7.17 - 7.14 (m, 1H), 4.00 (s, 3H), 3.96 (s, 3H).

[0160] Example 9: Synthesis of 2-(3-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid

[0161] The synthesis was performed according to the procedure described in Reference Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.29 (d, J = 1.5 Hz, 1H), 8.03 (dd, J = 8.3, 1.5 Hz, 1H), 7.91 (d, J = 8.3 Hz, 1H), 7.83 (dt, J = 7.7, 1.2 Hz, 1H), 7.73 (dd, J = 2.6, 1.5 Hz, 1H), 7.57 (t, J = 8.0 Hz, 1H), 7.28 - 7.25 (m, 1H), 3.89 (s, 3H).

[0162] Example 10: Synthesis of 2-(3,5-dimethoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester

[0163] The synthesis was performed according to the procedure described in Reference Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3,5-dimethoxybenzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.30 (d, J = 1.5 Hz, 1H), 8.13 (dd, J = 8.4, 1.5 Hz, 1H), 7.82 (d, J = 8.4 Hz, 1H), 7.46 (d, J = 2.4 Hz, 2H), 6.70 (t, J = 2.3 Hz, 1H), 4.00 (s, 3H), 3.93 (s, 6H).

[0164] Example 11: Synthesis of 2-(3,5-dimethoxyphenyl)benzo[d]oxazole-6-carboxylic acid

[0165] The synthesis was performed according to the procedure described in Reference Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(3,5-dimethoxyphenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) d 13.23 (s, 1H), 8.28 (d, J = 1.4 Hz, 1H), 8.03 (dd, J = 8.2, 1.5 Hz, 1H), 7.90 (d, J = 8.3 Hz, 1H), 7.35 (d, J = 2.3 Hz, 2H), 6.81 (t, J = 2.3 Hz, 1H), 3.88 (s, 6H).

[0166] Example 12: Synthesis of methyl 2-(3-fluoro-5-methoxyphenyl)benzo[d]oxazole-5- carboxylate

[0167] The synthesis was performed according to the procedure described in Reference Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-fluoro-5- methoxybenzoic acid and methyl 4-amino-3-hydroxybenzoate was replaced by methyl 3- amino-4-hydroxybenzoate. 1 H NMR (400 MHz, DMSO-d6) d 13.23 (s, 1H), 8.28 (d, J = 1.4 Hz, 1H), 8.03 (dd, J = 8.2, 1.5 Hz, 1H), 7.90 (d, J = 8.3 Hz, 1H), 7.35 (d, J = 2.3 Hz, 2H), 6.81 (t, J = 2.3 Hz, 1H), 3.88 (s, 6H).

[0168] Example 13: Synthesis of methyl 2-(3-fluoro-5-methoxyphenyl)benzo[d]oxazole-5- carboxylate

[0169] The synthesis was performed according to the procedure described in Reference Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(3-fluoro-5-methoxyphenyl)benzo[d]oxazole-5-carboxylate. 1 H NMR (400 MHz, DMSO-d6) d 13.23 (s, 1H), 8.28 (d, J = 1.4 Hz, 1H), 8.03 (dd, J = 8.2, 1.5 Hz, 1H), 7.90 (d, J = 8.3 Hz, 1H), 7.35 (d, J = 2.3 Hz, 2H), 6.81 (t, J = 2.3 Hz, 1H), 3.88 (s, 6H).

[0170] Example 14: Synthesis of methyl 2-(3-(trifluoromethyl)phenyl)benzo[d]oxazole-6- carboxylate

[0171] The procedure was reference to example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-trifluoromethylbenzoic acid. 1 HNMR (400 MHz, CDC13) δ 8.56 (d, J = 1.8 Hz, 1H), 8.47 (dt, J = 8.0, 1.5 Hz, 1H), 8.31 (d, J = 1.5 Hz, 1H), 8.13 (dd, J = 8.4, 1.5 Hz, 1H), 7.89-7.80 (m, 2H), 7.71 (t, J = 7.9 Hz, 1H), 4.00 (s, 3H).

[0172] Example 15: Synthesis of 2-(3-(trifluoromethyl)phenyl)benzo[d]oxazole-6- carboxylic acid

[0173] The procedure was reference to example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(3-(trifluoromethyl)phenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 13.61 (s, 1H), 8.50 (d, J = 7.9 Hz, 1H), 8.44 (s, 1H), 8.30 (s, 1H), 8.13-7.99 (m, 2H), 7.90 (dd, J = 15.2, 8.0 Hz, 2H).

[0174] Example 16: Synthesis of methyl 2-(4-fluoro-3-methoxyphenyl)benzo[d]oxazole-6- carboxylate

[0175] The procedure was reference to example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 4-fluoro-3-methoxybenzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.38-8.21 (m, 1H), 8.12 (dd, J = 8.3, 1.5 Hz, 1H), 7.97-7.84 (m, 2H), 7.79 (d, J = 8.3 Hz, 1H), 7.28-7.23 (m, 1H), 4.05 (s, 3H), 3.99 (s, 3H).

[0176] Example 17: Synthesis of 2-(4-fluoro-3-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid

[0177] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(4- chloro-3-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.18 (s, 1H), 8.27 (d, J = 1.5 Hz, 1H), 8.02 (dd, J = 8.3, 1.5 Hz, 1H), 7.95 - 7.87 (m, 2H), 7.85 - 7.82 (m, 1H), 7.50 (dd, J = 11.2, 8.5 Hz, 1H), 4.00 (s, 3H).

[0178] Example 18: Synthesis of 2-(2-chloro-3-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester

[0179] The synthesis was performed according to reference example 6, except that 3- (trifluoromethoxy)benzoic acid was replaced by 2-chloro-3-methoxybenzoic acid. 1 H NMR (400 MHz, DMSO-d6) δ 13.18 (s, 1H), 8.27 (d, J = 1.5 Hz, 1H), 8.02 (dd, J = 8.3, 1.5 Hz, 1H), 7.95 - 7.87 (m, 2H), 7.85 - 7.82 (m, 1H), 7.50 (dd, J = 11.2, 8.5 Hz, 1H), 4.00 (s, 3H).

[0180] Example 19: Synthesis of 2-(2-chloro-3-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid

[0181] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(2- chloro-3-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.18 (s, 1H), 8.27 (d, J = 1.5 Hz, 1H), 8.02 (dd, J = 8.3, 1.5 Hz, 1H), 7.95 - 7.87 (m, 2H), 7.85 - 7.82 (m, 1H), 7.50 (dd, J = 11.2, 8.5 Hz, 1H), 4.00 (s, 3H).

[0182] Example 20: Synthesis of 2-(2-fluoro-3-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester

[0183] The synthesis was performed according to reference example 6, except that 3- (trifluoromethoxy)benzoic acid was replaced by 2-fluoro-3-methoxybenzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.33 (d, J = 1.5 Hz, 1H), 8.13 (dd, J = 8.4, 1.5 Hz, 1H), 7.86 (d, J = 8.4 Hz, 1H), 7.83 - 7.79 (m, 1H), 7.28 - 7.23 (m, 1H), 7.21 - 7.17 (m, 1H), 3.99 (s, 3H), 3.98 (s, 3H).

[0184] Example 21 : Synthesis of 2-(2-fluoro-3-methoxyphenyl)benzo[d]oxazole-6- carboxylic acid

[0185] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(2- fluoro-3-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.21 (s, 1H), 8.29 (d, J = 1.4 Hz, 1H), 8.04 (dd, J = 8.3, 1.5 Hz, 1H), 7.93 (d, J = 8.4 Hz, 1H), 7.75 (ddd, J = 7.8, 6.0, 1.6 Hz, 1H), 7.48 (td, J = 8.1, 1.6 Hz, 1H), 7.38 (td, J = 8.1, 1.3 Hz, 1H), 3.93 (s, 3H).

[0186] Example 22: Synthesis of 2-(3-chloro-5-methoxyphenyl)benzo[d]oxazole-6- carboxylic acid methyl ester

[0187] The synthesis was performed according to reference example 6, except that 3- (trifluoromethoxy)benzoic acid was replaced by 3-chloro-5-methoxybenzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.28 (d, J = 1.5 Hz, 1H), 8.12 (dd, J = 8.4, 1.5 Hz, 1H), 7.86 (t, J = 1.6 Hz, 1H), 7.80 (d, J = 8.4 Hz, 1H), 7.69 (dd, J = 2.4, 1.4 Hz, 1H), 7.11 (t, J = 2.1 Hz, 1H), 3.99 (s, 3H), 3.93 (s, 3H).

[0188] Example 23: Synthesis of 2-(3-chloro-5-methoxyphenyl)benzo[d]oxazole-6- carboxylic acid

[0189] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3- chloro-5-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.30 (s, 1H), 8.29 (d, J = 1.5 Hz, 1H), 8.05 (dd, J = 8.3, 1.5 Hz, 1H), 7.92 (d, J = 8.3 Hz, 1H), 7.80 (t, J = 1.6 Hz, 1H), 7.69 (dd, J = 2.4, 1.4 Hz, 1H), 7.37 (t, J = 2.1 Hz, 1H), 3.92 (s, 3H).

[0190] Example 24: Synthesis of 2-(3-(trifluoromethyl)phenyl)benzo[d]oxazole-5-carboxylic acid methyl ester

[0191] The synthesis was performed according to reference example 6, except that 3- (trifluoromethoxy)benzoic acid was replaced by 3-(trifluoromethyl)benzoic acid and 4- amino-3-hydroxybenzoic acid methyl ester was replaced by 3-amino-4-hydroxybenzoic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.30 (s, 1H), 8.29 (d, J = 1.5 Hz, 1H), 8.05 (dd, J = 8.3, 1.5 Hz, 1H), 7.92 (d, J = 8.3 Hz, 1H), 7.80 (t, J = 1.6 Hz, 1H), 7.69 (dd, J = 2.4, 1.4 Hz, 1H), 7.37 (t, J = 2.1 Hz, 1H), 3.92 (s, 3H).

[0192] Example 25: Synthesis of 2-(3-(trifluoromethyl)phenyl)benzo[d]oxazole-5-carboxylic acid

[0193] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3- chloro-5-methoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.30 (s, 1H), 8.29 (d, J = 1.5 Hz, 1H), 8.05 (dd, J = 8.3, 1.5 Hz, 1H), 7.92 (d, J = 8.3 Hz, 1H), 7.80 (t, J = 1.6 Hz, 1H), 7.69 (dd, J = 2.4, 1.4 Hz, 1H), 7.37 (t, J = 2.1 Hz, 1H), 3.92 (s, 3H).

[0194] Example 26: Synthesis of methyl 2-(4-fluoro-3-methoxyphenyl)benzo[d]oxazole-5- carboxylate

[0195] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced with 4-fluoro-3- methoxybenzoic acid and methyl 4-amino-3-hydroxybenzoate was replaced with methyl 3-amino-4-hydroxybenzoate. 1 H NMR (400 MHz, CDC13) δ 8.45 (d, J = 1.6 Hz, 1H), 8.12 (dd, J = 8.5, 1.7 Hz, 1H), 7.87 (dd, J = 8.1, 2.0 Hz, 1H), 7.82 (ddd, J = 8.4, 4.4, 2.0 Hz, 1H), 7.61 (d, J = 8.5 Hz, 1H), 7.30 - 7.21 (m, 1H), 4.04 (s, 3H), 3.98 (s, 3H).

[0196] Example 27: Synthesis of 2-(4-fluoro-3-methoxyphenyl)benzo[d]oxazole-5-carboxylic acid

[0197] The synthesis was performed according to the procedure described in Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced with methyl 2-(4-fluoro-3-methoxyphenyl)benzo[d]oxazole-5-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 13.08 (s, 1H), 8.25 (d, J = 1.7 Hz, 1H), 8.00 (dd, J = 8.5, 1.7 Hz, 1H), 7.87 - 7.78 (m, 2H), 7.77 - 7.72 (m, 1H), 7.42 (dd, J = 11.2, 8.4 Hz, 1H), 3.97 (s, 3H).

[0198] Example 28: Synthesis of methyl 2-(3-(trifluoromethoxy)phenyl)benzo[d]oxazole-5- carboxylate

[0199] The synthesis was performed according to the procedure described in Example 6, except that methyl 4-amino-3-hydroxybenzoate was replaced with methyl 3-amino-4- hydroxybenzoate. 1H NMR (400 MHz, DMSO-d6) δ 8.37 (p, J = 0.8 Hz, 1H), 8.26 (dd, J = 7.9, 1.3 Hz, 1H), 8.14 - 8.05 (m, 2H), 7.97 (dt, J = 8.6, 0.8 Hz, 1H), 7.81 (t, J = 8.0 Hz, 1H), 7.71 - 7.69 (m, 1H), 3.92 (s, 3H).

[0200] Example 29: Synthesis of 2-(3-(trifluoromethoxy)phenyl)benzo[d]oxazole-5- carboxylic acid

[0201] The synthesis method refers to Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester is replaced by 2-(3-(trifluoromethoxy)phenyl)benzo[d]oxazole-5-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.37 (p, J = 0.8 Hz, 1H), 8.26 (dd, J = 7.9, 1.3 Hz, 1H), 8.14 - 8.05 (m, 2H), 7.97 (dt, J = 8.6, 0.8 Hz, 1H), 7.81 (t, J = 8.0 Hz, 1H), 7.71 - 7.69 (m, 1H), 3.92 (s, 3H).

[0202] Example 30: Synthesis of 2-(3,5-dimethoxyphenyl)benzo[d]oxazole-5-carboxylic acid methyl ester

[0203] The synthesis method refers to Example 6, except that 3-(trifluoromethoxy)benzoic acid is replaced by 3,5-dimethoxybenzoic acid, and 4-amino-3-hydroxybenzoic acid methyl ester is replaced by 3-amino-4-hydroxybenzoic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.37 (p, J = 0.8 Hz, 1H), 8.26 (dd, J = 7.9, 1.3 Hz, 1H), 8.14 - 8.05 (m, 2H), 7.97 (dt, J = 8.6, 0.8 Hz, 1H), 7.81 (t, J = 8.0 Hz, 1H), 7.71 - 7.69 (m, 1H), 3.92 (s, 3H).

[0204] Example 31: Synthesis of 2-(3,5-dimethoxyphenyl)benzo[d]oxazole-5-carboxylic acid

[0205] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3,5-dimethoxyphenyl)benzo[d]oxazole-5-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.15 (s, 1H), 8.32 (d, J = 1.6 Hz, 1H), 8.05 (dd, J = 8.5, 1.7 Hz, 1H), 7.90 (d, J = 8.5 Hz, 1H), 7.33 (d, J = 2.3 Hz, 2H), 6.79 (t, J = 2.3 Hz, 1H), 3.87 (s, 6H).

[0206] Example 32: Synthesis of 2-(3-methoxyphenyl)benzo[d]oxazole-5-carboxylic acid methyl ester

[0207] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-methoxybenzoic acid and 4-amino-3-hydroxybenzoic acid methyl ester was replaced by 3-amino-4-hydroxybenzoic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.15 (s, 1H), 8.32 (d, J = 1.6 Hz, 1H), 8.05 (dd, J = 8.5, 1.7 Hz, 1H), 7.90 (d, J = 8.5 Hz, 1H), 7.33 (d, J = 2.3 Hz, 2H), 6.79 (t, J = 2.3 Hz, 1H), 3.87 (s, 6H).

[0208] Example 33: Synthesis of 2-(3-methoxyphenyl)benzo[d]oxazole-5-carboxylic acid

[0209] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3-methoxyphenyl)benzo[d]oxazole-5-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.15 (s, 1H), 8.32 (d, J = 1.6 Hz, 1H), 8.05 (dd, J = 8.5, 1.7 Hz, 1H), 7.90 (d, J = 8.5 Hz, 1H), 7.33 (d, J = 2.3 Hz, 2H), 6.79 (t, J = 2.3 Hz, 1H), 3.87 (s, 6H).

[0210] Example 34: Synthesis of methyl 2-(2-fluoro-3-methoxyphenyl)benzo[d]oxazole-5- carboxylate

[0211] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced with 2-fluoro-3- methoxybenzoic acid and methyl 4-amino-3-hydroxybenzoate was replaced with methyl 3-amino-4-hydroxybenzoate. 1 H NMR (400 MHz, CDC13) δ 8.54 (d, J = 1.6 Hz, 1H), 8.16 (dd, J = 8.6, 1.7 Hz, 1H), 7.80 (ddd, J = 7.9, 5.9, 1.7 Hz, 1H), 7.67 (d, J = 8.6 Hz, 1H), 7.33 - 7.22 (m, 1H), 7.18 (td, J = 7.9, 1.7 Hz, 1H), 3.99 (s, 6H).

[0212] Example 35: Synthesis of 2-(2-fluoro-3-methoxyphenyl)benzo[d]oxazole-5-carboxylic acid

[0213] The synthesis was performed according to the procedure described in Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced with methyl 2-(2-fluoro-3-methoxyphenyl)benzo[d]oxazole-5-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 13.05 (s, 1H), 8.35 (d, J = 1.6 Hz, 1H), 8.07 (dd, J = 8.5, 1.7 Hz, 1H), 7.91 (d, J = 8.5 Hz, 1H), 7.76 - 7.72 (m, 1H), 7.47 (td, J = 8.1, 1.6 Hz, 1H), 7.37 (td, J = 8.1, 1.3 Hz, 1H), 3.93 (s, 3H).

[0214] Example 36: Synthesis of methyl 2-(2-fluoropyridin-4-yl)benzo[d]oxazole-6-carboxylate

[0215] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced with 2-fluoroisonicotinic acid. 1H NMR (400 MHz, CDC13) δ 8.47 (d, J = 5.2 Hz, 1H), 8.35 (d, J = 1.5 Hz, 1H), 8.18 (dd, J = 8.4, 1.5 Hz, 1H), 8.04 (dt, J = 5.2, 1.5 Hz, 1H), 7.89 (d, J = 8.4 Hz, 1H), 7.78 (t, J = 1.7 Hz, 1H), 4.01 (s, 3H).

[0216] Example 37: Synthesis of 2-(2-fluoropyridin-4-yl)benzo[d]oxazole-6-carboxylic acid

[0217] The synthesis method refers to Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester is replaced by 2-(2-fluoropyridin-4-yl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.55 (d, J = 5.1 Hz, 1H), 8.33 (d, J = 1.4 Hz, 1H), 8.14 - 8.05 (m, 2H), 7.98 (d, J = 8.4 Hz, 1H), 7.90 (d, J = 1.6 Hz, 1H).

[0218] Example 38: Synthesis of 2-(3,5-dichlorophenyl)-3a,7a dihydrobenzo[d]oxazole-6-carboxylic acid methyl ester

[0219] The synthesis method refers to Example 6, except that 3-(trifluoromethoxy)benzoic acid is replaced by 3,5-dichlorobenzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.47 (d, J = 5.2 Hz, 1H), 8.35 (d, J = 1.5 Hz, 1H), 8.18 (dd, J = 8.4, 1.5 Hz, 1H), 8.04 (dt, J = 5.2, 1.5 Hz, 1H), 7.89 (d, J = 8.4 Hz, 1H), 7.78 (t, J = 1.7 Hz, 1H), 4.01 (s, 3H).

[0220] Example 39: Synthesis of 2-(3-fluoro-5-methoxyphenyl)-1H-benzo[d]imidazole-6-carboxylic acid methyl ester

[0221] To 3-fluoro-5-methoxybenzaldehyde (1.54 g, 10 mmol) was added to 40% sodium bisulfite (4.16 g, 40 mmol) in water and stirred at room temperature for 1 hour. To methyl 3,4-diaminobenzoate (1.68 g, 10 mmol) was dissolved in 10 mL of ethanol and added dropwise to the above reaction system. The reaction was stirred at 100 °C for 6 hours. After cooling to room temperature, ethyl acetate was added and extracted three times, the organic layer was combined, washed with saturated sodium chloride once, dried over anhydrous sodium sulfate, and the organic solution was removed. The residue was purified by silica gel column chromatography (PE:EA (v:v) = 3:1) to give 2-(3-fluoro-5-methoxyphenyl)-1H-benzo[d]imidazole-6-carboxylic acid methyl ester 950 mg (yield 32%). 1 H NMR (400 MHz, DMSO-d6) δ 13.35 (s, 1H), 8.23 (s, 1H), 7.88 (d, J = 8.5 Hz, 1H), 7.70 (s, 1H), 7.63 (d, J = 2.2 Hz, 1H), 7.58 (dd, J = 9.6, 2.2 Hz, 1H), 7.03 (dt, J = 10.8, 2.4 Hz, 1H), 3.90 (s, 3H), 3.89 (s, 3H).

[0222] Example 40: Synthesis of 2-(3-fluoro-5-methoxyphenyl)-1H-benzo[d]imidazole-6- carboxylic acid

[0223] The synthesis method refers to Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester is replaced by 2-(3-fluoro-5-methoxyphenyl)-1H- benzo[d]imidazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.87 (s, 1H), 8.23 (d, J = 1.5 Hz, 1H), 7.90 (dd, J = 8.5, 1.6 Hz, 1H), 7.85-7.54 (m, 3H), 7.07-7.04 (m, 1H), 3.91 (s, 3H).

[0224] Example 41: Synthesis of 2-(3-fluoro-5-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid methyl ester

[0225] To 2-chlorobenzothiazole-6-carboxylic acid methyl ester (1.4 g, 6.15 mmol), 3-fluoro-5-methoxybenzoic acid (1.25 g, 7.38 mmol), tetrakis(triphenylphosphine)palladium (0.5 g, 0.43 mmol) and potassium phosphate (3.92 g, 18.5 mmol) were added into 20 mL 1,4-dioxane solution, which was protected by argon and placed in a microwave reactor for half an hour at 120 °C. After cooling to room temperature, it was extracted with ethyl acetate for three times, the organic layers were combined, washed with saturated sodium chloride once, dried over anhydrous sodium sulfate, and the organic solution was removed by rotary evaporation. The residue was purified by silica gel column chromatography (PE:EA (v:v) = 10:1) to give 2-(3-fluoro-5-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid methyl ester 1.22 g (yield 62%). 1 H NMR (400 MHz, CDCl3) δ 8.60 (d, J = 1.6 Hz, 1H), 8.16 (dd, J = 8.5, 1.7 Hz, 1H), 8.07 (d, J = 8.6 Hz, 1H), 7.44 (t, J = 1.9 Hz, 1H), 7.42-7.33 (m, 1H), 6.79-6.75 (m, 1H), 3.98 (s, 3H), 3.91 (s, 3H).

[0226] Example 42: Synthesis of 2-(3-fluoro-5-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid

[0227] The synthesis method refers to Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester is replaced by 2-(3-fluoro-5-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.12 (s, 1H), 8.77 (d, J = 1.6 Hz, 1H), 8.13 (d, J = 8.5 Hz, 1H), 8.08 (dd, J = 8.5, 1.7 Hz, 1H), 7.56-7.37 (m, 2H), 7.10 (dt, J = 10.8, 2.3 Hz, 1H), 3.89 (s, 3H).

[0228] Example 43: Synthesis of 2-(3-methoxyphenyl)benzo[d]thiazole-5-carboxylic acid methyl ester

[0229] To 4-chloro-3-nitrobenzoic acid methyl ester (1.08 g, 5 mmol), 3-methoxybenzylamine (1.7 g, 12.5 mmol), sulfur (0.24 g, 7.5 mmol) were added into 5 mL of pyridine, under argon protection, 100 °C for 24 hours. Cooled to room temperature, extracted with ethyl acetate three times, combined the organic layer, washed with saturated sodium chloride once, dried over anhydrous sodium sulfate, the organic solution was removed, the residue was purified by silica gel column chromatography (PE:EA (v:v) = 5:1) to give 2-(3-methoxyphenyl)benzo[d]thiazole-5-carboxylic acid methyl ester 0.86 g (yield 57%). 1 H NMR (400 MHz, CDC13) δ 8.76 (d, J = 1.6 Hz, 1H), 8.08 (dd, J = 8.4, 1.6 Hz, 1H), 7.96 (d, J = 8.4 Hz, 1H), 7.70 (dd, J = 2.6, 1.6 Hz, 1H), 7.69 - 7.60 (m, 1H), 7.43 (t, J = 8.0 Hz, 1H), 7.10 - 7.07 (m, 1H), 4.00 (s, 3H), 3.94 (s, 3H).

[0230] Example 44: Synthesis of 2-(3-methoxyphenyl)benzo[d]thiazole-5-carboxylic acid

[0231] The synthesis method refers to Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester is replaced by 2-(3-methoxyphenyl)benzo[d]thiazole-5-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.15 (s, 1H), 8.53 (d, J = 1.6 Hz, 1H), 8.24 (d, J = 8.3 Hz, 1H), 8.00 (dd, J = 8.4, 1.6 Hz, 1H), 7.73 - 7.55 (m, 2H), 7.49 (t, J = 7.9 Hz, 1H), 7.17 (dd, J = 8.3, 2.6 Hz, 1H), 3.87 (s, 3H).

[0232] Example 45: Synthesis of 2-(3-methoxyphenyl)-1H-indole-5-carboxylic acid

[0233] Step 1. Preparation of methyl 4-amino-3-((3-methoxyphenyl)ethynyl)benzoate

[0234] To 4-amino-3-iodobenzoic acid methyl ester (2.70 g, 10 mmol), 3-ethynylanisole (1.5 g, 11 mmol), copper iodide (39 mg, 0.2 mmol) and bis(triphenylphosphine)palladium dichloride (140 mg, 0.2 mmol) were added into 20 mL of triethylamine, and the reaction was carried out at room temperature for 8 hours under argon protection. Ethyl acetate was added to extract three times, the organic layers were combined, washed with saturated sodium chloride once, dried over anhydrous sodium sulfate, and the organic solution was removed by rotary evaporation. The residue was subjected to silica gel column chromatography (PE:EA (v:v) = 5:1) to obtain 4-amino-3-((3-methoxyphenyl)ethynyl)benzoic acid methyl ester 2.5 g (yield 89%). 1 H NMR (400 MHz, DMSO-d6) δ 7.85 (d, J = 2.1 Hz, 1H), 7.67 (dd, J = 8.6, 2.1 Hz, 1H), 7.32 (t, J = 7.9 Hz, 1H), 7.28 - 7.19 (m, 2H), 6.97 (ddd, J = 8.3, 2.7, 1.0 Hz, 1H), 6.78 (d, J = 8.7 Hz, 1H), 6.40 (s, 2H), 3.80 (s, 3H), 3.77 (s, 3H).

[0235] Step 2. Preparation of 2-(3-methoxyphenyl)-1H-indole-5-carboxylic acid

[0236] To 4-amino-3-((3-methoxyphenyl)ethynyl)benzoic acid methyl ester (2.5 g, 8.9 mmol) and potassium tert-butoxide (3.0 g, 26.7 mmol) were added into 20 mL of N-methylpyrrolidone solution. The reaction was carried out at 100°C for 12 hours. After cooling to room temperature, dilute hydrochloric acid was added to adjust the pH to about 7, and ethyl acetate was added to extract three times. The organic layers were combined, washed with saturated sodium chloride once, dried over anhydrous sodium sulfate, and the organic solution was removed by rotary evaporation. The residue was subjected to silica gel column chromatography (PE:EA (v:v) = 1:1) to obtain 2-(3-methoxyphenyl)-1H-indole-5-carboxylic acid 2.1 g (yield 88%). 1 H NMR (400 MHz, DMSO-d6) δ 7.85 (d, J = 2.1 Hz, 1H), 7.67 (dd, J = 8.6, 2.1 Hz, 1H), 7.32 (t, J = 7.9 Hz, 1H), 7.28 - 7.19 (m, 2H), 6.97 (ddd, J = 8.3, 2.7, 1.0 Hz, 1H), 6.78 (d, J = 8.7 Hz, 1H), 6.40 (s, 2H), 3.80 (s, 3H), 3.77 (s, 3H).

[0237] Example 46: Synthesis of 2-(3-methoxyphenyl)-1H-indole-5-carboxylic acid methyl ester

[0238] The synthesis was performed according to the procedure of Reference Example 1, Step 3, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid was replaced by 2-(3- methoxyphenyl)-lH-indole-5-carboxylic acid. 1 H NMR (400 MHz, DMSO-d6) δ 11.93 (s, 1H), 8.25 (s, 1H), 7.75 (dd, J = 8.6, 1.5 Hz, 1H), 7.61 - 7.43 (m, 3H), 7.40 (t, J = 7.9 Hz, 1H), 7.10 (s, 1H), 6.94 (dd, J = 8.0, 2.2 Hz, 1H), 3.86 (s, 3H), 3.85 (s, 3H).

[0239] Example 47: Synthesis of methyl 2-(3-methoxyphenyl)-l-methyl-lH-indole-5- carboxylate

[0240] Methyl 2-(3-methoxyphenyl)-lH-indole-5-carboxylate (0.28 g, 1 mmol) and 60% sodium hydride (0.12 g, 3 mmol) were placed in an ice water bath and protected by argon. 5 mL of N,N-dimethylformamide was added slowly and after the temperature was dropped to 0 °C, iodomethane (0.21 g, 1.5 mmol) was added dropwise. After the addition was completed, the reaction was allowed to proceed at room temperature for 5 hours. Ethyl acetate was added to extract three times and the organic layers were combined, washed with saturated sodium chloride once, dried over anhydrous sodium sulfate, and the organic solution was removed. The residue was purified by silica gel column chromatography (PE:EA (v:v) = 10:1) to give methyl 2-(3-methoxyphenyl)-l-methyl-lH-indole-5-carboxylate 0.18 g (yield 61%). 1 H NMR (400 MHz, DMSO-d6) δ 8.28 (d, J = 1.6 Hz, 1H), 7.82 (dd, J = 8.7, 1.7 Hz, 1H), 7.61 (d, J = 8.7 Hz, 1H), 7.46 (t, J = 7.9 Hz, 1H), 7.23 - 7.13 (m, 2H), 7.08 - 7.04 (m, 1H), 6.76 (d, J = 0.8 Hz, 1H), 3.86 (s, 3H), 3.84 (s, 3H), 3.80 (s, 3H).

[0241] Example 48: Synthesis of 2-(3-methoxyphenyl)-l-methyl-lH-indole-5-carboxylic acid

[0242] The synthesis was performed according to the procedure of Reference Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(3- methoxyphenyl)-l-methyl-lH-indole-5-carboxylate. 1H NMR (400 MHz, DMSO-d6) δ 12.49 (s, 1H), 8.25 (s, 1H), 7.81 (d, J = 8.6 Hz, 1H), 7.58 (d, J = 8.7 Hz, 1H), 7.45 (t, J = 7.9 Hz, 1H), 7.23 - 7.08 (m, 2H), 7.05 (dd, J = 8.3, 2.6 Hz, 1H), 6.74 (s, 1H), 3.84 (s, 3H), 3.80 (s, 3H).

[0243] Example 49: Synthesis of 2-(3-methoxyphenyl)-1H-indole-6-carboxylic acid

[0244] The synthesis method refers to Example 45, except that 4-amino-3-iodobenzoic acid methyl ester is replaced by 3-amino-4-iodobenzoic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.50 (s, 1H) 11.87 (d, J = 2.2 Hz, 1H), 8.04 (d, J = 1.4 Hz, 1H), 7.69 - 7.55 (m, 2H), 7.53 - 7.45 (m, 2H), 7.41 (t, J = 7.8 Hz, 1H), 7.03 (d, J = 2.1 Hz, 1H), 7.00 - 6.91 (m, 1H), 3.86 (s, 3H).

[0245] Example 50: Synthesis of 2-(3-methoxyphenyl)-1H-indole-6-carboxylic acid methyl ester

[0246] The synthesis method refers to step 3 of Example 1, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid is replaced by 2-(3-methoxyphenyl)-1H-indole-6-carboxylic acid. 1 H NMR (400 MHz, DMSO-d6) δ 11.92 (s, 1H), 8.06 (q, J = 1.1 Hz, 1H), 7.63 (d, J = 1.3 Hz, 2H), 7.55 - 7.46 (m, 2H), 7.42 (t, J = 7.9 Hz, 1H), 7.05 (dd, J = 2.2, 0.9 Hz, 1H), 6.97 (ddd, J = 8.1, 2.5, 1.0 Hz, 1H), 3.87 (s, 3H), 3.86 (s, 3H).

[0247] Example 51: Synthesis of 2-(3-methoxyphenyl)-1-methyl-1H-indole-6-carboxylic acid methyl ester

[0248] The synthesis was performed according to the procedure described in Example 47, except that 2-(3-methoxyphenyl)-lH-indole-5-carboxylic acid methyl ester was replaced by 2-(3- methoxyphenyl)-lH-indole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.15 (s, 1H), 7.71 (dd, J = 8.2, 1.4 Hz, 1H), 7.66 (d, J = 8.3 Hz, 1H), 7.46 (t, J = 7.9 Hz, 1H), 7.25 - 7.12 (m, 2H), 7.06 (dd, J = 8.3, 2.6 Hz, 1H), 6.70 (s, 1H), 3.89 (s, 3H), 3.84 (s, 3H), 3.83 (s, 3H).

[0249] Example 52: Synthesis of 2-(3-methoxyphenyl)-l-methyl-lH-indole-6-carboxylic acid

[0250] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3- methoxyphenyl)-l-methyl-lH-indole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.15 (s, 1H), 7.71 (dd, J = 8.2, 1.4 Hz, 1H), 7.66 (d, J = 8.3 Hz, 1H), 7.46 (t, J = 7.9 Hz, 1H), 7.25 - 7.12 (m, 2H), 7.06 (dd, J = 8.3, 2.6 Hz, 1H), 6.70 (s, 1H), 3.89 (s, 3H), 3.84 (s, 3H), 3.83 (s, 3H).

[0251] Example 53: Synthesis of 2-(3-fluoro-5-(trifluoromethyl)phenyl)benzo[d]oxazole-6- carboxylic acid methyl ester

[0252] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-fluoro-5- (trifluoromethyl)benzoic acid. 1 H NMR (400 MHz, CDCl3) δ 8.35 (s, 1H), 8.30 (d, J = 1.5 Hz, 1H), 8.20 - 8.08 (m, 2H), 7.82 (d, J = 8.4 Hz, 1H), 7.54 (dt, J = 8.1, 2.0 Hz, 1H), 4.00 (s, 3H).

[0253] Example 54: Synthesis of 2-(3-fluoro-5-(trifluoromethyl)phenyl)benzo[d]oxazole-6- carboxylic acid

[0254] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3- fluoro-5-(trifluoromethyl)phenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.26-8.23 (m, 3H), 8.03-8.01 (m, 2H), 7.90 (d, J = 8.4 Hz, 1H).

[0255] Example 55: Synthesis of 2-(2-fluoro-5-(trifluoromethyl)phenyl)-3a,7a dihydrobenzo[d]oxazole-6-carboxylic acid methyl ester

[0256] The synthesis was performed according to reference example 6, except that 3- (trifluoromethoxy)benzoic acid was replaced by 2-fluoro-5-(trifluoromethyl)benzoic acid. 1 H NMR (400 MHz, CDCl3) δ 8.60 (dd, J = 6.5, 2.4 Hz, 1H), 8.36 (d, J = 1.5 Hz, 1H), 8.16 (dd, J = 8.3, 1.5 Hz, 1H), 7.90 (d, J = 8.4 Hz, 1H), 7.88-7.78 (m, 1H), 7.45 (t, J = 9.4 Hz, 1H), 4.00 (s, 3H).

[0257] Example 56: Synthesis of 2-(2-fluoro-5-(trifluoromethyl)phenyl)benzo[d]oxazole-6- carboxylic acid

[0258] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(2- fluoro-5-(trifluoromethyl)phenyl)-3a,7a dihydrobenzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.51 (dd, J = 6.4, 2.4 Hz, 1H), 8.32 (s, 1H), 8.18-8.10 (m, 1H), 8.06 (dd, J = 8.3, 1.5 Hz, 1H), 7.95 (d, J = 8.3 Hz, 1H), 7.78 (t, J = 9.6 Hz, 1H).

[0259] Example 57: Synthesis of 2-(3-fluoro-5-methylphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester

[0260] The synthesis was performed according to reference example 6, except that 3- (trifluoromethoxy)benzoic acid was replaced by 3-fluoro-5-methylbenzoic acid. 1 HNMR (400 MHz, CDC13) δ 8.28 (d, J = 1.5 Hz, 1H), 8.12 (dd, J = 8.4, 1.5 Hz, 1H), 7.91 (d, J = 1.9 Hz, 1H), 7.78 (dd, J = 12.3, 8.7 Hz, 2H), 7.10 (dt, J = 9.3, 2.0 Hz, 1H), 3.99 (s, 3H), 2.48 (s, 3H).

[0261] Example 58: Synthesis of 2-(3-fluoro-5-methylphenyl)benzo[d]oxazole-6- carboxylic acid

[0262] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3- fluoro-5-methylphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.23 (s, 1H), 8.01 (d, J = 8.3 Hz, 1H), 7.87 (d, J = 7.7 Hz, 2H), 7.72 (d, J = 9.2 Hz, 1H), 7.34 (d, J = 9.7 Hz, 1H), 2.44 (s, 3H).

[0263] Example 59: Synthesis of 2-(2,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester

[0264] The synthesis was performed according to reference example 6, except that 3- (trifluoromethoxy)benzoic acid was replaced by 2,5-difluorobenzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.40-8.22 (m, 1H), 8.14 (dd, J = 8.4, 1.5 Hz, 1H), 8.02-7.90 (m, 1H), 7.87 (dd, J = 8.4, 0.6 Hz, 1H), 7.33-7.20 (m, 2H), 3.99 (s, 3H).

[0265] Example 60: Synthesis of 2-(2,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid

[0266] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(2,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1H NMR (400 MHz, DMSO-d6) δ 8.25 (d, J = 1.5 Hz, 1H), 8.02 (dd, J = 8.3, 1.5 Hz, 1H), 7.92 (dd, J = 13.1, 6.9 Hz, 2H), 7.65 - 7.46 (m, 2H).

[0267] Example 61: Synthesis of methyl 2-(3-methoxyphenyl)-2,3-dihydrobenzofuran-5- carboxylate

[0268] Methyl 3-methyl-4-nitrobenzoate (2.0 g, 10.2 mmol), 3-methoxybenzaldehyde (1.5 g, 11.2 mmol) were dissolved in 20 mL of tetrahydrofuran. N,N- diisopropylethylamine (2.6 g, 20.5 mmol) and tetrabutylammonium fluoride (4.8 g, 18.4 mmol, 70-75% content) were added successively. The reaction was carried out at 80 °C for 16 hours. Ethyl acetate was added to extract three times, the organic layers were combined, washed with saturated sodium chloride once, dried over anhydrous sodium sulfate, and the organic solution was removed by rotary evaporation. The residue was purified by silica gel column chromatography (PE:EA (v:v) = 20:1) to obtain methyl 2-(3-methoxyphenyl)-2,3-dihydrobenzofuran-5-carboxylate 1.7 g (yield 58%). 1 H NMR (400 MHz, CDCl3) δ 8.11 - 7.85 (m, 2H), 7.32 (t, J = 7.9 Hz, 1H), 7.03 - 6.92 (m, 2H), 6.93 - 6.83 (m, 2H), 5.84 (dd, J = 9.6, 8.0 Hz, 1H), 3.91 (s, 3H), 3.83 (s, 3H), 3.68 (dd, J = 15.8, 9.6 Hz, 1H), 3.26 (dd, J = 15.8, 8.0 Hz, 1H).

[0269] Example 62: Synthesis of 2-(3-methoxyphenyl)-2,3-dihydrobenzofuran-5-carboxylic acid

[0270] The synthesis method refers to Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester is replaced by 2-(3-methoxyphenyl)-2,3- dihydrobenzofuran-5-carboxylic acid methyl ester. 1H NMR (400 MHz, DMSO-d6) δ 12.56 (s, 1H), 7.81 (d, J = 8.1 Hz, 2H), 7.32 (t, J = 7.8 Hz, 1H), 7.02 - 6.85 (m, 4H), 5.91 (dd, J = 9.5, 7.8 Hz, 1H), 3.76 (s, 3H), 3.73 - 3.67 (m, 1H), 3.17 (dd, J = 16.1, 7.8 Hz, 1H).

[0271] Example 63: Synthesis of methyl 2-(3-methoxyphenyl)benzofuran-5-carboxylate

[0272] Step 1. Preparation of methyl 4-hydroxy-3-((3-methoxyphenyl)ethynyl)benzoate

[0273] To methyl 4-hydroxy-3-iodobenzoate (2.0 g, 7.2 mmol), 3-ethynylanisole (1.9 g, 14.4 mmol), copper iodide (55 mg, 0.23 mmol) and bis(triphenylphosphine)palladium dichloride (100 mg, 0.14 mmol) were added into 20 mL of triethylamine and 50 mL of tetrahydrofuran solution. Argon protection, reaction at room temperature for 16 hours. Added ethyl acetate to extract three times, combined the organic layer, washed with saturated sodium chloride once, dried with anhydrous sodium sulfate, the organic solution was removed by rotary evaporation, and the residue was purified by silica gel column chromatography (PE:EA (v:v) = 10:1) to give methyl 4-hydroxy-3-((3-methoxyphenyl)ethynyl)benzoate 1.7 g (yield 83%). 1 H NMR (400 MHz, CDCl3) δ 8.34 (d, J = 1.8 Hz, 1H), 8.04 (dd, J = 8.7, 1.8 Hz, 1H), 7.57 (dt, J = 8.7, 0.8 Hz, 1H), 7.49 (dt, J = 7.7, 1.3 Hz, 1H), 7.46 - 7.36 (m, 2H), 7.09 (d, J = 0.9 Hz, 1H), 6.96 (ddd, J = 8.2, 2.6, 1.0 Hz, 1H), 3.97 (s, 3H), 3.93 (s, 3H).

[0274] Step 2. Preparation of methyl 2-(3-methoxyphenyl)benzofuran-5-carboxylate

[0275] Methyl 2-(3-methoxyphenyl)benzofuran-5-carboxylate was synthesized according to the procedure of Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6- carboxylate was replaced by methyl 2-(3-methoxyphenyl)benzofuran-5-carboxylate. 1 H NMR (400 MHz, CDC13) δ 8.58 (d, J = 1.6 Hz, 1H), 8.11 (dd, J = 8.7, 1.7 Hz, 1H), 7.87 (s, 1H), 7.60 (d, J = 8.6 Hz, 1H), 7.45 (t, J = 7.9 Hz, 1H), 7.28 - 7.24 (m, 1H), 7.20 (t, J = 2.0 Hz, 1H), 6.98 (dd, J = 8.3, 2.5 Hz, 1H), 3.97 (s, 3H), 3.92 (s, 3H).

[0276] Example 64: Synthesis of 2-(3-methoxyphenyl)benzofuran-5-carboxylic acid

[0277] The synthesis method refers to Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate is replaced by methyl 2-(3-methoxyphenyl)benzofuran-5-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 13.04 (s, 1H), 8.51 (s, 1H), 8.46 (d, J = 1.6 Hz, 1H), 8.01 (dd, J = 8.7, 1.7 Hz, 1H), 7.78 (d, J = 8.6 Hz, 1H), 7.48 (t, J = 7.9 Hz, 1H), 7.32 (d, J = 7.6 Hz, 1H), 7.26 (t, J = 2.1 Hz, 1H), 7.02 (dd, J = 8.4, 2.6 Hz, 1H), 3.85 (s, 3H).

[0278] Example 65: Synthesis of 2-(3-methoxyphenyl)benzothiophene-5-carbonitrile

[0279] To a solution of 2-(3-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid (0.5 g, 1.8 mmol) in 10 mL of DMF was added 1-hydroxybenzotriazole (0.3 g, 2.2 mmol), N,N- dimethylformamide (0.3 mL, 2.2 mmol), and N,N-diisopropylcarbodiimide (0.3 mL, 2.2 mmol). The mixture was stirred at room temperature for 30 min, and then 3-aminopiperidine (0.2 mL, 1.8 mmol) was added. The mixture was stirred at room temperature for 12 h. The reaction mixture was diluted with ethyl acetate and washed with saturated sodium chloride solution. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by column chromatography (PE:EA (v:v) = 10:1) to give 2-(3-methoxyphenyl)-N-(piperidin-4-yl)benzo[d]thiazole-6-carboxamide 0.4 g (yield 68%). 1 HNMR (400 MHz, DMSO-d6) δ 8.36 (d, J = 1.5 Hz, 1H), 8.23 (d, J = 8.4 Hz, 1H), 8.00 (s, 1H), 7.73 (dd, J = 8.4, 1.6 Hz, 1H), 7.44 (t, J = 7.8 Hz, 1H), 7.40-7.31 (m, 2H), 7.03 (ddd, J = 8.1, 2.5, 1.1 Hz, 1H), 3.86 (s, 3H).

[0280] Example 66: Synthesis of 2-(3-methoxyphenyl)benzo[b]thiophene-5-carboxylic acid

[0281] To a solution of 2-(3-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid (0.5 g, 1.8 mmol) in 10 mL of DMF was added 1-hydroxybenzotriazole (0.3 g, 2.2 mmol), N,N- dimethylformamide (0.3 mL, 2.2 mmol), and N,N-diisopropylcarbodiimide (0.3 mL, 2.2 mmol). The mixture was stirred at room temperature for 30 min, and then 3-aminopiperidine (0.2 mL, 1.8 mmol) was added. The mixture was stirred at room temperature for 12 h. The reaction mixture was diluted with ethyl acetate and washed with saturated sodium chloride solution. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by column chromatography (PE:EA (v:v) = 10:1) to give 2-(3-methoxyphenyl)-N-(piperidin-4-yl)benzo[d]thiazole-6-carboxamide 0.4 g (yield 68%). 1 HNMR (400 MHz, DMSO-d6) δ 8.36 (d, J = 1.5 Hz, 1H), 8.23 (d, J = 8.4 Hz, 1H), 8.00 (s, 1H), 7.73 (dd, J = 8.4, 1.6 Hz, 1H), 7.44 (t, J = 7.8 Hz, 1H), 7.40-7.31 (m, 2H), 7.03 (ddd, J = 8.1, 2.5, 1.1 Hz, 1H), 3.86 (s, 3H).

[0282] Example 67: Synthesis of methyl 2-(3-(trifluoromethyl)phenyl)benzo[d]thiazole-6- carboxylate To a solution of 2-(3-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid (0.5 g, 1.8 mmol) in 10 mL of DMF was added 1-hydroxybenzotriazole (0.3 g, 2.2 mmol), N,N- dimethylformamide (0.3 mL, 2.2 mmol), and N,N-diisopropylcarbodiimide (0.3 mL, 2.2 mmol). The mixture was stirred at room temperature for 30 min, and then 3-aminopiperidine (0.2 mL, 1.8 mmol) was added. The mixture was stirred at room temperature for 12 h. The reaction mixture was diluted with ethyl acetate and washed with saturated sodium chloride solution. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by column chromatography (PE:EA (v:v) = 10:1) to give 2-(3-methoxyphenyl)-N-(piperidin-4-yl)benzo[d]thiazole-6-carboxamide 0.4 g (yield 68%).

[0283] The synthesis was performed according to reference example 41, except that 3- fluoro-5-methoxyboronic acid was replaced by 3-trifluoromethylbenzeneboronic acid. 1 H NMR (400 MHz, CDC13) δ 8.68 (d, J = 1.6 Hz, 1H), 8.42 (d, J = 1.8 Hz, 1H), 8.29 (dt, J = 8.1, 1.5 Hz, 1H), 8.22 (dd, J = 8.6, 1.7 Hz, 1H), 8.14 (d, J = 8.5 Hz, 1H), 7.84 - 7.75 (m, 1H), 7.68 (t, J = 7.8 Hz, 1H), 4.01 (s, 3H).

[0284] Example 68: Synthesis of 2-(3-(trifluoromethyl)phenyl)benzo[d]thiazole-6- carboxylic acid

[0285] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3- (trifluoromethyl)phenyl)benzo[d]thiazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.19 (s, 1H), 8.80 (d, J = 1.7 Hz, 1H), 8.45 - 8.30 (m, 2H), 8.16 (d, J = 8.5 Hz, 1H), 8.10 (dd, J = 8.6, 1.6 Hz, 1H), 7.97 (d, J = 7.8 Hz, 1H), 7.83 (t, J = 8.0 Hz, 1H).

[0286] Example 69: Synthesis of 2-(4-fluoro-3-methoxyphenyl)benzo[d]thiazole-6- carboxylic acid methyl ester

[0287] The synthesis was performed according to reference example 41, except that 3- fluoro-5-methoxyboronic acid was replaced by 4-fluoro-3-methoxybenzeneboronic acid. 1 H NMR (400 MHz, CDC13) δ 8.64 (d, J = 1.7 Hz, 1H), 8.22 - 8.17 (m, 1H), 8.09 (d, J = 8.6 Hz, 1H), 7.84 (dd, J = 8.1, 2.1 Hz, 1H), 7.60 (ddd, J = 8.4, 4.2, 2.1 Hz, 1H), 7.21 (dd, J = 10.6, 8.4 Hz, 1H), 4.05 (s, 3H), 4.00 (s, 3H).

[0288] Example 70: Synthesis of 2-(4-fluoro-3-methoxyphenyl)benzo[d]thiazole-6- carboxylic acid

[0289] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(4- fluoro-3-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.77 (d, J = 1.6 Hz, 1H), 8.17 - 8.05 (m, 2H), 7.85 (dd, J = 8.2, 2.2 Hz, 1H), 7.70 (ddd, J = 8.5, 4.3, 2.2 Hz, 1H), 7.45 (dd, J = 11.1, 8.4 Hz, 1H), 4.00 (s, 3H).

[0290] Example 71 : Synthesis of 2-(3-(trifluoromethoxy)phenyl)benzo[d]thiazole-6- carboxylic acid methyl ester

[0291] The synthesis was performed according to reference example 41, except that 3-fluoro-5- methoxyboronic acid was replaced by 3-trifluoromethoxybenzoic acid. 1 H NMR (400 MHz, CDCl3) δ 8.67 (d, J = 1.6 Hz, 1H), 8.21 (dd, J = 8.6, 1.7 Hz, 1H), 8.14 (d, J = 8.6 Hz, 1H), 8.04 (dd, J = 6.0, 1.7 Hz, 2H), 7.58 (t, J = 8.2 Hz, 1H), 7.47 - 7.36 (m, 1H), 4.00 (s, 3H).

[0292] Example 72: Synthesis of 2-(3-(trifluoromethoxy)phenyl)benzo[d]thiazole-6- carboxylic acid

[0293] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3-(trifluoromethoxy)phenyl)benzo[d]thiazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.80 (s, 1H), 8.26 - 8.00 (m, 4H), 7.75 (t, J = 8.0 Hz, 1H), 7.63 (d, J = 8.3 Hz, 1H).

[0294] Example 73: Synthesis of 2-(2-fluoro-3-methoxyphenyl)benzo[d]thiazole-6- carboxylic acid methyl ester

[0295] The synthesis was performed according to the procedure described in Reference Example 41, except that 3-fluoro-5-methoxyboronic acid was replaced by 2-fluoro-3- methoxybenzeneboronic acid. 1 HNMR (400 MHz, CDC13) δ 8.70 (d, J = 1.6 Hz, 1H), 8.27-8.12 (m, 2H), 8.02 (ddd, J = 7.9, 6.0, 1.6 Hz, 1H), 7.26 (dd, J = 8.1, 1.4 Hz, 1H), 7.15 (td, J = 8.1, 1.6 Hz, 1H), 4.00 (s, 3H), 3.99 (s, 3H).

[0296] Example 74: Synthesis of 2-(2-fluoro-3-methoxyphenyl)benzo[d]thiazole-6- carboxylic acid

[0297] The synthesis was performed according to the procedure described in Reference Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(2-fluoro-3-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.82 (s, 1H), 8.18 (d, J = 8.6 Hz, 1H), 8.11 (d, J = 8.4 Hz, 1H), 7.91 (t, J = 7.5 Hz, 1H), 7.40 (dt, J = 25.5, 8.1 Hz, 2H), 3.94 (s, 3H).

[0298] Example 75: Synthesis of 2-(3-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid methyl ester

[0299] The synthesis was performed according to the procedure described in Reference Example 41, except that 3-fluoro-5-methoxyboronic acid was replaced by 3-methoxybenzeneboronic acid. 1 H NMR (400 MHz, CDC13) δ 8.63 (d, J = 1.7 Hz, 1H), 8.18 (dd, J = 8.6, 1.7 Hz, 1H), 8.10 (d, J = 8.5 Hz, 1H), 7.81-7.61 (m, 2H), 7.42 (t, J = 7.9 Hz, 1H), 7.09 (ddd, J = 8.2, 2.6, 0.9 Hz, 1H), 3.99 (s, 3H), 3.94 (s, 3H).

[0300] Example 76: Synthesis of 2-(3-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid

[0301] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.77 (d, J = 1.6 Hz, 1H), 8.14 (d, J = 8.5 Hz, 1H), 8.09 (dd, J = 8.6, 1.7 Hz, 1H), 7.68 (d, J = 7.6 Hz, 1H), 7.64 (t, J = 2.1 Hz, 1H), 7.52 (t, J = 8.0 Hz, 1H), 7.20 (dd, J = 8.2, 2.6 Hz, 1H), 3.88 (s, 3H).

[0302] Example 77: Synthesis of 2-(2-hydroxy-3-methoxyphenyl)benzo[d]thiazole-6- carboxylic acid methyl ester

[0303] The synthesis was performed according to the procedure described in Example 41, except that 3-fluoro-5-methoxyboronic acid was replaced by 2-hydroxy-3- methoxybenzoic acid. 1 H NMR (400 MHz, DMSO-d6) δ 8.77 (d, J = 1.6 Hz, 1H), 8.14 (d, J = 8.5 Hz, 1H), 8.09 (dd, J = 8.6, 1.7 Hz, 1H), 7.68 (d, J = 7.6 Hz, 1H), 7.64 (t, J = 2.1 Hz, 1H), 7.52 (t, J = 8.0 Hz, 1H), 7.20 (dd, J = 8.2, 2.6 Hz, 1H), 3.88 (s, 3H).

[0304] Example 78: Synthesis of 2-(2-hydroxy-3-methoxyphenyl)benzo[d]thiazole-6- carboxylic acid

[0305] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(2-hydroxy-3-methoxyphenyl)benzo[d]thiazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.77 (d, J = 1.6 Hz, 1H), 8.14 (d, J = 8.5 Hz, 1H), 8.09 (dd, J = 8.6, 1.7 Hz, 1H), 7.68 (d, J = 7.6 Hz, 1H), 7.64 (t, J = 2.1 Hz, 1H), 7.52 (t, J = 8.0 Hz, 1H), 7.20 (dd, J = 8.2, 2.6 Hz, 1H), 3.88 (s, 3H).

[0306] Example 79: Synthesis of 2-(2-methoxypyridin-4-yl)benzo[d]thiazole-6-carboxylic acid methyl ester

[0307] The synthesis method refers to example 41, except that 3-fluoro-5-methoxy- benzenboronic acid is replaced by 2-methoxypyridin-4-ylboronic acid. 1 H NMR (400 MHz, CDC13) δ 8.69 (d, J = 1.7 Hz, 1H), 8.35 (d, J = 5.5 Hz, 1H), 8.22 (dd, J = 8.6, 1.7 Hz, 1H), 8.16 (d, J = 8.6 Hz, 1H), 7.58 (dd, J = 5.3, 1.5 Hz, 1H), 7.42 (d, J = 1.4 Hz, 1H), 7.28 (s, 1H), 4.04 (s, 3H), 4.00 (s, 3H).

[0308] Example 80: Synthesis of 2-(2-methoxypyridin-4-yl)benzo[d]thiazole-6-carboxylic acid

[0309] The synthesis method refers to example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester is replaced by 2-(2-methoxypyridin-4-yl)benzo[d]thiazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.83 (d, J = 1.6 Hz, 1H), 8.39 (d, J = 5.3 Hz, 1H), 8.20 (d, J = 8.5 Hz, 1H), 8.12 (dd, J = 8.6, 1.7 Hz, 1H), 7.64 (dd, J = 5.3, 1.5 Hz, 1H), 7.42 (d, J = 1.4 Hz, 1H), 3.95 (s, 3H).

[0310] Example 81: Synthesis of 2-(3-methoxyphenyl)benzo[b]thiophene-5-carboxylic acid methyl ester

[0311] 2-(3-methoxyphenyl)benzo[b]thiophene-5-carboxylic acid (100 mg, 0.35 mmol) was dissolved in 5 mL of anhydrous methanol, 1 mL of dichlorosulfoxide was slowly added dropwise, and the reaction was refluxed for 1 hour. After cooling to room temperature, the solvent was removed under reduced pressure, and the residue was subjected to silica gel column chromatography (PE:EA (v:v) = 10:1) to obtain 2-(3-methoxyphenyl)benzo[b]thiophene-5-carboxylic acid methyl ester 71 mg (yield 68%). 1H NMR (400 MHz, CDC13) δ 8.50 (d, J = 1.6 Hz, 1H), 8.00 (dd, J = 8.4, 1.6 Hz, 1H), 7.89 (d, J = 8.5 Hz, 1H), 7.62 (s, 1H), 7.45 - 7.32 (m, 2H), 7.27 (d, J = 2.2 Hz, 1H), 6.98 - 6.88 (m, 1H), 3.99 (s, 3H), 3.91 (s, 3H).

[0312] Example 82: Synthesis of methyl 2-(3,5-bis(trifluoromethyl)phenyl)benzo[d]oxazole-6- carboxylate

[0313] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3,5-bis(trifluoromethyl)benzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.50 (d, J = 1.6 Hz, 1H), 8.00 (dd, J = 8.4, 1.6 Hz, 1H), 7.89 (d, J = 8.5 Hz, 1H), 7.62 (s, 1H), 7.45 - 7.32 (m, 2H), 7.27 (d, J = 2.2 Hz, 1H), 6.98 - 6.88 (m, 1H), 3.99 (s, 3H), 3.91 (s, 3H).

[0314] Example 83: Synthesis of 2-(3,5-bis(trifluoromethyl)phenyl)benzo[d]oxazole-6-carboxylic acid

[0315] The synthesis was performed according to the procedure described in Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(3,5- bis(trifluoromethyl)phenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, CDC13) δ 8.50 (d, J = 1.6 Hz, 1H), 8.00 (dd, J = 8.4, 1.6 Hz, 1H), 7.89 (d, J = 8.5 Hz, 1H), 7.62 (s, 1H), 7.45 - 7.32 (m, 2H), 7.27 (d, J = 2.2 Hz, 1H), 6.98 - 6.88 (m, 1H), 3.99 (s, 3H), 3.91 (s, 3H).

[0316] Example 84: Synthesis of methyl 2-(3-(methylamino)phenyl)benzo[d]oxazole-6-carboxylate

[0317] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-(methylamino)benzoic acid. 1H NMR (400 MHz, DMSO-d6) δ 8.30 (s, 1H), 8.03 (dt, J = 8.3, 1.3 Hz, 1H), 7.90 (d, J = 8.3 Hz, 1H), 7.49 - 7.28 (m, 3H), 6.84 (d, J = 8.2 Hz, 1H), 6.13 (d, J = 5.5 Hz, 1H), 3.91 (s, 3H), 2.77 (d, J = 5.0 Hz, 3H).

[0318] Example 85: Synthesis of methyl 2-(benzo[d][l,3]dioxol-4-yl)benzo[d]oxazole-6- carboxylate

[0319] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by benzo[d][l,3]dioxole-4- carboxylic acid. 1 H NMR (400 MHz, DMSO-d6) δ 8.30 (s, 1H), 8.03 (dt, J = 8.3, 1.3 Hz, 1H), 7.90 (d, J = 8.3 Hz, 1H), 7.49 - 7.28 (m, 3H), 6.84 (d, J = 8.2 Hz, 1H), 6.13 (d, J = 5.5 Hz, 1H), 3.91 (s, 3H), 2.77 (d, J = 5.0 Hz, 3H).

[0320] Example 86: Synthesis of 2-(benzo[d][l,3]dioxol-4-yl)benzo[d]oxazole-6-carboxylic acid

[0321] The synthesis was performed according to the procedure described in Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2- (benzo[d][l,3]dioxol-4-yl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 8.30 (s, 1H), 8.03 (dt, J = 8.3, 1.3 Hz, 1H), 7.90 (d, J = 8.3 Hz, 1H), 7.49 - 7.28 (m, 3H), 6.84 (d, J = 8.2 Hz, 1H), 6.13 (d, J = 5.5 Hz, 1H), 3.91 (s, 3H), 2.77 (d, J = 5.0 Hz, 3H).

[0322] Example 87: Synthesis of methyl 2-(2,2-difluorobenzo[d][l,3]dioxol-4-yl)benzo[d]oxazole- 6-carboxylate

[0323] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 2,2-difluorobenzo[d][l,3]dioxole-4-carboxylic acid. 1 H NMR (400 MHz, DMSO-d6) δ 8.36 (d, J = 1.4 Hz, 1H), 8.06 (dd, J = 8.3, 1.5 Hz, 1H), 7.99 (d, J = 8.4 Hz, 2H), 7.71 (dd, J = 8.1, 1.1 Hz, 1H), 7.47 (t, J = 8.1 Hz, 1H), 3.91 (s, 3H).

[0324] Example 88: Synthesis of 2-(2,2-difluorobenzo[d][l,3]dioxol-4-yl)benzo[d]oxazole-6- carboxylic acid

[0325] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(2,2-difluorobenzo[d][l,3]dioxol-4-yl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.34 (d, J = 1.4 Hz, 1H), 8.07 (dd, J = 8.3, 1.5 Hz, 1H), 8.00 (dd, J = 10.2, 8.2 Hz, 2H), 7.73 (d, J = 8.0 Hz, 1H), 7.48 (t, J = 8.2 Hz, 1H).

[0326] Example 89: Synthesis of 2-(3-(trifluoromethyl)phenyl)-lH-indole-6-carboxylic acid

[0327] The synthesis was performed according to the procedure described in Example 45, except that 4-amino-3-iodobenzoic acid methyl ester was replaced by 3-amino-4-iodobenzoic acid methyl ester and 3-ethynylanisole was replaced by l-ethynyl-3-(trifluoromethyl)benzene. 1 H NMR (400 MHz, DMSO-d6) δ 12.49 (s, 1H), 12.08 (s, 1H), 8.25 (d, J = 1.7 Hz, 2H), 8.20 (dt, J = 7.2, 1.9 Hz, 1H), 7.76 (dd, J = 8.5, 1.7 Hz, 1H), 7.74 - 7.67 (m, 2H), 7.49 (d, J = 8.6 Hz, 1H), 7.25 (d, J = 2.1 Hz, 1H).

[0328] Example 90: Synthesis of 2-(3-(trifluoromethyl)phenyl)-lH-indole-6-carboxylic acid methyl ester

[0329] The synthesis was performed according to the procedure of Reference Example 1, Step 3, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid was replaced by 2-(3-(trifluoromethyl)phenyl)-1H-indole-6-carboxylic acid. 1 H NMR (400 MHz, DMSO-d6) δ 12.14 (s, 1H), 8.37-8.23 (m, 2H), 8.23-8.14 (m, 1H), 7.78 (dd, J = 8.6, 1.7 Hz, 1H), 7.73 (d, J = 6.9 Hz, 2H), 7.52 (d, J = 8.6 Hz, 1H), 7.27 (d, J = 2.0 Hz, 1H), 3.86 (s, 3H).

[0330] Example 91: Synthesis of 1-methyl-2-(3-(trifluoromethyl)phenyl)-1H-indole-6- carboxylic acid methyl ester

[0331] The synthesis was performed according to the procedure of Reference Example 47, except that 2-(3-methoxyphenyl)-1H-indole-5-carboxylic acid methyl ester was replaced by 2-(3-(trifluoromethyl)phenyl)-1H-indole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.18 (d, J = 1.3 Hz, 1H), 7.97 (dt, J = 4.2, 1.7 Hz, 2H), 7.86 (d, J = 7.9 Hz, 1H), 7.84-7.77 (m, 1H), 7.77-7.65 (m, 2H), 6.83 (d, J = 0.8 Hz, 1H), 3.90 (s, 3H), 3.85 (s, 3H).

[0332] Example 92: Synthesis of 1-methyl-2-(3-(trifluoromethyl)phenyl)-1H-indole-6- carboxylic acid

[0333] The synthesis was performed according to the procedure of Reference Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 1-methyl-2-(3-(trifluoromethyl)phenyl)-1H-indole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.72 (s, 1H), 8.16 (s, 1H), 8.05-7.92 (m, 2H), 7.86 (d, J = 7.8 Hz, 1H), 7.81 (q, J = 7.9, 7.2 Hz, 1H), 7.74-7.65 (m, 2H), 6.82 (s, 1H), 3.84 (s, 3H).

[0334] Example 93: Synthesis of 2-(3,5-bis(trifluoromethyl)phenyl)-1H-indole-6- carboxylic acid

[0335] The synthesis was performed according to the procedure of Example 45, except that 4-amino-3-iodobenzoic acid methyl ester was replaced with 3-amino-4-iodobenzoic acid methyl ester and 3-ethynyl anisole was replaced with 1-ethynyl-3,5-bis(trifluoromethyl)benzene. 1 H NMR (400 MHz, DMSO-d6) δ 12.22 (s, 1H), 8.58 (s, 2H), 8.27 (s, 1H), 8.03 (s, 1H), 7.82 (d, J = 8.6 Hz, 1H), 7.50 (d, J = 7.4 Hz, 2H).

[0336] Example 94: Synthesis of 2-(3-(trifluoromethyl)phenyl)-1H-indole-5-carboxylic acid

[0337] The synthesis was performed according to the procedure of Example 45, except that 3-ethynylanisole was replaced with 1-ethynyl-3-(trifluoromethyl)benzene. 1 H NMR (400 MHz, DMSO-d6) δ 12.50 (s, 1H), 12.09 (s, 1H), 8.25 (d, J = 1.8 Hz, 2H), 8.21 (dd, J = 6.9, 2.1 Hz, 1H), 7.80 - 7.75 (m, 1H), 7.75 - 7.67 (m, 2H), 7.49 (d, J = 8.6 Hz, 1H), 7.26 (d, J = 2.1 Hz, 1H).

[0338] Example 95: Synthesis of 2-(3-(trifluoromethyl)phenyl)-1H-indole-5-carboxylic acid methyl ester

[0339] The synthesis was performed according to the procedure of Example 1, Step 3, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid was replaced with 2-(3-(trifluoromethyl)phenyl)-1H-indole-5-carboxylic acid. 1 H NMR (400 MHz, DMSO-d6) δ 12.14 (s, 1H), 8.38 - 8.23 (m, 2H), 8.21 (dt, J = 7.0, 2.0 Hz, 1H), 7.78 (dd, J = 8.6, 1.7 Hz, 1H), 7.76 - 7.68 (m, 2H), 7.56 - 7.48 (m, 1H), 7.32 - 7.23 (m, 1H), 3.86 (s, 3H).

[0340] Example 96: Synthesis of 1-methyl-2-(3-(trifluoromethyl)phenyl)-1H-indole-5-carboxylic acid methyl ester

[0341] The synthesis was performed according to reference example 47, except that 2-(3- methoxyphenyl)-lH-indole-5-carboxylic acid methyl ester was replaced by 2-(3-(trifluoromethyl)phenyl)-lH-indole-5-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) d 8.31 (d, J = 1.6 Hz, 1H), 7.96 (dd, J = 4.7, 2.1 Hz, 2H), 7.85 (dd, J = 8.7, 1.7 Hz, 2H), 7.79 (t, J = 8.0 Hz, 1H), 7.65 (d, J = 8.7 Hz, 1H), 6.89 (s, 1H), 3.87 (s, 3H), 3.81 (s, 3H).

[0342] Example 97: Synthesis of l-methyl-2-(3-(trifluoromethyl)phenyl)-lH-indole-5- carboxylic acid

[0343] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by l-methyl- 2-(3-(trifluoromethyl)phenyl)-lH-indole-5-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) d 8.31 (d, J = 1.6 Hz, 1H), 7.96 (dd, J = 4.7, 2.1 Hz, 2H), 7.85 (dd, J = 8.7, 1.7 Hz, 2H), 7.79 (t, J = 8.0 Hz, 1H), 7.65 (d, J = 8.7 Hz, 1H), 6.89 (s, 1H), 3.87 (s, 3H), 3.81 (s, 3H).

[0344] Example 98: Synthesis of 2-(3,5-bis(trifluoromethyl)phenyl)-lH-indole-5- carboxylic acid

[0345] The synthesis was performed according to reference example 45, except that 3- ethynylanisole was replaced by l-ethynyl-3,5-bis(trifluoromethyl)benzene. 1 H NMR (400 MHz, DMSO-d6) d 8.31 (d, J = 1.6 Hz, 1H), 7.96 (dd, J = 4.7, 2.1 Hz, 2H), 7.85 (dd, J = 8.7, 1.7 Hz, 2H), 7.79 (t, J = 8.0 Hz, 1H), 7.65 (d, J = 8.7 Hz, 1H), 6.89 (s, 1H), 3.87 (s, 3H), 3.81 (s, 3H).

[0346] Example 99: Synthesis of 2-(3-ethylphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester

[0347] The synthesis was performed according to reference example 6, except that 3- (trifluoromethoxy)benzoic acid was replaced by 3-ethoxybenzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.30 (d, J = 1.5 Hz, 1H), 8.18 - 8.11 (m, 3H), 7.81 (d, J = 8.3 Hz, 1H), 7.51 - 7.41 (m, 2H), 4.00 (s, 3H), 2.80 (q, J = 7.6 Hz, 2H), 1.35 (t, J = 7.6 Hz, 3H).

[0348] Example 100: Synthesis of 2-(3-ethylphenyl)benzo[d]oxazole-6-carboxylic acid

[0349] The synthesis was performed according to reference example 2, except that 2-(3,5- difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3- ethylphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.26 (s, 1H), 8.29 (d, J = 1.5 Hz, 1H), 8.13 - 8.06 (m, 2H), 8.03 (dd, J = 8.3, 1.5 Hz, 1H), 7.90 (d, J = 8.3 Hz, 1H), 7.62 - 7.49 (m, 2H), 2.76 (q, J = 7.6 Hz, 2H), 1.26 (t, J = 7.6 Hz, 3H).

[0350] Example 101: Synthesis of 2-(3-(difluoromethoxy)phenyl)benzo[d]oxazole-6- carboxylic acid methyl ester

[0351] The synthesis was performed according to reference example 6, except that 3- (trifluoromethoxy)benzoic acid was replaced by 3-(difluoromethoxy)benzoic acid 1 H NMR (400 MHz, CDC13) δ 8.31 (d, J = 1.5 Hz, 1H), 8.20 - 8.13 (m, 2H), 8.06 (t, J = 2.0 Hz, 1H), 7.83 (d, J = 8.4 Hz, 1H), 7.58 (t, J = 8.0 Hz, 1H), 7.37 (dd, J = 8.1, 2.4 Hz, 1H), 6.65 (t, J = 73.2 Hz, 1H), 4.00 (s, 3H).

[0352] Example 102: Synthesis of 2-(3-ethylphenyl)benzo[d]oxazole-6-carboxylic acid

[0353] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3-(difluoromethoxy)phenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.26 (s, 1H), 8.31 (d, J = 1.4 Hz, 1H), 8.17 - 8.07 (m, 1H), 8.04 (dd, J = 8.4, 1.5 Hz, 1H), 7.98 (t, J = 2.0 Hz, 1H), 7.93 (d, J = 8.4 Hz, 1H), 7.72 (t, J = 8.0 Hz, 1H), 7.51 (dd, J = 8.2, 2.6 Hz, 1H), 7.63 - 7.26 (m, 1H).

[0354] Example 103: Synthesis of 2-(2-fluoro-3-(trifluoromethyl)phenyl)benzo[d]oxazole-6- carboxylic acid methyl ester

[0355] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 2-fluoro-3-(trifluoromethyl)benzoic acid. 1 H NMR (400 MHz, CDCl3) δ 8.50 (ddd, J = 8.1, 6.5, 1.8 Hz, 1H), 8.36 (dd, J = 1.6, 0.7 Hz, 1H), 8.17 (dd, J = 8.4, 1.5 Hz, 1H), 7.93 - 7.83 (m, 2H), 7.53 - 7.44 (m, 1H), 4.01 (s, 3H).

[0356] Example 104: Synthesis of 2-(2-fluoro-3-(trifluoromethyl)phenyl)benzo[d]oxazole-6- carboxylic acid

[0357] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(2-fluoro-3-(trifluoromethyl)phenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.29 (s, 1H), 8.62 - 8.52 (m, 1H), 8.33 (d, J = 1.5 Hz, 1H), 8.11 (t, J = 7.3 Hz, 1H), 8.07 (dd, J = 8.3, 1.5 Hz, 1H), 7.98 (d, J = 8.3 Hz, 1H), 7.68 (t, J = 7.9 Hz, 1H).

[0358] Example 105: Synthesis of methyl 2-(2-chloro-3-(trifluoromethyl)phenyl)benzo[d]oxazole-6-carboxylate

[0359] The synthesis was performed according to the procedure described in Reference Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 2-chloro-3- (trifluoromethyl)benzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.37 (d, J = 1.5 Hz, 1H), 8.33 (dd, J = 7.9, 1.7 Hz, 1H), 8.18 (dd, J = 8.4, 1.5 Hz, 1H), 7.98 - 7.88 (m, 2H), 7.60 (t, J = 7.9 Hz, 1H), 4.01 (s, 3H).

[0360] Example 106: Synthesis of 2-(2-chloro-3-(trifluoromethyl)phenyl)benzo[d]oxazole-6-carboxylic acid

[0361] The synthesis was performed according to the procedure described in Reference Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(2-chloro-3-(trifluoromethyl)phenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 13.30 (s, 1H), 8.44 (dd, J = 7.9, 1.6 Hz, 1H), 8.35 (d, J = 1.5 Hz, 1H), 8.18 (dd, J = 7.9, 1.6 Hz, 1H), 8.08 (dd, J = 8.4, 1.5 Hz, 1H), 8.02 (d, J = 8.3 Hz, 1H), 7.83 (t, J = 7.9 Hz, 1H).

[0362] Example 107: Synthesis of methyl 2-(2-hydroxy-3-methylphenyl)benzo[d]oxazole-6-carboxylate

[0363] The synthesis was performed according to the procedure described in Reference Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 2-hydroxy-3- methylbenzoic acid. 1 H NMR (400 MHz, CDC13) δ 11.53 (s, 1H), 8.32 (d, J = 1.5 Hz, 1H), 8.15 (dd, J = 8.3, 1.5 Hz, 1H), 7.97 - 7.90 (m, 1H), 7.78 (d, J = 8.4 Hz, 1H), 7.37 (d, J = 7.2 Hz, 1H), 6.97 (t, J = 7.6 Hz, 1H), 4.00 (s, 3H), 2.39 (s, 3H).

[0364] Example 108: Synthesis of 2-(2-hydroxy-3-methylphenyl)benzo[d]oxazole-6- carboxylic acid

[0365] The synthesis was performed according to the procedure described in Reference Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(2-hydroxy-3-methylphenyl)benzo[d]oxazole-6- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) d 11.42 (s, 1H), 8.33 (s, 1H), 8.07 (d, J = 8.3 Hz, 1H), 7.93 (dd, J = 12.4, 8.1 Hz, 2H), 7.47 (d, J = 7.4 Hz, 1H), 7.04 (t, J = 7.7 Hz, 1H), 2.29 (s, 3H).

[0366] Example 109: Synthesis of 2-(3-ethoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester

[0367] The synthesis was performed according to the procedure described in Reference Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-ethoxybenzoic acid. 1 H NMR (400 MHz, CDCl3) d 8.30 (d, J = 1.6 Hz, 1H), 8.12 (dd, J = 8.4, 1.5 Hz, 1H), 7.88 (dt, J = 7.8, 1.2 Hz, 1H), 7.83 - 7.77 (m, 2H), 7.47 (t, J = 8.0 Hz, 1H), 7.17 - 7.11 (m, 1H), 4.18 (q, J = 7.0 Hz, 2H), 4.00 (s, 3H), 1.50 (t, J = 7.0 Hz, 3H).

[0368] Example 110: Synthesis of 2-(3-ethoxyphenyl)benzo[d]oxazole-6-carboxylic acid

[0369] The synthesis was performed according to the procedure described in Reference Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3-ethoxyphenyl)-3a,7a dihydrobenzo[d]oxazole-6-carboxylic acid methyl ester. 1H NMR (400 MHz, DMSO-d6) δ 8.28 (s, 1H), 8.03 (dd, J = 8.4, 1.6 Hz, 1H), 7.90 (d, J = 8.3 Hz, 1H), 7.82 (d, J = 7.7 Hz, 1H), 7.71 (t, J = 2.1 Hz, 1H), 7.55 (t, J = 8.0 Hz, 1H), 7.24 (dd, J = 8.4, 2.6 Hz, 1H), 4.16 (q, J = 6.9 Hz, 2H), 1.39 (t, J = 6.9 Hz, 3H).

[0370] Example 111 : Synthesis of methyl 2-(2-hydroxy-3-(trifluoromethyl)phenyl)benzo[d]oxazole-6-carboxylate

[0371] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 2-hydroxy-3- (trifluoromethyl)benzoic acid. 1 H NMR (400 MHz, CDCl3) δ 8.36 (d, J = 1.5 Hz, 1H), 8.27 (dd, J = 7.9, 1.7 Hz, 1H), 8.19 (dd, J = 8.4, 1.5 Hz, 1H), 7.81 (d, J = 8.2 Hz, 2H), 7.15 (t, J = 7.8 Hz, 1H), 4.01 (s, 3H).

[0372] Example 112: Synthesis of methyl 2-(3-chloro-5-ethynylphenyl)benzo[d]oxazole-6-carboxylate

[0373] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-chloro-5-ethynylbenzoic acid. 1 H NMR (400 MHz, CDCl3) δ 8.29 (dt, J = 13.0, 1.7 Hz, 3H), 8.15 (dd, J = 8.4, 1.6 Hz, 1H), 7.83 (d, J = 8.4 Hz, 1H), 7.67 (t, J = 1.8 Hz, 1H), 4.00 (s, 3H), 3.25 (s, 1H).

[0374] Example 113: Synthesis of 2-(3-chloro-5-ethynylphenyl)benzo[d]oxazole-6-carboxylic acid

[0375] The synthesis was performed according to the procedure described in Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(3-chloro-5-ethynylphenyl)benzo[d]oxazole-6-carboxylate. 1H NMR (400 MHz, DMSO-d6) δ 13.28 (s, 1H), 8.29 (s, 1H), 8.22 (s, 1H), 8.18 (s, 1H), 8.04 (d, J = 8.4 Hz, 1H), 7.93 (d, J = 8.4 Hz, 1H), 7.89 (d, J = 1.9 Hz, 1H), 4.57 (s, 1H).

[0376] Example 114: Synthesis of methyl 2-(3-ethynylphenyl)benzo[d]oxazole-6-carboxylate

[0377] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-ethynylbenzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.44 (d, J = 1.8 Hz, 1H), 8.35 - 8.23 (m, 2H), 8.13 (dd, J = 8.3, 1.5 Hz, 1H), 7.82 (d, J = 8.3 Hz, 1H), 7.71 (dt, J = 7.7, 1.4 Hz, 1H), 7.54 (t, J = 7.8 Hz, 1H), 4.00 (s, 3H), 3.20 (s, 1H).

[0378] Example 115: Synthesis of 2-(3-ethynylphenyl)benzo[d]oxazole-6-carboxylic acid

[0379] The synthesis was performed according to the procedure described in Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(3-ethynylphenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 13.25 (s, 1H), 8.34 - 8.21 (m, 3H), 8.04 (d, J = 8.3 Hz, 1H), 7.92 (dd, J = 8.4, 2.4 Hz, 1H), 7.78 (d, J = 7.7 Hz, 1H), 7.68 (t, J = 7.9 Hz, 1H), 4.43 (s, 1H).

[0380] Example 116: Synthesis of methyl 2-(2-ethynylphenyl)benzo[d]oxazole-6-carboxylate

[0381] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 2-ethynylbenzoic acid. 1H NMR (400 MHz, CDC13) δ 8.34 (d, J = 1.5 Hz, 1H), 8.29 - 8.24 (m, 1H), 8.14 (dd, J = 8.4, 1.5 Hz, 1H), 7.88 (d, J = 8.4 Hz, 1H), 7.80 - 7.72 (m, 1H), 7.61 - 7.51 (m, 2H), 4.00 (s, 3H), 3.50 (s, 1H).

[0382] Example 117: Synthesis of 2-(2-ethynylphenyl)benzo[d]oxazole-6-carboxylic acid

[0383] The synthesis method refers to Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester is replaced by 2-(2-ethynylphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.23 (s, 1H), 8.28 (d, J = 1.5 Hz, 1H), 8.24 - 8.14 (m, 1H), 8.05 (dd, J = 8.4, 1.5 Hz, 1H), 7.95 (d, J = 8.3 Hz, 1H), 7.81 - 7.73 (m, 1H), 7.71 - 7.60 (m, 2H), 4.55 (s, 1H).

[0384] Example 118: Synthesis of 2-(3-(prop-2-yn-1-yloxy)phenyl)benzo[d]oxazole-6-carboxylic acid methyl ester

[0385] The synthesis method refers to Example 6, except that 3-(trifluoromethoxy)benzoic acid is replaced by 3-(prop-2-yn-1-yloxy)benzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.31 (d, J = 1.6 Hz, 1H), 8.13 (dd, J = 8.4, 1.6 Hz, 1H), 7.95 (d, J = 7.7 Hz, 1H), 7.90 (t, J = 2.1 Hz, 1H), 7.82 (d, J = 8.3 Hz, 1H), 7.51 (t, J = 8.0 Hz, 1H), 7.23 (dd, J = 8.2, 2.6 Hz, 1H), 4.85 (d, J = 2.4 Hz, 2H), 4.00 (s, 3H), 2.60 (d, J = 2.4 Hz, 1H).

[0386] Example 119: Synthesis of 2-(3-(prop-2-yn-1-yloxy)phenyl)benzo[d]oxazole-6-carboxylic acid

[0387] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3-(prop-2-yn-1-yloxy)phenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.20 (s, 1H), 8.29 (d, J = 1.5 Hz, 1H), 8.03 (dd, J = 8.4, 1.5 Hz, 1H), 7.92 (d, J = 8.3 Hz, 1H), 7.87 (d, J = 7.7 Hz, 1H), 7.81 (t, J = 2.0 Hz, 1H), 7.59 (t, J = 8.0 Hz, 1H), 7.31 (dd, J = 8.3, 2.7 Hz, 1H), 4.97 (d, J = 2.4 Hz, 2H), 3.66 (s, 1H).

[0388] Example 120: Synthesis of 2-(3-isopropoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester

[0389] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-isopropoxybenzoic acid. 1 H NMR (400 MHz, DMSO-d6) δ 8.29 (d, J = 1.5 Hz, 1H), 8.02 (dd, J = 8.3, 1.6 Hz, 1H), 7.91 (d, J = 8.3 Hz, 1H), 7.77 (dt, J = 7.7, 1.2 Hz, 1H), 7.67 (t, J = 2.0 Hz, 1H), 7.53 (t, J = 8.0 Hz, 1H), 7.29 - 7.17 (m, 1H), 4.75 (p, J = 6.0 Hz, 1H), 3.90 (s, 3H), 1.33 (s, 3H), 1.32 (s, 3H).

[0390] Example 121: Synthesis of 2-(3-isopropoxyphenyl)benzo[d]oxazole-6-carboxylic acid

[0391] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3-isopropoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1H NMR (400 MHz, DMSO-d6) δ 13.32 (s, 1H), 8.28 (s, 1H), 8.03 (d, J = 8.3 Hz, 1H), 7.91 (d, J = 8.3 Hz, 1H), 7.80 (d, J = 7.7 Hz, 1H), 7.70 (d, J = 2.5 Hz, 1H), 7.55 (t, J = 8.0 Hz, 1H), 7.23 (dd, J = 8.3, 2.5 Hz, 1H), 4.77 (p, J = 6.0 Hz, 1H), 1.34 (s, 3H), 1.32 (s, 3H).

[0392] Example 122: Synthesis of methyl 2-(3-propoxyphenyl)benzo[d]oxazole-6-carboxylate

[0393] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-propoxybenzoic acid. 1 H NMR (400 MHz, DMSO-d6) δ 8.28 (s, 1H), 8.02 (dd, J = 8.4, 1.5 Hz, 1H), 7.90 (d, J = 8.4 Hz, 1H), 7.79 (d, J = 7.7 Hz, 1H), 7.74 - 7.61 (m, 1H), 7.54 (t, J = 8.0 Hz, 1H), 7.31 - 7.15 (m, 1H), 4.05 (t, J = 6.5 Hz, 2H), 3.90 (s, 3H), 1.78 (q, J = 7.0 Hz, 2H), 1.02 (t, J = 7.4 Hz, 3H).

[0394] Example 123: Synthesis of 2-(3-propoxyphenyl)benzo[d]oxazole-6-carboxylic acid

[0395] The synthesis was performed according to the procedure described in Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(3-propoxyphenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 12.97 (s, 1H), 8.28 (s, 1H), 8.03 (d, J = 8.3 Hz, 1H), 7.89 (d, J = 8.3 Hz, 1H), 7.81 (d, J = 7.7 Hz, 1H), 7.73 - 7.68 (m, 1H), 7.55 (t, J = 8.0 Hz, 1H), 7.24 (dd, J = 8.4, 2.6 Hz, 1H), 4.06 (t, J = 6.5 Hz, 2H), 1.78 (q, J = 7.0 Hz, 2H), 1.02 (t, J = 7.4 Hz, 3H).

[0396] Example 124: Synthesis of methyl 2-(3-(methoxymethyl)phenyl)benzo[d]oxazole-6- carboxylate

[0397] The synthesis method refers to Example 6, except that 3-(trifluoromethoxy)benzoic acid is replaced by 3-(methoxymethyl)benzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.34-8.25 (m, 2H), 8.22 (dt, J = 7.0, 1.9 Hz, 1H), 8.12 (dd, J = 8.4, 1.5 Hz, 1H), 7.81 (d, J = 8.4 Hz, 1H), 7.61-7.50 (m, 2H), 4.59 (s, 2H), 3.99 (s, 3H), 3.48 (s, 3H).

[0398] Example 125: Synthesis of 2-(3-(methoxymethyl)phenyl)benzo[d]oxazole-6-carboxylic acid

[0399] The synthesis method refers to Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate is replaced by methyl 2-(3-(methoxymethyl)phenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 13.21 (s, 1H), 8.28 (q, J = 1.9 Hz, 1H), 8.22-8.12 (m, 2H), 8.05-8.01 (m, 1H), 7.89 (dd, J = 8.4, 2.0 Hz, 1H), 7.62 (dd, J = 6.0, 1.9 Hz, 2H), 4.56 (s, 2H), 3.37 (s, 3H).

[0400] Example 126: Synthesis of 2-(3-methoxyphenyl)-6-(methylsulfonyl)benzo[d]oxazole

[0401] Step 1: Synthesis of 6-bromo-2-(3-methoxyphenyl)benzo[d]oxazole refers to Step 1 and Step 2 of Example 6, except that 3-(trifluoromethoxy)benzoic acid is replaced by 3-methoxybenzoic acid, and methyl 4-amino-3-hydroxybenzoate is replaced by 2-amino-5-bromophenol. 1H NMR (400 MHz, CDC13) δ 7.85 (dt, J = 7.8, 1.3 Hz, 1H), 7.81 - 7.72 (m, 2H), 7.66 (d, J = 8.4 Hz, 1H), 7.57 - 7.42 (m, 2H), 7.13 (ddd, J = 8.3, 2.7, 1.0 Hz, 1H), 3.94 (s, 3H).

[0402] Step 2: 6-Bromo-2-(3-methoxyphenyl)benzo[d]oxazole (100 mg, 0.33 mmol) was dissolved in 10 mL of DMSO, sodium methanethiolate (50 mg, 0.49 mmol) and cuprous iodide (314 mg, 1.65 mmol) were added, the vessel was purged with argon, sealed and heated to 100 °C for 3 hours. The reaction mixture was cooled, water was added and the mixture was extracted with ethyl acetate (3 x 50 mL), the organic layer was washed with saturated NaCl and dried over Na2S04. The solid was filtered off and the filtrate was concentrated under reduced pressure. The crude product was purified by silica gel chromatography using petroleum ether / EtOAc (3 / 1, v / v) to give 2-(3-methoxyphenyl)-6-(methylsulfonyl)benzo[d]oxazole 42 mg (yield 41%). 1 H NMR (400 MHz, CDC13) δ 8.29 - 8.17 (m, 1H), 8.05 - 7.95 (m, 2H), 7.95 - 7.89 (m, 1H), 7.83 (t, J = 2.2 Hz, 1H), 7.50 (t, J = 8.0 Hz, 1H), 7.18 (dd, J = 8.3, 2.6 Hz, 1H), 3.96 (s, 3H), 3.16 (s, 3H).

[0403] Example 127: Synthesis of N-(2-(3-methoxyphenyl)benzo[d]oxazol-6-yl)methanesulfonamide

[0404] 6-bromo-2-(3-methoxyphenyl)benzo[d]oxazole (100 mg, 0.33 mmol), N,N'-dimethyl-1,2- cyclohexanediamine (94 mg, 0.66 mmol), methanesulfonamide (157 mg, 1.65 mmol), copper(II) trifluoromethanesulfonate (190 mg, 0.53 mmol) and potassium carbonate (455 mg, 3.3 mmol) were added to a 10 mL solution of N-methylpyrrolidine (NMP). Argon protection, microwave 125 °C for 2 hours. After cooling to room temperature, water was added, the aqueous layer was extracted with ethyl acetate (3 x 30 mL), the organic layer was washed with saturated NaCl and dried over Na2S04. The solid was filtered off and the filtrate was concentrated under reduced pressure. The resulting crude product was purified by silica gel chromatography with petroleum ether / EtOAc (2 / 1, v / v) to give N-(2-(3-methoxyphenyl)benzo[d]oxazol-6-yl)methanesulfonamide 31 mg (yield 29%). 1 H NMR (400 MHz, DMSO-d6) δ 10.02 (s, 1H), 7.82 - 7.73 (m, 2H), 7.68 (dd, J = 2.6, 1.5 Hz, 1H), 7.62 (d, J = 2.0 Hz, 1H), 7.54 (t, J = 8.0 Hz, 1H), 7.25 (dd, J = 8.6, 2.0 Hz, 1H), 7.21 (ddd, J = 8.4, 2.6, 1.0 Hz, 1H), 3.88 (s, 3H), 3.05 (s, 3H).

[0405] Example 128: Synthesis of (2-(3-methoxyphenyl)benzo[d]oxazol-6-yl)boronic acid

[0406] 6-bromo-2-(3-methoxyphenyl)benzo[d]oxazole (100 mg, 0.33 mmol) was dissolved in a 10 mL THF solution, argon protection, cooling to -78 °C. Dropwise addition of n-butyllithium (1.0 M in hexane, 0.66 mL, 0.66 mmol), stirring the reaction at low temperature for 0.5 hours. Then dropwise addition of triethyl borate (112 μL, 0.66 mmol / L), continue stirring for 1 hour. Slowly add 10 mL saturated ammonium chloride solution to quench the reaction, then dilute with 20 mL water. The aqueous layer was extracted with ethyl acetate (3 x 30 mL), the organic layer was washed with saturated NaCl and dried over Na2S04. The solid was filtered off and the filtrate was concentrated under reduced pressure. The resulting crude product was purified by silica gel chromatography with petroleum ether / EtOAc (1 / 1, v / v) to give (2-(3-methoxyphenyl)benzo[d]oxazol-6-yl)boronic acid 23 mg (yield 26%). 1H NMR (400 MHz, DMSO-d6) δ 8.46 (d, J = 1.7 Hz, 1H), 8.01 (d, J = 8.2 Hz, 1H), 7.88 (dt, J = 8.3, 1.4 Hz, 1H), 7.83 (dd, J = 7.8, 1.4 Hz, 1H), 7.72 (dd, J = 2.6, 1.5 Hz, 1H), 7.58 (t, J = 7.7 Hz, 1H), 7.36 - 7.20 (m, 1H), 3.89 (d, J = 1.1 Hz, 3H).

[0407] Example 129: Synthesis of 2-(3-methoxyphenyl)benzo[d]oxazole-6-carbonitrile

[0408] 6-bromo-2-(3-methoxyphenyl)benzo[d]oxazole (300 mg, 0.99 mmol), palladium(II) trifluoroacetate (117 mg, 0.50 mmol), 2-(di-tert-butylphosphino)-1,1'-binaphthalene (Trixie Phos, 77 mg, 0.19 mmol), zinc cyanide (578 mg, 4.95 mmol) and zinc powder (257 mg, 3.96 mmol) were added to a 20 mL DMF solution. Argon protection, 130 °C microwave reaction for 2 hours. After cooling to room temperature, water was added, extracted with ethyl acetate (3 x 50 mL), the organic layer was washed with saturated NaCl, dried over Na2SO4. The solid was filtered off, the filtrate was concentrated under reduced pressure. The resulting crude product was purified by silica gel chromatography with petroleum ether / EtOAc (6 / 1, v / v) to give 2-(3-methoxyphenyl)benzo[d]oxazole-6-carbonitrile 155 mg (yield 62%). 1 H NMR (400 MHz, DMSO-d6) δ 8.22 (d, J = 1.7 Hz, 1H), 7.92 (d, J = 8.3 Hz, 1H), 7.89 - 7.78 (m, 2H), 7.73 (dd, J = 2.7, 1.5 Hz, 1H), 7.57 (t, J = 8.0 Hz, 1H), 7.24 (ddd, J = 8.3, 2.6, 0.9 Hz, 1H), 3.91 (s, 3H).

[0409] Example 130: Synthesis of 2-(3,5-difluorophenyl)-6-methoxybenzo[d]oxazole

[0410] Synthesis of Reference Example 6, Step 1 and Step 2, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3,5-difluorobenzoic acid and 4-amino-3-hydroxybenzoic acid methyl ester was replaced by 2-amino-5-methoxyphenol. 1H NMR (400 MHz, DMSO-d6) δ 7.82 - 7.69 (m, 3H), 7.61 - 7.51 (m, 1H), 7.42 (d, J = 2.4 Hz, 1H), 7.05 (dd, J = 8.8, 2.4 Hz, 1H), 3.86 (s, 3H).

[0411] Example 131 : Synthesis of methyl 2-(2-fluoro-3-isopropoxyphenyl)benzo[d]oxazole-6- carboxylate

[0412] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 2-fluoro-3-isopropoxybenzoic acid. 1 H NMR (400 MHz, DMSO-d6) δ 7.82 - 7.69 (m, 3H), 7.61 - 7.51 (m, 1H), 7.42 (d, J = 2.4 Hz, 1H), 7.05 (dd, J = 8.8, 2.4 Hz, 1H), 3.86 (s, 3H).

[0413] Example 132: Synthesis of 2-(2-fluoro-3-isopropoxyphenyl)benzo[d]oxazole-6-carboxylic acid

[0414] The synthesis was performed according to the procedure described in Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(2-fluoro-3-isopropoxyphenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 7.82 - 7.69 (m, 3H), 7.61 - 7.51 (m, 1H), 7.42 (d, J = 2.4 Hz, 1H), 7.05 (dd, J = 8.8, 2.4 Hz, 1H), 3.86 (s, 3H).

[0415] Example 133: Synthesis of methyl 2-(2-fluoro-3-propoxyphenyl)benzo[d]oxazole-6-carboxylate

[0416] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 2-fluoro-3- propoxybenzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.33 (d, J = 1.5 Hz, 1H), 8.14 (dd, J = 8.4, 1.5 Hz, 1H), 7.87 (d, J = 8.4 Hz, 1H), 7.81 (ddd, J = 8.0, 5.9, 2.0 Hz, 1H), 7.26 - 7.14 (m, 2H), 4.10 (t, J = 6.5 Hz, 2H), 4.00 (s, 3H), 2.04 - 1.75 (m, 2H), 1.11 (t, J = 7.4 Hz, 3H).

[0417] Example 134: Synthesis of 2-(2-fluoro-3-propoxyphenyl)benzo[d]oxazole-6- carboxylic acid

[0418] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(2-fluoro-3-propoxyphenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, CDC13) δ 8.33 (d, J = 1.5 Hz, 1H), 8.14 (dd, J = 8.4, 1.5 Hz, 1H), 7.87 (d, J = 8.4 Hz, 1H), 7.81 (ddd, J = 8.0, 5.9, 2.0 Hz, 1H), 7.26 - 7.14 (m, 2H), 4.10 (t, J = 6.5 Hz, 2H), 4.00 (s, 3H), 2.04 - 1.75 (m, 2H), 1.11 (t, J = 7.4 Hz, 3H).

[0419] Example 135: Synthesis of 2-(3-ethoxy-2-fluorophenyl)benzo[d]oxazole-6- carboxylic acid methyl ester

[0420] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-ethoxy-2-fluorobenzoic acid. 1H NMR (400 MHz, DMSO-d6) δ 13.21 (s, 1H), 8.30 (q, J = 1.9 Hz, 1H), 8.06-8.03 (m, 1H), 7.95 (dt, J = 8.4, 2.0 Hz, 1H), 7.77-7.73 (m, 1H), 7.55-7.41 (m, 1H), 7.36 (t, J = 8.1 Hz, 1H), 4.21 (qd, J = 7.0, 2.3 Hz, 2H), 1.40 (t, J = 6.9 Hz, 3H).

[0421] Example 136: Synthesis of 2-(3-ethoxy-2-fluorophenyl)benzo[d]oxazole-6- carboxylic acid

[0422] The synthesis was performed according to the procedure described in Example 2, except that 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester was replaced by 2-(3-ethoxy-2-fluorophenyl)benzo[d]oxazole-6-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 13.21 (s, 1H), 8.30 (q, J = 1.9 Hz, 1H), 8.06-8.03 (m, 1H), 7.95 (dt, J = 8.4, 2.0 Hz, 1H), 7.77-7.73 (m, 1H), 7.55-7.41 (m, 1H), 7.36 (t, J = 8.1 Hz, 1H), 4.21 (qd, J = 7.0, 2.3 Hz, 2H), 1.40 (t, J = 6.9 Hz, 3H).

[0423] Example 137: Synthesis of 2-(3-(allyloxy)phenyl)benzo[d]oxazole-6-carboxylic acid methyl ester

[0424] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 3-(allyloxy)benzoic acid. 1 H NMR (400 MHz, DMSO-d6) δ 13.21 (s, 1H), 8.30 (q, J = 1.9 Hz, 1H), 8.06-8.03 (m, 1H), 7.95 (dt, J = 8.4, 2.0 Hz, 1H), 7.77-7.73 (m, 1H), 7.55-7.41 (m, 1H), 7.36 (t, J = 8.1 Hz, 1H), 4.21 (qd, J = 7.0, 2.3 Hz, 2H), 1.40 (t, J = 6.9 Hz, 3H).

[0425] Example 138: Synthesis of 2-(3-(allyloxy)phenyl)benzo[d]oxazole-6-carboxylic acid

[0426] The synthesis was performed according to the procedure described in Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(3-(allyloxy)phenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 13.19 (s, 1H), 8.29 (d, J = 1.5 Hz, 1H), 8.03 (dd, J = 8.3, 1.5 Hz, 1H), 7.91 (d, J = 8.4 Hz, 1H), 7.86 - 7.78 (m, 1H), 7.75 (t, J = 2.1 Hz, 1H), 7.57 (t, J = 8.0 Hz, 1H), 7.28 (dd, J = 8.3, 2.7 Hz, 1H), 6.15 - 6.05 (m, 1H), 5.46 (dq, J = 17.3, 1.8 Hz, 1H), 5.31 (dq, J = 10.5, 1.6 Hz, 1H), 4.73 (dd, J = 5.2, 1.6 Hz, 2H).

[0427] Example 139: Synthesis of methyl 2-(2-morpholino-phenyl)benzo[d]oxazole-6-carboxylate

[0428] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 2-morpholino-phenyl benzoic acid. 1 H NMR (400 MHz, CDCl3) δ 8.29 (d, J = 1.5 Hz, 1H), 8.14 (ddd, J = 9.8, 8.2, 1.6 Hz, 2H), 7.82 (d, J = 8.3 Hz, 1H), 7.53 (ddd, J = 8.5, 7.3, 1.7 Hz, 1H), 7.23 - 7.12 (m, 2H), 4.00 (s, 3H), 3.96 - 3.86 (m, 4H), 3.14 - 2.99 (m, 4H).

[0429] Example 140: Synthesis of 2-(2-morpholino-phenyl)benzo[d]oxazole-6-carboxylic acid

[0430] The synthesis was performed according to the procedure described in Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(2-morpholino-phenyl)benzo[d]oxazole-6-carboxylate. 1H NMR (400 MHz, DMSO-d6) δ 13.11 (s, 1H), 8.30 (d, J = 1.5 Hz, 1H), 8.04 (ddd, J = 10.3, 8.0, 1.6 Hz, 2H), 7.89 (d, J = 8.3 Hz, 1H), 7.65 - 7.54 (m, 1H), 7.25 (d, J = 8.2 Hz, 1H), 7.19 (t, J = 7.5 Hz, 1H), 3.76 (t, J = 4.5 Hz, 4H), 2.97 (t, J = 4.5 Hz, 4H).

[0431] Example 141 : Synthesis of methyl 2-(2-(methoxymethyl)phenyl)benzo[d]oxazole-6- carboxylate

[0432] The synthesis was performed according to the procedure described in Example 6, except that 3-(trifluoromethoxy)benzoic acid was replaced by 2-(methoxymethyl)benzoic acid. 1 H NMR (400 MHz, CDC13) δ 8.31 (d, J = 1.6 Hz, 1H), 8.27 (dd, J = 7.8, 1.4 Hz, 1H), 8.13 (dd, J = 8.4, 1.5 Hz, 1H), 7.85 (d, J = 8.4 Hz, 1H), 7.79 (d, J = 7.8 Hz, 1H), 7.61 (td, J = 7.6, 1.4 Hz, 1H), 7.49 (td, J = 7.6, 1.4 Hz, 1H), 5.12 (s, 2H), 4.00 (s, 3H), 3.56 (s, 3H).

[0433] Example 141 : Synthesis of methyl 2-(2-(methoxymethyl)phenyl)benzo[d]oxazole-6- carboxylate

[0434] The synthesis was performed according to the procedure described in Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate was replaced by methyl 2-(2-(methoxymethyl)phenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 13.21 (s, 1H), 8.31 (s, 1H), 8.21 (d, J = 7.8 Hz, 1H), 8.04 (d, J = 8.3 Hz, 1H), 7.94 (d, J = 8.4 Hz, 1H), 7.74 (d, J = 7.8 Hz, 1H), 7.68 (t, J = 7.6 Hz, 1H), 7.57 (t, J = 7.6 Hz, 1H), 5.01 (s, 2H), 3.41 (s, 3H).

[0435] Example 143: Synthesis of methyl 2-(3-(cyanomethoxy)phenyl)benzo[d]oxazole-6- carboxylate

[0436] The synthesis method refers to Example 6, except that 3-(trifluoromethoxy)benzoic acid is replaced by 3-(cyanomethoxy)benzoic acid. 1 H NMR (400 MHz, DMSO-d6) δ 8.33 (d, J = 1.5 Hz, 1H), 8.05 (dd, J = 8.4, 1.6 Hz, 1H), 7.94 (d, J = 8.4 Hz, 1H), 7.87 (dt, J = 7.7, 1.1 Hz, 1H), 7.72 (dd, J = 2.7, 1.5 Hz, 1H), 7.58 (t, J = 8.0 Hz, 1H), 7.32 - 7.26 (m, 1H), 4.98 (s, 2H), 3.92 (s, 3H).

[0437] Example 144: Synthesis of methyl 2-(3-(cyanomethoxy)phenyl)benzo[d]oxazole-6- carboxylate

[0438] The synthesis method refers to Example 2, except that methyl 2-(3,5-difluorophenyl)benzo[d]oxazole-6-carboxylate is replaced by methyl 2-(3-(cyanomethoxy)phenyl)benzo[d]oxazole-6-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 8.33 (d, J = 1.5 Hz, 1H), 8.05 (dd, J = 8.4, 1.6 Hz, 1H), 7.94 (d, J = 8.4 Hz, 1H), 7.87 (dt, J = 7.7, 1.1 Hz, 1H), 7.72 (dd, J = 2.7, 1.5 Hz, 1H), 7.58 (t, J = 8.0 Hz, 1H), 7.32 - 7.26 (m, 1H), 4.98 (s, 2H), 3.92 (s, 3H).

[0439] Example 145: Luciferase Reporter Gene Experiment

[0440] 1. Purpose of the experiment: To determine the agonistic effect of the compound of the present application on the HIF-2a gene regulated HRE gene in the HRE reporter gene 786-0 stable cell strain.

[0441] 2. Experimental method: 6000 stable 3x HRE-containing 786-O cells were seeded in 96-well plates, 100 μL RPMI-1640 medium containing 10% fetal bovine serum was added to each well. After 24 h, DMSO solution of each compound at corresponding concentration was added to each well. In the initial screening of compounds, first test at two concentrations of 2 μM and 20 μM, if agonistic activity is shown, then select further evaluation of EC 50 . In the evaluation of EC 50 During the evaluation process, the compound was tested at 9 concentrations of 20, 6.67, 2.22, 0.74, 0.25, 0.082, 0.027, 0.009 and 0.0073 μM, with 3 replicates for each concentration. After 24 h of incubation, the culture solution was discarded, 20 μL of firefly luciferase reporter gene cell lysate (RG126M, Beyotime) was added to each well, and the 96-well plate was placed on a microplate rapid shaker for 10 min. After shaking, 10 μL of lysate was transferred to a white opaque plate, then 10 μL of Steady-LumiTM firefly luciferase detection reagent (RG058S, Beyotime) was added to each well, and finally the plate was placed in an enzyme labeler (Agilent Synergy Neo2) for detection of luminescence. In order to characterize the agonist activity, the effective concentration of the compound producing 50% of the assay signal (EC 50 ) was calculated using Graphpad software.

[0442] 3x HRE SEQ ID:

[0443] CGAGCTCTGTCACGTCCTGCACGACTCTAGTTGTCACGTCCTGCACGACTCTAGTTGTCACGTCCTGCACGACGCTAGC

[0444] 3. Experimental results: Table 1 lists the compounds with agonistic activity, where “A” means EC 50 less than or equal to 100 nM, “B” means EC 50 between 100 nM and 1000 nM, “C” means EC 50 between 1000 and 5000 nM.

[0445] Table 1 Agonistic activity table of compounds

[0446] Table 1 data shows that the compounds of the present application have good agonistic activity of HIF-2α protein transcription level.

[0447] Example 146: In the experiment of TGF-β1 induced fibrosis in rat kidney fibroblasts, the regulatory effect of the compound on renal fibrosis genes is determined.

[0448] Experimental principle: Transforming growth factor (TGF-β1) is the main factor driving fibrosis, which can promote the transformation of fibroblasts into myofibroblasts, and can also promote the differentiation of myofibroblasts into a fibrosis-promoting phenotype. TGF-β1 stimulates rat kidney fibroblasts (NRK-49F), thereby increasing the upregulation of fibrosis-promoting genes such as a-smooth muscle actin (α-SMA), collagen III and connective tissue growth factor (CTGF).

[0449] Experimental method: Rat kidney fibroblasts were seeded in a 12-well plate, and after 24 h, the culture solution was aspirated, and fresh culture solution containing 0.5% FBS was added, and 2 ng / mL of TGF-β1 (dissolved in DMEM) was added. After 6 h, the final concentration of 10 μM of the test compound was added, and incubated for 24 h. RNA extraction used TRIZOL reagent. cDNA transcription used All-in-one First-Strand cDNA Synthesis Kit kit (for details see the instructions). Signal labeling was performed using SYBR reagent, and β-actin was used as an internal reference. The qRT-PCR primers were: TM

[0450] β-actin group:

[0451] β-actin_fwd, GGAGATTACTGCCCTGGCTCCTA;

[0452] β-actin_rev, GACTCATCGTACTCCTGCTTGCTG;

[0453] α-SMA group:

[0454] α-SMA_fwd, CGGGAGAAAATGACCCAGAT

[0455] α-SMA_rev, CCAGAGTCCAGCACAATACCA

[0456] Collagen III group:

[0457] Collagen III_fwd, TCCAATGAGGGAGAATTCAAGGCTG

[0458] Collagen III_rev, CTGTCTTGCTCCATTCACCAGTG ​

[0459] CTGF group:

[0460] CTGF_fwd, GAGGAGTGGGTGTGTGACGA

[0461] CTGF_rev, CCAGGCAGTTGGCTCTAATC

[0462] The detection results are shown in FIG. 1, FIG. 2 and FIG. 3 and Table 2. After treatment with 2 ng / mL TGF-β1, the expression levels of α-SMA, Collagen III and CTGF genes were normalized to 1.00. Compared with the control group (Control) without TGF-β1 treatment, the basal expression levels of α-SMA, Collagen III and CTGF genes were 0.24, 0.23 and 0.33 (P<0.001), respectively, which confirmed that TGF-β1 could significantly up-regulate the expression of the above fibrosis marker genes. Using proline hydroxylase inhibitor roxadustat and broad-spectrum anti-fibrosis drug pirfenidone as positive references, the drug screening results showed that: experimental compounds 2, 4, 7, 8, 12, 13, 15, 19, 20, 26, 32, 35, 41, 43, 49, 52, 58, 60, 63, 66, 67, 71, 81, 84, 86, 99, 101, 102, 108, 110, 114, 115, 117, 118, 120, 121, 122, 123, 125, 131, 132, 133, 134, 135, 136, 137 and 138 showed significant inhibitory effect on TGF-β1-induced up-regulation of α-SMA gene (P<0.05-P<0.001); compounds 2, 4, 12, 13, 15, 19, 20, 26, 32, 33, 34, 41, 43, 45, 52, 63, 66, 67, 69, 70, 71, 74, 81, 84, 86, 99, 101, 102, 109, 114, 115, 118, 120, 122, 125, 131, 132, 133, 134, 135, 136 and 137 significantly reduced the expression level of Collagen III gene (P<0.05-P<0.001); compounds 7, 12, 13, 15, 19, 20, 26, 32, 33, 34, 35, 41, 43, 44, 49, 58, 60, 63, 66, 67, 68, 69, 70, 71, 72, 74, 76, 81, 84, 86, 99, 100, 101, 109, 114, 115, 118, 119, 120, 121, 122, 132, 133, 135, 136 and 137 significantly reduced the expression level of CTGF gene (P<0.05-P<0.001). The experimental data was statistically analyzed by GraphPad Prism software (version 8.0). Compared with the 2 ng / mL TGF-β1 treatment group, a two-tailed test was used, and the significance level was set as *P<0.05, **P<0.01, ***P<0.001.

[0463] Table 2 Compounds reduce TGF-β1-induced fibrosis

[0464] Example 147: Assay of the regulatory effect of a compound in combination with roxadustat on the expression of a gene related to renal anemia.

[0465] The Hep3B cell line is derived from human hepatocarcinoma tissue, and the liver is one of the main organs for EPO gene expression. Under physiological conditions, the liver (especially during the fetal period) and the kidney are the main sites of EPO production. Although the kidney becomes the main source of EPO after adulthood, the liver can re-activate the expression of EPO under certain pathological conditions (such as hypoxia or anemia). Therefore, the Hep3B cell line provides a suitable model for studying the regulation of EPO gene expression in hepatocytes. Roxadustat is a proline hydroxylase inhibitor.

[0466] Experimental method: Hepatocarcinoma cells Hep3B were seeded in 12-well plates. After 24 h, 2.5 μM roxadustat was added, and after 6 h, 10 μM of the test compound was added, and incubated for 24 h. RNA extraction used TRIZOL reagent. cDNA transcription used All-in-one First-Strand cDNA Synthesis Kit (see the instructions for specific operation steps). Signal calibration used SYBR reagent, with GAPDH as the internal reference. qRT-PCR primers were: TM EPO_fwd, AACAATCACTGCTGACACTT; EPO_rev, AGAGTTGCTCTCTGGACAGT.

[0467] GAPDH group:

[0468] GAPDH_fwd, GCACCGTCAAGGCTGAGAAC; GAPDH_rev, TGGTGAAGACGCCAGTGGA.

[0469] GAPDH_fwd, GCACCGTCAAGGCTGAGAAC; GAPDH_rev, TGGTGAAGACGCCAGTGGA.

[0470] EPO group:

[0471] EPO_fwd, AACAATCACTGCTGACACTT; EPO_rev, AGAGTTGCTCTCTGGACAGT.

[0472] EPO_fwd, AACAATCACTGCTGACACTT; EPO_rev, AGAGTTGCTCTCTGGACAGT.

[0473] The results are shown in Figure 4 and Table 3. The expression of the EPO gene was normalized to 1.00 after treatment with 2.5 mM Roxadustat. Compared with the control group without the application of Roxadustat, the basal expression level of the EPO gene was 0.61 (P < 0.001), which confirmed that Roxadustat can significantly up-regulate the expression of the erythropoietin gene. The drug screening results showed that 10 mM of compounds 2, 7, 9, 12, 13, 15, 19, 20, 21, 26, 32, 33, 34, 35, 45, 49, 58, 60, 66, 68, 69, 70, 71, 73, 76, 81, 86, 100, 108, 109, 110, 115, 117, 119, 120, 121, 122, 123, 125, 131, 132, 133, 134, 135, 136, and 137 further up-regulated the expression of the EPO gene compared with the Roxadustat group (Figure 4), showing an enhancing effect. These results suggest that the use of the above-mentioned drugs in combination can effectively activate the expression of target genes downstream of HIF-2a, which may provide a new treatment strategy for treating ischemic diseases or anemia and the like. The experimental data was statistically analyzed using GraphPad Prism software (version 8.0), and a two-tailed test was used, *P < 0.05, **P < 0.01, ***P < 0.001.

[0474] Table 3. Compounds that increase the expression of EPO based on Roxadustat

[0475] Example 148: Aristolochic acid-induced zebrafish kidney injury combined with renal anemia experiment

[0476] 1. Compound 60 improves the incidence of renal edema

[0477] Randomly selected wild-type AB strain zebrafish at 2 days post-fertilization (2dpf) were treated with 30 zebrafish per well (experimental group) in a 6-well plate. Except for the normal control group, the rest of the experimental groups were given Aristolochic Acid (AA) to establish a zebrafish renal anemia model. After 18h of treatment at 28°C, samples (Roxadustat or Compound 60) were given in water, and normal control and model control groups were set up, with a volume of 3 mL per well. After 30h of continuous treatment at 28°C, each experimental group was observed under a dissecting microscope, and the number of zebrafish with renal edema was counted to calculate the incidence of renal edema in each experimental group (%). The results are shown in Table 4 and Figure 5.

[0478] 2. Efficacy evaluation of Compound 60 in improving renal anemia (heart red blood cell staining intensity)

[0479] Randomly selected 2dpf wild type AB strain zebrafish in 6-well plates, each hole (experimental group) was treated with 30 zebrafish. Except for the normal control group, the rest of the experimental groups were given aqueous Aristolochic acid to establish a zebrafish renal anemia model. After 18h treatment at 28℃, the samples were given aqueous, and the normal control group and the model control group were set up, with a volume of 3mL per hole. After 30h continuous treatment at 28℃, o-phenylendiamine was used for staining, and after staining, 10 zebrafish were randomly selected from each experimental group and placed under a dissecting microscope for photography. The data were collected using NIS-Elements D 3.20 advanced image processing software, and the zebrafish heart red blood cell staining intensity was analyzed. The statistical significance of this index was used to evaluate the efficacy of the sample in improving renal anemia. SPSS 26.0 software was used for statistical analysis, and p<0.05 indicated that the difference was statistically significant. The results are shown in Table 5 and Figure 6.

[0480] Table 4 Incidence of renal edema improved by compound 60

[0481] Table 5 Efficacy evaluation of compound 60 for improving renal anemia (heart red blood cell staining intensity)

[0482] Test results: (1) Aristolochic acid induced zebrafish model group, the incidence of renal edema was 100%, 1 μM compound 60 renal edema incidence decreased from 100% to 60%, 10 μM compound 60 renal edema incidence decreased from 100% to 50%. Compared with the positive drug Roxadustat, the activity of compound 60 was slightly weaker (Figure 5), indicating that compound 60 has the effect of improving renal injury. (2) The heart red blood cell count of normal zebrafish group was 100%, the heart red blood cell count of aristolochic acid induced zebrafish model group was 35%, the heart red blood cell count of 1 μM compound 60 experimental group was 84%, and the heart red blood cell count of 10 μM compound 60 group was 87%. The activity of compound 60 was similar to that of the positive drug Roxadustat, indicating that compound 60 has the effect of treating renal anemia (Figure 6).

[0483] Example 149: 5 / 6 nephrectomy (5 / 6 Nx) renal anemia rat model

[0484] Male Sprague-Dawley (SD) rats were used to establish a model of anemia induced by kidney injury by 5 / 6 nephrectomy surgery to study the erythropoietic effect of compound 15. After a one-week adaptation period, rats were anesthetized with isoflurane and the left kidney was exposed through a midline abdominal incision. Ligation threads were placed at the upper and lower thirds of the kidney and the corresponding kidney tissue outside the ligation threads was removed. After a one-week recovery period, the right kidney was removed. Of the 24 rats, 8 were assigned to a nephrectomy group and the other 8 served as a non-surgical normal control group. Compound 15 and roxadustat were dissolved in a vehicle consisting of 10% dimethyl sulfoxide (DMSO), 30% polyethylene glycol 400 (PEG 400), 5% Tween-80, 1% hydrochloric acid (113.3 mM), 9% 0.1 N sodium hydroxide, and 45% normal saline. The nephrectomized rats were randomly divided into a 5 / 6 Nx group, a compound 15 treatment group, and a roxadustat treatment group (8 rats each), ensuring comparable baseline body weights for each group. Starting at the sixth week after surgery, the compound 15 treatment group and the roxadustat group were orally administered 10 mg / kg (10 mg per 1 kg of rat body weight per day) of the respective compound daily for four weeks, while the sham group and the 5 / 6 nephrectomy model (5 / 6 Nx) rats were given the vehicle according to the same administration schedule. Hematology analysis was performed weekly. Hematology analysis (using a Sysmex Europe XN-2000 automated blood analyzer) and urine analysis (using a Cobas C501 automated blood analyzer) were performed using commercially available kits according to the manufacturer's instructions. After sample collection, the animals were euthanized. Statistical significance was determined by one-way ANOVA followed by Dunnett's test for comparison with the 5 / 6 Nx group (*P < 0.05, **P < 0.01, ***P < 0.001).

[0485] Results analysis: Hematology analysis showed that the 5 / 6 Nx group and the 10 mg / kg compound 15 treatment group had a significant increase in the number of red blood cells (RBCs) at week 4 (7.71 ± 0.15 x 1012 cells / L vs. 8.31 ± 0.20 x 1012 cells / L, p < 0.05, Table 6 and Figure 7). 10 mg / kg roxadustat showed a clear polycythemia at day 14, and the RBC levels were all above the physiological range of the healthy control group, suggesting that excessive erythropoiesis could pose a risk of thromboembolism. Compound 15 was found to have anemia-improving efficacy.

[0486] Table 6 Change in the number of red blood cells at 4 weeks of administration

[0487] The present application is illustrated by the above examples, but the present application is not limited to the above methods, i.e. it does not mean that the present application must rely on the above detailed methods to be implemented. It should be understood by those skilled in the art that any improvement of the present application, equivalent replacement of each raw material of the product of the present application, addition of auxiliary ingredients, selection of specific modes, etc. fall within the protection scope and disclosure scope of the present application.

Claims

A compound having a structure as shown in Formula (I), or a stereoisomer, a tautomer, a solvate, a metabolite, a pharmaceutically acceptable salt, or a prodrug thereof, wherein, in formula (I) Partially represented as When For X is N or CH; Y is NH, NCH3, O, S or CH2; When For X is NH, NCH3, O, S or CH2; Y is N or CH; When For X is NH, NCH3, O, S or CH2; Y is CH2; A is C 6-12 aryl or 5-12 membered heteroaryl; each R 1 and R 2 is independently H, D, F, Cl, Br, I, OH, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -(CH2) p -OR 7 , -NR a R b , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , C 1-4 alkyl, C 2-4 alkenyl, C 2-4 alkynyl, C 1-4 haloalkyl (e.g., -CF3, -CHF2, -CH2F, -CF2CF3), C 2-4 haloalkenyl, C 2-4 haloalkynyl, C 2-4 haloalkynyl, C 3-6 cycloalkyl, or 3-6 membered heterocyclyl; R 3 H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b or -B(OR 7 )2; each R 4 and R 5 is independently H, D, F, Cl, Br, I, OH, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -NHS(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , -B(OR 7 )2, -NHS(=O)2R 7 , C 1-4 1-6 alkyl, C 1-4 1-6 hydroxy-substituted alkyl, C 2-4 2-6 alkenyl, C 2-4 2-6 alkynyl, C 3-6 3-6 cycloalkyl, 3-6 membered heterocyclyl, C 1-4 haloalkyl (e.g., -CF3, -CHF2, -CH2F, -CF2CF3), C 2-4 haloalkenyl, C 2-4 haloalkynyl, C 3-6 halocycloalkyl, or 3-6 membered haloheterocyclyl; R 6 H, D, F, Cl, Br, I, OH, CN, NH2, NO2, C 1-4 alkyl, C 2-4 alkenyl, C 2-4 alkynyl, C 1-4 haloalkyl (e.g., -CF3, -CHF2, -CH2F, -CF2CF3), C 2-4 haloalkenyl or C 2-4 haloalkynyl; R 7 independently H, D, CN-substituted C 1-4 alkyl, C 1-4 alkyl, C 2-4 alkenyl, C 2-4 alkynyl, C 3-6 cycloalkyl, 3-6 membered heterocyclyl, C 1-4 haloalkyl, C 2-4 haloalkenyl, C 2-4 haloalkynyl, C 3-6 halocycloalkyl or 3-6 membered haloheterocyclyl; Each R a and R b H, D, C independently 1-4 Alkyl, C 1-4 Alkoxy, C 2-4 alkenyl, C 2-4 alkynyl group, C 3-6 cycloalkyl, 3-6 membered heterocyclic, C 1-4 Haloalkyl, C 1-4 Halogenated alkoxy groups, C 2-4 Haloalkenyl, C 2-4 Halogenated alkynyl group, C 3-6 Halogenated cycloalkyl groups or 3-6 membered halogenated heterocyclic groups; p is 0, 1, 2 or 3; m is 0, 1, 2 or 3. The compound of claim 1 having a structure according to Formula (II-1), (II-2), (II-3), (II-4), (II-5), (II-6), (II-7), (II-8), (II-9), (II-10), (II-11), (II-12), (II-13), (II-14), (II-15), (II-16), (II-17), (II-18), (II-19), (II-20), (II-21), (II-22), (II-23), (II-24), (II-25), (II-26), (II-27), (II-28), (II-29), (II-30), (II-31), (II-32), (II-33), (II-34), (II-35), (II-36), (II-37), (II-38), (II-39), (II-40), (II-41), (II-42), (II-43), (II-44), or (II-45), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof, wherein, each m is independently 1, 2 or 3. The compound of claim 1 having a structure according to Formula (III-1), (III-2), (III-3), (III-4), (III-5), (III-6), (III-7), or (III-8), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof, wherein, each A1is independently 5-membered heteroaryl, 6-membered heteroaryl, 5-membered and 5-membered heteroaryl, 5-membered and 6-membered heteroaryl, or 6-membered and 6-membered heteroaryl; optionally, each A1is independently imidazolyl, pyrazolyl, thienyl, thiazolyl, pyridyl, pyrimidinyl, pyrazinyl, benzo[d][1,3]dioxol, benzofuran, benzimidazole, indolyl, or quinolinyl. The compound according to any one of claims 1-3, wherein, each R 1 and R 2 independently H, D, F, CI, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -(CH2) p -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , methyl, ethyl, n-propyl, i-propyl, t-butyl, ethenyl, propenyl, allyl, ethynyl, propynyl, propargyl, -CF3, -CHF2, -CH2F, -CF2CF3, pyrrolidinyl or tetrahydrofuranyl. The compound according to any one of claims 1-3, wherein, R 4 and R 5 are independently H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -NHS(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , -B(OR 7 )2, methyl, ethyl, 2-hydroxyethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, -CF3, -CHF2, -CH2F or -CF2CF3. The compound according to any one of claims 1-3, wherein, R 6 H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, -CF3, -CHF2, -CH2F, -CF2CF3. The compound according to any one of claims 1 to 3, wherein, Each R 7 Methyl, ethyl, propyl, ethyl, propyl, isopropyl, tert-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propynyl, propynyl, propyl, cyclobutyl, cyclopentyl, or cyclohexyl are independently H, D, -CF3, -CHF2, -CH2F, -CF2CF3, CN-substituted, CN-substituted, n-propyl, methyl, ethyl, n-propyl, isopropyl, tert-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propynyl, propyl, cyclobutyl, cyclopentyl, or cyclohexyl; each R a and R b is independently H, D, methyl, ethyl, n-propyl, i-propyl, t-butyl, trifluoromethyl, 1-fluoroethyl, 2-fluoroethyl, 1,2-dichloroethyl, 2-fluoropropyl, 3-fluoropropyl, methoxy, ethoxy, n-propoxy, i-propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl. The compound according to claim 1, wherein, having a structure according to Formula (IV-1), (IV-2), (IV-3), (IV-4), (IV-5), (IV-6), (IV-7), (IV-8), or (IV-9), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof, A compound having one of the following structures, or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof, A pharmaceutical composition, characterized in that, The pharmaceutical combination is the compound of any one of claims 1-9 or the pharmaceutical composition of claim 10 in combination with a prolyl hydroxylase inhibitor. A pharmaceutical combination for treating a disease associated with HIF-2a activity, characterized in that, The prolyl hydroxylase inhibitor includes any one of Roxadustat, Daprodustat, Vadadustat, Enasidenib, or Molidustat. The pharmaceutical combination according to claim 11, characterized in that The use of the compound of any one of claims 1-9 or the pharmaceutical composition of claim 10 or the pharmaceutical combination of any one of claims 11-12 in the manufacture of a medicament for preventing, managing, treating or alleviating a HIF-2α-mediated related disease. The use of the compound of any one of claims 1-9 or the pharmaceutical composition of claim 10 or the pharmaceutical combination of any one of claims 11-12 in the manufacture of a medicament for preventing, managing, treating or alleviating a HIF-2α-mediated related disease. A method for preventing, managing, treating or alleviating a HIF-2α-mediated related disease, comprising administering to a patient a therapeutically effective amount of the compound of any one of claims 1-9 or the pharmaceutical composition of claim 10 or the pharmaceutical combination of any one of claims 11-12. The HIF-2α-mediated related disease includes hematopoietic disorder, anemia, renal anemia, ischemic conditions associated with surgery and its sequelae after surgery, wound healing of surgery, chronic kidney disease, cardiovascular disease, infection, inflammatory disease, chronic metabolic disease, neurodegenerative disease, pulmonary edema, acute respiratory distress syndrome, cancer and damage to health status occurring during cancer treatment, or sequelae of acute and prolonged cerebral ischemic conditions. Use according to any one of claims 13-14, characterized in that ​ Use according to any one of claims 13-14, characterized in that The HIF-2a-mediated related diseases are selected from the group consisting of hematopoietic disorders, such as renal anemia, primary anemia, and anemia associated with neoplastic diseases (in particular chemotherapy-induced anemia), anemia due to blood loss, iron deficiency anemia, vitamin deficiency anemia, dysplasia and aplastic anemia or hemolytic anemia, anemia due to disorders of iron utilization (iron deficiency anemia) or due to other endocrine disorders (e.g. hypothyroidism); post-surgical conditions associated with ischemia and its sequelae, in particular cardiac interventions using a heart-lung machine (e.g. shunt surgery, heart valve implantation), carotid interventions, aortic interventions and interventions using instruments opening or penetrating the skull; wound healing of surgical interventions; chronic kidney diseases, such as primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial lesions (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, hereditary nephropathies (polycystic kidney, hereditary nephritis); inflammatory diseases, such as rheumatoid arthritis, nephritis, pneumonitis, bronchitis, enteritis, arthritis; acute and prolonged cerebral ischemic conditions (e.g. stroke, birth asphyxia); immunodeficiency diseases, including systemic lupus erythematosus, psoriasis, rheumatoid arthritis; acute respiratory distress syndrome; chronic metabolic diseases, including diabetes, hypertension, obesity; neurodegenerative diseases, including cerebral ischemia, brain injury, Alzheimer's disease, Parkinson's disease, Huntington's disease; pulmonary edema; cardiovascular diseases, in particular cardiac insufficiency, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension and peripheral arterial occlusive disease; infections, in particular HIV infection. Use according to any one of claims 13-14, characterized in that The HIF-2a-mediated related diseases include anemia, ischemia or ischemic diseases, vascular diseases, angina pectoris, myocardial infarction, metabolic disorders, cancer, renal anemia, renal fibrosis, renal edema and / or nephropathy. Use according to any one of claims 13-14, characterized in that The prevention, reduction or treatment of the HIF-2a-mediated related diseases is achieved by the action of the compound according to any one of claims 1 to 9 or the pharmaceutical composition according to claim 10 or the pharmaceutical combination according to any one of claims 11 to 12 on the downstream genes regulated by HIF-2a. Use according to any one of claims 13-14, characterized in that The prevention, reduction or treatment of the HIF-2a-mediated related diseases is achieved by the action of the compound according to any one of claims 1 to 9 or the pharmaceutical composition according to claim 10 or the pharmaceutical combination according to any one of claims 11 to 12 on the downstream genes regulated by HIF-2a in the form of upregulation of the EPO gene. Use according to any one of claims 13-14, characterized in that The prevention, reduction or treatment of the HIF-2a-mediated related diseases is achieved by the action of the compound according to any one of claims 1 to 9 or the pharmaceutical composition according to claim 10 or the pharmaceutical combination according to any one of claims 11 to 12 on the downstream genes regulated by HIF-2a in the form of agonistic activity on the HIF-2a protein transcription level; preferably agonistic activity on the HRE genes regulated by HIF-2a gene. Use according to any one of claims 13-14, characterized in that The compound of any one of claims 1-9 or the pharmaceutical composition of claim 10 or the drug combination of any one of claims 11-12 has a regulatory effect on HIF-2α-mediated renal fibrosis genes; or, the regulatory effect on renal fibrosis genes is in the form of: down-regulating a-smooth muscle actin gene; down-regulating collagen type III gene; and down-regulating connective tissue growth factor gene.

Citation Information

Patent Citations

  • Aza-fused ring derivative as well as pharmaceutical composition and application thereof

    CN115974872A

  • Application of chlorbenazolic acid and pharmaceutically acceptable salt thereof in preventing, relieving or treating diseases related to HIF-2alpha

    CN120053435A

  • Drug combined preparation of chlorbuconazole and pharmaceutically acceptable salt thereof and proline hydroxylase inhibitor

    CN120189410A

  • Compounds for nonsense suppression, use of these compounds for the manufacture of a medicament for treating somatic mutation-related diseases

    WO2006044503A2