Compositions and methods for stitchr-mediated full-length SCN5a expression in vivo

Abstract

The present invention provides compositions, systems and methods for using ribozyme-mediated cis-cleavage and trans-splicing of RNA molecules to express a functional SCN5A, and methods of use thereof for treating Brugada Syndrome and other diseases associated with SCN5A loss of function.

Description

Attorney Docket No.204606-0196-00WO COMPOSITIONS AND METHODS FOR STITCHR-MEDIATED FULL-LENGTH SCN5A EXPRESSION IN VIVO CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 679,363, August 5, 2024 which is hereby incorporated by reference herein in its entirety. REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

[0002] This application contains a Sequence Listing, which is submitted electronically via EFS-Web as an XML Document formatted sequence listing with a file name “204606-0196-00WO Sequence Listing.xml,” having a creation date of July 24, 2025, and having a size of 72,660 bytes. The sequence listing submitted via EFS-Web is part of the specification and is herein incorporated by reference in its entirety. BACKGROUND OF THE INVENTION

[0003] Loss-of-function mutations in Sodium Voltage-Gated Channel Alpha Subunit 5 (SCN5A) result in Brugada Syndrome (BrS), a hereditary lethal cardiac arrhythmia disease characterized by ventricular fibrillation and sudden cardiac death (SCD). The occurrence of BrS is estimated to be 1 in 2000 births, and currently there are no treatments or cures. The average life expectancy of an BrS patient is 40 years of age.

[0004] Animal-based transgenic studies have shown that rescue of SCNA5A protein expression is sufficient to correct cardiac conduction defects, however delivery of SCN5A to patients remains a major challenge due to the large size of the SCN5A gene.

[0005] While voltage-gated potassium channels are comprised of a tetramer of single domain alpha-subunits, the SCN5A protein is comprised of four domains in a single protein. The large size of the SCN5A protein (2,016 amino acids (aa)) means the protein-coding open reading frame (>6.0 kb) greatly exceeds the packaging size limit of current non-integrating viral vectors, such as AAV (~4.7 kb), preventing its use in current human gene therapies.

[0006] CRISPR-Cas gene editing has been a recent focus for the development of therapeutic approaches to correct large gene diseases. CRISPR-Cas utilizes a single guide- RNA (sgRNA) to direct Cas9 endonuclease activity to specific target sequence, where it induces double-strand DNA cleavage and triggers cellular repair pathways that can be used to generate frame-shift mutations or to insert large donor sequences through Homology Directed Repair (HDR).

[0007] CRISPR-Cas gene editing of SCN5A mutations remains a significant challenge due to 1) the many distinct human patient-specific mutations within the SCN5A gene locus that can give rise to disease and thus require patient specific therapeutic strategies, and 2) targeted insertion of DNA sequences by CRISPR-mediated HDR is inefficient, requires donor templates containing large regions of flanking homology, and does not occur in non-dividing cells, which comprise many adult tissues, notably cardiac and skeletal muscle. CRISPR-Cas Editing variations, such as Based Editors or Prime Editors, can be efficient for correcting disease mutations, but are notably too large to be packaged into AAV for delivery in vivo.

[0008] Thus, there is a need in the art for improved compositions and methods for efficient expression of SCN5A. This invention satisfies this unmet need. SUMMARY OF THE INVENTION

[0009] The present invention provides compositions and methods for efficiently and reliably ligating two or more individual RNA molecules to produce a larger single RNA molecule that encodes Sodium Voltage-Gated Channel Alpha Subunit 5 (SCN5A), and methods of use thereof for the treatment of a disease or disorder.

[0010] In some embodiments, the invention relates to a system for generating an RNA molecule encoding voltage-gated sodium channel SCN5A comprising: a nucleic acid molecule encoding a first RNA molecule comprising a coding region encoding a first portion of SCN5A and a 3’ribozyme; and a nucleic acid molecule encoding a second RNA molecule comprising a coding region encoding a second portion of SCN5A and a 5’ribozyme.

[0011] In some embodiments, the first nucleic acid molecule comprises the N- terminal coding sequence of SEQ ID NO:1, or a fragment or variant thereof, and the secondnucleic acid molecule comprises the C-terminal coding sequence of SEQ ID NO:2, or a fragment or variant thereof.

[0012] In some embodiments, the first 3’ribozyme catalyzes itself out of the first RNA molecule, thereby generating a 3’P or 2’3’ cP end.

[0013] In some embodiments, the 5’ribozyme catalyzes itself out of the second RNA molecule, thereby generating a 5’OH end.

[0014] In some embodiments, the 3’P or 2’3’ cP end is ligated to the 5’OH end to form an RNA molecule encoding SCN5A.

[0015] In some embodiments, the 3’ ribozyme comprises SEQ ID NO:3 or SEQ ID NO:9-61.

[0016] In some embodiments, the 5’ ribozyme comprises SEQ ID NO:4 or SEQ ID NO:9-61.

[0017] In some embodiments, each of the nucleic acid molecule encoding the first RNA molecule comprising the coding region encoding the first portion of SCN5A and the nucleic acid molecule encoding the second RNA molecule comprising the coding region encoding the second portion of SCN5A comprise a chicken cardiac troonin-T promoter core (cTnT) promoter sequence. In some embodiments, the cTnT promoter sequence comprises SEQ ID NO:5.

[0018] In some embodiments, the first nucleic acid molecule comprises SEQ ID NO:6 and the second nucleic acid molecule comprises SEQ ID NO:7.

[0019] In some embodiments, the invention relates to a method for generating an RNA molecule encoding voltage-gated sodium channel SCN5A comprising administering to a cell or tissue a nucleic acid molecule encoding a first RNA molecule comprising a coding region encoding a first portion of SCN5A and a 3’ribozyme; and administering to a cell or tissue a nucleic acid molecule encoding a second RNA molecule comprising a coding region encoding a second portion of SCN5A and a 5’ribozyme.

[0020] In some embodiments, the first nucleic acid molecule comprises SEQ ID NO:1 and the second nucleic acid molecule comprises SEQ ID NO:2.

[0021] In some embodiments, the the 3’ribozyme catalyzes itself out of the first RNA molecule, thereby generating a 3’P or 2’3’ cP end.

[0022] In some embodiments, the 5’ribozyme catalyzes itself out of the second RNA molecule, thereby generating a 5’OH end.

[0023] In some embodiments, the 3’P or 2’3’ cP end is ligated to the 5’OH end to form an RNA molecule comprising the coding region of the first RNA molecule and the coding region of the second RNA molecule.

[0024] In some embodiments, the 3’ ribozyme comprises SEQ ID NO:3 or SEQ ID NO:9-61.

[0025] In some embodiments, the 5’ ribozyme comprises SEQ ID NO:4 or SEQ ID NO:9-61.

[0026] In some embodiments, each of the nucleic acid molecule encoding the first RNA molecule comprising the coding region encoding the first portion of SCN5A and the nucleic acid molecule encoding the second RNA molecule comprising the coding region encoding the second portion of SCN5A comprise a chicken cardiac troonin-T promoter core (cTnT) promoter sequence. In some embodiments, the cTnT promoter sequence comprises SEQ ID NO:5.

[0027] In some embodiments, the first nucleic acid molecule comprises SEQ ID NO:6 and the second nucleic acid molecule comprises SEQ ID NO:7.

[0028] In some embodiments, the disease or disorder is associated with a decreased level of activity of voltage-gated sodium channel SCN5A. In some embodiments, the disease or disorder is Brugada Syndrome, Long QT Syndrome, atrial fibrillation, sick sinus syndrome or cardiomyopathy. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The following detailed description of embodiments of the invention will be better understood when read in conjunction with the appended drawings. It should be understood that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0030] Figure 1 depicts a diagram demonstrating that organized rhythmic contraction of the heart is precisely coordinated by ion-specific transmembrane channels and pumps in the membrane of heart cells, and that loss-of-function mutations in SCN5A disrupt this process and result in cardiac arrhythmia.

[0031] Figure 2 provides a diagram depicting the functional domains of SCN5A, the large cardiac sodium channel protein required for normal cardiomyocyte depolarization. Mutations in SCN5A cause multiple lethal cardiac arrhythmias, including hereditary Long QT Syndrome (LQTS) Type III and Brugada Syndrome (BrS).

[0032] Figure 3 depicts an overview of the research plan.

[0033] Figure 4 provides a diagram depicting the dual AAV StitchR vectors for SCN5A, the large cardiac sodium channel protein required for normal cardiomyocyte depolarization. This approach allows for AAV delivery and expression of SCN5A under the control of the cardiac-specific troponin T promoter (cTnT). Both vectors have a packaging capacity of 4.2 kb, well under the 4.7 packaging limit of a single AAV particle.

[0034] Figure 5 provides data demonstrating the validation of StitchR SCN5A channel activity in vitro. Patch clamp electrophysiology experiments on SCN5A channel kinetics in transiently transfected human HEK293T cells. Cells transfected with empty vector, StitchR Nt-SCN5A or Ct-SCN5A alone, do not produce current. Whereas cells co- transfected with StitchR Nt- and Ct-SCN5A produce current indistinguishable from current produced by SCN5A expressed from a single ORF. In all conditions cells were co-transfected with the SCN1B (Na+ channel Beta-1 subunit). DETAILED DESCRIPTION

[0035] The present invention provides compositions and methods for efficiently and reliably ligating two or more individual RNA molecules to produce a larger single RNA molecule that encodes Sodium Voltage-Gated Channel Alpha Subunit 5 (SCN5A). The invention utilizes ribozyme-mediated trans-splicing of multiple RNA molecules to assemble a single RNA molecule encoding SCN5A. Ligation of the compatible ends of the first RNA portion encoding an N-terminal portion of SCN5A and the second RNA portion encoding a C-terminal portion of SCN5A, generates an RNA molecule encoding a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein.

[0036] The present invention also provides compositions and methods for efficiently delivering one or more RNA molecule with a ribozyme-flanked synthetic intron. The ribozyme-flanked synthetic intron can be placed between a first RNA portion encoding an N-terminal portion of SCN5A and a second RNA portion encoding a C-terminal portion of SCN5A.

[0037] In one aspect, the present invention provides one or more nucleic acid molecules encoding two or more RNA molecules. In certain embodiments, one or more of the RNA molecules comprise a ribozyme. In one embodiment, one or more of the RNA molecules comprise a coding region and a ribozyme. In certain embodiments, the ribozyme self-cleaves out of the RNA molecule leaving the coding region. Exemplary ribozymes that may be used in the context of the present invention include, but is not limited to, members of the Hammerhead (HH), Hepatitis Delta Virus (HDV), Varkud Satellite (VS), Sister, Twister- sister, Hairpin, Hatchet and Pistol families of ribozymes.

[0038] For example, in one embodiment, the composition comprises a nucleic acid molecule encoding a first RNA molecule, where the first RNA molecule comprises a coding region and a 3’ ribozyme, where the 3’ ribozyme is able to catalyze itself out of the RNA molecule leaving the coding region with a 3’P or 2’3’ cyclic phosphate (cP) end. Further, in one embodiment, the composition comprises a nucleic acid molecule encoding a second RNA molecule, where the second RNA molecule comprises a coding region and a 5’ ribozyme, where the 5’ ribozyme is able to catalyze itself out of the RNA molecule leaving the coding region with a 5’OH end. In certain instances, a ligase joins the coding region of the first RNA molecule to the coding region of the second RNA molecule together to form a longer RNA molecule encoding SCN5A. Definitions

[0039] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0040] Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, and nucleic acid chemistry and hybridization are those well-known and commonly employed in the art.

[0041] Standard techniques are used for nucleic acid and peptide synthesis. The techniques and procedures are generally performed according to conventional methods in the art and various general references (e.g., Sambrook and Russell, 2012, Molecular Cloning, ALaboratory Approach, Cold Spring Harbor Press, Cold Spring Harbor, NY, and Ausubel et al., 2012, Current Protocols in Molecular Biology, John Wiley & Sons, NY), which are provided throughout this document.

[0042] The nomenclature used herein, and the laboratory procedures used in analytical chemistry and organic syntheses described below, are those well-known and commonly employed in the art. Standard techniques or modifications thereof are used for chemical syntheses and chemical analyses.

[0043] The term “a,” “an,” “the” and similar terms used in the context of the present invention (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context.

[0044] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, or ±10%, or ±5%, or ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

[0045] “Antisense” refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand. As defined herein, an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule. The antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences.

[0046] A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate.

[0047] In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health.

[0048] A disease or disorder is “alleviated” if the severity of a sign or symptom of the disease or disorder, the frequency with which such a sign or symptom is experienced by a patient, or both, is reduced.

[0049] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non- coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

[0050] The terms “patient,” “subject,” “individual,” and the like are used interchangeably herein, and refer to any animal or cell whether in vitro or in vivo, amenable to the methods described herein. In one embodiment, the subjects include vertebrates and invertebrates. Invertebrates include, but are not limited to, Drosophila melanogaster and Caenorhabditis elegans. Vertebrates include, but are not limited to, primates, rodents, domestic animals or game animals. Primates include, but are not limited to, chimpanzees, cynomologous monkeys, spider monkeys, and macaques (e.g., Rhesus). Rodents include, but are not limited to, mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include, but are not limited to, cows, horses, pigs, deer, bison, buffalo, feline species (e.g., domestic cat), canine species (e.g., dog, fox, wolf), avian species (e.g., chicken, emu, ostrich), and fish (e.g., zebrafish, trout, catfish and salmon). In some embodiments, the subject is a mammal, e.g., a primate, e.g., a human. In certain non-limiting embodiments, the patient, subject or individual is a human.

[0051] By the term “specifically binds,” as used herein with respect to an antibody, is meant an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more species. But, such cross-species reactivity does not itself alter the classification of an antibody as specific. Inanother example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross reactivity does not itself alter the classification of an antibody as specific.

[0052] In some instances, the terms “specific binding” or “specifically binding,” can be used in reference to the interaction of an antibody, a protein, or a peptide with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody is specific for epitope “A”, the presence of a molecule containing epitope A (or free, unlabeled A), in a reaction containing labeled “A” and the antibody, will reduce the amount of labeled A bound to the antibody.

[0053] A “coding region” of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous with or complementary to, respectively, the coding region of an mRNA molecule which is produced by transcription of the gene.

[0054] A “coding region” of a mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anti-codon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon. The coding region may thus include nucleotide residues comprising codons for amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g., amino acid residues in a protein export signal sequence).

[0055] “Complementary” as used herein to refer to a nucleic acid, refers to the broad concept of sequence complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds (“base pairing”) with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil. Similarly, it is known that a cytosine residue of a first nucleic acid strand is capable of base pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine. A first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue of the firstregion is capable of base pairing with a residue of the second region. In one embodiment, the first region comprises a first portion and the second region comprises a second portion, whereby, when the first and second portions are arranged in an antiparallel fashion, at least about 50%, at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion. In one embodiment, all nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion.

[0056] The term “DNA” as used herein is defined as deoxyribonucleic acid.

[0057] The term “expression” as used herein is defined as the transcription and / or translation of a particular nucleotide sequence driven by its promoter.

[0058] The term “expression vector” as used herein refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules, siRNA, ribozymes, and the like. Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operatively linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well.

[0059] As used herein the term “wild type” is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.

[0060] The term “homology” refers to a degree of complementarity. There may be partial homology or complete homology (i.e., identity). Homology is often measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group. University of Wisconsin Biotechnology Center.1710 University Avenue. Madison, Wis.53705). Such software matches similar sequences by assigning degrees of homology to various substitutions, deletions, insertions, and other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.

[0061] By “nucleic acid” is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil). The term “nucleic acid” typically refers to large polynucleotides.

[0062] Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5'-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5'-direction.

[0063] The direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the “coding strand”; sequences on the DNA strand which are located 5' to a reference point on the DNA are referred to as “upstream sequences”; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as “downstream sequences.”

[0064] In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.

[0065] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers,heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.

[0066] The term “RNA” as used herein is defined as ribonucleic acid.

[0067] “Variant” as the term is used herein, is a nucleic acid sequence or a peptide sequence that differs in sequence from a reference nucleic acid sequence or peptide sequence respectively, but retains essential biological properties of the reference molecule. Changes in the sequence of a nucleic acid variant may not alter the amino acid sequence of a peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions and truncations. Changes in the sequence of peptide variants are typically limited or conservative, so that the sequences of the reference peptide and the variant are closely similar overall and, in many regions, identical. A variant and reference peptide can differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A variant of a nucleic acid or peptide can be a naturally occurring such as an allelic variant, or can be a variant that is not known to occur naturally. Non-naturally occurring variants of nucleic acids and peptides may be made by mutagenesis techniques or by direct synthesis.

[0068] A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.

[0069] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical valueswithin that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. Description

[0070] The present invention provides compositions and methods for efficiently and reliably ligating two or more individual RNA molecules to produce a larger single RNA molecule that encodes a protein or fusion protein. The invention utilizes ribozyme-mediated trans-splicing of multiple RNA molecules to assemble a single RNA molecule encoding a protein or fusion protein of interest. In one embodiment, the protein or fusion protein of interest comprises voltage-gated sodium channel protein type 5 subunit alpha (SCN5A). The present invention is useful as the coding sequence for SCN5A is too large to package into a single vector. The present invention can also be used to efficiently produce fusion proteins comprising SCN5A, chimeric proteins comprising SCN5A, and the like.

[0071] The present invention employs scarless trans-ligation of RNAs in cells using ribozyme-cleaved RNAs. Ribozymes (Rzs) are small, catalytic RNA sequences which are capable of nucleotide specific self-cleavage.

[0072] Ribozyme-mediated RNA cleavage generates unique 3’ phosphate and 5’- hydroxy termini, which resemble substrates for ubiquitous RNA repair pathways present in all three kingdoms of life. Ribozyme-mediated cleavage can be harnessed for the trans- ligation of independent RNA transcripts in mammalian cells, an approach named stitchR (stitch RNA) which is described in PCT publication No. WO2021158964, which is incorporated herein by reference in its entirety.

[0073] Remarkably, reconstitution of messenger RNA by stitchR allows for efficient translation and expression of full-length proteins in mammalian cells. StitchR can be harnessed for the combination of protein coding functional domains or for the delivery and expression of large protein coding sequences by viral vectors.

[0074] Described herein is a StitchR-mediated dual AAV approach to deliver and express full-length human codon optimized SCN5A in cardiomyocytes in vivo as a noveltherapeutic approach to correct Brugada Syndrome conduction defects and other defects or diseases associated with loss of function of SCN5A.

[0075] Ribozyme-mediated RNA cleavage generates unique 3’ phosphate and 5’- hydroxy termini, which resemble substrates for ubiquitous RNA repair pathways present in all three kingdoms of life. Ribozyme-mediated cleavage can be harnessed for the trans- ligation of independent RNA transcripts in mammalian cells, an approach named stitchR (stitch RNA) which is described in PCT publication No. WO2021158964, which is incorporated herein by reference in its entirety.

[0076] Remarkably, reconstitution of messenger RNA by stitchR allows for efficient translation and expression of full-length proteins in mammalian cells. StitchR can be harnessed for the combination of protein coding functional domains or for the delivery and expression of large protein coding sequences by viral vectors.

[0077] In one aspect, the present invention provides one or more nucleic acid molecules encoding two or more RNA molecules. In certain embodiments, one or more of the RNA molecules comprise a ribozyme. In one embodiment, one or more of the RNA molecules comprise a coding region and a ribozyme. In certain embodiments, the ribozyme self-cleaves out of the RNA molecule leaving the coding region. Exemplary ribozymes that may be used in the context of the present invention include, but is not limited to, members of the Hammerhead (HH), Hepatitis Delta Virus (HDV), Varkud Satellite (VS), Sister, Twister- sister, Hairpin, Hatchet, Pistol, HOV Linc, or lantern families of ribozymes. However, the present invention is not limited to any particular ribozyme, but rather encompasses members of all known endogenous ribozyme families and any potential artificial ribozymes. That is, the described ribozymes, all known endogenous ribozymes, and potential artificial ribozymes can be used in the ligation of multiple RNAs, transplicing, and circularization, as described elsewhere herein.

[0078] For example, in one embodiment, the composition comprises a nucleic acid molecule encoding a first RNA molecule, where the first RNA molecule comprises a coding region and a 3’ ribozyme, where the 3’ ribozyme is able to catalyze itself out of the RNA molecule leaving the coding region with a 3’P or 2’3’ cyclic phosphate (cP) end. In one embodiment, the 3’ ribozyme comprises an HDV ribozyme. Further, in one embodiment, the composition comprises a nucleic acid molecule encoding a second RNA molecule, where thesecond RNA molecule comprises a coding region and a 5’ ribozyme, where the 5’ ribozyme is able to catalyze itself out of the RNA molecule leaving the coding region with a 5’OH end. In one embodiment, the 5’ ribozyme comprises an HH ribozyme. In certain instances, a ligase joins the coding region of the first RNA molecule to the coding region of the second RNA molecule together to form a longer RNA molecule encoding a protein of interest.

[0079] For example, in one embodiment, the composition comprises a first RNA molecule, where the first RNA molecule comprises a coding region and a 3’ ribozyme, where the 3’ ribozyme is able to catalyze itself out of the RNA molecule leaving the coding region with a 3’P or 2’3’ cyclic phosphate (cP) end. In one embodiment, the 3’ ribozyme comprises an HDV ribozyme. Further, in one embodiment, the composition comprises a second RNA molecule, where the second RNA molecule comprises a coding region and a 5’ ribozyme, where the 5’ ribozyme is able to catalyze itself out of the RNA molecule leaving the coding region with a 5’OH end. In one embodiment, the 5’ ribozyme comprises an HH ribozyme. In certain instances, a ligase joins the coding region of the first RNA molecule to the coding region of the second RNA molecule together to form a longer RNA molecule encoding SCN5A.

[0080] In certain embodiments the first RNA comprises a coding region encoding a first portion of SCN5A and the second RNA comprises a coding region encoding a second portion of SCN5A, and thus the ribozyme-mediated cleavage and ligase-mediated assembly of the RNA molecules results in the production of an RNA molecule encoding a SCN5A protein having both the first and second portions. The present invention can be used to produce a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein from multiple RNAs, each comprising a coding region encoding a portion of the full-length SCN5A protein. Further, the present invention can be used to produce fusion proteins comprising multiple domains, where each RNA molecule comprises a coding region encoding a domain of the fusion protein. For example, the present invention can be used to generate an RNA molecule encoding a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein having a leader sequence, N-terminal tag, C-terminal tag, or the like by assembling an RNA from a first RNA comprising a coding sequence encoding the leader sequence, N-terminal tag, or C- terminal tag attached to a coding region encoding a first portion of a full-length SCN5Aprotein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein, and at least one additional RNA molecule comprising a coding sequence encoding a second portion of a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein.

[0081] In certain aspects, the multiple RNA molecules are ligated together after ribozyme-mediated generation of the 5’OH and 3’P or 2’3’cP ends. In some instances, the RNA molecules are ligated together by an endogenous ligase that exists in the native cell or tissue in which the RNA assembly is taking place. In some instances, the method of the present invention comprises the step of adding an exogenous ligase to induce the ligation of the processed RNA molecules together. In one embodiment, the ligase is RNA 2',3'-Cyclic Phosphate and 5'-OH (RtcB) ligase. Compositions

[0082] In one embodiment, the present invention relates to a composition comprising one or more nucleic acid molecule comprising a coding sequence encoding a portion of a SCN5A protein linked to a coding sequence of a ribozyme. In one embodiment, the present invention comprises one or more RNA molecule comprising one or more ribozyme. In some embodiments, the one or more RNA molecule comprises at least a first RNA molecule and a second RNA molecule.

[0083] In some embodiments, said one or more ribozyme of the composition is capable of spontaneously cis-cleaving from said one or more RNA molecule. In some embodiments, said one or more ribozyme is a 3’ ribozyme. In some embodiments, said 3’ ribozyme generates a 3’P or 2’3’ cP end on the remaining one or more RNA molecule after spontaneous cis-cleavage. In some embodiments, said one or more ribozyme is a 5’ ribozyme. In some embodiments, said 5’ ribozyme generates a 5’OH end on the remaining one or more RNA molecules after spontaneous cis-cleavage. In some embodiments, said 3’P or 2’3’ cP end and said 5’OH end can be ligated together.

[0084] In some embodiments, said first RNA molecule comprises a 3’ ribozyme. In some embodiments, said 3’ ribozyme is from one or more family selected from the group consisting of: Hammerhead (HH), Hepatitis Delta Virus (HDV), Varkud Satellite (VS), Twister (Twst), Sister, Twister-sister (TS), Hairpin, Hatchet, Pistol, HOV Linc or a variant orfragment thereof that maintains cis-cleaving functionality. In one embodiment, the 3’ ribozyme comprises the lantern ribozyme (Zhou et al.2003, Research Square; DOI: 10.21203 / rs.3.rs-2567304 / v1). However, the present invention is not limited to any particular ribozyme, but rather encompasses members of all known endogenous ribozyme families and any potential artificial ribozymes. In one embodiment, the 3’ ribozyme comprises a Type P1 Twister, a Type P3 Twister, or a Type P5 Twister. In one embodiment, the 3’ribozyme comprises a Type P1 Twister. In one embodiment, the 3’ ribozyme comprises Type P1 Twister from rice (Oryza sativa, Osa). In some embodiments, the 3’ ribozyme comprises an overhang of one or more nucleotides. In one embodiment, the overhang comprises a nucleotide sequence that hybridizes to a sequence upstream of said 3’ ribozyme within the first RNA molecule. In some embodiments, the overhang improves efficiency of spontaneous cis-cleavage.

[0085] In some embodiments, said second RNA molecule comprises a 5’ ribozyme. In some embodiments, said 5’ ribozyme is from one or more family selected from the group consisting of: Hammerhead (HH), Hepatitis Delta Virus (HDV) (e.g., HDV68, HDV67, HDV56, genHDV, or antiHDV), Varkud Satellite (VS), Twister (Twst), Sister, Twister-sister (TS), Hairpin, Hatchet, Pistol, HOV Linc or a variant or fragment thereof that maintains cis- cleaving functionality. In one embodiment, the 5’ ribozyme comprises the lantern ribozyme (Zhou et al., 2023, Research Square; DOI: 10.21203 / rs.3.rs-2567304 / v1). However, the present invention is not limited to any particular ribozyme, but rather encompasses members of all known endogenous ribozyme families and any potential artificial ribozymes. In one embodiment, the 5’ ribozyme comprises a Type P1 Twister, a Type P3 Twister, or a Type P5 Twister. In one embodiment, the 5’ribozyme comprises a Type P1 Twister. In one embodiment, the 5’ ribozyme comprises Type P1 Twister from rice (Oryza sativa, Osa). In some embodiments, the 5’ ribozyme comprises an overhang of one or more nucleotides. In one embodiment, the overhang comprises a nucleotide sequence that hybridizes to a sequence downstream of said 5’ ribozyme within the second RNA molecule. In some embodiments, the overhang improves efficiency of spontaneous cis-cleavage.

[0086] As described herein, the 3’P or 2’3’ cP end and the 5’OH end of RNA molecules that have undergone ribozyme-mediated cleavage can be ligated together. As such, separated RNA sequences encoding separate portions of a larger protein can be trans-splicedtogether in a scar-less manner to enable expression of the larger protein. In one embodiment, the present invention relates to a composition comprising one or more nucleic acid molecule encoding two or more portions of a protein of interest and encoding one or more ribozyme. In one embodiment, the present invention relates to a composition comprising one or more RNA molecule encoding two or more portions protein of interest and comprising one or more ribozyme.

[0087] In one embodiment, the one or more nucleic acid molecules encoding two or more portions of a protein of interest comprise a first nucleic acid molecule encoding a first portion of a protein of interest and a second nucleic acid molecule encoding a second portion of a protein of interest. In one embodiment, the first nucleic acid comprises a first RNA molecule. In one embodiment, the second nucleic acid comprises a second RNA molecule. In one embodiment, the first RNA molecule is linked at the 3’ end to a 3’ ribozyme. In one embodiment, the second RNA molecule is linked at the 5’ end to a 5’ ribozyme. In one embodiment, upon cis-cleavage of the 3’ and 5’ ribozyme sequences, the 3’P or 2’3’ cP end of first RNA molecule is ligated to the 5’OH end of the second RNA molecule, thereby generating a single RNA molecule encoding a full-length protein of interest. In one embodiment, the full-length protein of interest functions identically to an endogenously expressed full-length protein of the same sequence.

[0088] In one embodiment, the full-length protein of interest comprises a therapeutic protein. In one embodiment, the therapeutic protein comprises SCN5A.

[0089] N-terminal or C-terminal RNA molecules encoding a portion of a protein of interest could be subject to translation prior to ribozyme-mediated cleavage, or when expressed separately, potentially resulting in unwanted or truncated protein expression. However, translational control of protein degradation sequences can be utilized to limit this unwanted expression. In one embodiment, the one or more RNA molecule of the composition comprises a nucleic acid sequence encoding a translational control of protein degradation sequence. In one embodiment, the first RNA molecule comprises a nucleic acid sequence encoding a translational control of protein degradation sequence. In one embodiment, the second RNA molecule comprises a nucleic acid sequence encoding a translational control of protein degradation sequence. In some embodiments, said translational control of protein degradation sequences prevent partial expression of proteinprior to cleavage of ribozyme sequences and splicing. In some embodiments, the translational control of protein degradation sequences comprise one or more selected from the group consisting of: a hCL1-PEST sequence, an E1A-PEST sequence, removal of the nucleic acid’s poly(A) sequence, simulated translation through a poly A tail to generate a poly K tail, deletion of the ATG stop codon, silent mutations within N-terminal NTG codons, a 5’ UTR of yeast GCN4 sequence encoding four small upstream ORFs that function as translation inhibitors, a small internal fragment of a 5’ UTR of yeast GCN4 sequence.

[0090] In certain aspects, to further prevent unwanted or truncated protein expression, RNA nuclear localization signals may be useful to prevent cytosolic export and translation of un-spliced RNA molecules. In one embodiment, the one or more RNA molecule of the composition comprises a nucleic acid sequence encoding an RNA nuclear localization sequence. In one embodiment, the first RNA molecule comprises a nucleic acid sequence encoding an RNA nuclear localization sequence. In one embodiment, the second RNA molecule comprises a nucleic acid sequence encoding an RNA nuclear localization sequence. In one embodiment, the RNA nuclear localization sequences prevent cytosolic RNA export and translation of partial protein prior to cleavage of ribozyme sequences and splicing.

[0091] In some embodiments, the composition further comprises one or more additional RNA molecule, each additional RNA molecule comprising a coding region encoding a domain of the protein of interest; a 5’ ribozyme; and a 3’ ribozyme. In some embodiments, the system further comprises one or more additional nucleic acid molecule encoding one or more additional RNA molecule, each additional RNA molecule comprising a coding region encoding a domain of the protein of interest; a 5’ ribozyme; and a 3’ ribozyme.

[0092] In some embodiments, the composition further comprises one or more additional RNA molecule, each additional RNA molecule comprising a coding region encoding a domain of the protein of interest; a 5’ ribozyme; and a 3’ ribozyme recognition sequence. In some embodiments, the system further comprises one or more additional nucleic acid molecule encoding one or more additional RNA molecule, each additional RNA molecule comprising a coding region encoding a domain of the protein of interest; a 5’ ribozyme; and a 3’ ribozyme recognition sequence.Nucleic Acids

[0093] In some embodiments, one or more nucleic acid of the present invention comprises a nucleic acid sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7, or a fragment or variant thereof. For example, in some embodiments, the variant nucleic acid has a degree of identity with respect to SEQ ID NO:1 or SEQ ID NO:2 of at least 60%, of at least 65%, of at least 70%, of at least 75%, of at least 80%, of at least 81%, of at least 82%, of at least 83%, of at least 84%, of at least 85%, of at least 86%, of at least 87%, of at least 88%, of at least 89%, of at least 90%, of at least 91%, of at least 92%, of at least 93%, of at least 94%, of at least 95%, of at least 96%, of at least 97%, of at least 98%, of at least 99%, or of at least 99.5%. In some embodiments, the variant of SEQ ID NO:1 or SEQ ID NO:2 encodes a portion of a functional SCN5A protein such that upon ligation of the RNA molecules a functional SCN5A protein is generated. In some embodiments, the functional SCN5A retains the ability to interact with protein partners of native SCN5A. In some embodiments, the functional SCN5A retains the ability to participate in the formation of the voltage-gated sodium channel NaV1.5. In some embodiments, the variant of SEQ ID NO:6 or SEQ ID NO:7 comprises at least the coding sequences as set forth in SEQ ID NO:1 and SEQ ID NO:2 respectively.

[0094] In some embodiments, one or more nucleic acid of the present invention comprises a nucleic acid sequence that is a portion or fragment of a nucleic acid sequence described herein. For example, in some embodiments, the nucleic acid has a length with respect to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 of at least 60%, of at least 65%, of at least 70%, of at least 75%, of at least 80%, of at least 81%, of at least 82%, of at least 83%, of at least 84%, of at least 85%, of at least 86%, of at least 87%, of at least 88%, of at least 89%, of at least 90%, of at least 91%, of at least 92%, of at least 93%, of at least 94%, of at least 95%, of at least 96%, of at least 97%, of at least 98%, of at least 99%, or of at least 99.5%. In some embodiments, the fragment of SEQ ID NO:1 or SEQ ID NO:2 encodes a portion of a functional SCN5A protein such that upon ligation of the RNA molecules a functional SCN5A protein is generated. In some embodiments, the functional SCN5A retains the ability to interact with protein partners of native SCN5A. In some embodiments, the functional SCN5A retains the ability to participate in the formation of thevoltage-gated sodium channel NaV1.5. In some embodiments, the fragment of SEQ ID NO:6 or SEQ ID NO:7 comprises at least the coding sequences as set forth in SEQ ID NO:1 and SEQ ID NO:2 respectively.

[0095] In some embodiments, one or more nucleic acid of the present invention comprises a nucleic acid sequence that is a portion of a nucleic acid sequence described herein, and is substantially homologous to a nucleic acid sequence described herein. For example, in some embodiments, the nucleic acid has a degree of identity with respect to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 of at least 60%, of at least 65%, of at least 70%, of at least 75%, of at least 80%, of at least 81%, of at least 82%, of at least 83%, of at least 84%, of at least 85%, of at least 86%, of at least 87%, of at least 88%, of at least 89%, of at least 90%, of at least 91%, of at least 92%, of at least 93%, of at least 94%, of at least 95%, of at least 96%, of at least 97%, of at least 98%, of at least 99%, or of at least 99.5%. and / or has a length with respect to the original nucleic acid sequence of at least 60%, of at least 65%, of at least 70%, of at least 75%, of at least 80%, of at least 81%, of at least 82%, of at least 83%, of at least 84%, of at least 85%, of at least 86%, of at least 87%, of at least 88%, of at least 89%, of at least 90%, of at least 91%, of at least 92%, of at least 93%, of at least 94%, of at least 95%, of at least 96%, of at least 97%, of at least 98%, of at least 99%, or of at least 99.5%.

[0096] The nucleic acid of the present invention may comprise any type of nucleic acid, including, but not limited to DNA and RNA. For example, in one embodiment, the composition comprises an isolated DNA molecule, including for example, an isolated cDNA molecule, encoding a fusion protein of the invention. In one embodiment, the composition comprises an isolated RNA molecule encoding a fusion protein of the invention, or a functional fragment thereof.

[0097] The nucleic acid molecules of the present invention can be modified to improve stability in serum or in growth medium for cell cultures. Modifications can be added to enhance stability, functionality, and / or specificity and to minimize immunostimulatory properties of the nucleic acid molecule of the invention. For example, in order to enhance the stability, the 3’-residues may be stabilized against degradation, e.g., they may be selected such that they consist of purine nucleotides, particularly adenosine or guanosine nucleotides.Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine by 2’-deoxythymidine is tolerated and does not affect function of the molecule.

[0098] In one embodiment of the present invention the nucleic acid molecule may contain at least one modified nucleotide analogue. For example, the ends may be stabilized by incorporating modified nucleotide analogues.

[0099] Non-limiting examples of nucleotide analogues include sugar- and / or backbone-modified ribonucleotides (i.e., include modifications to the phosphate-sugar backbone). For example, the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. In exemplary backbone-modified ribonucleotides the phosphoester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g., of phosphothioate group. In exemplary sugar-modified ribonucleotides, the 2’ OH-group is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2or ON, wherein R is C1-C6alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I.

[0100] Other examples of modifications are nucleobase-modified ribonucleotides, i.e., ribonucleotides, containing at least one non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Bases may be modified to block the activity of adenosine deaminase. Exemplary modified nucleobases include, but are not limited to, uridine and / or cytidine modified at the 5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and / or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6-methyl adenosine are suitable. It should be noted that the above modifications may be combined.

[0101] In some instances, the nucleic acid molecule comprises at least one of the following chemical modifications: 2’-H, 2’-O-methyl, or 2’-OH modification of one or more nucleotides. In certain embodiments, a nucleic acid molecule of the invention can have enhanced resistance to nucleases. For increased nuclease resistance, a nucleic acid molecule, can include, for example, 2’-modified ribose units and / or phosphorothioate linkages. For example, the 2’ hydroxyl group (OH) can be modified or replaced with a number of different “oxy” or “deoxy” substituents. For increased nuclease resistance the nucleic acid molecules of the invention can include 2’-O-methyl, 2’-fluorine, 2’-O-methoxyethyl, 2’-O- aminopropyl, 2’-amino, and / or phosphorothioate linkages. Inclusion of locked nucleic acids(LNA), ethylene nucleic acids (ENA), e.g., 2’-4’-ethylene-bridged nucleic acids, and certain nucleobase modifications such as 2-amino-A, 2-thio (e.g., 2-thio-U), G-clamp modifications, can also increase binding affinity to a target.

[0102] In one embodiment, the nucleic acid molecule includes a 2’-modified nucleotide, e.g., a 2’-deoxy, 2’-deoxy-2’-fluoro, 2’-O-methyl, 2’-O-methoxyethyl (2’-O- MOE), 2’-O-aminopropyl (2’-O-AP), 2’-O-dimethylaminoethyl (2’-O-DMAOE), 2’-O- dimethylaminopropyl (2’-O-DMAP), 2’-O-dimethylaminoethyloxyethyl (2’-O-DMAEOE), or 2’-O-N-methylacetamido (2’-O-NMA). In one embodiment, the nucleic acid molecule includes at least one 2’-O-methyl-modified nucleotide, and in some embodiments, all of the nucleotides of the nucleic acid molecule include a 2’-O-methyl modification.

[0103] In certain embodiments, the nucleic acid molecule of the invention has one or more of the following properties:

[0104] Nucleic acid agents discussed herein include otherwise unmodified RNA and DNA as well as RNA and DNA that have been modified, e.g., to improve efficacy, and polymers of nucleoside surrogates. Unmodified RNA refers to a molecule in which the components of the nucleic acid, namely sugars, bases, and phosphate moieties, are the same or essentially the same as that which occur in nature, or as occur naturally in the human body. The art has referred to rare or unusual, but naturally occurring, RNAs as modified RNAs, see, e.g., Limbach et al. (Nucleic Acids Res., 1994, 22:2183-2196). Such rare or unusual RNAs, often termed modified RNAs, are typically the result of a post-transcriptional modification and are within the term unmodified RNA as used herein. Modified RNA, as used herein, refers to a molecule in which one or more of the components of the nucleic acid, namely sugars, bases, and phosphate moieties, are different from that which occur in nature, or different from that which occurs in the human body. While they are referred to as “modified RNAs” they will of course, because of the modification, include molecules that are not, strictly speaking, RNAs. Nucleoside surrogates are molecules in which the ribophosphate backbone is replaced with a non-ribophosphate construct that allows the bases to be presented in the correct spatial relationship such that hybridization is substantially similar to what is seen with a ribophosphate backbone, e.g., non-charged mimics of the ribophosphate backbone.

[0105] Modifications of the nucleic acid of the invention may be present at one or more of, a phosphate group, a sugar group, backbone, N-terminus, C-terminus, or nucleobase. Vectors

[0106] The present invention also includes a composition comprising one or more vector in which one or more nucleic acid molecule of the present invention is inserted. In one embodiment, the vector encodes at least two RNA molecules. In one embodiment, the vector comprises at least two RNA molecules. In some embodiments, the at least two RNA molecules are encoded by the same vector. In some embodiments, the at least two RNA molecules are contained within the same vector. In one embodiment, said at least two RNA molecules comprise a first RNA molecule and a second RNA molecule.

[0107] In some embodiments, the present invention comprises at least two vectors encoding at least two RNA molecules. In some embodiments, the at least two vectors comprise at least two RNA molecules. In some embodiments, the at least two vectors encode separate RNA molecules. In some embodiments, the at least two vectors comprise separate RNA molecules. In some embodiments, the at least two separate RNA molecules comprise a first RNA molecule and a second RNA molecule. In some embodiments, the first RNA molecule is encoded by a first vector and the second RNA molecule is encoded by a second vector. In some embodiments, the first RNA molecule comprises a first vector and the second RNA molecule comprises a second vector.

[0108] In some embodiments, the present invention further comprises a vector encoding one or more additional RNA molecule. In some embodiments, the present invention further comprises one or more vector comprising one or more additional RNA molecule. In some embodiments, each additional RNA molecule comprises a coding region encoding a domain of the protein of interest; a 5’ ribozyme; and a 3’ ribozyme. In some embodiments, each additional RNA molecule comprises a coding region encoding a domain of the protein of interest; a 5’ ribozyme; and a 3’ ribozyme recognition sequence.

[0109] The art is replete with suitable vectors that are useful in the present invention. In brief summary, the expression of natural or synthetic nucleic acids encoding a fusion protein of the invention is typically achieved by operably linking a nucleic acid encoding thefusion protein of the invention or portions thereof to a promoter, and incorporating the construct into an expression vector. The vectors to be used are suitable for replication and, optionally, integration in eukaryotic cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence.

[0110] The vectors of the present invention may also be used for nucleic acid immunization and gene therapy, using standard gene delivery protocols. Methods for gene delivery are known in the art. See, e.g., U.S. Pat. Nos.5,399,346, 5,580,859, 5,589,466, incorporated by reference herein in their entireties. In another embodiment, the invention provides a gene therapy vector.

[0111] The isolated nucleic acid of the invention can be cloned into a number of types of vectors. For example, the nucleic acid can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

[0112] Further, the vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno- associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers, (e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Pat. No.6,326,193).

[0113] Further, a number of additional viral based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. A selected gene can be inserted into a vector and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo. A number of retroviral systems are known in the art. In some embodiments, adenovirus vectors are used. A number of adenovirus vectors are known in the art.

[0114] In one embodiment, the composition includes a vector derived from an adeno- associated virus (AAV). The term "AAV vector" means a vector derived from an adeno- associated virus serotype, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, and AAV-9. AAV vectors have become powerful gene delivery tools for the treatment of various disorders. AAV vectors possess a number of features that render them ideally suited for gene therapy, including a lack of pathogenicity, minimal immunogenicity, and the ability to transduce postmitotic cells in a stable and efficient manner. Expression of a particular gene contained within an AAV vector can be specifically targeted to one or more types of cells by choosing the appropriate combination of AAV serotype, promoter, and delivery method. In some embodiments, the AAV serotype is myoAAV-4A.

[0115] AAV vectors can have one or more of the AAV wild-type genes deleted in whole or part, preferably the rep and / or cap genes, but retain functional flanking ITR sequences. Despite the high degree of homology, the different serotypes have tropisms for different tissues. The receptor for AAV1 is unknown; however, AAV1 is known to transduce skeletal and cardiac muscle more efficiently than AAV2. Since most of the studies have been done with pseudotyped vectors in which the vector DNA flanked with AAV2 ITR is packaged into capsids of alternate serotypes, it is clear that the biological differences are related to the capsid rather than to the genomes. Recent evidence indicates that DNA expression cassettes packaged in AAV 1 capsids are at least 1 log 10 more efficient at transducing cardiomyocytes than those packaged in AAV2 capsids. In one embodiment, the viral delivery system is an adeno-associated viral delivery system. The adeno-associated virus can be of serotype 1 (AAV 1), serotype 2 (AAV2), serotype 3 (AAV3), serotype 4 (AAV4), serotype 5 (AAV5), serotype 6 (AAV6), serotype 7 (AAV7), serotype 8 (AAV8), or serotype 9 (AAV9).

[0116] Desirable AAV fragments for assembly into vectors include the cap proteins, including the vp1, vp2, vp3 and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments may be readily utilized in a variety of vector systems and host cells. Such fragments may be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAVserotypes include, without limitation, AAV with a non-naturally occurring capsid protein. Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vp1 capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, non-contiguous portions of the same AAV serotype, from a non-AAV viral source, or from a non-viral source. An artificial AAV serotype may be, without limitation, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid. Thus exemplary AAVs, or artificial AAVs, suitable for expression of one or more proteins, include AAV2 / 8 (see U.S. Pat. No.7,282,199), AAV2 / 5 (available from the National Institutes of Health), AAV2 / 9 (International Patent Publication No. WO2005 / 033321), AAV2 / 6 (U.S. Pat. No.6,156,303), and AAVrh8 (International Patent Publication No. WO2003 / 042397), among others. In some embodiments, the AAV serotype selected shows greater tropism for cardiac tissues. In some embodiments, the AAV serotype is myoAAV-4A.

[0117] In one embodiment, the composition comprises a lentiviral vector to deliver one or more nucleic acid of the present invention. In one embodiment, the present invention comprises a lentiviral vector comprising one or more RNA molecule encoding one or more protein of interest. For example, vectors derived from retroviruses such as the lentivirus are suitable tools to achieve long-term gene transfer since they allow long-term, stable integration of a transgene and its propagation in daughter cells. Lentiviral vectors have the added advantage over vectors derived from onco-retroviruses such as murine leukemia viruses in that they can transduce non-proliferating cells, such as hepatocytes. They also have the added advantage of low immunogenicity.

[0118] In certain embodiments, the vector also includes conventional control elements which are operably linked to the transgene in a manner which permits its transcription, translation and / or expression in a cell transfected with the plasmid vector or infected with the virus produced by the invention. As used herein, “operably linked” sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA;sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A great number of expression control sequences, including promoters which are native, constitutive, inducible and / or tissue-specific, are known in the art and may be utilized.

[0119] Additional promoter elements, e.g., enhancers, regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either cooperatively or independently to activate transcription.

[0120] One example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. Another example of a suitable promoter is Elongation Growth Factor -1α (EF-1α). However, other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter. Further, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.

[0121] In one embodiment, the promoter is the human Elongation Growth Factor -1α (EF-1α). In one embodiment, the promoter is the cardiac-specific cardiac Troponin-T (cTnT) promoter. In one embodiment, the cTnT promoter comprises a sequence as set forth in SEQ ID NO:5.

[0122] Enhancer sequences found on a vector also regulates expression of the gene contained therein. Typically, enhancers are bound with protein factors to enhance the transcription of a gene. Enhancers may be located upstream or downstream of the gene it regulates. Enhancers may also be tissue-specific to enhance transcription in a specific cell or tissue type. In one embodiment, the vector of the present invention comprises one or more enhancers to boost transcription of the gene present within the vector.

[0123] In order to assess the expression of a fusion protein of the invention, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co- transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, for example, antibiotic-resistance genes, such as neo and the like.

[0124] Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82). Suitable expression systems are well known and may be prepared using known techniques or obtained commercially. In general, the construct with the minimal 5' flanking region showing the highest level of expression of reporter gene is identified as the promoter. Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to modulate promoter- driven transcription.Pharmaceutical Compositions

[0125] The invention also encompasses the use of pharmaceutical compositions of the invention or salts thereof to practice the methods of the invention. Such a pharmaceutical composition may consist of at least one nucleic acid of the invention or a salt thereof in a form suitable for administration to a subject, or the pharmaceutical composition may comprise at least one nucleic acid of the invention or a salt thereof, and one or more pharmaceutically acceptable carriers, one or more additional ingredients, or some combination of these. The nucleic acid of the invention may be present in the pharmaceutical composition in the form of a physiologically acceptable salt, such as in combination with a physiologically acceptable cation or anion, as is well known in the art. Systems

[0126] In some embodiments, the present invention relates to systems for cis- cleavage and trans-splicing of independent RNA molecules. In some embodiments, the present invention relates to systems cis-cleavage and trans-splicing of a single RNA molecule. In some embodiments, cis-cleavage and trans-splicing of independent RNA molecules or fragments of a single RNA molecule results in a single RNA molecule encoding a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein, as described herein. In some embodiments, the system comprises a ligase or a nucleic acid encoding a ligase, such as RtcB, as described herein.

[0127] In one embodiment, the present invention relates to an inducible system for generating a single RNA encoding a full-length protein from two separate RNA molecules encoding a first part and a second part of the full-length protein via cis-cleavage of ribozymes and trans-splicing of the two independent RNA molecules. In some embodiments, the system comprises a ribozyme recognition sequence and a ribozyme, as described herein. In some embodiments, the system comprises a ligase or a nucleic acid encoding a ligase, as described herein.

[0128] In one embodiment, the present invention relates to a system for delivery and expression of a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein via cis-cleavage and trans-splicing of independent RNA molecules encoding parts of the full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein. In one embodiment, the system comprises a first vector comprising a coding sequence for the N-terminal portion of SCN5A (SEQ ID NO:1) and a second vector comprising a coding sequence for the C- terminal portion of SCN5A (SEQ ID NO:2), wherein each of the vectors further comprises a ribozyme sequence for self-cleavage of the vectors and subsequent trans-ligation for formation of an RNA encoding full length SCN5A. In one embodiment, the system comprises a first vector comprising SEQ ID NO:6 and a second vector comprising SEQ ID NO:7. Delivery Vehicles

[0129] In some embodiments, the system or composition comprises a delivery vehicle or a combination of delivery vehicles for delivery of at least one nucleic acid molecule for the in vivo generation and expression of a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A or a SCN5A fusion protein to a subject.

[0130] In one embodiment, the invention provides a single delivery vehicle for delivery of a first and second RNA molecule, wherein each of the first and second RNA molecule comprises a coding sequence for a portion of a full length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein.

[0131] In one embodiment, the invention provides a combination of two or more delivery vehicles for delivery of a first and second nucleic acid molecule, wherein the first delivery vehicle comprises or encapsulates a nucleic acid molecule comprises a coding sequence for a first portion of a full length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein, and the second delivery vehicle comprises or encapsulates a nucleic acid molecule comprises a coding sequence for a second portion of a full length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein.

[0132] An exemplary delivery vehicle for targeted delivery of one or more nucleic acid molecules into a host cell is a lipid nanoparticle (LNP). The term “lipid nanoparticle” refers to a particle having at least one dimension on the order of nanometers (e.g., 1-1,000 nm) which includes one or more lipids. In some embodiments, such lipid nanoparticles comprise a cationic lipid and at least one excipient. Exemplary excipients include, but are not limited to, neutral lipids, charged lipids, steroids and polymer conjugated lipids (e.g., a pegylated lipid). In some embodiments, the at least one agent or polynucleotide is encapsulated in the lipid portion of the LNP or an aqueous space enveloped by some or all of the lipid portion of the LNP, thereby protecting it from enzymatic degradation or other undesirable effects induced by the mechanisms of the host organism or cells e.g. an adverse immune response.

[0133] In various embodiments, the lipid nanoparticles have a mean diameter of from about 30 nm to about 150 nm, from about 40 nm to about 150 nm, from about 50 nm to about 150 nm, from about 60 nm to about 130 nm, from about 70 nm to about 110 nm, from about 70 nm to about 100 nm, from about 80 nm to about 100 nm, from about 90 nm to about 100 nm, from about 70 to about 90 nm, from about 80 nm to about 90 nm, from about 70 nm to about 80 nm, or about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, 150 nm, 155 nm, 160 nm, 165 nm, 170 nm, 175 nm, 180 nm, 185 nm, 190 nm, 195 nm or 200 nm. In some embodiments, the lipid nanoparticles are substantially non-toxic. In certain embodiments the genome editing complex, when present in the lipid nanoparticles, is resistant in aqueous solution to degradation by intra- or intercellular enzymes.

[0134] The LNP may comprise any lipid capable of forming a particle to which the at least one agent is attached, or in which the at least one agent is encapsulated. The term “lipid” refers to a group of organic compounds that are derivatives of fatty acids (e.g., esters) and are generally characterized by being insoluble in water but soluble in many organic solvents. Lipids are usually divided into at least three classes: (1) “simple lipids” which include fats and oils as well as waxes; (2) “compound lipids” which include phospholipids and glycolipids; and (3) “derived lipids” such as steroids.

[0135] In one embodiment, the LNP comprises one or more cationic lipids, and one or more stabilizing lipids. Stabilizing lipids include neutral lipids and pegylated lipids.

[0136] In one embodiment, the LNP comprises an ionizable cationic lipid. As used herein, the term “ionizable cationic lipid” refers to a lipid that is cationic or becomes cationic (protonated) as the pH is lowered below the pK of the ionizable group of the lipid but is progressively more neutral at higher pH values. At pH values below the pK, the lipid is then able to associate with negatively charged nucleic acids. In certain embodiments, the cationic lipid comprises a zwitterionic lipid that assumes a positive charge on pH decrease.

[0137] In certain embodiments, the ionizable cationic lipid comprises any of a number of lipid species which carry a net positive charge at a selective pH, such as physiological pH. Such lipids include, but are not limited to, N,N-dioleyl-N,N- dimethylammonium chloride (DODAC); N-(2,3-dioleyloxy)propyl)-N,N,N- trimethylammonium chloride (DOTMA); N,N-distearyl-N,N-dimethylammonium bromide (DDAB); N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP); 3- (N—(N′,N′-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), N-(1-(2,3- dioleoyloxy)propyl)-N-2-(sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoracetate (DOSPA), dioctadecylamidoglycyl carboxyspermine (DOGS), 1,2-dioleoyl-3- dimethylammonium propane (DODAP), N,N-dimethyl-2,3-dioleoyloxy)propylamine (DODMA), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (DMRIE), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), N,N- dimethyl-2,3-bis(((9Z,12Z,15Z)-octadeca-9,12,15-trien-1-yl)oxy)propan-1-amine (DLenDMA), (6Z,9Z,28Z,31Z)-Heptatriaconta-6,9,28,31-tetraen-19-yl 4- (dimethylamino)butanoate (D-Lin-MC3-DMA), 1,2-dilinoleyoxy-3- (dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-dilinoleylthio-3- dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-dilinoleyloxy-3- (N-methylpiperazino)propane (DLin-MPZ), 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxo-3-(2-N,N- dimethylamino)ethoxypropane (DLin-EG-DMA), and 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA). Additionally, a number of commercial preparations of cationic lipids are available which can be used in the present invention. These include, for example, LIPOFECTIN® (commercially available cationic liposomes comprising DOTMA and 1,2-dioleoyl-sn-3-phosphoethanolamine (DOPE), from GIBCO / BRL, Grand Island, N.Y.); LIPOFECTAMINE® (commercially available cationic liposomes comprising N-(1-(2,3-dioleyloxy)propyl)-N-(2-(sperminecarboxamido)ethyl)- N,N-dimethylammonium trifluoroacetate (DOSPA) and (DOPE), from GIBCO / BRL); and TRANSFECTAM® (commercially available cationic lipids comprising dioctadecylamidoglycyl carboxyspermine (DOGS) in ethanol from Promega Corp., Madison, Wis.).

[0138] Exemplary LNPs and their manufacture are described in the art, for example in U.S. Patent Application Publication No. US20120276209, Semple et al., 2010, Nat Biotechnol., 28(2):172-176; Akinc et al., 2010, Mol Ther., 18(7): 1357-1364; Basha et al., 2011, Mol Ther, 19(12): 2186-2200; Leung et al., 2012, J Phys Chem C Nanomater Interfaces, 116(34): 18440-18450; Lee et al., 2012, Int J Cancer., 131(5): E781-90; Belliveau et al., 2012, Mol Ther nucleic Acids, 1: e37; Jayaraman et al., 2012, Angew Chem Int Ed Engl., 51(34): 8529-8533; Mui et al., 2013, Mol Ther Nucleic Acids.2, e139; Maier et al., 2013, Mol Ther., 21(8): 1570-1578; and Tam et al., 2013, Nanomedicine, 9(5): 665-74, each of which are incorporated by reference in their entirety.

[0139] In one embodiment, delivery of a vector for in vivo generation and expression of a full length SCN5A protein, a functional SCN5A fragment, a functional SCN5A or a SCN5A fusion protein comprises any suitable delivery method, including exemplary transfection methods described elsewhere herein.

[0140] In some embodiments, delivery of a vector to a subject comprises mixing the vector with a transfection reagent prior to the step of contacting. In another embodiment, a method of present invention further comprises administering the vector together with the transfection reagent. In another embodiment, the transfection reagent is a cationic lipid reagent. In another embodiment, the transfection reagent is a cationic polymer reagent. In another embodiment, the transfection reagent is a lipid-based transfection reagent. In another embodiment, the transfection reagent is a protein-based transfection reagent. In another embodiment, the transfection reagent is a carbohydrate-based transfection reagent. In anotherembodiment, the transfection reagent is a cationic lipid-based transfection reagent. In another embodiment, the transfection reagent is a cationic polymer-based transfection reagent. In another embodiment, the transfection reagent is a polyethyleneimine based transfection reagent. In another embodiment, the transfection reagent is calcium phosphate. In another embodiment, the transfection reagent is Lipofectin®, Lipofectamine®, or TransIT®. In another embodiment, the transfection reagent is any other transfection reagent known in the art.

[0141] In another embodiment, the transfection reagent forms a liposome. Liposomes, in another embodiment, increase intracellular stability, increase uptake efficiency and improve biological activity. In another embodiment, liposomes are hollow spherical vesicles composed of lipids arranged in a similar fashion as those lipids, which make up the cell membrane. They have, in another embodiment, an internal aqueous space for entrapping water-soluble compounds and range in size from 0.05 to several microns in diameter. In another embodiment, liposomes can deliver nucleic acid molecules (e.g., DNA or RNA) to cells in a biologically active form. Pharmaceutical Formulations

[0142] The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.

[0143] Although the description of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to subjects of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various subjects is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to,humans and other primates, mammals including commercially relevant mammals such as non-human primates, cattle, pigs, horses, sheep, cats, and dogs.

[0144] Pharmaceutical compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for ophthalmic, oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, intravenous, intracerebroventricular, intradermal, intramuscular, or another route of administration. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunogenic-based formulations.

[0145] A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient, which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

[0146] The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w / w) active ingredient.

[0147] In addition to the active ingredient, a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents.

[0148] Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.

[0149] As used herein, “parenteral administration” of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue- penetrating non-surgical wound, and the like. In particular, parenteral administration iscontemplated to include, but is not limited to, intraocular, intravitreal, subcutaneous, intraperitoneal, intramuscular, intradermal, intrasternal injection, intratumoral, intravenous, intracerebroventricular and kidney dialytic infusion techniques.

[0150] of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e. powder or granular) form for reconstitution with a suitable vehicle (e.g. sterile pyrogen free water) prior to parenteral administration of the reconstituted composition.

[0151] The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non toxic parenterally acceptable diluent or solvent, such as water or 1,3 butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer’s solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono or di- glycerides. Other parentally-administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer systems. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.

[0152] A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for pulmonary administration via the buccal cavity. Such a formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 0.5 to about 7 nanometers. In some embodiments, the formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 1 to about 6 nanometers. Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant may be directed to disperse the powder or using a self propelling solvent / powder dispensing container such as a device comprising the active ingredient dissolved or suspended in a low-boiling propellant in a sealed container. In some embodiments, such powders comprise particles wherein at least 98% of the particles by weight have a diameter greater than 0.5 nanometers and at least 95% of the particles by number have a diameter less than 7 nanometers. In some embodiments, at least 95% of the particles by weight have a diameter greater than 1 nanometer and at least 90% of the particles by number have a diameter less than 6 nanometers. In some embodiments, dry powder compositions include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.

[0153] Low boiling propellants generally include liquid propellants having a boiling point of below 65°F at atmospheric pressure. Generally the propellant may constitute 50 to 99.9% (w / w) of the composition, and the active ingredient may constitute 0.1 to 20% (w / w) of the composition. The propellant may further comprise additional ingredients such as a liquid non-ionic or solid anionic surfactant or a solid diluent (in some instances having a particle size of the same order as particles comprising the active ingredient).

[0154] Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradableformulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e., powder or granular) form for reconstitution with a suitable vehicle (e.g., sterile pyrogen free water) prior to parenteral administration of the reconstituted composition.

[0155] The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non toxic parenterally acceptable diluent or solvent, such as water or 1,3 butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer’s solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono or di- glycerides. Other parentally-administrable formulations that are useful include those that comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer system. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt. Methods

[0156] In some embodiments, the present invention relates to methods of cis- cleavage and trans-splicing of independent RNA molecules. In some embodiments, cis- cleavage and trans-splicing of independent RNA molecules results in a single RNA molecule encoding a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein, as described herein. In some embodiments, the method comprises administering ligase or a nucleic acid encoding a ligase, as described herein.

[0157] In one embodiment, the present invention relates to an inducible method for generating a single RNA encoding a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein, from two separate RNAmolecules encoding a first part and a second part of the SCN5A protein via cis-cleavage of ribozymes and trans-splicing of the two independent RNA molecules.

[0158] In one embodiment, the present invention relates to in vivo methods of generating an RNA molecule encoding a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein. In some embodiments, the method comprises administering at least two nucleic acid molecules to a cell or tissue. In one embodiment, the at least two nucleic acid molecules comprise a first RNA molecule and a second RNA molecule. In some embodiments, the at least two nucleic acid molecules encode a first portion of a SCN5A protein and a second portion of a SCN5A protein.

[0159] In one embodiment, the first RNA molecule comprises a coding region encoding a first portion of the protein of interest and a 3’ribozyme. In one embodiment, the 3’ribozyme catalyzes itself out of the first RNA molecule, thereby generating a 3’P or 2’3’ cP end. In one embodiment, the 3’ ribozyme is a member of the HDV family of ribozymes. In one embodiment, the second RNA molecule comprises a coding region encoding a second portion of the protein of interest. In one embodiment, the second RNA molecule comprises a 5’ribozyme. In one embodiment, the second RNA molecule comprises a coding region encoding a second portion of the protein of interest and a 5’ribozyme. In one embodiment, the 5’ribozyme catalyzes itself out of the second RNA molecule, thereby generating a 5’OH end. In one embodiment, the 5’ ribozyme is a member of the HH family of ribozymes.

[0160] In some embodiments, the 3’ ribozyme comprises SEQ ID NO:3 or SEQ ID NO:9-61.

[0161] In some embodiments, the 5’ ribozyme comprises SEQ ID NO:4 or SEQ ID NO:9-61.

[0162] In one embodiment, the 3’P or 2’3’ cP end is ligated to the 5’OH end to form an RNA molecule comprising the coding region of the first RNA molecule and the coding region of the second RNA molecule. In some embodiments, trans-ligation of the coding sequences for the first and second portion of the protein of interest occurs in a scarless manner, such that there is no intervening sequence between the first and second portion of the protein of interest after translation.

[0163] In one embodiment, the method comprises administering to the cell or tissue one or more additional nucleic acid molecules encoding one or more additional RNAmolecules, each additional RNA molecule comprising a coding region encoding a domain of a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein; a 5’ ribozyme; and a 3’ ribozyme.

[0164] In one embodiment, the method comprises administering to the cell or tissue two or more RNA molecules encoding two or more portions of a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein. An RNA molecule of the present disclosure may be transcribed in vitro from template DNA, referred to as an “in vitro transcription template.” The source of the DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequence or any other appropriate source of DNA. The RNA molecule can be administered as a linear or circular RNA molecule. In some embodiments, an in vitro transcription template encodes a 5′ untranslated (UTR) region, contains an open reading frame, and encodes a 3′ UTR and a polyA tail. In some embodiments, an in vitro transcription template lacks the polyA tail. The particular nucleic acid sequence composition and length of an in vitro transcription template will depend on the mRNA, or fragment thereof (e.g., N-terminal or C-terminal fragment) encoded by the template.

[0165] In one embodiment, the method comprises administering to the cell or tissue one or more selected from the group consisting of: a nucleic acid molecule encoding a ligase and a ligase. In one embodiment, the ligase induces the assembly of the RNA molecule from the coding region of a first RNA molecule and the coding region of one or more additional RNA molecule. In some embodiments, trans-ligation of the coding sequences for the first and second (or more) portion of a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein occurs in a scarless manner, such that there is no intervening sequence between the two or more portions of the full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein after translation. In one embodiment, the ligase is RNA 2',3'-Cyclic Phosphate and 5'- OH (RtcB) ligase.

[0166] Methods of introducing and expressing genes into a cell are known in the art. In the context of an expression vector, the vector can be readily introduced into a host cell, e.g., mammalian, bacterial, yeast, or insect cell by any method in the art. For example, theexpression vector can be transferred into a host cell by physical, chemical, or biological means.

[0167] Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and / or exogenous nucleic acids are well-known in the art. See, for example, Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). An exemplary method for the introduction of a polynucleotide into a host cell is calcium phosphate transfection.

[0168] Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.

[0169] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0170] In the case where a non-viral delivery system is utilized, an exemplary delivery vehicle is a liposome. The use of lipid formulations is contemplated for the introduction of the nucleic acids into a host cell (in vitro, ex vivo or in vivo). In another aspect, the nucleic acid may be associated with a lipid. The nucleic acid associated with a lipid may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the oligonucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid. Lipid, lipid / DNA or lipid / expression vector associated compositions are not limited to any particular structure in solution. For example, they may bepresent in a bilayer structure, as micelles, or with a “collapsed” structure. They may also simply be interspersed in a solution, possibly forming aggregates that are not uniform in size or shape. Lipids are fatty substances which may be naturally occurring or synthetic lipids. For example, lipids include the fatty droplets that naturally occur in the cytoplasm as well as the class of compounds which contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

[0171] Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) can be obtained from Sigma, St. Louis, MO; dicetyl phosphate (“DCP”) can be obtained from K & K Laboratories (Plainview, NY); cholesterol (“Choi”) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20°C. Chloroform is used as the only solvent since it is more readily evaporated than methanol. “Liposome” is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed. For example, the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine-nucleic acid complexes.

[0172] Regardless of the method used to introduce exogenous nucleic acids into a host cell, in order to confirm the presence of the recombinant DNA sequence in the host cell, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; “biochemical” assays, such as detecting the presence or absenceof a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention. Treatment and Use

[0173] The present invention provides methods of treating, reducing the symptoms of, and / or reducing the risk of developing a disease or disorder associated with reduced levels of SCN5A activity. In some embodiments, the disease or disorder is associated with loss of function of SCN5A. For example, in one embodiment, methods of the invention of treat, reduce the symptoms of, and / or reduce the risk of developing Brugada Syndrome, Long QT Syndrome, atrial fibrillation, sick sinus syndrome or cardiomyopathy.

[0174] In one embodiment, the subject is a mammal. For example, in one embodiment, the subject is a human, non-human primate, dog, cat, horse, cow, goat, sheep, rabbit, pig, rat, or mouse. In one embodiment, the subject is a non-mammalian subject. For example, in one embodiment, the subject is a zebrafish, fruit fly, or roundworm.

[0175] In one embodiment, the disease or disorder is caused by an absent or defective SCN5A. Thus, in one embodiment, the disease or disorder may treated, reduced, or the risk can be reduced using the compositions, systems and methods of the present invention. Thus, in one embodiment, the method comprises administering to the subject one or more composition of the present invention. Further, in one embodiment, the method comprises utilizing one or more system of the present invention to treat, reduce the symptoms of, and / or reduce the risk of developing a disease or disorder in a subject.

[0176] In one embodiment, the method of the present invention comprises administering to a subject having Brugada Syndrome, Long QT Syndrome, atrial fibrillation, sick sinus syndrome or cardiomyopathy due to an absent or defective SCN5A a composition comprising a first nucleic acid comprising a coding region encoding a first portion of SCN5A and a 3’ ribozyme, and a second nucleic acid comprising a coding region encoding a second portion of SCN5A and a 5’ ribozyme, wherein the first nucleic acid transcribes a first RNA molecule and the second nucleic acid transcribes a second RNA molecule, and wherein cis- cleavage of the 3’ and 5’ ribozymes and trans-splicing of the coding region encoding the first portion of SCN5A and the coding region encoding the second portion of SCN5A, generates asingle RNA molecule encoding a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein.

[0177] In one embodiment, the method of the present invention comprises administering to a subject having Brugada Syndrome, Long QT Syndrome, atrial fibrillation, sick sinus syndrome or cardiomyopathy due to an absent or defective SCN5A a composition comprising a first nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 1, or a fragment or variant thereof, and a second nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 2, or a fragment or variant thereof, wherein transcription of the first nucleic acid results in a first RNA molecule and transcription of the second nucleic acid results in a second RNA molecule, and wherein cis-cleavage of the 3’ and 5’ ribozymes and trans- splicing of the first RNA molecule and second RNA molecule, generates a single RNA molecule encoding a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein.

[0178] In one embodiment, the method of the present invention comprises administering to a subject having Brugada Syndrome, Long QT Syndrome, atrial fibrillation, sick sinus syndrome or cardiomyopathy due to an absent or defective SCN5A a composition comprising a first nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 6, or a fragment or variant thereof, and a second nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 7, or a fragment or variant thereof, wherein transcription of the first nucleic acid results in a first RNA molecule and transcription of the second nucleic acid results in a second RNA molecule, and wherein cis-cleavage of the 3’ and 5’ ribozymes and trans- splicing of the first RNA molecule and second RNA molecule, generates a single RNA molecule encoding a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein.

[0179] Administration of the compositions of the invention in a method of treatment can be achieved in a number of different ways, using methods known in the art. In one embodiment, the method of the invention comprises systemic administration of the subject, including for example enteral or parenteral administration. In some embodiments, the method comprises intradermal delivery of the composition. In another embodiment, the method comprises intravenous delivery of the composition. In some embodiments, the method comprises intramuscular delivery of the composition. In one embodiment, the methodcomprises subcutaneous delivery of the composition. In one embodiment, the method comprises inhalation of the composition. In one embodiment, the method comprises intranasal delivery of the composition.

[0180] It will be appreciated that the composition of the invention may be administered to a subject either alone, or in conjunction with another agent.

[0181] The therapeutic and prophylactic methods of the invention thus encompass the use of pharmaceutical compositions comprising one or more nucleic acid molecules for in vivo generation and expression of a full-length SCN5A protein, a functional SCN5A fragment, a functional SCN5A variant or a SCN5A fusion protein and an adjuvant, a delivery vehicle, a transfection reagent, or any combination thereof as described herein to practice the methods of the invention. The pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of from 1 ng / kg / day and 100 mg / kg / day. In one embodiment, the invention envisions administration of a dose, which results in a concentration of the compound of the present invention from 10 nM and 10 ^M in a mammal.

[0182] Typically, dosages which may be administered in a method of the invention to a mammal, such as a human, range in amount from 0.01 μg to about 50 mg per kilogram of body weight of the mammal, while the precise dosage administered will vary depending upon any number of factors, including but not limited to, the type of mammal and type of disease state being treated, the age of the mammal and the route of administration. In some embodiments, the dosage of the compound will vary from about 0.1 μg to about 10 mg per kilogram of body weight of the mammal. In some embodiments, the dosage will vary from about 1 μg to about 1 mg per kilogram of body weight of the mammal.

[0183] The composition may be administered to a mammal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months, several years, or even less frequently, such as every 10-20 years, 15-30 years, or even less frequently, such as every 50-100 years. The frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the mammal, etc.EXPERIMENTAL EXAMPLES

[0184] The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

[0185] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the present invention and practice the claimed methods. The following working examples therefore are not to be construed as limiting in any way the remainder of the disclosure. Example 1: Therapeutic Correction of Brugada Syndrome (BrS) using StitchR-mediated Full-length SCN5A Expression In Vivo

[0186] A StitchR-mediated dual AAV vector approach was developed to deliver and express full-length human codon optimized SCN5A in cardiomyocytes in vivo as a novel therapeutic approach to correct Brugada Syndrome (BrS). A StitchR vector pair was developed for the expression of full-length SCN5A. Preliminary in vitro data using patch clamp electrophysiology demonstrated that StitchR SCN5A functions indistinguishable from SCN5A expressed by a single vector. A research plan was developed to validate StitchR- mediated vectors for expressing full-length SCN5A in vivo for POC studies in mice in a mouse model of BrS.

[0187] Described herein is 1) the design, generation and validation of StitchR- mediated vectors for expressing full-length SCN5A in cells and 2) the generation of AAV virus and determination of the efficacy of this approach for expression of full-length SCN5A in a mouse model of BrS in vivo. Design, construction and in vitro validation of StitchR-activated Dual AAV SCN5A Vectors.

[0188] The full-length cardiac-expressed isoform of the human SCN5A gene encodes a single large protein composed of 4 domains, required for cardiac cell depolarization and normal heart rhythm. The approach and vectors express a full-length human codon optimized SCN5A protein, could be utilized to correct all human loss-of-function mutations which give rise to BrS. Vector design and construction.

[0189] Vectors have been designed, constructed and validated for stitchR-mediated expression of a split, codon-optimized SCN5A gene pair using transient transfection in cells. Vectors also encode regulatory sequences including promoter, high efficiency ribozymes allowing for scarless trans-ligation of the split SCN5A mRNAs, splice donor and acceptor sequences, bovine growth hormone polyadenylation sequence (bGH pA) and a WPRE transgene expression enhancing sequence. In vitro validation of StitchR mediated SCN5A expression.

[0190] The StitchR-mediated SCN5A gene vectors were compared to a single vector encoding full-length SCN5A in cell-based assays for protein function – notably patch clamp electrophysiology of SCN5A channel kinetics. The vector encoding full-length SCN5A could never be packaged into an AAV particle, but serves here in plasmid transfection-based assays as a positive control. All SCN5A ORFs were fully sequenced using Sanger sequencing and full plasmid sequence using Oxford Nanopore sequencing. The human EF1a promoter (strong ubiquitous expression) was utilized for testing in vitro to validate vector constructs in vitro, but can be replaced with the cardiac-specific cardiac Troponin-T (cTnT) promoter for in vivo studies.

[0191] A major benefit of StitchR-mediated trans-ligation, vs other dual expression approaches, such as INTEINS - whereby two protein halves are spliced together, is that StitchR allows for protein expression from a single reconstituted full-length mRNA. Therefore, StitchR-mediated SCN5A expressed protein behaves identically to SCN5A expressed from a single plasmid. To validate and demonstrate StitchR SCN5A function, patch clamp electrophysiology is used to measure and compare channel kinetics of SCN5A in transiently transfected HEK293T cells (Figure 5).AAV virus generation.

[0192] High titer AAV virus is generated to generate myoAAV-4A serotyped virus, an AAV9 evolved variant, which shows the greatest tropism for both human and mouse cardiac tissues. High titer (~5e13gc / ml to ~2e14 gc / ml) AAV viral preps are received for large gene inserts.

[0193] At postnatal day 8 (P8), 1E+12 vg of both AAVs (2E+12 total) is injected intraperitoneally into 6 male and 6 female Scn5a+ / - heterozygous mice, with comparable number of male and female wild type and Scn5a+ / - heterozygous mice injected with saline as control. Measurements are made at 10 weeks of age. RNA isolation and SCN5A trans-ligation validation.

[0194] Heart tissues snap frozen in liquid nitrogen are pulverized using a Bessman tissue pulverizer to obtain whole tissue homogenates. For RNA isolation, pulverized heart tissue homogenates are added to 1 ml of ice-cold TRIzol and homogenized in a VWR Beadmill using 2.8mm ceramic beads. Total RNA is extracted by isopropanol precipitation and cDNA are generated using SuperScript III (Invitrogen) for qRTPCR sequence analyses using primers specific to the SCN5A trans-ligation junction. Cardiac function assessment using non-invasive cardiac monitoring.

[0195] Heart function is measured and compared in all AAV treated mice (12 male and 12 females for each AAV vector pair) at 8 weeks of age by two-dimensional echocardiography using the SIG Visual Sonics Vevo 2100. Measurements of heart rate (HR), fractional shortening (FS) and ejection fraction (EF), and left ventricular dimensions are recorded and compared. Additionally, non-invasive ECG measurements are recorded on anesthetized mice using an AdInstruments BioAmp ECG apparatus. ECG recordings are captured for 10 minutes for each animal and analyzed using AdInstruments LabChart7 software. Tissue harvest and histological analyses.

[0196] At 10 weeks of age, total body weight is recorded, and liver and heart are harvested, weighed, and normalized to tibia length from 3 mice of each sex and AAV vector type. Heart tissues are bisected, and the bottom half is snap frozen in liquid nitrogen for further RNA and protein analyses. The bottom half is fixed in 4% formaldehyde in PBS and processed using routine methods for paraffin histology and histological staining (H&E). In vivo analysis of AAV-expressed Full-length SCN5A.

[0197] Histological sections generated above are processed for IHC to determine the percentage of cardiomyocytes with human SCN5A expression and sarcolemma membrane localization. Protein lysates generated above are compared by western blot for SCN5A expression in wild type mice. Successful in vivo demonstration of full-length SCN5A protein expression at levels comparable to endogenous levels, and phenotypic rescue lead to experiments assessing the therapeutic efficacy of this approach in large animal models (ex. Pig) of BrS. Sequences SCN5A Nt (SEQ ID NO:1) ATGGCCAACTTCCTGCTGCCGAGAGGCACCTCCTCCTTCAGACGGTTCACCCGGGAGTCCCTGGCGGCCATTGA GAAGCGCATGGCCGAGAAGCAGGCAAGAGGCAGCACCACATTGCAGGAGAGCAGAGAGGGCTTGCCTGAGGAGG AGGCCCCTAGGCCCCAGCTGGACCTGCAGGCCTCTAAGAAGCTACCCGATCTGTATGGCAACCCACCTCAGGAG CTGATCGGAGAACCCCTGGAGGACCTGGACCCATTCTACAGCACACAGAAGACCTTTATTGTGCTAAACAAGGG CAAGACAATCTTCCGCTTTAGCGCCACAAACGCTCTGTACGTGCTGAGCCCTTTCCACCCCATCAGAAGAGCCG CCGTGAAGATCCTGGTCCATAGCCTGTTCAACATGCTCATCATGTGCACCATCCTGACAAACTGCGTGTTCATG GCCCAGCACGACCCTCCCCCCTGGACAAAGTACGTCGAGTACACGTTCACCGCAATCTATACCTTCGAATCTCT GGTGAAGATTCTGGCCCGCGGCTTCTGCCTGCACGCCTTTACTTTTCTGAGAGACCCATGGAACTGGCTGGACT TCAGCGTGATCATCATGGCCTACACAACCGAGTTCGTGGATCTGGGCAATGTATCTGCCCTGAGGACATTTAGA GTGCTGCGGGCCCTGAAGACCATCTCCGTCATCAGCGGCCTGAAGACGATCGTGGGCGCCCTGATCCAGAGCGT GAAAAAGCTGGCCGACGTGATGGTGCTGACCGTATTCTGTCTGAGCGTCTTCGCACTGATTGGACTGCAACTGT TCATGGGCAACCTGAGACATAAGTGCGTGAGAAACTTCACAGCTCTGAATGGCACAAACGGATCCGTGGAAGCG GACGGCCTGGTGTGGGAGAGCCTGGACCTGTACCTGTCCGATCCTGAGAATTACCTGCTCAAGAACGGCACCAG CGATGTCTTACTCTGTGGCAACAGCAGCGACGCCGGCACCTGTCCTGAGGGGTACAGATGCCTGAAAGCCGGCG AGAATCCTGACCACGGCTACACGTCTTTCGACAGCTTCGCCTGGGCCTTCCTGGCACTGTTTCGCCTCATGACC CAGGACTGCTGGGAAAGACTGTACCAGCAGACGCTGCGTAGCGCTGGCAAGATCTACATGATCTTCTTCATGCT GGTGATTTTTCTGGGCAGCTTCTACCTGGTGAATCTGATCCTGGCAGTGGTTGCCATGGCCTACGAGGAGCAGAACCAGGCAACTATTGCCGAGACCGAAGAGAAGGAAAAGCGGTTCCAAGAGGCCATGGAAATGTTAAAAAAAGAA CACGAGGCTCTGACCATTAGAGGCGTGGACACGGTGAGCCGGTCGAGCCTGGAAATGTCCCCTCTGGCCCCTGT GAACAGCCACGAGAGAAGAAGCAAGAGAAGAAAGCGGATGTCAAGCGGCACGGAAGAGTGCGGCGAGGACCGAT TACCCAAGAGCGACAGCGAGGACGGCCCCCGGGCCATGAACCACCTGTCACTGACCAGAGGGCTGTCTCGCACC AGCATGAAGCCCAGATCTTCTCGGGGGTCTATATTCACCTTTAGAAGAAGAGACCTGGGAAGCGAGGCCGACTT CGCCGACGACGAGAACAGCACCGCCGGAGAGAGCGAGTCCCACCACACCAGCCTGCTGGTGCCTTGGCCCCTGA GAAGAACCTCCGCCCAGGGCCAGCCTAGCCCTGGCACATCTGCCCCTGGCCACGCCCTGCACGGCAAGAAAAAC AGCACCGTGGATTGCAACGGCGTCGTGAGCCTTCTGGGCGCCGGGGATCCAGAAGCCACCTCCCCGGGCAGCCA CCTGCTCCGACCTGTGATGCTGGAGCACCCCCCCGATACCACAACACCATCCGAGGAACCCGGCGGACCTCAAA TGCTGACCAGCCAGGCGCCATGCGTGGACGGCTTCGAGGAGCCCGGCGCCAGACAGCGGGCTTTAAGCGCCGTG AGCGTGCTGACAAGCGCGTTGGAGGAGCTGGAAGAGAGCAGACACAAGTGCCCTCCATGTTGGAACAGACTCGC CCAACGGTACTTAATCTGGGAATGCTGCCCCCTGTGGATGTCTATCAAGCAGGGCGTCAAGCTCGTAGTGATGG ACCCTTTTACAGACCTGACCATCACAATGTGCATCGTGCTGAACACCCTTTTCATGGCCCTTGAGCACTATAAC ATGACATCCGAGTTCGAGGAAATGCTGCAGGTGGGCAACCTGGTGTTTACCGGAATCTTCACCGCCGAGATGAC CTTCAAGATCATAGCTCTGGACCCCTACTACTACTTCCAGCAGGGTTGGAATATCTTCGATAGCATCATTGTTA TCCTGTCCCTGATGGAACTGGGCCTGTCCCGGATGAGCAACCTGAGCGTGCTGCGGTCTTTTAGACTGCTGCGG GTGTTCAAGCTGGCCAAAAGCTGGCCTACCCTGAACACACTGATCAAGATCATCGGCAACAGCGTGGGAGCATT AGGCAACCTGACCCTGGTGCTCGCTATCATCGTGTTCATTTTCGCCGTGGTGGGCATGCAACTGTTCGGCAAAA ACTACAGCGAGTTGCGGGATAGCGACAGCGGACTGTTACCTCGGTGGCACATGATGGACTTCTTCCACGCCTTC CTGATCATCTTCCGGATCCTGTGTGGAGAATGGATCGAGACAATGTGGGACTGCATGGAAGTATCCGGACAGTC TCTGTGTCTGCTGGTGTTCCTGCTGGTGATGGTGATCGGCAACCTGGTGGTGCTGAACTTGTTTCTGGCCCTGT TGCTGAGTTCCTTCAGCGCTGACAACCTGACCGCCCCTGACGAGGACAGAGAGATGAACAACCTGCAGCTGGCA CTGGCACGTATCCAGAGAGGCCTGCGGTTCGTGAAAAGAACTACATGGGATTTCTGTTGTGGCCTCCTGCGGCA GCGGCCACAGAAACCTGCCGCTCTAGCCGCTCAGGGACAGCTGCCTTCTTGCATCGCCACACCATACAGCCCTC CTCCTCCCGAGACAGAAAAGGTGCCTCCGACAAGAAAGGAAACTCGGTTCGAGGAAGGCGAACAGCCTGGCCAG GGAACACCTGGAGACCCTGAGCCTGTTTGTGTGCCCATCGCCGTGGCCGAGTCGGACACAGATGACCAGGAGGA AGACGAGGAAAACAGCCTTGGCACCGAAGAGGAGAGCAGCAAACAGCAGGAATCTCAACCGGTAAGCGGAG SCN5A Ct (SEQ ID NO:2) GTCCTGAGGCTCCACCCGACAGCAGAACATGGAGCCAGGTGTCCGCCACCGCCAGCTCAGAGGCAGAAGCTTCT GCCAGCCAGGCCGATTGGCGGCAGCAATGGAAGGCCGAACCTCAGGCTCCTGGATGCGGCGAGACCCCTGAGGA CAGCTGCAGCGAAGGCTCCACAGCGGATATGACCAACACCGCTGAGCTGCTGGAACAGATACCTGACCTGGGCC AAGATGTGAAAGATCCCGAGGATTGTTTCACCGAGGGCTGTGTGCGGCGGTGCCCTTGCTGTGCCGTGGACACC ACCCAAGCCCCAGGCAAGGTGTGGTGGAGACTGCGGAAAACATGCTACCACATCGTGGAACACAGCTGGTTCGA GACATTTATCATCTTTATGATCCTGCTGAGCAGCGGCGCCCTTGCCTTTGAAGATATCTACCTGGAAGAACGGA AGACCATCAAGGTCCTGCTGGAGTACGCCGATAAGATGTTTACATACGTGTTTGTGCTGGAAATGCTGCTGAAA TGGGTGGCTTACGGCTTCAAGAAATATTTTACCAACGCCTGGTGCTGGCTGGACTTTCTAATCGTGGACGTGTC ACTGGTGTCTCTGGTGGCCAATACCCTGGGCTTCGCTGAGATGGGACCAATCAAGTCCCTGCGCACCCTGAGAGCCCTGCGACCTCTGAGAGCCCTGAGCCGATTTGAGGGCATGAGAGTGGTGGTGAACGCTCTGGTGGGCGCCATC CCCAGCATCATGAACGTGCTTCTGGTGTGCCTGATTTTTTGGCTGATCTTCAGCATCATGGGCGTGAACCTGTT TGCCGGCAAATTCGGCCGGTGCATCAACCAGACAGAGGGCGACCTGCCACTGAACTACACCATCGTGAACAACA AGAGCCAATGTGAATCACTGAACCTGACCGGCGAACTGTATTGGACCAAGGTCAAGGTGAACTTCGACAACGTG GGCGCTGGTTATCTCGCCCTGCTGCAAGTGGCCACCTTCAAGGGCTGGATGGACATAATGTATGCCGCCGTGGA CTCCAGAGGATATGAGGAACAGCCTCAGTGGGAATACAACCTGTACATGTACATCTACTTTGTCATCTTCATCA TCTTCGGTAGTTTCTTCACCCTCAACCTGTTCATAGGGGTGATTATAGACAATTTTAATCAACAGAAAAAGAAG CTGGGGGGACAGGACATTTTCATGACAGAAGAGCAGAAGAAGTACTACAACGCCATGAAAAAGCTGGGCTCTAA GAAGCCTCAGAAGCCTATACCTAGACCTCTGAACAAGTACCAGGGATTTATCTTCGACATCGTGACCAAGCAGG CCTTCGACGTGACAATCATGTTCCTGATCTGCCTAAATATGGTGACCATGATGGTCGAAACAGATGATCAGAGC CCTGAAAAGATCAATATTCTCGCTAAGATCAATCTGTTATTTGTGGCCATCTTCACAGGCGAATGCATCGTGAA GCTGGCTGCACTGAGACATTACTACTTCACCAATTCTTGGAACATCTTCGACTTCGTGGTGGTGATCCTGTCTA TTGTGGGAACCGTCCTGAGCGACATCATTCAAAAGTACTTCTTCAGCCCTACACTGTTCCGGGTGATCCGGCTG GCCAGAATCGGCAGAATCCTCAGATTGATCCGGGGAGCCAAGGGCATCAGAACGCTGCTGTTCGCCCTGATGAT GTCTCTTCCCGCCCTCTTCAACATCGGCCTTCTGCTGTTCCTCGTGATGTTCATCTACAGCATCTTTGGCATGG CCAACTTCGCATACGTTAAGTGGGAAGCCGGAATCGACGACATGTTCAACTTCCAAACCTTCGCTAACAGCATG CTGTGCCTGTTCCAGATCACCACCAGCGCTGGCTGGGATGGTCTGCTGTCTCCCATCCTGAATACTGGACCACC TTACTGCGATCCTACCCTGCCCAACAGTAACGGCTCTCGGGGAGACTGCGGCAGCCCTGCCGTAGGCATCCTCT TCTTCACCACCTACATCATCATTAGCTTTCTGATCGTGGTCAACATGTACATCGCCATCATCCTGGAAAACTTC AGCGTCGCAACCGAGGAGTCGACCGAACCTCTGAGCGAGGATGATTTCGACATGTTCTACGAGATCTGGGAGAA GTTTGATCCTGAGGCCACCCAGTTCATAGAGTACAGCGTCCTGAGCGATTTCGCCGATGCCCTGTCTGAACCTC TGAGAATCGCTAAGCCTAACCAGATCTCTCTGATCAACATGGATCTGCCTATGGTCTCGGGCGACAGAATCCAC TGCATGGATATCCTGTTCGCCTTTACCAAGCGGGTGCTGGGCGAGAGCGGAGAGATGGACGCTCTGAAGATCCA GATGGAAGAGAAGTTCATGGCCGCCAATCCTTCCAAAATCAGCTACGAACCGATCACCACCACCCTGAGAAGAA AGCACGAGGAGGTGAGCGCTATGGTTATCCAGAGAGCCTTCAGAAGACACCTGTTGCAGAGAAGCCTGAAGCAC GCCAGCTTCCTCTTCCGGCAGCAGGCCGGGTCTGGACTGAGTGAGGAAGACGCCCCCGAGAGAGAGGGCTTAAT CGCCTACGTGATGAGCGAGAATTTCAGCCGTCCCCTGGGTCCACCCAGTTCCAGCAGTATCAGCTCCACCAGCT TCCCCCCCAGCTACGACAGCGTGACTAGAGCCACCAGCGACAACCTGCAGGTCAGGGGATCCGATTACTCCCAT AGCGAGGACCTGGCCGACTTCCCTCCATCTCCTGATCGAGACCGGGAGTCAATTGTGTAATAG 3’ribozyme (SEQ ID NO:3) TAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGGCCCA 5’ribozyme (SEQ ID NO:4) AGCCTTAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGAGGCTcTnT promoter (SEQ ID NO:5) GGGATAAAAGCAGTCTGGGCTTTCACATGACAGCATCTGGGGCTGCGGCAGAGG GTCGGGTCCGAAGCGCTGCCTTATCAGCGTCCCCAGCCCTGGGAGGTGACAGCT GGCTGGCTTGTGTCAGCCCCTCGGGCACTCACGTATCTCCGTCCGACGGGTTTAA AATAGCAAAACTCTGAGGCCACACAATAGCTTGGGCTTATATGGGCTCCTGTGG GGGAAGGGGGAGCACGGAGGGGGCCGGGGCCGCTGCTGCCAAAATAGCAGCTC ACAAGTGTTGCATTCCTCTCTGGGCGCCGGGCACATTCCTGCTGGCTCTGCCCGC CCCGGGGTGGGCGCCGGGGGGACCTTAAAGCCTCTGCCCCCCAAGGAGCCCTTC CCAGACAGCCGCCGGCACCCACCGCTCCGTGGGAC Nt -SCN5A (SEQ ID NO:6) ITR-EF1a-Kozak-SCN5A Nt-SD-Rz-Degron-bGHpA-ITR 5’- CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGT CGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCG CGGTACCaaGAATTCTAGGTCTTGAAAGGAGTGGGAATTGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATC GCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAA ACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTA GTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTCGAGCGCCACCATGGCCAACTTC CTGCTGCCGAGAGGCACCTCCTCCTTCAGACGGTTCACCCGGGAGTCCCTGGCGGCCATTGAGAAGCGCATGGC CGAGAAGCAGGCAAGAGGCAGCACCACATTGCAGGAGAGCAGAGAGGGCTTGCCTGAGGAGGAGGCCCCTAGGC CCCAGCTGGACCTGCAGGCCTCTAAGAAGCTACCCGATCTGTATGGCAACCCACCTCAGGAGCTGATCGGAGAA CCCCTGGAGGACCTGGACCCATTCTACAGCACACAGAAGACCTTTATTGTGCTAAACAAGGGCAAGACAATCTT CCGCTTTAGCGCCACAAACGCTCTGTACGTGCTGAGCCCTTTCCACCCCATCAGAAGAGCCGCCGTGAAGATCC TGGTCCATAGCCTGTTCAACATGCTCATCATGTGCACCATCCTGACAAACTGCGTGTTCATGGCCCAGCACGAC CCTCCCCCCTGGACAAAGTACGTCGAGTACACGTTCACCGCAATCTATACCTTCGAATCTCTGGTGAAGATTCT GGCCCGCGGCTTCTGCCTGCACGCCTTTACTTTTCTGAGAGACCCATGGAACTGGCTGGACTTCAGCGTGATCA TCATGGCCTACACAACCGAGTTCGTGGATCTGGGCAATGTATCTGCCCTGAGGACATTTAGAGTGCTGCGGGCC CTGAAGACCATCTCCGTCATCAGCGGCCTGAAGACGATCGTGGGCGCCCTGATCCAGAGCGTGAAAAAGCTGGC CGACGTGATGGTGCTGACCGTATTCTGTCTGAGCGTCTTCGCACTGATTGGACTGCAACTGTTCATGGGCAACC TGAGACATAAGTGCGTGAGAAACTTCACAGCTCTGAATGGCACAAACGGATCCGTGGAAGCGGACGGCCTGGTG TGGGAGAGCCTGGACCTGTACCTGTCCGATCCTGAGAATTACCTGCTCAAGAACGGCACCAGCGATGTCTTACT CTGTGGCAACAGCAGCGACGCCGGCACCTGTCCTGAGGGGTACAGATGCCTGAAAGCCGGCGAGAATCCTGACC ACGGCTACACGTCTTTCGACAGCTTCGCCTGGGCCTTCCTGGCACTGTTTCGCCTCATGACCCAGGACTGCTGG GAAAGACTGTACCAGCAGACGCTGCGTAGCGCTGGCAAGATCTACATGATCTTCTTCATGCTGGTGATTTTTCT GGGCAGCTTCTACCTGGTGAATCTGATCCTGGCAGTGGTTGCCATGGCCTACGAGGAGCAGAACCAGGCAACTA TTGCCGAGACCGAAGAGAAGGAAAAGCGGTTCCAAGAGGCCATGGAAATGTTAAAAAAAGAACACGAGGCTCTG ACCATTAGAGGCGTGGACACGGTGAGCCGGTCGAGCCTGGAAATGTCCCCTCTGGCCCCTGTGAACAGCCACGA GAGAAGAAGCAAGAGAAGAAAGCGGATGTCAAGCGGCACGGAAGAGTGCGGCGAGGACCGATTACCCAAGAGCG ACAGCGAGGACGGCCCCCGGGCCATGAACCACCTGTCACTGACCAGAGGGCTGTCTCGCACCAGCATGAAGCCC AGATCTTCTCGGGGGTCTATATTCACCTTTAGAAGAAGAGACCTGGGAAGCGAGGCCGACTTCGCCGACGACGA GAACAGCACCGCCGGAGAGAGCGAGTCCCACCACACCAGCCTGCTGGTGCCTTGGCCCCTGAGAAGAACCTCCG CCCAGGGCCAGCCTAGCCCTGGCACATCTGCCCCTGGCCACGCCCTGCACGGCAAGAAAAACAGCACCGTGGAT TGCAACGGCGTCGTGAGCCTTCTGGGCGCCGGGGATCCAGAAGCCACCTCCCCGGGCAGCCACCTGCTCCGACC TGTGATGCTGGAGCACCCCCCCGATACCACAACACCATCCGAGGAACCCGGCGGACCTCAAATGCTGACCAGCC AGGCGCCATGCGTGGACGGCTTCGAGGAGCCCGGCGCCAGACAGCGGGCTTTAAGCGCCGTGAGCGTGCTGACA AGCGCGTTGGAGGAGCTGGAAGAGAGCAGACACAAGTGCCCTCCATGTTGGAACAGACTCGCCCAACGGTACTT AATCTGGGAATGCTGCCCCCTGTGGATGTCTATCAAGCAGGGCGTCAAGCTCGTAGTGATGGACCCTTTTACAGACCTGACCATCACAATGTGCATCGTGCTGAACACCCTTTTCATGGCCCTTGAGCACTATAACATGACATCCGAG TTCGAGGAAATGCTGCAGGTGGGCAACCTGGTGTTTACCGGAATCTTCACCGCCGAGATGACCTTCAAGATCAT AGCTCTGGACCCCTACTACTACTTCCAGCAGGGTTGGAATATCTTCGATAGCATCATTGTTATCCTGTCCCTGA TGGAACTGGGCCTGTCCCGGATGAGCAACCTGAGCGTGCTGCGGTCTTTTAGACTGCTGCGGGTGTTCAAGCTG GCCAAAAGCTGGCCTACCCTGAACACACTGATCAAGATCATCGGCAACAGCGTGGGAGCATTAGGCAACCTGAC CCTGGTGCTCGCTATCATCGTGTTCATTTTCGCCGTGGTGGGCATGCAACTGTTCGGCAAAAACTACAGCGAGT TGCGGGATAGCGACAGCGGACTGTTACCTCGGTGGCACATGATGGACTTCTTCCACGCCTTCCTGATCATCTTC CGGATCCTGTGTGGAGAATGGATCGAGACAATGTGGGACTGCATGGAAGTATCCGGACAGTCTCTGTGTCTGCT GGTGTTCCTGCTGGTGATGGTGATCGGCAACCTGGTGGTGCTGAACTTGTTTCTGGCCCTGTTGCTGAGTTCCT TCAGCGCTGACAACCTGACCGCCCCTGACGAGGACAGAGAGATGAACAACCTGCAGCTGGCACTGGCACGTATC CAGAGAGGCCTGCGGTTCGTGAAAAGAACTACATGGGATTTCTGTTGTGGCCTCCTGCGGCAGCGGCCACAGAA ACCTGCCGCTCTAGCCGCTCAGGGACAGCTGCCTTCTTGCATCGCCACACCATACAGCCCTCCTCCTCCCGAGA CAGAAAAGGTGCCTCCGACAAGAAAGGAAACTCGGTTCGAGGAAGGCGAACAGCCTGGCCAGGGAACACCTGGA GACCCTGAGCCTGTTTGTGTGCCCATCGCCGTGGCCGAGTCGGACACAGATGACCAGGAGGAAGACGAGGAAAA CAGCCTTGGCACCGAAGAGGAGAGCAGCAAACAGCAGGAATCTCAACCGGTAAGCGGAGGTAAGTATCAAGGTT ACAAGACAGGTGGGCTAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGGCCCAtgcttgcaag aactggttcagtagcttaagccactttgtgatccaccttaacagccacggattccctcctgaggtggaggagca ggctgccggaaccctgcccatgagctgcgcccaggagagcggcatggatagacaccctgctgcttgcgctagcg ctaggatcaacgtctaaTCTAGAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTG TTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAA ATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGA TTGGGAAGAGAATAGCAGGCATGCTGGGGAGCTAGAGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCC TCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTCAGTGAGCG AGCGAGCGCGCAGCTGCCTGCAGG Ct-SCN5A (SEQ ID NO:7) ITR-EF1a-Rz-SA-SCN5A Ct-WPRE-bGHpA-ITR 5’- CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGT CGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCG CGGTACCAAGAATTCTAGGTCTTGAAAGGAGTGGGAATTGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATC GCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAA ACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTA GTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTCGAGAGCCTTAACACTGCCAATG CCGGTCCCAAGCCCGGATAAAAGTGGAGGGAGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCAC CTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGTCCTGAGGCTCCACCCGACAGCAGAACATGG AGCCAGGTGTCCGCCACCGCCAGCTCAGAGGCAGAAGCTTCTGCCAGCCAGGCCGATTGGCGGCAGCAATGGAA GGCCGAACCTCAGGCTCCTGGATGCGGCGAGACCCCTGAGGACAGCTGCAGCGAAGGCTCCACAGCGGATATGA CCAACACCGCTGAGCTGCTGGAACAGATACCTGACCTGGGCCAAGATGTGAAAGATCCCGAGGATTGTTTCACC GAGGGCTGTGTGCGGCGGTGCCCTTGCTGTGCCGTGGACACCACCCAAGCCCCAGGCAAGGTGTGGTGGAGACT GCGGAAAACATGCTACCACATCGTGGAACACAGCTGGTTCGAGACATTTATCATCTTTATGATCCTGCTGAGCA GCGGCGCCCTTGCCTTTGAAGATATCTACCTGGAAGAACGGAAGACCATCAAGGTCCTGCTGGAGTACGCCGAT AAGATGTTTACATACGTGTTTGTGCTGGAAATGCTGCTGAAATGGGTGGCTTACGGCTTCAAGAAATATTTTAC CAACGCCTGGTGCTGGCTGGACTTTCTAATCGTGGACGTGTCACTGGTGTCTCTGGTGGCCAATACCCTGGGCT TCGCTGAGATGGGACCAATCAAGTCCCTGCGCACCCTGAGAGCCCTGCGACCTCTGAGAGCCCTGAGCCGATTT GAGGGCATGAGAGTGGTGGTGAACGCTCTGGTGGGCGCCATCCCCAGCATCATGAACGTGCTTCTGGTGTGCCT GATTTTTTGGCTGATCTTCAGCATCATGGGCGTGAACCTGTTTGCCGGCAAATTCGGCCGGTGCATCAACCAGA CAGAGGGCGACCTGCCACTGAACTACACCATCGTGAACAACAAGAGCCAATGTGAATCACTGAACCTGACCGGC GAACTGTATTGGACCAAGGTCAAGGTGAACTTCGACAACGTGGGCGCTGGTTATCTCGCCCTGCTGCAAGTGGC CACCTTCAAGGGCTGGATGGACATAATGTATGCCGCCGTGGACTCCAGAGGATATGAGGAACAGCCTCAGTGGG AATACAACCTGTACATGTACATCTACTTTGTCATCTTCATCATCTTCGGTAGTTTCTTCACCCTCAACCTGTTC ATAGGGGTGATTATAGACAATTTTAATCAACAGAAAAAGAAGCTGGGGGGACAGGACATTTTCATGACAGAAGA GCAGAAGAAGTACTACAACGCCATGAAAAAGCTGGGCTCTAAGAAGCCTCAGAAGCCTATACCTAGACCTCTGA ACAAGTACCAGGGATTTATCTTCGACATCGTGACCAAGCAGGCCTTCGACGTGACAATCATGTTCCTGATCTGC CTAAATATGGTGACCATGATGGTCGAAACAGATGATCAGAGCCCTGAAAAGATCAATATTCTCGCTAAGATCAA TCTGTTATTTGTGGCCATCTTCACAGGCGAATGCATCGTGAAGCTGGCTGCACTGAGACATTACTACTTCACCAATTCTTGGAACATCTTCGACTTCGTGGTGGTGATCCTGTCTATTGTGGGAACCGTCCTGAGCGACATCATTCAA AAGTACTTCTTCAGCCCTACACTGTTCCGGGTGATCCGGCTGGCCAGAATCGGCAGAATCCTCAGATTGATCCG GGGAGCCAAGGGCATCAGAACGCTGCTGTTCGCCCTGATGATGTCTCTTCCCGCCCTCTTCAACATCGGCCTTC TGCTGTTCCTCGTGATGTTCATCTACAGCATCTTTGGCATGGCCAACTTCGCATACGTTAAGTGGGAAGCCGGA ATCGACGACATGTTCAACTTCCAAACCTTCGCTAACAGCATGCTGTGCCTGTTCCAGATCACCACCAGCGCTGG CTGGGATGGTCTGCTGTCTCCCATCCTGAATACTGGACCACCTTACTGCGATCCTACCCTGCCCAACAGTAACG GCTCTCGGGGAGACTGCGGCAGCCCTGCCGTAGGCATCCTCTTCTTCACCACCTACATCATCATTAGCTTTCTG ATCGTGGTCAACATGTACATCGCCATCATCCTGGAAAACTTCAGCGTCGCAACCGAGGAGTCGACCGAACCTCT GAGCGAGGATGATTTCGACATGTTCTACGAGATCTGGGAGAAGTTTGATCCTGAGGCCACCCAGTTCATAGAGT ACAGCGTCCTGAGCGATTTCGCCGATGCCCTGTCTGAACCTCTGAGAATCGCTAAGCCTAACCAGATCTCTCTG ATCAACATGGATCTGCCTATGGTCTCGGGCGACAGAATCCACTGCATGGATATCCTGTTCGCCTTTACCAAGCG GGTGCTGGGCGAGAGCGGAGAGATGGACGCTCTGAAGATCCAGATGGAAGAGAAGTTCATGGCCGCCAATCCTT CCAAAATCAGCTACGAACCGATCACCACCACCCTGAGAAGAAAGCACGAGGAGGTGAGCGCTATGGTTATCCAG AGAGCCTTCAGAAGACACCTGTTGCAGAGAAGCCTGAAGCACGCCAGCTTCCTCTTCCGGCAGCAGGCCGGGTC TGGACTGAGTGAGGAAGACGCCCCCGAGAGAGAGGGCTTAATCGCCTACGTGATGAGCGAGAATTTCAGCCGTC CCCTGGGTCCACCCAGTTCCAGCAGTATCAGCTCCACCAGCTTCCCCCCCAGCTACGACAGCGTGACTAGAGCC ACCAGCGACAACCTGCAGGTCAGGGGATCCGATTACTCCCATAGCGAGGACCTGGCCGACTTCCCTCCATCTCC TGATCGAGACCGGGAGTCAATTGTGTAATAGACGCGTTAAGTGACAATCAACCTCTGGATTACAAAATTTGTGA AAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATC ATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAG TTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCAT TGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCG CCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCA TCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTC GGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTC GCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCTCTAGAGAGCTCGCTGATCAGCCTCGACTGTG CCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCAC TGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGG TGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAGAATAGCAGGCATGCTGGGGAGCTAGAGGCCGCAGGAACC CCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCC GACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG Chicken Cardiac Troonin-T promoter core promoter (cTnT) (SEQ ID NO:8) 5’- GGGATAAAAGCAGTCTGGGCTTTCACATGACAGCATCTGGGGCTGCGGCAGAGGGTCGGGTCCGAAGCGCTGCC TTATCAGCGTCCCCAGCCCTGGGAGGTGACAGCTGGCTGGCTTGTGTCAGCCCCTCGGGCACTCACGTATCTCC GTCCGACGGGTTTAAAATAGCAAAACTCTGAGGCCACACAATAGCTTGGGCTTATATGGGCTCCTGTGGGGGAA GGGGGAGCACGGAGGGGGCCGGGGCCGCTGCTGCCAAAATAGCAGCTCACAAGTGTTGCATTCCTCTCTGGGCG CCGGGCACATTCCTGCTGGCTCTGCCCGCCCCGGGGTGGGCGCCGGGGGGACCTTAAAGCCTCTGCCCCCCAAG GAGCCCTTCCCAGACAGCCGCCGGCACCCACCGCTCCGTGGGAC-3’ Ribozyme nucleic acid sequences for scar-less 3’ RNA Cleavage HDV68 (SEQ ID NO: 9) GGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUGCUUCGG CAUGGCGAAUGGGAC HDV68 catalytic mutant (SEQ ID NO: 10) 5’ GGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUGCUUCGG CAUGGUGAAUGGGAC -3’HDV67 (SEQ ID NO: 11) GGGUCGGCAUGGCAUCUCCACCUCCUCGCGGUCCGACCUGGGCUACUUCGGUA GGCUAAGGGAGAAG HDV56 (SEQ ID NO: 12) GAGGGAUAGUACAGAGCCUCCCCGUGGCUCCCUUGGAUAACCAACUGAUACUG UAC Genomic HDV (genHDV) (SEQ ID NO: 13) GGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUUCCGAGG GGACCGUCCCCUCGGUAAUGGCGAAUGGGACCCA Antigenomic HDV (antiHDV) (SEQ ID NO: 14) GGGUCGGCAUGGCAUCUCCACCUCCUCGCGGUCCGACCUGGGCAUCCGAAGGA GGACGCACGUCCACUCGGAUGGCUAAGGGAGAGCCACU VS Ribozyme (SEQ ID NO: 15) GCGGUAGUAAGCAGGGAACUCACCUCCAAUUUCAGUACUGAAAUUGUCGUAG CAGUUGACUACUGUUAUGUGAUUGGUAGAGGCUAAGUGACGGUAUUGGCGUA AGUCAGUAUUGCAGCACAGCACAAGCCCGCUUGCGAGAAU VS-S (SEQ ID NO: 16) GAAGGGCGUCGUCGCCCCGAG VS-Rz (SEQ ID NO: 17) GCGGUAGUAAGCAGGGAACUCACCUCCAAUUUCAGUACUGAAAUUGUCGUAG CAGUUGACUACUGUUAUGUGAUUGGUAGAGGCUAAGUGACGGUAUUGGCGUA AGUCAGUAUUGCAGCACAGCACAAGCCCGCUUGCGAGAAU Hammerhead with stem 3 overhangs specific to Nt-Luc (SEQ ID NO: 18) 5’ GAGCCUUACCGGAUGUGUUUUCCGGUCUGAUGAGUCCGGUAGCGGACGAAAG GCUC 3’ Twister with 5 nt P1 stem for Ct-Luc (SEQ ID NO: 19) 5’ AGCCUUAACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGAGGC U 3’ Twister with 5 nt P1 stem for Ct-Luc and T6A mutation (SEQ ID NO: 20) 5’ AGCCUAAACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGAGGC U 3’ Twister mutant with 5 nt P1 stem for Ct-Luc (SEQ ID NO: 21)5’ AGCCUUAACUCUUCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGAGGC U 3’ Twister with 5 nt P1 stem for Ct-Luc (SEQ ID NO: 22) 5’ AGCCUUAACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGAGGC U 3’ Twister with 2 nt P1 stem for Ct-Luc (SEQ ID NO: 23) 5’ AGCCUUAACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGAG 3’ Twister with 1 nt P1 stem for Ct-Luc (SEQ ID NO: 24) 5’ AGCCUUAACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGG 3’ Twister with no P1 stem for Ct-Luc (SEQ ID NO: 25) 5’ AGCCUUAACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGG 3’ Hammerhead (HH) for 3’(SEQ ID NO: 26) 5’ NNNNDWHACCGGAUGUGUUUUCCGGUCUGAUGAGUCCGGUAGCGGACGAAWH NNNN 3’ Twister WT with 5 nt P1 stem (SEQ ID NO: 27) 5’ NNNNNUAACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGNNN NN 3’ Twister Mutant with 5 nt P1 stem (SEQ ID NO: 28) 5’ NNNNNUAACUCUUCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGNNN NN 3’ Twister with 5 nt P1 stem with U1A mutation (SEQ ID NO: 29) 5’ NNNNNAAACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGNNN NN 3’ Twister with 5 nt P1 stem with U1C mutation (SEQ ID NO: 30) 5’ NNNNNCAACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGNNN NN 3’ Twister with 5 nt P1 stem with U1G mutation (SEQ ID NO: 31)5’ NNNNNGAACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGNNN NN 3’ Hammerhead 4 nt overhang for 5’ (SEQ ID NO: 32) 5’ NNNNCUGAUGAGUCCGUGAGGACGAAACGAGUAAGCUCGUC 3’ Hammerhead 6 nt overhang for 5’(SEQ ID NO: 33) 5’ NNNNNNCUGAUGAGUCCGUGAGGACGAAACGAGUAAGCUCGUC 3’ Hammerhead 8 nt overhang for 5’ (SEQ ID NO: 34) 5’ NNNNNNNNCUGAUGAGUCCGUGAGGACGAAACGAGUAAGCUCGUC 3’ Hammerhead 10 nt overhang for 5’(SEQ ID NO: 35) 5’ NNNNNNNNNNCUGAUGAGUCCGUGAGGACGAAACGAGUAAGCUCGUC 3’ Hammerhead 12 nt overhang for 5’ (SEQ ID NO: 36) 5’ NNNNNNNNNNNNCUGAUGAGUCCGUGAGGACGAAACGAGUAAGCUCGUC 3’ Hammerhead 14 nt overhang for 5’ (SEQ ID NO: 37) 5’ NNNNNNNNNNNNNNCUGAUGAGUCCGUGAGGACGAAACGAGUAAGCUCGUC 3’ Hammerhead 16 nt overhang for 5’(SEQ ID NO: 38) 5’ NNNNNNNNNNNNNNNNCUGAUGAGUCCGUGAGGACGAAACGAGUAAGCUCGU C 3’ TX2 Hammerhead 4 nt overhang for 5’ (Huang et al.2019) (SEQ ID NO: 39) 5’ NNNNCUGAUGAGUCCGGUAGCGGACGAAACGCGCUUCGGUGCGUC 3’ TX2 Hammerhead 6 nt overhang for 5’ (Huang et al.2019) (SEQ ID NO: 40) 5’ NNNNNNCUGAUGAGUCCGGUAGCGGACGAAACGCGCUUCGGUGCGUC 3’ TX2 Hammerhead 8 nt overhang for 5’ (Huang et al.2019) (SEQ ID NO: 41) 5’ NNNNNNNNCUGAUGAGUCCGGUAGCGGACGAAACGCGCUUCGGUGCGUC 3’ TX2 Hammerhead 10 nt overhang for 5’ (Huang et al.2019) (SEQ ID NO: 42) 5’ NNNNNNNNNNCUGAUGAGUCCGGUAGCGGACGAAACGCGCUUCGGUGCGUC 3’ TX2 Hammerhead 12 nt overhang for 5’ (Huang et al.2019) (SEQ ID NO: 43) 5’ NNNNNNNNNNNNCUGAUGAGUCCGGUAGCGGACGAAACGCGCUUCGGUGCGU C 3’TX2 Hammerhead 14 nt overhang for 5’ (Huang et al.2019) (SEQ ID NO: 44) 5’ NNNNNNNNNNNNNNCUGAUGAGUCCGGUAGCGGACGAAACGCGCUUCGGUGC GUC 3’ TX2 Hammerhead 16 nt overhang for 5’ (Huang et al.2019) (SEQ ID NO: 45) 5’ NNNNNNNNNNNNNNNNCUGAUGAGUCCGGUAGCGGACGAAACGCGCUUCGGU GCGUC 3’ RzB Hammerhead for 5’ (Saksmerprome et al.2004) (SEQ ID NO: 46) 5’ NNNNNNUAANNNNNCUGAUGAGUCGCUGGGAUGCGACGAAACGCCUUCGGGC GUC 3’ RzB (Saksmerprome et al.2004), with stem1 overhang specific to Ct-Luc (SEQ ID NO: 47) 5’ UUGUAAUAAUCCUGCUGAUGAGUCGCUGGGAUGCGACGAAACGCCUUCGGGC GUC 3’ P1 Type Twister Ribozymes Twister (Osa)(SEQ ID NO:48) 5’- NNNNNNAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGNNNN N-3’ Twister (Dre)(SEQ ID NO:49) 5’- TTAGAAACTCCGCCATTGCCGGTCCCAAGCCCGGATGAAAAAGGAGGAGGGTTG A-3’ Twister (Nvi)(SEQ ID NO:50) 5’- CTTTTAATGCGGCCTATTGTCGGTCTTAAGCCCGAAGAAAACGCATAGAGAAGG- 3’ Twister (Sbi)(SEQ ID NO:51) 5’-TGCCTAGCACTGCCAATGCCGGTCCCAAGCCCGGATAAATGTGGAGGGGGCA- 3’ P3 Type Twister Ribozymes Twister (Env1)(SEQ ID NO:52)5’- ATGCTCAGCGGTCCCAAGTCCGCATCAAAGCCTGAGGGCTGCAGTAAAGGTACT GAGCTG-3’ P5 Type Twister Ribozymes Twister (Spu) (SEQ ID NO:53) 5’- AGGGAGGGAGGGGTATTGGAACCAAACCTCTTAACCAACCGTCGCCCGTCCCAA GTCGGG-3’ Twister (Cpa) (SEQ ID NO:54) 5’ GCAGATGGGCCGGAGAAATCCGGTTAATGCCGATACCGTAAGGTATGCAGTCCA AACGCTGC-3’ Other Ribozyme Family Sequences Twister Sister (SEQ ID NO:55) 5’ GCAGGGCAAGGCCCAGTCCCGTGAAAGCCGGGACCGCCCCTTCGGGGGCGCGGC GCTCATGCCTGC-3’ HDV (antigenomic) (SEQ ID NO:56) 5’ GGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCATCCGAAGGAG GACGCACGTCCACTCGGATGGCTAAGGGAGAGCCACT-3’ Pistol (SEQ ID NO:57) 5’ ACTCGACTAAGCGAGTATAAACAGGCATTAGGCTTAGAGCGTTCTCACGTTATCT GAATGATGATGTGAGAGGTTGCA-3’ Varkud Satellite (VS) (SEQ ID NO:58) 5’ GAAGGGCGTCGTCGCCCCGAGCGGTAGTAAGCAGGGAACTCACCTCCAATTTCA GTACTGAAATTGTCGTAGCAGTTGACTACTGTTATGTGATTGGTAGAGGCTAAGT GACGGTATTGGCGTAAGTCAGTATTGCAGCACAGCACAAGCCCGCTTGCGAGAA TATT 3’ Hatchet (SEQ ID NO:59)5’ GTTCTTACTGTGAGAATCAGTGACAAACATGTGGGGCTTATATCTAATCTTCGGA TTAGTATTAGTGCAGACGTTAAAACCATGTA-3’ Hairpin (SEQ ID NO:60) 5’ AAACAGAGAAGTCAACCAGAGAAACACACGTTGTGGTATATTACCTGGTACCCC CTGACAGTCCTGTTT-3’ Hovlinc (SEQ ID NO:61) 5’ ACCTAGACTAAGCCCAGGAACATAAGACCTCAGAGCTAATGAGCCACATACCTA CCCAAGGTGAAAGCTCCTTCTCTCGCAATGTGTAACTCATGATTCTCATGACCCC TGGTTGGAGAGATCCGGACTAGGAGCCAGGGGGCCTCTGATTCTGCCAGCCACT GCTAA-3’

[0198] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.

Claims

CLAIMS What is claimed is:

1. A system for generating an RNA molecule encoding voltage-gated sodium channel SCN5A comprising: a nucleic acid molecule encoding a first RNA molecule comprising a coding region encoding a first portion of SCN5A and a 3’ribozyme; and a nucleic acid molecule encoding a second RNA molecule comprising a coding region encoding a second portion of SCN5A and a 5’ribozyme.

2. The system of claim 1, wherein the first nucleic acid molecule comprises the N-terminal coding sequence of SEQ ID NO:1 and the second nucleic acid molecule comprises the C-terminal coding sequence of SEQ ID NO:

2.

3. The system of any one of claims 1-2, wherein the 3’ribozyme catalyzes itself out of the first RNA molecule, thereby generating a 3’P or 2’3’ cP end.

4. The system of any one of claims 1-3, wherein the 5’ribozyme catalyzes itself out of the second RNA molecule, thereby generating a 5’OH end.

5. The system of claim 4, wherein the 3’P or 2’3’ cP end is ligated to the 5’OH end to form an RNA molecule encoding SCN5A.

6. The system of any one of claims 1-5 wherein the 3’ ribozyme comprises SEQ ID NO:3 or SEQ ID NO:9-61.

7. The system of any one of claims 1-6 wherein the 5’ ribozyme comprises SEQ ID NO:4 or SEQ ID NO:9-61.

8. The system of any one of claims 1-7, wherein each of the nucleic acid molecule encoding the first RNA molecule comprising the coding region encodingthe first portion of SCN5A and the nucleic acid molecule encoding the second RNA molecule comprising the coding region encoding the second portion of SCN5A comprise a chicken cardiac troonin-T promoter core (cTnT) promoter sequence.

9. The system of claim 8, wherein the cTnT promoter sequence comprises SEQ ID NO:

5.

9. The system of any one of claims 1-8, wherein the first nucleic acid molecule comprises SEQ ID NO:6 and the second nucleic acid molecule comprises SEQ ID NO:

7.

10. A method for generating an RNA molecule encoding voltage-gated sodium channel SCN5A comprising: administering to a cell or tissue a nucleic acid molecule encoding a first RNA molecule comprising a coding region encoding a first portion of SCN5A and a 3’ribozyme; and administering to a cell or tissue a nucleic acid molecule encoding a second RNA molecule comprising a coding region encoding a second portion of SCN5A and a 5’ribozyme.

11. The method of claim 10, wherein the first nucleic acid molecule comprises SEQ ID NO:1 and the second nucleic acid molecule comprises SEQ ID NO:

2.

12. The method of any one of claims 10-11, wherein the 3’ribozyme catalyzes itself out of the first RNA molecule, thereby generating a 3’P or 2’3’ cP end.

13. The method of any one of claims 10-12, wherein the 5’ribozyme catalyzes itself out of the second RNA molecule, thereby generating a 5’OH end.

14. The method of claim 13, wherein the 3’P or 2’3’ cP end is ligated to the 5’OH end to form an RNA molecule comprising the coding region of the first RNA molecule and the coding region of the second RNA molecule.

15. The method of any of claims 10-14 wherein the 3’ ribozyme comprises SEQ ID NO:3 or SEQ ID NO:9-61.

16. The method of any of claims 10-14 wherein the 5’ ribozyme comprises SEQ ID NO:4 or SEQ ID NO:9-61.

17. The method of any of claims 10-16, wherein each of the nucleic acid molecule encoding the first RNA molecule comprising the coding region encoding the first portion of SCN5A and the nucleic acid molecule encoding the second RNA molecule comprising the coding region encoding the second portion of SCN5A comprise a chicken cardiac troonin-T promoter core (cTnT) promoter sequence.

18. The method of any of claim 17, wherein the cTnT promoter sequence comprises SEQ ID NO:

5.

19. The method of any one of claims 10-18, wherein the first nucleic acid molecule comprises SEQ ID NO:6 and the second nucleic acid molecule comprises SEQ ID NO:

7.

20. The method of any one of claims 10-19 for treating a disease or disorder associated with a decreased level of activity of voltage-gated sodium channel SCN5A.

21. The method of claim 20, wherein the disease or disorder is Brugada Syndrome, Long QT Syndrome, atrial fibrillation, sick sinus syndrome or cardiomyopathy.

Images