Targeted enzyme protein drug and design method therefor

Abstract

The present invention provides a complex comprising an enzyme protein and a protein-targeting element. Specifically, by introducing the protein-targeting element in potential enzyme protein therapy, the present invention achieves the effects of reducing the dosage level of an enzyme protein drug, improving the targeting property of the enzyme protein, reducing toxic side effects, etc.

Description

A targeted enzyme protein drug and a design method thereof TECHNICAL FIELD

[0001] The present application relates to the field of protein drug design, in particular to a targeted enzyme protein drug and a design method thereof. BACKGROUND

[0002] Enzyme protein refers to the pure protein part of an enzyme, which is an important component of protein. With the rise of protein drugs represented by antibodies, enzyme proteins also play an important role as potential drugs. For example, carboxypeptidase G2 can be used to remove methotrexate from blood; asparaginase has become a routine therapy for acute lymphoblastic leukemia.

[0003] However, current enzyme protein drugs mainly focus on the degradation of metabolites, and other enzyme proteins cannot be directly developed as potential drugs due to weak targeting and low activity.

[0004] Therefore, there is an urgent need in the art for an enzyme protein drug with high selectivity and high activity.

[0005] SUMMARY

[0006] In order to overcome the weakness of enzyme protein drugability, the present application introduces protein targeting elements and enzyme protein mutation technology to achieve the design of enzyme protein drugs with high selectivity and high activity. Through the combination of different enzyme proteins and protein targeting elements, the present application obtains new protein therapies based on enzyme proteins such as protein targeting inactivation, cell targeting ferroptosis and protein targeting degradation. These therapies can be used to treat various tumors, including but not limited to PD-L1 high expression triple-negative breast cancer, EGFR high expression lung cancer cells and HER2+ high expression breast cancer.

[0007] In a first aspect of the present application, a complex is provided, which contains an enzyme protein and a protein targeting element;

[0008] The enzyme protein is selected from the group consisting of enzymes or their mutants: post-translational modification removing enzymes, amino acid cleaving enzymes, proteolytic enzymes, or combinations thereof.

[0009] The protein targeting element is selected from the group consisting of antibodies, antibody-like molecules, nucleic acid aptamers, or combinations thereof.

[0010] In a preferred embodiment, the post-translational modification removing enzyme is selected from the group consisting of enzymes or their mutants: deglycosylation enzymes, deubiquitination enzymes, dephosphorylation enzymes, deacetylation enzymes, desumoylation enzymes, demethylation enzymes, or combinations thereof.

[0011] The amino acid lyase is selected from the group consisting of methionine lyase, cysteine lyase, aspartate decarboxylase, glutamate decarboxylase, phenylalanine lyase, histidine lyase, lysine decarboxylase, asparaginase, glutaminase, arginase, serine lyase, threonine lyase, tryptophan lyase, tyrosine lyase, or a combination thereof, or a mutant thereof.

[0012] The proteolytic enzyme is selected from the group consisting of trypsin, matrix metalloproteinase, proteinase K, endoproteinase Glu-C, or a combination thereof, or a mutant thereof.

[0013] In another preferred embodiment, the antibody-like molecule is selected from the group consisting of Nanobody, chimeric antibody, Fab, single-chain antibody (ScFv), Affibody, or a combination thereof.

[0014] In a preferred embodiment, the enzyme protein is selected from the group consisting of:

[0015] PNGase F, or mutant PNGase F-m;

[0016] MetL, or mutant MetL-m;

[0017] TRY1, or mutant TRY1-m;

[0018] Preferably, the PNGase F has an amino acid sequence selected from the group consisting of:

[0019] (1) the amino acid sequence as set forth in SEQ ID NO: 5;

[0020] (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as set forth in SEQ ID NO: 5;

[0021] The PNGase F-m has an amino acid sequence selected from the group consisting of:

[0022] (1) the amino acid sequence as set forth in SEQ ID NO: 7;

[0023] (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as set forth in SEQ ID NO: 7;

[0024] The MetL has an amino acid sequence selected from the group consisting of:

[0025] (1) the amino acid sequence set forth in SEQ ID NO: 19;

[0026] (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence set forth in SEQ ID NO: 19;

[0027] The MetL-m has an amino acid sequence selected from the group consisting of:

[0028] (1) the amino acid sequence set forth in SEQ ID NO: 21;

[0029] (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence set forth in SEQ ID NO: 21;

[0030] The TRY1 has an amino acid sequence selected from the group consisting of:

[0031] (1) the sequence set forth in SEQ ID NO: 28;

[0032] (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence set forth in SEQ ID NO: 28;

[0033] The TRY1-m has an amino acid sequence selected from the group consisting of:

[0034] (1) the sequence set forth in SEQ ID NO: 30;

[0035] (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence set forth in SEQ ID NO: 30.

[0036] In a preferred embodiment, the antibody is selected from the group consisting of a PD-L1 antibody, an EGFR antibody, a HER2 antibody, a CD47 antibody, or a combination thereof.

[0037] The antibody mimetic is selected from the group consisting of a PD-L1 nanobody, a PD-L1 single chain antibody, an EGFR affibody, an EGFR single chain antibody, an EGFR antibody binding fragment, a HER2 affibody, a HER2 single chain antibody, a HER2 antibody binding fragment, a CD47 nanobody, a CD47 single chain antibody, or a combination thereof.

[0038] The aptamer is selected from the group consisting of a HER2 aptamer, an EGFR aptamer, a PD-L1 aptamer, a CD47 aptamer, or a combination thereof.

[0039] In a preferred embodiment, when the protein targeting element is an antibody or an antibody-like molecule, the enzyme protein and the antibody or antibody-like molecule are connected via a polypeptide linker;

[0040] Preferably, the polypeptide linker is polypeptide linker X, which has an amino acid sequence selected from the group consisting of:

[0041] (1) the sequence as shown in SEQ ID NO: 9;

[0042] (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence as shown in SEQ ID NO: 9.

[0043] In a preferred embodiment, when the protein targeting element is an aptamer, the enzyme protein and the aptamer are connected via a small molecule linker; preferably, the small molecule linker is small molecule linker Y, which has the structure as shown in formula (I):

[0044] In a preferred embodiment, the enzyme protein is a post-translational modification enzyme PNGase F or a mutant post-translational modification enzyme PNGase F-m, and the protein targeting element is a PD-L1 antibody;

[0045] wherein the PNGase F has an amino acid sequence selected from the group consisting of:

[0046] (1) the amino acid sequence as shown in SEQ ID NO: 5;

[0047] (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as shown in SEQ ID NO: 5.

[0048] The PNGase F-m has an amino acid sequence selected from the group consisting of:

[0049] (1) the amino acid sequence as shown in SEQ ID NO: 7;

[0050] (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as shown in SEQ ID NO: 7.

[0051] Preferably, the heavy chain of the PD-L1 antibody has the amino acid sequence as shown in SEQ ID NO: 1, and the light chain of the PD-L1 has the amino acid sequence as shown in SEQ ID NO: 3.

[0052] In another preferred embodiment, the coding gene of the PNGase F has a nucleotide sequence selected from the group consisting of:

[0053] (1) the nucleotide sequence as shown in SEQ ID NO: 6;

[0054] (2) a nucleotide sequence complementary to the nucleotide sequence as shown in SEQ ID NO: 6;

[0055] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as shown in SEQ ID NO: 6 or a nucleotide sequence complementary thereto.

[0056] In another preferred embodiment, the coding gene of the PNGase F-m has a nucleotide sequence selected from the group consisting of:

[0057] (1) the nucleotide sequence as shown in SEQ ID NO: 8;

[0058] (2) a nucleotide sequence complementary to the nucleotide sequence as shown in SEQ ID NO: 8;

[0059] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as shown in SEQ ID NO: 8 or a nucleotide sequence complementary thereto.

[0060] In another preferred embodiment, the coding gene of the heavy chain of the PD-L1 antibody has a nucleotide sequence selected from the group consisting of:

[0061] (1) the nucleotide sequence as shown in SEQ ID NO: 2;

[0062] (2) a nucleotide sequence complementary to the nucleotide sequence as shown in SEQ ID NO: 2;

[0063] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as shown in SEQ ID NO: 2 or a nucleotide sequence complementary thereto.

[0064] In another preferred embodiment, the coding gene of the light chain of the PD-L1 antibody has a nucleotide sequence selected from the group consisting of:

[0065] (1) the nucleotide sequence as shown in SEQ ID NO: 4;

[0066] (2) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 4;

[0067] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence shown in SEQ ID NO: 4 or a nucleotide sequence complementary to the nucleotide sequence.

[0068] In another preferred embodiment, the complex is anti-PD-L1-PNGase F; wherein the enzyme protein is a post-deamidation enzyme PNGase F, and the protein targeting element is a PD-L1 antibody.

[0069] The heavy chain of the anti-PD-L1-PNGase F contains an amino acid sequence as shown in SEQ ID NO: 1, and / or the light chain of the anti-PD-L1-PNGase F has an amino acid sequence as shown in SEQ ID NO: 11.

[0070] In another preferred embodiment, the encoding gene of the heavy chain of the anti-PD-L1-PNGase F has a nucleotide sequence selected from the group consisting of:

[0071] (1) a nucleotide sequence as shown in SEQ ID NO: 2;

[0072] (2) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 2;

[0073] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence shown in SEQ ID NO: 2 or a nucleotide sequence complementary to the nucleotide sequence.

[0074] In another preferred embodiment, the encoding gene of the light chain of the anti-PD-L1-PNGase F has a nucleotide sequence selected from the group consisting of:

[0075] (1) a nucleotide sequence as shown in SEQ ID NO: 12;

[0076] (2) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 12;

[0077] (3) a nucleotide sequence that has at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence shown in SEQ ID NO: 12 or its complementary nucleotide sequence.

[0078] In another preferred embodiment, the complex is anti-PD-L1-PNGase F-m; wherein the enzyme protein is a mutated de-modification enzyme PNGase F-m, and the protein targeting element is a PD-L1 antibody.

[0079] The heavy chain of the anti-PD-L1-PNGase F-m contains an amino acid sequence as shown in SEQ ID NO: 1, and / or the light chain of the anti-PD-L1-PNGase F-m has an amino acid sequence as shown in SEQ ID NO: 13.

[0080] In another preferred embodiment, the encoding gene of the heavy chain of the anti-PD-L1-PNGase F-m has a nucleotide sequence selected from the group consisting of:

[0081] (1) a nucleotide sequence as shown in SEQ ID NO: 2;

[0082] (2) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 2;

[0083] (3) a nucleotide sequence that has at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence shown in SEQ ID NO: 2 or its complementary nucleotide sequence.

[0084] In another preferred embodiment, the encoding gene of the light chain of the anti-PD-L1-PNGase F-m has a nucleotide sequence selected from the group consisting of:

[0085] (1) a nucleotide sequence as shown in SEQ ID NO: 14;

[0086] (2) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 14;

[0087] (3) a nucleotide sequence that has at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence shown in SEQ ID NO: 14 or its complementary nucleotide sequence.

[0088] In another preferred embodiment, the de-modification enzyme is linked to the antibody via a polypeptide linker.

[0089] In another preferred embodiment, the PNGase F and the PD-L1 antibody are linked via a polypeptide linker X to form a complex anti-PD-L1-PNGase F.

[0090] In another preferred embodiment, the PNGase F is linked to the C-terminus of the PD-L1 antibody via a polypeptide linker X to form a complex anti-PD-L1-PNGase F.

[0091] In another preferred embodiment, the PNGase F-m and the PD-L1 antibody are linked via a polypeptide linker X to form a complex anti-PD-L1-PNGase F-m.

[0092] In another preferred embodiment, the PNGase F-m is linked to the C-terminus of the PD-L1 antibody via a polypeptide linker X to form a complex anti-PD-L1-PNGase F-m.

[0093] In a preferred embodiment, the enzyme protein is an amino acid cleavage enzyme MetL or a mutated amino acid cleavage enzyme MetL-m, and the protein targeting element is an EGFR antibody.

[0094] wherein the MetL has an amino acid sequence selected from the group consisting of:

[0095] (1) the amino acid sequence as set forth in SEQ ID NO: 19;

[0096] (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as set forth in SEQ ID NO: 19;

[0097] the MetL-m has an amino acid sequence selected from the group consisting of:

[0098] (1) the amino acid sequence as set forth in SEQ ID NO: 21;

[0099] (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as set forth in SEQ ID NO: 21;

[0100] the heavy chain of the EGFR antibody has an amino acid sequence as set forth in SEQ ID NO: 15, and / or the light chain of the EGFR antibody has an amino acid sequence as set forth in SEQ ID NO: 17.

[0101] In another preferred embodiment, the MetL-m has a nucleotide sequence selected from the group consisting of:

[0102] (1) the nucleotide sequence as shown in SEQ ID NO: 22;

[0103] (2) a nucleotide sequence complementary to the nucleotide sequence as shown in SEQ ID NO: 22;

[0104] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as shown in SEQ ID NO: 22 or a nucleotide sequence complementary thereto.

[0105] In another preferred embodiment, the MetL-m has a nucleotide sequence selected from the group consisting of:

[0106] (1) the nucleotide sequence as shown in SEQ ID NO: 22;

[0107] (2) a nucleotide sequence complementary to the nucleotide sequence as shown in SEQ ID NO: 22;

[0108] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as shown in SEQ ID NO: 22 or a nucleotide sequence complementary thereto.

[0109] In another preferred embodiment, the MetL-m has a nucleotide sequence selected from the group consisting of:

[0110] (1) the nucleotide sequence as shown in SEQ ID NO: 22;

[0111] (2) a nucleotide sequence complementary to the nucleotide sequence as shown in SEQ ID NO: 22;

[0112] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as shown in SEQ ID NO: 22 or a nucleotide sequence complementary thereto.

[0113] In another preferred embodiment, the MetL-m has a nucleotide sequence selected from the group consisting of:

[0114] (1) the nucleotide sequence as shown in SEQ ID NO: 22;

[0115] (2) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 18;

[0116] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence shown in SEQ ID NO: 18 or a nucleotide sequence complementary to the nucleotide sequence.

[0117] In another preferred embodiment, the complex is anti-EGFR-MetL; wherein the enzyme protein is MetL, and the protein targeting element is EGFR antibody.

[0118] The heavy chain of the anti-EGFR-MetL has an amino acid sequence as shown in SEQ ID NO: 15, and / or the light chain of the anti-EGFR-MetL has an amino acid sequence as shown in SEQ ID NO: 23.

[0119] In another preferred embodiment, the encoding gene of the heavy chain of the anti-EGFR-MetL has a nucleotide sequence selected from the group consisting of:

[0120] (1) a nucleotide sequence as shown in SEQ ID NO: 16;

[0121] (2) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 16;

[0122] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence shown in SEQ ID NO: 16 or a nucleotide sequence complementary to the nucleotide sequence.

[0123] In another preferred embodiment, the encoding gene of the light chain of the anti-EGFR-MetL has a nucleotide sequence selected from the group consisting of:

[0124] (1) a nucleotide sequence as shown in SEQ ID NO: 24;

[0125] (2) a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 24;

[0126] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence shown in SEQ ID NO: 24 or a nucleotide sequence complementary to the nucleotide sequence.

[0127] In another preferred embodiment, the complex is anti-EGFR-MetL-m, wherein the enzyme protein is MetL-m and the protein targeting element is EGFR antibody.

[0128] The heavy chain of anti-EGFR-MetL-m has an amino acid sequence as set forth in SEQ ID NO: 15, and / or the light chain of anti-EGFR-MetL-m has an amino acid sequence as set forth in SEQ ID NO: 25.

[0129] In another preferred embodiment, the encoding gene of the heavy chain of anti-EGFR-MetL-m has a nucleotide sequence selected from the group consisting of:

[0130] (1) a nucleotide sequence as set forth in SEQ ID NO: 16;

[0131] (2) a nucleotide sequence complementary to the nucleotide sequence as set forth in SEQ ID NO: 16;

[0132] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 16 or a nucleotide sequence complementary thereto.

[0133] In another preferred embodiment, the encoding gene of the light chain of anti-EGFR-MetL-m has a nucleotide sequence selected from the group consisting of:

[0134] (1) a nucleotide sequence as set forth in SEQ ID NO: 26;

[0135] (2) a nucleotide sequence complementary to the nucleotide sequence as set forth in SEQ ID NO: 26;

[0136] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 26 or a nucleotide sequence complementary thereto.

[0137] In another preferred embodiment, the amino acid lyase is linked to the antibody via a polypeptide linker.

[0138] In another preferred embodiment, the MetL and the EGFR antibody are linked via a polypeptide linker X to form a complex anti-EGFR-MetL.

[0139] In another preferred embodiment, the MetL is linked to the C-terminus of the EGFR antibody via a polypeptide linker X, forming a complex anti-EGFR-MetL.

[0140] In another preferred embodiment, the MetL-m and the EGFR antibody are linked via a polypeptide linker X, forming a complex anti-EGFR-MetL-m.

[0141] In another preferred embodiment, the MetL-m is linked to the C-terminus of the EGFR antibody via a polypeptide linker X, forming a complex anti-EGFR-MetL-m.

[0142] In a preferred embodiment, the enzyme protein is a proteolytic enzyme TRY1 or a mutated proteolytic enzyme TRY1-m, and the protein targeting element is a HER2 aptamer;

[0143] The TRY1 has an amino acid sequence selected from the group consisting of:

[0144] (1) the sequence as set forth in SEQ ID NO: 28;

[0145] (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence as set forth in SEQ ID NO: 28;

[0146] The TRY1-m has an amino acid sequence selected from the group consisting of:

[0147] (1) the sequence as set forth in SEQ ID NO: 30;

[0148] (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence as set forth in SEQ ID NO: 30;

[0149] The HER2 aptamer has a nucleotide sequence selected from the group consisting of:

[0150] (1) the nucleotide sequence as set forth in SEQ ID NO: 27;

[0151] (2) a nucleotide sequence complementary to the nucleotide sequence as set forth in SEQ ID NO: 27;

[0152] (3) a nucleotide sequence or a complementary nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 27.

[0153] In another preferred embodiment, the coding gene of TRY1 has a nucleotide sequence selected from the group consisting of:

[0154] (1) the nucleotide sequence as shown in SEQ ID NO: 29;

[0155] (2) the nucleotide sequence complementary to the nucleotide sequence as shown in SEQ ID NO: 29;

[0156] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as shown in SEQ ID NO: 29 or the nucleotide sequence complementary thereto.

[0157] In another preferred embodiment, the coding gene of TRY1-m has a nucleotide sequence selected from the group consisting of:

[0158] (1) the nucleotide sequence as shown in SEQ ID NO: 31;

[0159] (2) the nucleotide sequence complementary to the nucleotide sequence as shown in SEQ ID NO: 31;

[0160] (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as shown in SEQ ID NO: 31 or the nucleotide sequence complementary thereto.

[0161] In another preferred embodiment, the protease and the aptamer are linked by a small molecule linker.

[0162] In another preferred embodiment, the complex is apt-HER2-TRY1, wherein the enzyme protein is protease TRY1 and the protein targeting element is HER2 aptamer.

[0163] In another preferred embodiment, the complex is apt-HER2-TRY1-m, wherein the enzyme protein is protease TRY1-m and the protein targeting element is HER2 aptamer.

[0164] In a second aspect, the present application provides a use of the complex according to the first aspect of the present application, wherein the use is selected from the group consisting of:

[0165] (1) for specifically inactivating a tumor target protein;

[0166] (2) for specifically killing a tumor cell;

[0167] (3) for specific degradation of tumor target proteins.

[0168] In another preferred embodiment, the tumor cell specific death is ferroptosis.

[0169] It should be understood that, within the scope of the present application, each of the technical features described above and each of the technical features specifically described below (e.g., in the examples) can be combined with each other to form new or preferred technical solutions. Due to the limited space, they will not be listed one by one here. BRIEF DESCRIPTION OF DRAWINGS

[0170] Figure 1 shows the effect of anti-PD-L1-PNGase F-m treatment on the tumor volume of PD-L1 high expression triple negative breast cancer mice.

[0171] Figure 2 shows the effect of anti-EGFR-MetL-m treatment on the tumor volume of EGFR high expression lung cancer mice.

[0172] Figure 3 shows the effect of apt-HER2-TRY1-m treatment on the tumor volume of HER2 high expression breast cancer mice. DETAILED DESCRIPTION

[0173] Enzyme proteins have great potential as protein drugs, but their targeting is weak, their activity is low, and they are difficult to be developed into drugs. Through the investigation of the performance and catalytic efficiency of a series of enzyme proteins, the inventors accidentally found that the introduction of protein targeting elements and point mutation technology can improve the targeting and activity of enzyme proteins.

[0174] Through a large number of cell and tumor model experiment screening and verification, the inventors developed new protein therapies based on enzyme proteins, such as protein targeting inactivation, cell targeting ferroptosis, and protein targeting degradation, which can be applied to the treatment of a variety of tumors, including but not limited to the treatment of PD-L1 high expression triple negative breast cancer, EGFR high expression lung cancer cells, and HER2+ high expression breast cancer. Based on the above findings, the inventors completed the present application.

[0175] Specifically, the present application provides a complex of enzyme proteins and protein targeting elements, which can achieve new protein therapies based on enzyme proteins, such as protein targeting inactivation, cell targeting ferroptosis, and protein targeting degradation, by flexibly combining enzyme proteins and protein targeting elements.

[0176] Design, construction, and optimization of the complex of enzyme proteins and protein targeting elements

[0177] The present application mainly selects three types of enzymes, post-translation modification enzymes, amino acid cleavage enzymes, and proteolytic enzymes, to design the complex of enzyme proteins and protein targeting elements.

[0178] Post-translation modification enzymes

[0179] Post-translational modification enzymes can change the specific post-translational modification of target proteins. Current protein drugs can only target cell surface or extracellular target proteins, and there is still a lack of mature methods for transporting proteins into cells. The most common post-translational modification of cell surface or extracellular proteins is glycosylation modification, and glycosylation modification often confers function or stability to these proteins. Therefore, the present application first develops a de-post-translational modification enzyme targeting glycosylation, and selects a peptide N-glycosidase F (PNGase F) that removes N-glycosylation modification.

[0180] N-glycosylation of immune checkpoint PD-L1 is a necessary post-translational modification for its binding to PD-1, so the present application selects PD-L1 as the target protein.

[0181] The present application uses PD-L1 antibody as a targeting element (the amino acid sequence of the heavy chain is shown as SEQ ID NO: 1; the nucleotide sequence of the heavy chain is shown as SEQ ID NO: 2; the amino acid sequence of the light chain is shown as SEQ ID NO: 3; the nucleotide sequence of the light chain is shown as SEQ ID NO: 4), and uses PNGase F from Elizabethkingia miricola as a de-post-translational modification enzyme PNGase F (the amino acid sequence is shown as SEQ ID NO: 5; the nucleotide sequence is shown as SEQ ID NO: 6):

[0182] SEQ ID NO: 1

[0183] Type: Protein

[0184] Name: anti-PD-L1 heavy chain

[0185] Source: Homo sapiens

[0186] SEQ ID NO: 2

[0187] Type: DNA

[0188] Name: anti-PD-L1 heavy chain

[0189] Source: Homo sapiens

[0190] SEQ ID NO: 3

[0191] Type: Protein

[0192] Name: anti-PD-L1 light chain

[0193] Source: Homo sapiens

[0194] SEQ ID NO: 4

[0195] Type: DNA

[0196] Name: anti-PD-L1 light chain

[0197] Source: Homo sapiens

[0198] SEQ ID NO: 5

[0199] Type: protein

[0200] Name: PNGase F

[0201] Source: Elizabethkingia miricola

[0202] SEQ ID NO: 6

[0203] Type: DNA

[0204] Name: PNGase F

[0205] Source: Elizabethkingia miricola

[0206] Since the activity of PNGase F is weak, the present application improves its activity through artificial intelligence assisted rational design, and obtains a mutated PNGase F, namely PNGase F-m (the amino acid sequence is shown as SEQ ID NO: 7; the nucleotide sequence is shown as SEQ ID NO: 8):

[0207] SEQ ID NO: 7

[0208] Type: protein

[0209] Name: PNGase F-m

[0210] Source: Elizabethkingia miricola

[0211] SEQ ID NO: 8

[0212] Type: DNA

[0213] Name: PNGase F-m

[0214] Source: Elizabethkingia miricola

[0215] The PNGase F or PNGase F-m is fused to the C-terminus of the light chain of the PD-L1 antibody by a polypeptide linker X (amino acid sequence as shown in SEQ ID NO: 9; nucleotide sequence SEQ ID NO: 10), to obtain the complex anti-PD-L1-PNGase F and anti-PD-L1-PNGase F-m.

[0216] SEQ ID NO: 9

[0217] Type: protein

[0218] Name: Peptide linker X

[0219] SEQ ID NO: 10

[0220] Type: DNA

[0221] Name: Peptide linker X

[0222] The amino acid sequence of the anti-PD-L1-PNGase F light chain is as shown in SEQ ID NO: 11; the nucleotide sequence of the anti-PD-L1-PNGase F light chain is as shown in SEQ ID NO: 12; the amino acid sequence of the anti-PD-L1-PNGase F-m light chain is as shown in SEQ ID NO: 13; the nucleotide sequence of the anti-PD-L1-PNGase F-m light chain is as shown in SEQ ID NO: 14; the amino acid sequence of the heavy chain of anti-PD-L1-PNGase F and anti-PD-L1-PNGase F-m is as shown in SEQ ID NO: 1; the nucleotide sequence of the heavy chain of anti-PD-L1-PNGase F and anti-PD-L1-PNGase F-m is as shown in SEQ ID NO: 2 (the sequences SEQ ID No. 1 and SEQ ID No. 2 are shown above):

[0223] SEQ ID NO: 11

[0224] Type: protein

[0225] Name: anti-PD-L1-PNGase F light chain

[0226] SEQ ID NO: 12

[0227] Type: DNA

[0228] Name: anti-PD-L1-PNGase F light chain

[0229] SEQ ID NO: 13

[0230] Type: protein

[0231] Name: anti-PD-L1-PNGase F-m light chain

[0232] SEQ ID NO: 14

[0233] Type: DNA

[0234] Name: anti-PD-L1-PNGase F-m light chain

[0235] Amino acid cleavage enzyme

[0236] Metabolic enzymes are currently the most common enzyme protein drugs, which are used to degrade metabolites that are harmful to humans or contribute to disease progression. However, most biological metabolites (such as amino acids) are also beneficial to normal cells or normal physiological activities. If the targeting of solid tumors can be achieved, metabolic enzymes will be a tumor metabolic therapy with good efficacy and low toxicity.

[0237] In recent years, amino acid metabolism has gained more and more attention and become a research hotspot of tumor metabolism. Therefore, amino acid cleavage enzymes that degrade amino acids have shown great potential for tumor metabolic therapy. For example, iron death caused by cysteine deficiency has shown great potential for anti-tumor treatment, and the additional deletion of methionine can further enhance iron death. Studies have found that methionine cleavage enzyme (MetL) can simultaneously degrade cysteine and methionine and is a potential iron death inducing enzyme.

[0238] The present application selects EGFR antibody (anti-EGFR) as the targeting element (the amino acid sequence of the heavy chain is shown as SEQ ID NO: 15; the nucleotide sequence of the heavy chain is shown as SEQ ID NO: 16; the amino acid sequence of the light chain is shown as SEQ ID NO: 17; and the nucleotide sequence of the light chain is shown as SEQ ID NO: 18):

[0239] SEQ ID NO: 15

[0240] Type: protein

[0241] Name: anti-EGFR heavy chain

[0242] Source: Homo sapiens

[0243] SEQ ID NO: 16

[0244] Type: DNA

[0245] Name: anti-EGFR heavy chain

[0246] Source: Homo sapiens

[0247] SEQ ID NO: 17

[0248] Type: protein

[0249] Name: anti-EGFR light chain

[0250] Source: Homo sapiens

[0251] SEQ ID NO: 18

[0252] Type: DNA

[0253] Name: anti-EGFR light chain

[0254] Source: Homo sapiens

[0255] Using MetL from Treponema denticola as metabolic enzyme (amino acid sequence as shown in SEQ ID NO: 19; nucleotide sequence as shown in SEQ ID NO: 20):

[0256] SEQ ID NO: 19

[0257] Type: protein

[0258] Name: TRY1

[0259] Source: Treponema denticola

[0260] SEQ ID NO: 20

[0261] Type: DNA

[0262] Name: TRY1

[0263] Source: Treponema denticola

[0264] Since the activity of MetL is weak, the present application improves its activity by artificial intelligence assisted rational design, and obtains a mutated MetL, i.e. MetL-m (the amino acid sequence is shown as SEQ ID NO: 21, and the nucleotide sequence is shown as SEQ ID NO: 22):

[0265] SEQ ID NO: 21

[0266] Type: protein

[0267] Name: TRY1-m

[0268] Source: Treponema denticola

[0269] SEQ ID NO: 22

[0270] Type: DNA

[0271] Name: TRY1-m

[0272] Source: Treponema denticola

[0273] MetL or MetL-m is fused to the C-terminal of EGFR antibody through a polypeptide linker X (the amino acid sequence is shown as SEQ ID NO: 9; the nucleotide sequence is shown as SEQ ID NO: 10), to obtain complexes anti-EGFR-MetL and anti-EGFR-MetL-m, wherein:

[0274] The amino acid sequence of anti-EGFR-MetL light chain is shown as SEQ ID NO: 23; the nucleotide sequence of anti-EGFR-MetL light chain is shown as SEQ ID NO: 24;

[0275] SEQ ID NO: 23

[0276] Type: protein

[0277] Name: anti-EGFR-TRY1 light chain

[0278] SEQ ID NO: 24

[0279] Type: DNA

[0280] Name: anti-EGFR-TRY1 light chain

[0281] The amino acid sequence of the anti-EGFR-MetL-m light chain is shown as SEQ ID NO: 25; the nucleotide sequence of the anti-EGFR-MetL-m light chain is shown as SEQ ID NO: 26;

[0282] SEQ ID NO: 25

[0283] Type: protein

[0284] Name: anti-EGFR-TRY1-m light chain

[0285] SEQ ID NO: 26

[0286] Type: DNA

[0287] Name: anti-EGFR-TRY1-m light chain

[0288] The amino acid sequence of the anti-EGFR-MetL and anti-EGFR-MetL-m heavy chain is shown as SEQ ID NO: 15; the nucleotide sequence of the anti-EGFR-MetL-m and anti-EGFR-MetL-m heavy chain is shown as SEQ ID NO: 16 (see above).

[0289] Proteolytic enzyme

[0290] Lysosomal targeting chimera (LYTAC) is an important protein degradation strategy, which can be designed based on antibodies of cell surface target proteins to achieve degradation of target proteins by antibody-small molecule complex or secondary antibodies. However, LYTAC has the disadvantages of long degradation time, and antibody complex cannot be recycled because it is degraded by lysosomes. Therefore, the present application uses a lysosome-independent protease degradation strategy to achieve specific degradation of target proteins by introducing a protein targeting element, and obtains a fast-degrading and recyclable protease-protein targeting element complex.

[0291] The present application selects HER2 aptamer (apt-HER2) as a targeting element (nucleotide sequence shown as SEQ ID NO: 27), and uses human trypsin 1 (TRY1) as a protease (amino acid sequence shown as SEQ ID NO: 28; nucleotide sequence shown as SEQ ID NO: 29):

[0292] SEQ ID NO: 27

[0293] Type: RNA

[0294] Name: HER2 Aptamer

[0295] SEQ ID NO: 28

[0296] Type: Protein

[0297] Name: TRY1

[0298] Source: Homo sapiens

[0299] SEQ ID NO: 29

[0300] Type: DNA

[0301] Name: TRY1

[0302] Source: Homo sapiens

[0303] Since the activity of TRY1 is weak, the present application improves its activity by artificial intelligence assisted rational design, and obtains a mutated TRY1, i.e. TRY1-m (the amino acid sequence is shown as SEQ ID NO: 30; the nucleotide sequence is shown as SEQ ID NO: 31):

[0304] SEQ ID NO: 30

[0305] Type: Protein

[0306] Name: TRY1-m

[0307] Source: Homo sapiens

[0308] SEQ ID NO: 31

[0309] Type: DNA

[0310] Name: TRY1-m

[0311] Source: Homo sapiens

[0312] The TRY1 or TRY1-m is connected to the HER2 nucleic acid aptamer by a small molecule linker Y as shown in formula (I) to obtain the complex apt-HER2-TRY1 and apt-HER2-TRY1-m.

[0313] The main advantages of the present application are:

[0314] (1) Compared with enzyme protein drugs, on the one hand, the present application realizes the targeting of enzyme proteins to target proteins or target cells by introducing protein targeting elements, so that enzyme protein drugs are enriched at specific tumor sites, reducing the toxicity of enzyme protein drugs to other living sites. Moreover, for enzyme proteins with target proteins as substrates, protein targeting elements reduce the Km of enzyme reactions and increase the reaction rate of enzyme proteins. On the other hand, the present application further improves the activity of enzyme proteins through artificial intelligence assisted rational design (such as point mutation), so that the effective concentration of enzyme protein-protein targeting element complex reaches the same level as existing protein targeting elements (such as antibodies), thereby reducing the dosage of protein drugs.

[0315] (2) Compared with protein targeting elements, the introduction of enzyme proteins provides new therapeutic effects, achieving 1+1>=2. For example, post-translational modification enzymes specifically inactivate target proteins, and have the effects of inhibitors, inactivators and recycling; protein cleavage enzymes increase new therapeutic effects (such as ferroptosis); proteolytic enzymes specifically degrade target proteins, and have the effects of inhibitors, degraders and recycling.

[0316] The present application will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. The experimental methods in the following examples are not specified, which are usually carried out according to conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by weight. Other materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.

[0317] Example 1. Preparation of complex

[0318] 1.1 Preparation of complex anti-PD-L1-PNGase F and anti-PD-L1-PNGase F-m

[0319] Construction of anti-PD-L1-PNGase F plasmid: Synthesize the heavy chain (SEQ ID NO: 2) and light chain (SEQ ID NO: 12) of anti-PD-L1-PNGase F gene sequence by Shenguo Biotech, and insert into the BamHI and XhoI sites of pcDNA3.1 expression vector (Life Technologies V79020), respectively.

[0320] Anti-PD-L1-PNGase F-m plasmid construction: The heavy chain (SEQ ID NO: 2) and light chain (SEQ ID NO: 14) gene sequences were synthesized by Shengwo Biotechnology and inserted into the BamHI and Xhol sites of pcDNA3.1 expression vector (Life Technologies V79020), respectively.

[0321] CHO cell transfection and expression: The expression vectors of anti-PD-L1-PNGase F and anti-PD-L1-PNGase F-m were mixed with PEI transfection reagent (proteintech PR40001) at 1:1.5 to transfect CHO-S cells (Invitrogen). The cells were cultured at 37°C for 3 days using lx CD-CHO and lx HT medium (Gibco), and the stable cell lines were screened using G418 and puromycin. After mass culture for 7 days, the culture supernatant was collected by centrifugation.

[0322] Purification of complex anti-PD-L1-PNGase F and anti-PD-L1-PNGase F-m: After purification with a protein A affinity column (GE), PBS dialysis, and filtration with a 0.22 um filter, the complex anti-PD-L1-PNGase F and anti-PD-L1-PNGase F-m was obtained.

[0323] 1.2 Preparation of complex anti-EGFR-MetL and anti-EGFR-MetL-m

[0324] Anti-EGFR-MetL plasmid construction: The heavy chain (SEQ ID NO: 16) and light chain (SEQ ID NO: 24) gene sequences were synthesized by Shengwo Biotechnology and inserted into the BamHI and Xhol sites of pcDNA3.1 expression vector (Life Technologies V79020), respectively.

[0325] Anti-EGFR-MetL-m plasmid construction: The heavy chain (SEQ ID NO: 16) and light chain (SEQ ID NO: 26) gene sequences were synthesized by Shengwo Biotechnology and inserted into the BamHI and Xhol sites of pcDNA3.1 expression vector (Life Technologies V79020), respectively.

[0326] CHO cell transfection and expression: anti-EGFR-MetL and anti-EGFR-MetL-m expression vectors were mixed with PEI transfection reagent (proteintech PR40001) at 1:1.5 to transfect CHO-S cells (Invitrogen). 1x CD-CHO and 1x HT medium (Gibco) were used to culture for 3 days at 37℃, and stable cell lines were screened using G418 and puromycin. After 7 days of mass culture, the culture supernatant was collected by centrifugation.

[0327] Purification of complex anti-EGFR-MetL and anti-EGFR-MetL-m: After purification with a protein A affinity column (GE), PBS dialysis, and filtration with a 0.22 um filter, the complex anti-EGFR-MetL and anti-EGFR-MetL-m was obtained.

[0328] 1.3 Preparation of complex apt-HER2-TRY1 and apt-HER2-TRY1-m

[0329] TRY1 and TRY1-m plasmid construction: Genesyn gene sequences (SEQ ID NO: 29 and 31) were inserted into the BamHI and XhoI sites of the pcDNA3.1 expression vector (Life Technologies V79020) with a tag sequence (CATCATCACCACCACCATGGCTCAGAGAATCT CTACTTCCAG) added at the front of the gene sequence.

[0330] CHO cell transfection and expression: TRY1 and TRY1-m expression vectors were mixed with PEI transfection reagent (proteintech PR40001) at 1:1.5 to transfect CHO-S cells (Invitrogen). 1x CD-CHO and 1x HT medium (Gibco) were used to culture for 3 days at 37℃, and stable cell lines were screened using G418 and puromycin. After 7 days of mass culture, the culture supernatant was collected by centrifugation.

[0331] Purification of TRY1 and TRY1-m: After binding with a His-tag affinity column (GE) and removing the tag with TEV protease (Beyotime P2308), TRY1 and TRY1-m were purified using an AKTA protein purification system, and were used after filtration with a 0.22 um filter.

[0332] Preparation of complex apt-HER2-TRY1, apt-HER2-TRY1-m: TRY1 and TRY1-m were respectively reacted with NHS-Maleimide (cas 55750-62-4) in a buffer solution of 10 mM PBS (pH 8) at room temperature for 4 hours to modify the surface of the protein with Maleimide, and then PBS dialysis. Then reacted with the 3' modified thiol HER2 aptamer (SEQ ID NO: 27) synthesized by Kingsway in PBS at room temperature for 1 hour to connect the HER2 aptamer to the surface of the protein, PBS dialysis and filtration through a 0.22 um filter membrane, and then used to obtain the complex apt-HER2-TRY1 and apt-HER2-TRY1-m.

[0333] Example 2. Anti-PD-L1-PNGase F-m targeted protein inactivation treatment of PD-L1 high expression breast cancer

[0334] Human triple negative breast cancer cells MDA-MB-231 were treated with anti-PD-L1, PNGase F, PNGase F-m, anti-PD-L1-PNGase F, anti-PD-L1-PNGase F-m respectively for 6 hours, and then detected using Biotin modified PD-1 and flow cytometry. The experimental results are shown in Table 1.

[0335] Table 1. PD-1 binding strength to PD-L1 of MDA-MB-231 cells

[0336] The experimental results show that the activity of the mutant PNGase F-m is significantly improved, and anti-PD-L1-PNGase F-m can deprive the binding of PD-L1 and PD-1 at a lower concentration, and is a potential immune checkpoint inactivator.

[0337] MDA-MB-231 cells were transplanted into NOG mice to form tumors, and at the same time, the humanized immune system was reconstructed by injecting human peripheral blood mononuclear cells (PBMC). When the tumor of the mouse reached 100 mm 3 around, 1 mg / kg of control, anti-PD-L1, PNGase F, PNGase F-m, anti-PD-L1-PNGase F, anti-PD-L1-PNGase F-m was injected intraperitoneally every two days. The experimental results are shown in Figure 1.

[0338] The experimental results show that the inhibitory effect of the anti-PD-L1-PNGase F-m drug group is significantly stronger than that of the anti-PD-L1 and PNGase F-m drug groups, and can significantly inhibit tumor growth and reduce tumor volume.

[0339] Example 3. Anti-EGFR-MetL-m targeted cell ferroptosis treatment of lung cancer with high EGFR expression

[0340] Human lung adenocarcinoma cells H2122 were treated with anti-EGFR, MetL, MetL-m, anti-EGFR-MetL, anti-EGFR-MetL-m respectively for 24 hours, and then cell survival was detected using CCK8. The experimental results are shown in Table 2.

[0341] Table 2. Cell survival after different protein drug treatment of H2122 cells

[0342] The experimental results show that the activity of MetL-m after mutation is significantly improved, and anti-EGFR-MetL-m can further improve the tumor killing effect. It has been verified that the death mode is ferroptosis.

[0343] H2122 cells were transplanted into BALB / c nude mice to form tumors. After one week, 2 mg / kg of control, anti-EGFR, MetL-m, anti-EGFR+MetL-m (molar ratio 1:1) or anti-EGFR-MetL-m was injected intratumorally every two days. The experimental results are shown in Figure 2.

[0344] The experimental results show that the inhibitory effect of the anti-EGFR-MetL-m drug group is significantly stronger than that of the anti-EGFR and MetL-m drug groups, and can significantly inhibit the growth of tumors.

[0345] Example 4. apt-HER2-TRY1-m targeted protein degradation treatment of breast cancer with high HER2 expression

[0346] Human breast cancer cells SK-BR-3 were treated with apt-HER2, TRY1, TRY1-m, apt-HER2-TRY1, apt-HER2-TRY1-m respectively for 6 hours, and then HER2 was detected using Western Blot. The experimental results are shown in Table 3.

[0347] Table 3. HER2 degradation after different drug treatment of SK-BR-3 cells

[0348] The experimental results show that the activity of TRY1-m after mutation is significantly improved, and apt-HER2-TRY1-m can degrade HER2 at a lower concentration, and is a potential targeted HER2 degradation agent drug.

[0349] SK-BR-3 cells are transplanted into BALB / c nude mice to form tumors. After one week, 10 mg / kg of control, apt-HER2, TRY1-m, apt-HER2-TRY1, apt-HER2-TRY1-m are injected intratumorally every two days. The experimental results are shown in Fig. 3.

[0350] The experimental results show that the inhibitory effect of the apt-HER2-TRY1-m drug group is obviously stronger than that of the apt-HER2 and TRY1-m drug groups, and can obviously inhibit the growth of tumors.

[0351] In summary, by introducing a protein targeting element in the potential enzyme protein therapy, the present application achieves the effects of reducing the dosage of enzyme protein drugs, improving the targeting of enzyme proteins, reducing the toxic side effects, etc.

[0352] All the documents mentioned in the present application are cited as references in the present application, as if each document is cited as a reference individually. In addition, it should be understood that, after reading the above teaching of the present application, those skilled in the art can make various modifications or changes to the present application, and these equivalent forms also fall within the scope defined by the claims of the present application.

Claims

1. A composite body, characterized by The complex contains an enzyme protein and a protein targeting element; The enzyme protein is selected from the group consisting of enzymes or mutants thereof: a post-decoding modification removing enzyme, an amino acid cleaving enzyme, a protease, or a combination thereof; The protein targeting element is selected from the group consisting of: an antibody, an antibody-like molecule, an aptamer, or a combination thereof.

2. The complex of claim 1, wherein, The post-decoding modification removing enzyme is selected from the group consisting of enzymes or mutants thereof: a deglycosylation enzyme, a deubiquitination enzyme, a dephosphorylation enzyme, a deacetylation enzyme, a desumoylation enzyme, a demethylation enzyme, or a combination thereof; The amino acid cleaving enzyme is selected from the group consisting of enzymes or mutants thereof: a methionine cleaving enzyme, a cysteine cleaving enzyme, an aspartate decarboxylase, a glutamate decarboxylase, a phenylalanine cleaving enzyme, a histidine cleaving enzyme, a lysine decarboxylase, an asparaginease, a glutaminase, an arginase, a serine cleaving enzyme, a threonine cleaving enzyme, a tryptophan cleaving enzyme, a tyrosine cleaving enzyme, or a combination thereof; The protease is selected from the group consisting of enzymes or mutants thereof: a trypsin, a matrix metalloproteinase, a proteinase K, an endoproteinase Glu-C, or a combination thereof.

3. The complex of claim 1, wherein, The enzyme protein is selected from the group consisting of: a post-decoding modification removing enzyme PNGase F, or a mutant post-decoding modification removing enzyme PNGase F-m; an amino acid cleaving enzyme MetL, or a mutant amino acid cleaving enzyme MetL-m; a protease TRY1, or a mutant protease TRY1-m; Preferably, the PNGase F has an amino acid sequence selected from the group consisting of: (1) the amino acid sequence as set forth in SEQ ID NO: 5; (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as set forth in SEQ ID NO: 5; The PNGase F-m has an amino acid sequence selected from the group consisting of: (1) the amino acid sequence as set forth in SEQ ID NO: 7; (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as set forth in SEQ ID NO: 7; The MetL has an amino acid sequence selected from the group consisting of: (1) the amino acid sequence as set forth in SEQ ID NO: 19; (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as set forth in SEQ ID NO: 19; The MetL-m has an amino acid sequence selected from the group consisting of: (1) the amino acid sequence as set forth in SEQ ID NO: 21; (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as set forth in SEQ ID NO: 21; The TRY1 has an amino acid sequence selected from the group consisting of: (1) the sequence as set forth in SEQ ID NO: 28; (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence shown in SEQ ID NO: 28; the TRY1-m has an amino acid sequence selected from the group consisting of: (1) the sequence shown in SEQ ID NO: 30; (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence shown in SEQ ID NO:

30.

4. The complex of claim 1, wherein, the antibody is selected from the group consisting of a PD-L1 antibody, an EGFR antibody, a HER2 antibody, a CD47 antibody, or a combination thereof; the antibody is selected from the group consisting of a PD-L1 antibody, an EGFR antibody, a HER2 antibody, a CD47 antibody, or a combination thereof; the nucleic acid aptamer is selected from the group consisting of a HER2 nucleic acid aptamer, an EGFR nucleic acid aptamer, a PD-L1 nucleic acid aptamer, a CD47 nucleic acid aptamer, or a combination thereof.

5. The complex of claim 1, wherein, when the protein targeting element is an antibody or an antibody-like molecule, the enzyme protein and the antibody or antibody-like molecule are connected via a polypeptide linker; Preferably, the polypeptide linker is polypeptide linker X, which has an amino acid sequence selected from the group consisting of: (1) the sequence shown in SEQ ID NO: 9; (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence shown in SEQ ID NO:

9.

6. The complex of claim 1, wherein, When the protein targeting element is an aptamer, the enzyme protein and the aptamer are connected by a small molecule linker; preferably, the small molecule linker is a small molecule linker Y, which has the structure shown in formula (I):

7. The complex of claim 1, wherein, the enzyme protein is a post-translational modification enzyme PNGase F or a mutated post-translational modification enzyme PNGase F-m, and the protein targeting element is a PD-L1 antibody; wherein the PNGase F has an amino acid sequence selected from the group consisting of: (1) the sequence shown in SEQ ID NO: 5; (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence shown in SEQ ID NO:

5. the PNGase F-m has an amino acid sequence selected from the group consisting of: (1) the sequence shown in SEQ ID NO: 7; (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence shown in SEQ ID NO:

7. Preferably, the heavy chain of the PD-L1 antibody has an amino acid sequence shown in SEQ ID NO: 1, and the light chain of the PD-L1 has an amino acid sequence shown in SEQ ID NO:

3.

8. The complex of claim 1, wherein, the enzyme protein is a post-translational modification enzyme PNGase F or a mutated post-translational modification enzyme PNGase F-m, and the protein targeting element is a PD-L1 antibody; The MetL has an amino acid sequence selected from the group consisting of: (1) the amino acid sequence as shown in SEQ ID NO: 19; (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as shown in SEQ ID NO: 19; The MetL-m has an amino acid sequence selected from the group consisting of: (1) the amino acid sequence as shown in SEQ ID NO: 21; (2) an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the amino acid sequence as shown in SEQ ID NO: 21; The heavy chain of the EGFR antibody has an amino acid sequence as shown in SEQ ID NO: 15, and / or the light chain of the EGFR antibody has an amino acid sequence as shown in SEQ ID NO:

17.

9. The complex of claim 1, wherein, The enzyme protein is a protease TRY1 or a mutated protease TRY1-m, and the protein targeting element is a HER2 aptamer; The TRY1 has an amino acid sequence selected from the group consisting of: (1) the sequence as shown in SEQ ID NO: 28; (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence as shown in SEQ ID NO: 28; The TRY1-m has an amino acid sequence selected from the group consisting of: (1) the sequence as shown in SEQ ID NO: 30; (2) a sequence having at least 90%, preferably at least 95%, more preferably at least 98%, most preferably at least 99% homology to the sequence as shown in SEQ ID NO: 30; The HER2 aptamer has a nucleotide sequence selected from the group consisting of: (1) the nucleotide sequence as shown in SEQ ID NO: 27; (2) a nucleotide sequence complementary to the nucleotide sequence as shown in SEQ ID NO: 27; (3) a nucleotide sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity to the nucleotide sequence as shown in SEQ ID NO: 27 or a complementary nucleotide sequence.

10. Use of the complex according to claim 1, characterized in that, The use is selected from the group consisting of: (1) for specifically inactivating a tumor target protein; (2) for specifically killing a tumor cell; (3) for specifically degrading a tumor target protein.

Images