Method for detecting genotype of SNP site, and kit thereof
By designing specific modified primers and combining them with different fluorescence channels, the problems of low amplification yield and difficulty in distinguishing Tm values in multiplex SNP site detection were solved, achieving highly sensitive and accurate genotype detection.
Patent Information
- Application Number
- PCT/CN2025/112308
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-02
- Filing Date
- 2025-08-03
- Publication Date
- 2026-03-05
AI Technical Summary
Existing technologies for multiplex SNP site detection suffer from problems such as low amplification yield, low sensitivity, unstable fluorescence signals, and difficulty in distinguishing Tm values, especially for A>T mutations where it is difficult to accurately distinguish genotypes.
Two specifically modified primers were designed to label different fluorescent groups. The genotypes of SNP sites were distinguished by the melting curve peaks of different fluorescence channels. Symmetrical PCR amplification was performed by controlling the Tm value and length difference of the primers to form stable fluorescence signal changes.
It improves amplification yield and sensitivity, solves the problem of difficulty in distinguishing Tm values, realizes accurate detection of multiple SNP sites, and simplifies the operation process.
Smart Images

Figure CN2025112308_05032026_PF_FP_ABST
Abstract
Description
Methods and kits for detecting SNP loci genotypes
[0001] This invention was completed with funding from the following project: KCXF Z20211020165547010 "Research and Application of Health Evaluation Technology for Marine Animal Seedlings". Technical Field
[0002] This invention relates to the field of biological detection technology, and more specifically, to a method and kit for detecting SNP locus genotypes. Background Technology
[0003] Single nucleotide polymorphisms (SNPs) are DNA variations occurring at specific loci in the genome, resulting in two or more alleles at the same locus. They are one of the most common forms of genetic variation in humans. These variations occur frequently in the human genome (typically greater than 1%), with an average of one polymorphic site every 500 to 1000 base pairs, and an estimated total of 3 million or more. SNPs are closely related to genetic diseases and play a crucial role in regulating gene expression, determining human phenotypes, and regulating metabolic processes. They explain the heritable inter-individual differences in complex phenotypes and the relationship between genes and diseases, and are associated with disease susceptibility, disease pathogenesis, and individual differences in drug response. Therefore, SNP detection can promote the early diagnosis, prevention, and treatment of genetic diseases and has a guiding role in clinical diagnosis.
[0004] Currently, methods for detecting gene polymorphisms include sequencing, TaqMan probe hydrolysis, PCR-RELF, amplification arrest PCR, molecular beacon methods, and high-resolution melting curve methods. Among these, the TaqMan probe method is the most common detection method in clinical applications, characterized by its simplicity, high sensitivity, and high accuracy. However, this method only utilizes the fluorescence signal generated by fluorescence changes for detection and analysis in one dimension. For each SNP site, two specific probes with different fluorescent labels at both ends need to be designed to identify different alleles. For multiplex detection, due to the limitation of the fluorescence channel, it can only be used for the analysis of a small number of SNP sites, making it difficult to distinguish multiple targets. Furthermore, probe design is relatively difficult for SNP sites that are close to each other.
[0005] Multicolor melting curve analysis combines multicolor fluorescence with melting curve analysis, performing detection and analysis in two dimensions: fluorescence change and Tm value, achieving multiplex detection in a single channel. This method utilizes the Tm value generated by the hybridization of probes with a large number of DNA single strands for melting curve analysis. Therefore, asymmetric PCR is used. By adjusting the concentration ratio of upstream and downstream primers, a large number of single-stranded products complementary to the fluorescent probe are obtained. The asymmetric amplification is combined with the DNA melting temperature to form the characteristic peak of the melting curve. This method avoids the limitations of PCR instrument fluorescence channels in other multiplex detection methods, offering advantages such as high throughput, simple operation, low cost, and reliable accuracy. However, multicolor melting curve analysis still faces many challenges. Because asymmetric amplification is linear, non-exponential amplification is prone to low amplification yield and low sensitivity. Furthermore, optimizing the upstream and downstream primer ratio is difficult, making design challenging. The molecular beacon used in asymmetric melting curves undergoes a process of hairpin structure, free single strand, hybridization double strand, and free single strand during the reaction. The fluorescence signal transitions from weak to strong and from strong to weak, which can easily lead to problems such as uneven baseline and inverted peaks.
[0006] Currently, asymmetric melting curves are widely used in SNP genotyping. This method designs mutation sites onto probes. Since the probes are non-selective, only one probe is designed for each SNP site to distinguish between two genotypes. Genotype differentiation is achieved by using the Tm value of single-base binding to the probe in the same fluorescent channel. For ATGC>GC mutations, the difference in Tm value is easily distinguishable, but for A>T mutations, the difference in Tm value binding is small, making genotype identification difficult. Furthermore, due to limitations in probe temperature and the two peaks per channel, a maximum of 2-3 SNP sites can be designed for each fluorescent channel. This invention designs two specifically modified primers, each labeled with a different fluorescent group. The melting curve peaks in different fluorescent channels are used to distinguish the genotype of the same SNP site, without distinguishing Tm values, allowing for overlap. Therefore, for A>T mutations, differentiation can be achieved simply by the difference in fluorescent channels. For different SNP sites, Tm values are differentiated by controlling the amplicon length and GC content between the two primers. Different melting curve Tm values distinguish different SNP sites, thus increasing the number of detectable SNP sites. Summary of the Invention
[0007] To address the aforementioned technical problems, this invention provides a method for detecting SNP locus genotypes, comprising the following steps: Step 1: Designing three amplification primers for a target containing one SNP locus to be tested: one mutant primer, one wild-type primer, and one common primer; the mutant primer and the common primer are used together to amplify the mutant template, and the wild-type primer and the common primer are used together to amplify the wild-type template; the 3' terminal base of the mutant primer is complementary to or identical to the SNP locus base in the mutant template, and the 3' terminal base of the wild-type primer is complementary to or identical to the SNP locus base in the wild-type template; The Tm value of the mutant primer and the Tm value of the wild-type primer differ within ±2℃. If the Tm value of the mutant primer and the length of the wild-type primer are the same, the mutant primer and the wild-type primer are the same except for the 3' terminal base. If the Tm value of the mutant primer and the length of the wild-type primer are different, the mutant primer and the wild-type primer are the same except for the 3' terminal base, the longer primer has one or two more bases at the 5' end than the shorter primer, and the remaining bases are the same. Step 2: Label the mutant primer and the wild-type primer with two fluorescence channels of different fluorescence. The two fluorescence channels emit low fluorescence (no fluorescence) in single-stranded nucleic acids and high fluorescence (fluorescence) in double-stranded nucleic acids. Step 3: Using the labeled mutant primers, wild-type primers, and the shared primers, PCR amplification is performed on the target containing the SNP locus to be tested. During the PCR extension phase, a fluorescently labeled double-stranded product is formed. During amplification, the sum of the amounts of the mutant primers and wild-type primers is equal to the amount of the shared primers, and symmetrical PCR amplification is performed. Step 4: After the amplification phase is completed, as the temperature increases, the double strands of the amplicon gradually unwind, causing the fluorescence signal intensity to weaken, forming melting peaks in different fluorescence channels. Step 5: The genotype of the SNP locus to be tested is determined based on the melting peak results of different fluorescence channels.
[0008] In this invention, the Tm values of the mutant primers and the wild-type primers differ by within +2°C. Because the two primers differ only by a single base at the 3” end, a difference of more than 2°C in Tm values will result in differences in amplification efficiency at the same annealing temperature, and there may be a risk of primer cross-amplification. That is, the primer with high amplification efficiency will not only amplify its perfectly paired template, but will also competitively amplify another template that differs by only a single base. Therefore, in this invention, the Tm values of the mutant primers and the wild-type primers differ by within +2°C.
[0009] In one embodiment, a method for simultaneous detection of genotypes at multiple SNP loci is provided. The method includes the following steps: Step 1: Design three amplification primers for each target SNP locus among multiple target SNP loci: one mutant primer, one wild-type primer, and one common primer; the mutant primer and the common primer are used together to amplify the mutant template, and the wild-type primer and the common primer are used together to amplify the wild-type template; the 3' terminal base of the mutant primer is complementary to or the same as the base of the SNP locus in the mutant template, and the 3' terminal base of the wild-type primer is complementary to or the same as the base of the SNP locus in the wild-type template; the Tm values of the target amplicon for each target SNP locus are different from each other and are distinguishable. For each SNP site to be tested, the Tm value of the mutant primer and the Tm value of the wild-type primer differ within ±2℃. If the Tm value of the mutant primer and the length of the wild-type primer are the same, the mutant primer and the wild-type primer are identical except for the 3' terminal base. If the Tm value of the mutant primer and the length of the wild-type primer are different, the mutant primer and the wild-type primer are identical except for the 3' terminal base, and the 5' terminal of the longer primer has 1 or 2 more bases than the 5' terminal of the shorter primer. Step 2: Label the mutant primers and wild-type primers for each SNP site to be tested with two different fluorescent channels. The two fluorescent channels emit low fluorescence (no fluorescence) in single-stranded nucleic acids and high fluorescence (high fluorescence) in double-stranded nucleic acids. Step 3: Use the labeled mutant primers, wild-type primers, and the shared primers to amplify the target containing the SNP site to be tested by PCR. During the PCR extension stage, a fluorescently labeled double-stranded product is formed. During amplification, the sum of the amounts of the mutant primers and wild-type primers for each SNP site to be tested is equal to the amount of the shared primers. Symmetrical PCR amplification is performed. Step 4: After the amplification stage is completed, as the temperature increases, the double strands of the amplicon gradually unwind, causing the fluorescence signal intensity to weaken, forming melting peaks with different fluorescent channels and melting peaks with different Tm values. Step 5: Interpret the formed melting peaks. The genotype of each SNP site to be tested is distinguished by the difference in fluorescent channels, and different SNP sites to be tested are distinguished by the difference in Tm values.
[0010] In one embodiment, the Tm value of the mutant primer and / or the Tm value of the wild-type primer is 55-65°C.
[0011] In one embodiment, the ratio of the mass of the mutant primer, the mass of the wild-type primer, and the mass of the common primer for each SNP site to be tested is 1:1:2.
[0012] In one implementation, the Tm value of the amplicon for each SNP site to be tested is 50℃-90℃.
[0013] In one implementation, the Tm values of amplicones from different SNP sites to be tested differ from each other by 2℃ to 10℃.
[0014] In one implementation, the Tm values of amplicones from different SNP sites to be tested differ from each other by 5°C.
[0015] In one embodiment, a kit for use in the above method is provided.
[0016] In one embodiment, a kit is provided for detecting polymorphisms in folate metabolism-related genes using the above method. The kit simultaneously detects the C677T and A1298C sites of the MTHFR gene. The wild-type primer sequence for the C677T site is SEQ ID NO.1: GAGAAGGTGTCTGCGGGAGC, the mutant primer sequence is SEQ ID NO.2: GAGAAGGTGTCTGCGGGAGT, and the common primer sequence is SEQ ID NO.3: TCACCTGGATGGGAAAGATCC. Similarly, the wild-type primer sequence for the A1298C site of the MTHFR gene is SEQ ID NO.4: GGAGGAGCTGACCAGTGAAGA, the mutant primer sequence is SEQ ID NO.5: GGAGGAGCTGACCAGTGAAGC, and the common primer sequence is SEQ ID NO.6: CCCGAGAGGTAAAGAACGAAGAC.
[0017] Traditional asymmetric melting curves design mutation sites onto probes, using the difference in Tm values between probes in a single fluorescent channel to distinguish between wild-type and mutant types. For ATGC>GC mutations, the Tm value difference is easily distinguishable, but for A>T mutations, the difference in probe binding Tm is smaller, making genotype differentiation difficult. Currently, asymmetric melting curves are widely used in SNP genotyping. This method designs mutation sites onto probes. Because the probes are non-selective, only one probe is designed for each SNP site to distinguish between two genotypes. Genotype differentiation is achieved by using the single-base Tm value of probe binding to the single strand in the same fluorescent channel. While the difference in Tm values for ATGC>GC mutations is easily distinguishable, the difference in probe binding Tm for A>T mutations is smaller, making genotype differentiation difficult. Furthermore, due to limitations in probe temperature and the two peaks per channel, a maximum of 2-3 SNP sites can be designed for each fluorescent channel.
[0018] This invention designs two specifically modified primers, each labeled with a different fluorescent group. The melting curve peaks in different fluorescence channels distinguish the genotypes at the same SNP locus, without differentiating based on Tm values, allowing for overlap. Therefore, A>T mutations can be distinguished simply by the difference in fluorescence channels. This invention, by designing two probes with different fluorescence channels that match their respective wild-type / mutant templates, distinguishes between wild-type and mutant genotypes at the same SNP locus, avoiding the problem of indistinguishable Tm values, reducing design complexity, and enabling the specific differentiation of A>T base mutations at the target site.
[0019] Different SNP sites are distinguished by controlling the amplicon length and GC content between the two primers to obtain the Tm value. Different SNP sites are distinguished by the Tm values of different melting curves, thus increasing the number of detectable SNP sites. The molecular beacon used in asymmetric melting curves undergoes a process of hairpin structure, free single strand, hybrid double strand, and free single strand during the reaction. The fluorescence signal has two parts: weak to strong and strong to weak, which can easily lead to problems such as uneven baseline and inverted peaks. The mutant and wild-type primers of this invention use RQA modifications with different fluorescent channels from our company, without the need for quenching groups. Options include BF490 / RQA, BF533 / RQA, BF590 / RQA, and BF648 / RQA. The mutant and wild-type primers can be any combination of two of the above four modifications. The fluorescence used in this invention has low fluorescence emission (no fluorescence) in unstructured single strands and strong fluorescence in double strands, with only a fluorescence change from strong to weak. Therefore, the baseline is smooth and stable, without inverted peaks. In this invention, the increased fluorescence caused by single- or double-strand variations is differentiated by melting curve analysis, achieving distinction based on sequences differing by only a single base. This invention utilizes the principle of amplification retardation, meaning that during amplification, effective polymerization can only occur when the 3' end base of the primer perfectly matches the template under the action of DNA polymerase. Otherwise, the extension reaction will be hindered by the formation of 3',5'-phosphodiester bonds, preventing extension. Primer systems that perfectly match the template, however, can continue to extend. Therefore, the 3' end of the primer is designed with SNP sites to distinguish the mutant template from the wild-type template. By combining our company's fluorescence product with the principle of amplification retardation, the increased fluorescence caused by single- or double-strand variations during extension due to perfect pairing forms a melting curve, achieving single-base differentiation.
[0020] Existing multicolor melting curve methods amplify single-stranded DNA complementary to the probe using asymmetric PCR, where the concentration ratio of upstream and downstream primers is unequal. The amplified single-stranded DNA is then hybridized with the probe for melting curve analysis. This invention employs symmetrical amplification. It designs two specifically modified primers (in the same direction) and one shared primer (in the opposite direction), with the ratio of the two modified primers being the same as the shared primer. Amplification with equal proportions of upstream and downstream primers results in a fluorescently labeled product. This invention utilizes symmetrical amplification, employing a proportional ratio of the specific modified primers and the shared primer, avoiding the linear amplification of asymmetric methods to achieve exponential amplification, thereby improving amplicon yield and sensitivity.
[0021] Due to the limitations of probe temperature and Tm in distinguishing genotypes, the detectable targets of each channel are limited in asymmetric melting. This invention distinguishes only different SNP sites based on the different Tm values of the amplicon, without distinguishing genotypes. Each Tm value represents one SNP site, which increases the number of detectable targets in a single fluorescent channel, thus greatly increasing the number of detectable targets.
[0022] Compared with existing technologies, this invention proposes for the first time a method to distinguish genotypes of the same SNP locus by utilizing melting curve peaks in different fluorescence channels, and to design different melting curve Tm values to distinguish different SNP loci. This invention directly analyzes the melting curves of amplicones after PCR amplification, offering advantages such as high throughput, simple operation, and reliable accuracy. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of this application, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments recorded in this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 is an exemplary effect diagram illustrating the method of the present invention; Figure 2 is a melting curve analysis diagram of MTHFR(677C>T) genotype CC wild type; Figure 3 is a melting curve analysis diagram of MTHFR(677C>T) genotype TT homozygous mutant; Figure 4 is a melting curve analysis diagram of MTHFR(677C>T) genotype CT heterozygous mutant; Figure 5 is a melting curve analysis diagram of MTHFR(1298A>C) genotype AA wild type; Figure 6 is a melting curve analysis diagram of MTHFR(1298A>C) genotype CC homozygous mutant; Figure 7 is a melting curve analysis diagram of MTHFR(1298A>C) genotype AC heterozygous mutant; Figure 8 is a melting curve analysis diagram of two SNP sites both being mutant; Figure 9 is a melting curve analysis diagram of two SNP sites both being wild type. Figure 10 shows the melting curve analysis of MTHFR(677C>T) as wild type and MTHFR(1298A>C) as mutant; Figure 11 shows the melting curve analysis of MTHFR(677C>T) as wild type and MTHFR(1298A>C) as heterozygous; Figure 12 shows an example of the melting curve analysis of MTHFR(677C>T) as heterozygous and MTHFR(1298A>C) as mutant; Figure 13 shows the melting curve analysis of MTHFR(677C>T) as heterozygous and MTHFR(1298A>C) as heterozygous. Detailed Implementation
[0025] To enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are merely some embodiments of this application, and not all embodiments. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this application. Unless otherwise specified, the following embodiments are all conventional methods in the art.
[0026] Example 1: The basic principle of this invention is shown in Figure 1. This invention provides a method for detecting the genotype of an SNP locus. The method includes the following steps: Step 1: Design three amplification primers for a target containing one SNP locus to be tested: one mutant primer, one wild-type primer, and one common primer; the mutant primer and the common primer are used together to amplify the mutant template, and the wild-type primer and the common primer are used together to amplify the wild-type template; the 3' terminal base of the mutant primer is complementary to or the same as the SNP locus base in the mutant template, and the 3' terminal base of the wild-type primer is complementary to or the same as the SNP locus base in the wild-type template.
[0027] In a preferred embodiment, the Tm values of the three amplification primers are controlled at 55-65℃.
[0028] The Tm value of the mutant primer and the wild-type primer should differ by ±2°C. Since the two primers differ only in the single base at their 3' ends, a difference exceeding 2°C in Tm values will result in different amplification efficiencies at the same annealing temperature, potentially leading to primer cross-amplification. This means the primer with higher amplification efficiency may not only amplify its perfectly paired template but also competitively amplify another template with only a single base difference. If the mutant primer's Tm value and the wild-type primer have the same length, and the mutant primer and the wild-type primer are identical except for the 3' end base, then if the mutant primer's Tm value and the wild-type primer are different in length, and the mutant primer has one or two more bases at its 5' end than the shorter primer, and the remaining bases are identical, then the mutant primer and the wild-type primer are identical.
[0029] Step 2: Label the mutant primer and the wild-type primer with two fluorescent channels, respectively. The two fluorescent channels exhibit low fluorescence emission (no fluorescence) in single-stranded nucleic acids and high fluorescence emission (high fluorescence) in double-stranded nucleic acids. The mutant primer and the wild-type primer can be modified with commercially available RQA converters of different fluorescent channels without the need for quenching groups. Options include BF490 / RQA, BF533 / RQA, BF590 / RQA, and BF648 / RQA. The mutant primer and the wild-type primer can be any combination of two of the above four modifications.
[0030] Step 3: Using the labeled mutant primers, wild-type primers, and the common primers, PCR amplification is performed on the target containing the SNP site to be tested. During the PCR extension stage, a fluorescently labeled double-stranded product is formed. During amplification, the sum of the amounts of the mutant primers and wild-type primers is equal to the amount of the common primers, and symmetrical PCR amplification is performed.
[0031] Step 4: After the amplification stage, as the temperature increases, the double strands of the amplicon gradually unwind, causing the fluorescence signal intensity to weaken and forming melting peaks in different fluorescence channels. After PCR amplification, the primer set forms amplicones carrying different fluorescent molecules. During the melting curve analysis stage, as the temperature increases, the double strands of the amplicon gradually unwind, causing the fluorescence signal intensity to weaken and forming melting peaks with different Tm values. For the same SNP locus, melting curve peaks in different fluorescence channels are used to distinguish genotypes (wild type, homozygous mutant, and heterozygous mutant).
[0032] Step 5: Determine the genotype of the SNP site to be tested based on the melting peak results of different fluorescence channels.
[0033] A method for simultaneous detection of genotypes at multiple SNP loci is provided, comprising the following steps: Step 1: Design three amplification primers for each target SNP locus containing multiple target SNP loci: one mutant primer, one wild-type primer, and one common primer; the mutant primer and the common primer are used together to amplify the mutant template, and the wild-type primer and the common primer are used together to amplify the wild-type template; the 3' terminal base of the mutant primer is complementary to or identical to the base of the SNP locus in the mutant template, and the 3' terminal base of the wild-type primer is complementary to or identical to the base of the SNP locus in the wild-type template; the Tm values of the target amplicon for each target SNP locus are different from each other and are distinguishable. The Tm values of the amplicon from the mutant primer, wild-type primer, and common primer are controlled during the design, and the differences in Tm values caused by the length of the amplicon and the GC content of the bases are used to distinguish different SNP loci.
[0034] For each SNP site to be tested, the Tm value of the mutant primer and the Tm value of the wild-type primer differ within ±2℃. If the Tm value of the mutant primer and the length of the wild-type primer are the same, the mutant primer and the wild-type primer are the same except for the 3' terminal base. If the Tm value of the mutant primer and the length of the wild-type primer are different, the mutant primer and the wild-type primer are the same except for the 3' terminal base. The 5' terminal of the longer mutant primer and the wild-type primer has 1 or 2 more bases than the 5' terminal of the shorter primer. The remaining bases of the mutant primer and the wild-type primer are the same.
[0035] Step 2: Label each of the mutant and wild-type primers for the SNP site to be tested with two different fluorescent channels. The two fluorescent channels exhibit low fluorescence emission (no fluorescence) in single-stranded nucleic acids and high fluorescence emission in double-stranded nucleic acids. The mutant and wild-type primers can be modified with commercially available RQA primers of different fluorescent channels without the need for quenching groups. Options include BF490 / RQA, BF533 / RQA, BF590 / RQA, and BF648 / RQA. The mutant and wild-type primers can be any combination of two of the above four modifications.
[0036] Step 3: Using the labeled mutant primers, wild-type primers, and the common primers, PCR amplification is performed on the target containing the SNP site to be tested. During the PCR extension stage, a fluorescently labeled double-stranded product is formed. During amplification, the sum of the amounts of the mutant primers and wild-type primers for each SNP site to be tested is equal to the amount of the common primers, and symmetrical PCR amplification is performed.
[0037] Step 4: After the amplification stage, as the temperature rises, the double strands of the amplicon gradually unwind, causing the fluorescence signal intensity to weaken and forming melting peaks with different fluorescence channels and different Tm values. For different SNP sites, amplicons with different melting curve Tm values are designed based on the differences in amplicon length and base composition. Melting curve analysis is performed on the amplicones, and the differences in amplicon Tm values are used to distinguish different polymorphic sites.
[0038] Step 5: Interpret the formed melting peaks. Differentiate the genotype of each SNP site by the difference in fluorescence channels, and differentiate different SNP sites by the difference in Tm values.
[0039] Example 2: Genotyping of the MTHFR C677T locus I. Primer design
[0040] The primer set used in this invention to detect the MTHFR C677T site is shown in Table 1. The mutant primer is labeled BF490 / RQA, and the wild-type primer is labeled BF533 / RQA. The Tm values of the mutant primer and the wild-type primer are 61.54 and 61.17, respectively, and the amplicon length is 76 bp.
[0041] Table 1 Primer sequences for the MTHFR C677T site
[0042] II. PCR Amplification Reaction System and Procedure The amount of MTHFR-C677T-Fmut primers used is the same as that of MTHFR-C677T-Fwt primers, and the total amount used is the same as that used for MTHFR C677T-R primers. The ratio of MTHFR-C677T-Fmut primers:MTHFR-C677T-Fwt primers:MTHFR C677T-R primers is 1:1:2. The components of the PCR reaction solution targeting the MTHFR C677T site are prepared as shown in Table 2: Table 2: Components and Amounts of MTHFR C677T Site Reaction Solution
[0043] MTHFR C677T site PCR amplification program: 55℃ for 2 min, 95℃ pre-denaturation for 5 min, followed by 95℃ for 15 s denaturation, 58℃ for 30 s annealing, and 72℃ for 20 s extension (40 cycles), with fluorescence collected during the annealing phase; 95℃ pre-denaturation for 2 min; 65℃ for 5 min, with fluorescence collected from 65℃ to 95℃ for melting curve analysis (heating rate: 0.15℃ / s), using FAM and HEX fluorescence channels.
[0044] III. Melting Curve Analysis Table 3 Interpretation of Melting Curve Results
[0045] Table 3 shows that, for the MTHFR C677T site, the FAM channel at T m When a melting peak appears at 80±1.5℃, and no melting peak appears in the HEX channel, the genotype is determined to be the TT homozygous mutant. See Figure 2 for specific melting curve results; the HEX channel at T... m When a melting peak appears at 80±1.5℃ and the FAM channel shows no amplification, the genotype is determined to be AA wild-type (see Figure 3); while the FAM channel shows a melting peak at T... m A melting peak appears at a value of 80±1.5℃, while the HEX channel shows a peak at T. m The peak value was observed at 80±1.5℃, indicating that the genotype was a CT heterozygous mutant, as shown in Figure 4.
[0046] Example 3: Genotyping of the MTHFR A1298C locus
[0047] I. Primer Design The primer set for detecting the MTHFR A1298C site in this invention is shown in Table 4. The amplicon length is 56 bp, and the Tm values of the mutant primer and the wild-type primer are 61.00 and 61.56, respectively.
[0048] Table 4 Primer sequences of the MTHFR A1298C site
[0049] II. PCR Amplification Reaction System and Procedure The ratio of MTHFR A1298C-Fwt primers to MTHFR A1298C-Fmut primers is 1:0.3, and the total amount used is the same as the amount of MTHFR A1298C-R primers. The ratio of MTHFR A1298C-Fwt primers:MTHFR A1298C-Fmut primers:MTHFR A1298C-R primers is 1:0.3:1.3. The components of the PCR reaction solution targeting the MTHFR C677T locus are prepared as shown in Table 5: Table 5: Components and Amounts of MTHFR A1298C Locus Reaction Solution
[0050] III. Melting Curve Analysis Table 6 Interpretation of Melting Curve Results
[0051] For the MTHFR A1298C site, the FAM channel in T m The peak eluted at 77±1.5℃, and the HEX channel showed no melting peak, indicating a homozygous CC mutant genotype (see Figure 5). Only the HEX channel showed a peak at T... m If the peak appears at 75±1.5℃, the genotype is interpreted as AA wild-type (see Figure 6); if both FAM and HEX peak at their respective positions, the result is interpreted as AC heterozygous mutant (see Figure 7).
[0052] Example 4: MTHFR A1298C locus and A1298C dual locus genotyping
[0053] I. PCR Amplification Reaction System and Procedure: MTHFR C677T site primer ratio: MTHFR-C677T-Fmut primer: MTHFR-C677T-Fwt primer: MTHFR C677T-R primer = 1:1:2; MTHFR A1298C site primer ratio is preferably MTHFR A1298C-Fwt primer: MTHFR A1298C-Fmut primer: MTHFR A1298C-R primer = 1:0.3:1.3. The components of the multiplex PCR reaction solution are prepared as shown in Table 7.
[0054] Table 7. Components and dosages of MTHFR C677T and MTHFR A1298C multiplex reaction solutions
[0055] Two-site PCR amplification program: 55℃ for 2 min, 95℃ pre-denaturation for 5 min, followed by 95℃ for 15 s denaturation, 58℃ for 30 s annealing, and 72℃ for 20 s extension (40 cycles), with fluorescence collected during the annealing phase; 95℃ pre-denaturation for 2 min; 65℃ for 5 min, with fluorescence collected from 65℃ to 95℃ for melting curve analysis (heating rate: 0.15℃ / s), using FAM and HEX fluorescence channels.
[0056] II. Melting Curve Analysis: For the single-tube detection of MTHFR A1298C and C677T sites, the melting curve results of the random template are shown in Figures 8-13. If the FAM channel shows a peak at the corresponding position and the HEX channel shows no melting peak, then both sites are homozygous mutants (Figure 8); if the HEX channel shows a peak at the corresponding position and the FAM channel shows no melting peak, then both sites are wild-type (Figure 9); if the FAM channel shows a peak at 77±1.5℃ and the HEX channel shows a peak at 80±1.5℃, then the A1298C site is a homozygous mutant and the C677T site is wild-type (Figure 10); if the FAM channel shows a peak at 77±1.5℃ and the HEX channel shows a peak at 75±1.5℃, then the A1298C site is a homozygous mutant and the C677T site is wild-type (Figure 10); if the FAM channel shows a peak at 77±1.5℃ and the HEX channel shows a peak at 75±1.5℃, then the A1298C site is a homozygous mutant and the C677T site is wild-type. If the peak is observed at 1.5℃ and HEX shows a melting peak at 80±1.5℃, then the A1298C site is a heterozygous mutant and C677T is a wild type (Figure 11); if the FAM channel shows a peak at 77±1.5℃ and both FAM and HEX channels show peaks at 80±1.5℃, then the A1298C site is a homozygous mutant and C677T is a heterozygous mutant (Figure 12); if both FAM and HEX show peaks at their respective positions, then the A1298C site is heterozygous and C677T is a heterozygous mutant (Figure 13).
[0057] Table 8 Interpretation of Fluorescence Melting Curve Results
[0058] It should be understood that the disclosed invention is not limited to the specific methods, schemes, and substances described, as these are all subject to variation. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to limit the scope of the invention, which is limited only by the appended claims.
[0059] Those skilled in the art will also recognize, or be able to identify, many equivalents of the specific embodiments of the invention described herein using no more than conventional experiments. These equivalents are also included in the appended claims.
Claims
1. A method for detecting SNP locus genotypes, characterized in that, The method includes the following steps: Step 1: Design three amplification primers for a target containing one SNP site to be tested: one mutant primer, one wild-type primer, and one common primer; the mutant primer and the common primer are used together to amplify the mutant template, and the wild-type primer and the common primer are used together to amplify the wild-type template; the 3' terminal base of the mutant primer is complementary to or the same as the SNP site in the mutant template, and the 3' terminal base of the wild-type primer is complementary to or the same as the SNP site in the wild-type template. The Tm value of the mutant primer and the Tm value of the wild-type primer differ within ±2℃. If the Tm value of the mutant primer and the length of the wild-type primer are the same, the mutant primer and the wild-type primer are the same except for the 3' terminal base. If the Tm value of the mutant primer and the length of the wild-type primer are different, the mutant primer and the wild-type primer are the same except for the 3' terminal base, and the 5' terminal of the longer primer has 1 or 2 more bases than the 5' terminal of the shorter primer. Step 2: Label the mutant primer and the wild-type primer with two different fluorescent channels, respectively. The two fluorescent channels emit low fluorescence (no fluorescence) in single-stranded nucleic acids and emit high fluorescence (fluorescence) in double-stranded nucleic acids. Step 3: Using the labeled mutant primers, wild-type primers, and the common primers, PCR amplification is performed on the target containing the SNP site to be tested. During the PCR extension stage, a fluorescently labeled double-stranded product is formed. During amplification, the sum of the amounts of the mutant primers and the wild-type primers is equal to the amount of the common primers, and symmetrical PCR amplification is performed. Step 4: After the amplification stage is completed, as the temperature rises, the double strands of the amplicon gradually unwind, causing the fluorescence signal intensity to weaken and forming melting peaks in different fluorescence channels. Step 5: Determine the genotype of the SNP site to be tested based on the melting peak results of different fluorescence channels.
2. A method for simultaneous detection of genotypes at multiple SNP loci, characterized in that, The method includes the following steps: Step 1: Design three amplification primers for each of the multiple SNP sites to be tested: one mutant primer, one wild-type primer, and one common primer. The mutant primer and the common primer are used together to amplify the mutant template, and the wild-type primer and the common primer are used together to amplify the wild-type template. The 3' terminal base of the mutant primer is complementary to or the same as the base of the SNP site in the mutant template, and the 3' terminal base of the wild-type primer is complementary to or the same as the base of the SNP site in the wild-type template. The Tm values of the target amplicon for each SNP site to be tested are different from each other and are distinguishable. For each SNP site to be tested, the Tm value of the mutant primer and the Tm value of the wild-type primer differ within ±2℃. If the Tm value of the mutant primer and the length of the wild-type primer are the same, the mutant primer and the wild-type primer are identical except for the 3' terminal base. If the Tm value of the mutant primer and the length of the wild-type primer are different, the mutant primer and the wild-type primer are identical except for the 3' terminal base, and the 5' terminal of the longer primer has 1 or 2 more bases than the 5' terminal of the shorter primer. Step 2: Label each of the mutant primers and wild-type primers for each SNP site to be tested with two different fluorescent channels. The two fluorescent channels emit low fluorescence (no fluorescence) in single-stranded nucleic acids and emit high fluorescence (fluorescence) in double-stranded nucleic acids. Step 3: Using the labeled mutant primers, wild-type primers, and the common primers, PCR amplification is performed on the target containing the SNP site to be tested. During the PCR extension stage, a fluorescently labeled double-stranded product is formed. During amplification, the sum of the amounts of the mutant primers and wild-type primers for each SNP site to be tested is equal to the amount of the common primers, and symmetrical PCR amplification is performed. Step 4: After the amplification stage is completed, as the temperature rises, the double strands of the amplicon gradually unwind, causing the fluorescence signal intensity to weaken, forming melting peaks of different fluorescence channels and melting peaks of different Tm values. Step 5: Interpret the formed melting peaks. Differentiate the genotype of each SNP site by the difference in fluorescence channels, and differentiate different SNP sites by the difference in Tm values.
3. The method according to claim 1 or 2, characterized in that, The Tm value of the mutant primer and / or the Tm value of the wild-type primer are 55-65℃.
4. The method according to claim 1 or 2, characterized in that, The ratio of the mass of the mutant primer, the mass of the wild-type primer, and the mass of the common primer for each SNP site to be tested is 1:1:
2.
5. The method according to claim 1 or 2, characterized in that, The Tm value of the amplicon for each SNP locus to be tested is 50℃-90℃.
6. The method according to claim 2, characterized in that, The Tm values of amplicones from different SNP sites can differ by 2℃-10℃.
7. The method according to claim 6, characterized in that, The Tm values of amplicones from different SNP sites differed by 5°C.
8. A kit for use in the method of any one of claims 1-7.
9. A kit for detecting polymorphisms in folic acid metabolism-related genes using the method described in any one of claims 1-6, characterized in that, The kit simultaneously detects the C677T and A1298C sites of the MTHFR gene. The wild-type primer sequence for detecting the C677T site is SEQ ID NO.1: GAGAAGGTGTCTGCGGGAGC, the mutant primer sequence is SEQ ID NO.2: GAGAAGGTGTCTGCGGGAGT, and the common primer sequence is SEQ ID NO.3: TCACCTGGATGGGAAAGATCC. The wild-type primer sequence for the A1298C site of the MTHFR gene is SEQ ID NO.4: GGAGGAGCTGACCAGTGAAGA, the mutant primer sequence is SEQ ID NO.5: GGAGGAGCTGACCAGTGAAGC, and the common primer sequence is SEQ ID NO.6: CCCGAGAGGTAAAGAACGAAGAC.
Citation Information
Patent Citations
Melting curve analysis method of single nucleotide polymorphism
CN104004823A
Method for determining genotype of allele by detecting SNP sites
CN110607364A
Primer combination for detecting MTHFR gene polymorphism, kit and detection method thereof
CN112662751A
Primer probe combination, kit and method for SNP (Single Nucleotide Polymorphism) site detection
CN114277108A
Method for detecting mutation of multiple gene loci by using fluorescent quantitative PCR (Polymerase Chain Reaction)
CN114317697A