Aptamer-drug conjugate with high drug loading ratio and use thereof

Abstract

Provided in the present invention are an aptamer-drug conjugate with a high drug loading ratio and the use thereof. By means of using a linker with dendritic structural characteristics combined with highly efficient solid-phase synthesis and click chemistry reactions, the designable and efficient synthesis of the aptamer-drug conjugate with a high drug loading ratio is achieved. The aptamer-drug conjugate exhibits excellent tumor inhibitory activity for use in resisting tumors. Furthermore, for different drugs, aptamer-drug conjugates with different drug loading ratios can be designed to obtain higher therapeutic efficacy. The aptamer-drug conjugate also exhibits excellent anti-tumor effects against malignant tumors such as lung cancer, colorectal cancer, breast cancer, and ovarian cancer, with a tumor inhibitory efficiency exceeding 90%.

Description

A high drug loading ratio nucleic acid aptamer conjugate drug and its application This application claims priority to the earlier Chinese application, application number: 202411216202X, application date: August 30, 2024. Technical Field This invention belongs to the field of biotechnology, and more specifically, relates to a high drug loading ratio nucleic acid aptamer conjugate drug and its application. Background Technology

[0001] Drug conjugates, especially antibody-drug conjugates (ADCs), have attracted widespread industry attention due to their clinical results and potential commercial value fueling mergers and acquisitions among companies. Technological advancements have also led to a clash between old and new concepts in drug conjugates, even posing challenges to current concepts and technologies.

[0002] Nucleic acid aptamer conjugates (NAPs) are highly promising conjugates due to their ease of chemical synthesis and modification. Currently known NAPs are primarily those with a drug loading ratio of 1. High drug loading ratio NAPs are mainly achieved by synthesizing a high drug loading ratio precursor and conjugating it to the NAP. However, the synthesis of high drug loading ratio precursors is complex, and their poor water solubility leads to low conjugation efficiency with the NAP. Therefore, there is an urgent need to find a high drug loading ratio NAP that can precisely control the drug loading ratio for efficient conjugation while significantly improving efficacy to meet clinical needs. Summary of the Invention To address the aforementioned issues, this invention provides a high drug-load ratio nucleic acid aptamer conjugate drug and its applications. By employing a linker with a tree-like structure and combining efficient reactions of solid-phase synthesis and click chemistry, the high drug-load ratio nucleic acid aptamer conjugate drug can be designed and synthesized efficiently. It exhibits high antitumor activity in antitumor applications. Furthermore, for different drugs, nucleic acid aptamer conjugate drugs with different drug-load ratios can be designed to improve efficacy. It demonstrates excellent antitumor effects against malignant tumors such as colorectal cancer, breast cancer, lung cancer, and ovarian cancer, with an antitumor efficiency exceeding 90%. On one hand, the present invention provides a nucleic acid aptamer-conjugated drug with high drug loading capacity, wherein the nucleic acid aptamer-conjugated drug is prepared by conjugating a drug with a multi-conjugation site nucleic acid aptamer; the multi-conjugation site nucleic acid aptamer includes a nucleic acid aptamer and a dendritic phosphorus amide monomer, wherein the 3' and / or 5' end of the nucleic acid aptamer is connected to the dendritic phosphorus amide monomer, and the end connected to the dendritic phosphorus amide monomer has one or more active groups selected from thiol, amino, DBCO, azide, and maleimide; the dendritic phosphorus amide monomer includes any one or more of Phosphoramidite 1, Phosphoramidite 2, and Phosphoramidite 3, wherein Phosphoramidite 1, Phosphoramidite 2, and Phosphoramidite 3 respectively have the following structural formulas: Where x = any integer from 1 to n; y = any integer from 1 to n; z = any integer from 1 to n. Existing high-drug-ratio nucleic acid aptamer conjugates suffer from low conjugation efficiency, making precise and efficient drug-drug conjugation difficult. This invention utilizes a linker with a tree-like structure and employs nucleic acid solid-phase synthesis technology to synthesize nucleic acid aptamer conjugates with precisely controllable drug loading ratios. Phosphate ester bonds serve as the linker backbone, improving drug water solubility and thus enhancing conjugation efficiency. The IC50 of the prepared high-drug-ratio nucleic acid aptamer conjugate is significantly lower than that of a single-loaded nucleic acid aptamer conjugate (e.g., for SKOV-3 ovarian cancer cells, the IC50 is more than 8 times lower than that of a single-loaded nucleic acid aptamer conjugate). The drug-load ratio-controlled nucleic acid aptamer conjugate provided by this invention specifically comprises a nucleic acid portion, an intermediate tree-shaped linker portion, and a cytotoxic drug portion. The nucleic acid aptamer portion is a nucleic acid aptamer capable of recognizing tumor cell-related targets; the linker portion is a linker with a bifurcation or trifurcation structure synthesized based on solid-phase nucleic acid synthesis; and the cytotoxic drug portion is a commonly used cytotoxic drug conjugate, such as aurestatin microtubule inhibitors or their derivatives, or eczema or its derivatives. The drug-load ratio-controlled nucleic acid aptamer conjugate provided by this invention can be used to construct nucleic acid aptamer conjugates containing 2, 3, 4, 6, and 8 drugs, and can be used for the treatment of malignant tumors. Dendritic phosphoramidite monomers, including bifid monomers (Phosphoramidite 1 or Phosphoramidite 2), trifid monomers (Phosphoramidite 3), or combinations thereof, are used to construct multi-coupling site aptamers using solid-phase synthesis. The solid-phase synthesis method for multi-coupling site aptamers is as follows: Aptamers are synthesized using a solid-phase synthesizer. After the solid-phase synthesis of the aptamers is complete, aptamers with two coupling sites are prepared following the same solid-phase synthesis method. Specific procedures are as follows: 1. Prepare a 3% trichloroacetic acid / dichloromethane solution to remove the 4,4′-dimethoxytriphenylmethyl protecting group from the 5-terminal hydroxyl group of the nucleic acid chain. After the reaction, wash away the residual reagents with dehydrated acetonitrile. 2. Prepare a solution of the bifurcated linker phosphoramidite monomer, dissolved in dehydrated acetonitrile to a concentration of 0.1 M. Tetrazolium is selected as the activator, dissolved in dehydrated acetonitrile to a concentration of 0.5 M. The monomer and tetrazolium are mixed at a volume ratio of 2:3 and then the coupling reaction is carried out. After the reaction is completed, the residual reagents are washed away with dehydrated acetonitrile. 3. Prepare a 0.05M iodine solution using a pyridine / tetrahydrofuran solution (1:3 volume ratio) as the solvent. This solution is used to oxidize the trivalent phosphate bond formed by base coupling to a pentavalent phosphate bond. After the reaction is complete, wash away any residual reagents with anhydrous acetonitrile. After completing the above steps, a product containing two hydroxyl sites is obtained, and the thiol group is coupled according to the solid-phase synthesis method. 4. Prepare a 3% trichloroacetic acid / dichloromethane solution to remove the 4,4′-dimethoxytriphenylmethyl protecting group from the 5-terminal hydroxyl group of the nucleic acid chain. After the reaction, wash away the residual reagents with dehydrated acetonitrile. 5. Prepare a mercaptophosphoramide monomer solution by dissolving it in dehydrated acetonitrile to a concentration of 0.1 M. Tetrazolium is selected as the activator and dissolved in dehydrated acetonitrile to a concentration of 0.5 M. The monomer and tetrazolium are mixed at a volume ratio of 2:3 and then the coupling reaction is carried out. After the reaction is completed, the residual reagents are washed away with dehydrated acetonitrile. 6. Repeat the coupling reaction in step two once. 7. Prepare a 0.05M iodine solution using a pyridine / tetrahydrofuran solution (1:3 volume ratio) as the solvent. This solution is used to oxidize the trivalent phosphate bond formed by base coupling to a pentavalent phosphate bond. After the reaction is complete, wash away any residual reagents with anhydrous acetonitrile. After completing the above steps, a product with thiol-protected dual coupling sites is obtained. Subsequently, the nucleic acid aptamer is cleaved and removed from the solid support, and the disulfide bond is reduced and purified using TCEP to obtain the nucleic acid aptamer with dual coupling sites. Preparation process of nucleic acid aptamers with dual coupling sites The preparation of aptamers with four or more coupling sites is similar to that with two coupling sites. Coupled with two bifurcation linkers, a aptamer with four coupling sites is obtained; coupled with three bifurcation linkers, an aptamer with eight coupling sites is obtained; coupled with one bifurcation linker and one trifurcation linker, a aptamer with six coupling sites is obtained, and so on. Preparation process of nucleic acid aptamers with four coupling sites Furthermore, the nucleic acid aptamer targets any one or more of the following antigens: CD5, CD19, CD20, CD25, CD37, CD30, CD33, CD45, CAMPATH-1, HLD-DR, CEA, TAG-72, EpCAM, MUC1, MUC15, folate-binding protein, A33, G250, PSMA, ferritin, GD2, GD3, GM2, Leg, CA-125, CA19-9, epidermal growth factor, p185HER2, IL-2 receptor, tenascin, a metalloproteinase, endosialin, vascular endothelial growth factor, avB3, WT1, LMP2, HPV E6, HPV E7, EGFRvIII, Her-2 / neu, MAGE A3, p53 nonmutant, NY-ESO-1, MelanA / MART1, Ras mutant, gp100, p53 mutant, PR1, bcr-abl, tyrosinase, survivin, PSA, hTERT, a Sarcoma translocation breakpoint fusion protein, EphA2, PAP, ML-IAP, AFP, ERG, NA17, PAX3, ALK, androgen receptor, cyclin Bl, polysialic acid, MYCN, RhoC, TRP-2, fucosyl GM1, MSLN, PSCA, MAGE Al, MAGE-A3, sLe, CYP1B1, PLAV1, GM3, BORIS, Tn, GloboH, ETV6-AML, NY-BR-1, RGS5, SART3, STn, Carbonic anhydrase IX, PAX5, OY-TESL Sperm protein 17, LCK, HMWMAA, AKAP-4, 55X2, XAGE 1, B7H3, Legumain, Tie 3. Page4, VEGFR2, MAD-CT-1, PDGFR-B, MAD-CT-2, ROR2, CMET, HER3, EPCAM, CA6, NAPI2B, TROP2, CLDN18.2. FAP, RON, LY6E, FRA, DLL3, PTK7, LIV1, ROR1, Fos-related antigen 1, VEGFR, endoglin, PD-L1, CD204, CD206, CD301, VTCN1, VISTA. . Furthermore, the drug includes any one or more of auristatin E, Dxd, ethanotine, or derivatives having the same or similar core structure as auristatin E, Dxd, or ethanotine. Furthermore, the number of coupling sites of the multi-coupling site aptamer is 2, 3, 4, 6, or 8. Furthermore, the linker is attached to the 5' end of the nucleic acid aptamer. This invention compares two drugs simultaneously linked to both ends of a nucleic acid, and drugs linked to the 5' and 3' ends using a bifurcated linker. The comparison shows that using a bifurcated linker to the 5' end of the nucleic acid aptamer significantly improves the stability of the peptide linker vitamin C in mouse plasma. Furthermore, when the drug is Dxd, the number of coupling sites of the multi-coupling site aptamer is 4; when the drug is ethiophene, the number of coupling sites of the multi-coupling site aptamer is 2 or 4; when the drug is aurestatin E, the number of coupling sites of the multi-coupling site aptamer is 2 or 4. Studies have shown that when treating different cancers with different drugs, it is necessary to select the appropriate drug loading ratio of nucleic acid aptamer conjugates in order to truly enhance the effect of inhibiting tumor activity. For example, when the drug Dxd (Deruxtecan) is used to treat colorectal cancer, at the same drug concentration (with the drug equivalent concentration in each structure remaining consistent), a number of coupling sites of 4 significantly improves efficacy compared to other numbers of coupling sites (including 1, 2, 3, 6, 8, etc.). This may be because the S4D structure with 4 coupling sites is optimal in terms of steric hindrance or synergistic effects between drugs, making it particularly suitable for the treatment of colorectal cancer. It can maximize the efficacy of Dxd, and when used to treat colorectal cancer, the efficacy of S4D can exceed that of the same concentration of eczema (EXA), while no other Dxd structure can achieve this effect. When the drug is ethiotecan or auristatin, there is no significant difference in efficacy when the number of conjugation sites is 2 or 4 for the treatment of lung adenocarcinoma or colon cancer. However, the effect is improved compared to the case with 1 site. Therefore, it is preferred to use a number of conjugation sites of 2 or 4. Furthermore, when the drug is Dxd, the nucleic acid aptamer-conjugated drug is S4D, whose structural formula is: Furthermore, when the drug is eczemab, the nucleic acid aptamer-conjugated drug is S2E or S4E, and the structural formula of S2E is: The structural formula of S4E is: Furthermore, when the drug is auristatin E, the nucleic acid aptamer-conjugated drug is S2M or S4M, and the structural formula of S2M is: The structural formula of S4M is: On the other hand, the present invention provides the use of a nucleic acid aptamer-conjugated drug in the preparation of a reagent to enhance the tumor-suppressive effect of colon cancer, wherein the nucleic acid aptamer-conjugated drug is S4D, and its structural formula is: Furthermore, this invention provides the use of a nucleic acid aptamer-conjugated drug in the preparation of a reagent that enhances the efficacy of the DNA topoisomerase I inhibitor Dxd, thereby surpassing the in vivo tumor-suppressing effect of eczemab, wherein the nucleic acid aptamer-conjugated drug is S4D, and its structural formula is: In another aspect, the present invention provides the use of a high drug loading ratio nucleic acid aptamer-conjugated drug in the preparation of a reagent to improve the therapeutic effect of malignant tumor cell models. In some embodiments, the malignant tumor cell models include cell xenograft models or PDX models that highly express target nucleic acid aptamer proteins, such as lung cancer, breast cancer, liver cancer, gastric cancer, pancreatic cancer, colorectal cancer, thyroid cancer, prostate cancer, ovarian cancer, neuroblastoma, and glioma. Furthermore, this invention provides a method for preparing nucleic acid aptamer-conjugated drugs with precisely controllable drug loading ratios, the method comprising: (1) Synthesis of nucleic acid aptamers with multiple coupling sites based on solid-phase synthesis; (2) Efficient and precise construction of nucleic acid aptamer conjugates with high drug loading ratio. Furthermore, research on the antitumor applications of nucleic acid aptamer conjugates with high drug loading ratios is also included. The multiple coupling site nucleic acid aptamers use one or a mixture of several of the dendritic (branched) phosphoramidite monomers (Phosphoramidite 1-3), and are synthesized using a nucleic acid solid-phase synthesizer, with active groups such as thiol, amino, DBCO, azide, and maleimide introduced at the ends for drug coupling. In some approaches, the reaction sites of multi-coupling site nucleic acid aptamers include one of the active groups such as thiol, maleimide, azide, alkyne, amino, and carboxyl. In some methods, the isolation and purification of the multi-coupling site aptamers are performed using one or a combination of methods selected from high-performance liquid chromatography, size exclusion chromatography, and gel electrophoresis. In some methods, the separation and purification of the high drug loading ratio nucleic acid aptamer conjugate is performed using one or a combination of methods selected from high performance liquid chromatography, size exclusion chromatography, and gel electrophoresis. In some methods, multi-coupling site aptamers are efficiently coupled to drug molecules via reactions such as thiol-maleimide, amino-carboxyl, and DBCO-azide; specific synthetic methods are as follows: For the synthesis of auristatin drugs, an aqueous solution (1 equivalent) of a terminal thiol-modified multi-conjugation site aptamer and a 1 / 1 mixture of acetonitrile / water (2-6 equivalents, preferably 3 equivalents) of auristatin microtubule inhibitor were added to centrifuge tubes. The temperature was maintained at 4-40°C, preferably 37°C, and the reaction was stirred for 2-24 hours, preferably 16 hours. The mixture was purified by reverse-phase preparative column chromatography and freeze-dried to obtain a high drug loading ratio aptamer-conjugated drug with a yield of approximately 70%. After desalting, the drug was freeze-dried for later use. For ixenoclax drugs, an aqueous solution (1 equivalent) of a terminal thiol-modified multi-conjugation site aptamer is added to a centrifuge tube. For the ixenoclax drug itself, an aqueous solution (2-20 equivalents, preferably 12 equivalents) containing 20%-60% organic phase is used. The organic phase can be acetonitrile, dimethylformamide, dimethyl sulfoxide, dimethylacetamide, or a combination thereof. The temperature is maintained at 4-40 degrees Celsius, preferably 37 degrees Celsius, and the reaction is stirred for 1-24 hours, preferably 16 hours. The mixture is purified using a reverse-phase preparative column, freeze-dried to obtain the multi-loaded conjugated drug, with a yield of approximately 60%. After desalting, it is freeze-dried for later use. In some methods, the high drug loading ratio nucleic acid aptamer-conjugated drug is used in experiments on the binding and proliferation inhibition of malignant cells, for example: Human ovarian cancer cells SKOV-3 were seeded into 96-well plates (4000 cells per well) and cultured at 37°C with 5% CO2 for 24 hours. Medium containing the same drug concentration but different drug loading ratios of aptamer-conjugated drugs SD, S2D, and S4D was then added. After culturing at 37°C with 5% CO2 for 24 hours, the drug-containing medium was discarded, and the cells were cultured in drug-free medium for another 108 hours. The inhibitory effect of the drugs was measured using an MTS kit after a total of 120 hours. In some methods, the high drug loading ratio nucleic acid aptamer-conjugated drug is used to inhibit malignant tumor xenograft models, for example: The mouse model used female Balb / c nude mice, with 5 million human colon cancer HT29 cells per mouse, injected subcutaneously into the right hind limb. After 15 days, the tumor volume reached approximately 50-150 mm. 3The mice were randomly divided into two groups. Both groups received intravenous injections of saline (Saline) or S4M (an aptamer-conjugated drug with a drug loading ratio of 4) every four days, at a dose of 2.5 nmol DNA or 0.5 mg / kg MMAE per mouse, respectively. At each injection, the mice's body weight, tumor length (a), and tumor width (b) were measured and recorded. The tumor volume (V) was calculated using the formula: V = (a × b) / (a ​​× b) 2 ) / 2. The experiment was terminated when the tumor volume exceeded 1000 mm3 or the body weight decreased by more than 15%. Mice were euthanized. The reverse-phase preparation column purification, desalting, seeding, tail vein administration, flow cytometry, and cell transplantation involved in each step of the method described in this invention are all conventional methods in the field, and can be determined by those skilled in the art in combination with common knowledge in the field and the contents described in this invention. Attached Figures and Descriptions The present invention has the following beneficial effects: (1) For the precise and controllable construction of nucleic acid aptamer conjugates with high drug loading ratio, multiple reactive groups are introduced at the ends of nucleic acid molecules by using dendritic monomers in solid-phase synthesis, thereby conjugating them with drug molecules and constructing nucleic acid aptamer conjugates with multiple drug loads. (2) The constructed high drug-load ratio nucleic acid aptamer conjugate was used to treat tumor models with high expression of functional nucleic acid targets. The cytotoxic IC50 was significantly lower than that of the single-load nucleic acid aptamer conjugate, and the tumor inhibition effect in the animal model was significantly improved. (3) When the drug is Dxd, it is found that when the number of coupling sites is 4, the efficacy of Dxd can be maximized compared with other coupling site numbers. Moreover, when used to treat colon cancer, the efficacy of S4D can exceed that of the same concentration of the first-line clinical chemotherapy drug eczema EXA, while Dxd of any other structure cannot achieve this effect. (4) It was found that when the 5' end of the nucleic acid aptamer was connected by a bifurcated linker, the stability of the peptide linker vitamin C in mouse plasma was significantly improved compared with connecting both ends of the nucleic acid aptamer at the same time or connecting the 3' end of the nucleic acid aptamer. Attached Figure Description Figure 1 shows the mass spectrometry characterization of the PTK7 nucleic acid aptamer conjugate drug S4M with a drug loading ratio of 4 in Example 1. Figure 2 shows the S2M mass spectrometry characterization of the PTK7 nucleic acid aptamer conjugate drug with a drug loading ratio of 2 in Example 2. Figure 3 shows the mass spectrometry characterization of the PTK7 nucleic acid aptamer conjugate drug S3M with a drug loading ratio of 3 in Example 3. Figure 4 shows the mass spectrometry characterization of CMET nucleic acid aptamer conjugate drug SL1-3M with a drug loading ratio of 3 in Example 4. Figure 5 shows the S2D mass spectrometry characterization of the PTK7 nucleic acid aptamer conjugate drug with a drug loading ratio of 2 in Example 5. Figure 6 shows the mass spectrometry characterization of CMET nucleic acid aptamer conjugate drug SL1-3D with a drug loading ratio of 3 in Example 6. Figure 7 shows the mass spectrometry characterization of the PTK7 nucleic acid aptamer conjugate drug S4D with a drug loading ratio of 4 in Example 7. Figure 8 shows the S4E mass spectrometry characterization of the PTK7 nucleic acid aptamer conjugate drug with a drug loading ratio of 4 in Example 11. Figure 9 shows the PTK7-targeted nucleic acid aptamer conjugate drug proliferation inhibition experiment of SKOV-3 ovarian cancer cells with different drug loading ratios in Example 12. Figure 10 shows the tumor volume curves of in vivo tumor inhibition experiments of PTK7 nucleic acid aptamer-conjugated drugs with different drug loading ratios in Example 13. Figure 11 shows the body weight curves of mice in the in vivo tumor inhibition experiment with PTK7 nucleic acid aptamer-conjugated drugs at different drug loading ratios in Example 13. Figure 12 is a graph showing the tumor volume inhibition curve of the nucleic acid aptamer-conjugated drug S4D with a drug loading ratio of 4 in Example 14. Figure 13 is a graph showing the body weight curve of mice in the in vivo tumor inhibition experiment of nucleic acid aptamer-conjugated drug S4D with a drug loading ratio of 4 in Example 14. Figure 14 shows an image of mice in an in vivo tumor inhibition experiment with the PTK7-targeting nucleic acid aptamer conjugate drug S4M at a drug loading ratio of 4 in Example 15. Figure 15 is a graph showing the tumor volume inhibition curve of mice in the in vivo tumor inhibition experiment of PTK7-targeting nucleic acid aptamer conjugate drug S4M with a drug loading ratio of 4 in Example 15. Figure 16 is a graph showing the relative tumor volume of mice in an in vivo tumor inhibition experiment with PTK7-targeting nucleic acid aptamer conjugate drug S4M at a drug loading ratio of 4 in Example 15. Figure 17 is a graph showing the body weight curve of mice in the in vivo tumor inhibition experiment of PTK7-targeting nucleic acid aptamer conjugate drug S4M with a drug loading ratio of 4 in Example 15. Figure 18 is a graph showing the relative body weight of mice in the in vivo tumor inhibition experiment of PTK7-targeting nucleic acid aptamer conjugate drug S4M with a drug loading ratio of 4 in Example 15. Figure 19 is a graph showing the tumor volume curve of mice in the in vivo tumor inhibition experiment of S2M and S4M, which have a high drug loading ratio and are conjugated with nucleic acid aptamers in Example 16. Figure 20 is a graph showing the relative tumor volume curves of mice in the in vivo tumor inhibition experiment of S2M and S4M, which have a high drug loading ratio and are conjugated with nucleic acid aptamers in Example 16. Figure 21 is a graph showing the tumor volume inhibition experiment of PTK7 nucleic acid aptamer conjugate drug S4M with a drug loading ratio of 4 in Example 17. Figure 22 shows the body weight of mice in the in vivo tumor inhibition experiment of PTK7 nucleic acid aptamer conjugate drug S4M with a drug loading ratio of 4 in Example 17. Figure 23 shows the tumor volume in the OVCAR3 model in vivo tumor inhibition experiment of PTK7 nucleic acid aptamer conjugates with different drug loading ratios in Example 18. Figure 24 shows the body weight of mice in the OVCAR3 model in vivo tumor suppression experiment with PTK7 nucleic acid aptamer conjugates with different drug loading ratios in Example 18. Figure 25 shows the proliferation experiment of PTK7 nucleic acid aptamer conjugates with different Dxd drug loading ratios in NCI-H1975 cells in Example 19. Figure 26 shows the tumor volume curves of PTK7 nucleic acid aptamer conjugates with different drug loading ratios in the in vivo tumor inhibition experiment of the HT-29 model in Example 20. Figure 27 shows the body weight curves of PTK7 nucleic acid aptamer conjugates with different drug loading ratios in the HT-29 model in vivo tumor inhibition experiment mice in Example 20. Detailed Implementation The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be noted that the embodiments described below are intended to facilitate the understanding of the present invention and do not limit it in any way. Example 1: Preparation of PTK7 aptamer conjugate drug S4M with a drug loading ratio of 4 In this embodiment, a drug conjugate S4M consisting of a PTK7 (sgc8c, publicly disclosed sequence) aptamer with a drug loading ratio of 4 was prepared. It was constructed by using a PTK7 aptamer with four conjugation sites and the microtubule inhibitor MMAE, which is a type of auristatin. The PTK7 aptamer with four conjugation sites was prepared by solid-phase synthesis. The nucleic acid aptamer-conjugated drug S4M with a drug loading ratio of 4 was synthesized using a thiol maleimide chemical reaction, as shown in the following reaction formula: Among them, the band-shaped material with thiol groups is a nucleic acid aptamer. The preparation process is as follows: (1) Preparation of aqueous solution of PTK7 aptamer with tetra-coupling site: First, the oligonucleotide chain (sgc8c) was synthesized using solid-phase synthesis technology. Controlled-pore glass (CPG) was selected as the solid-phase support for the synthesis reaction, requiring strict dehydration and deoxygenation of the synthetic reagents during the process. The nucleic acid sequence (sgc8c: 5'-3': ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GTA CGG TTA GA (SEQ NO: 1)) was input into the solid-phase synthesis instrument control software. At the 5' end, two x=1 Phosphoramidite 1 bifurcation linker modifications and reactive functional group modifications were introduced. The phosphoramidite monomer for the bifurcation linker was prepared at a concentration of 0.1M for coupling. After one bifurcation linker modification, thiol groups were modified, and the mixture was subjected to ammonolysis with 30% concentrated ammonia to remove the protecting groups on the oligonucleotide chain and hydrolyze it off from the support. After heat treatment, the cooled reaction solution was mixed with 10% (by volume) 3M sodium chloride solution, followed by 2.5 times the volume of ammonia. Anhydrous ethanol was then added and mixed again. A white flocculent precipitate formed, which was the crude product obtained from the synthesis. The supernatant was removed by centrifugation and the product was dried as much as possible. It was then reconstituted with pure water, filtered, and the crude product was purified using HPLC. The fractions were collected. At this point, the thiol groups of the nucleic acid aptamer product were protected by disulfide bonds. Reduction was performed using 20 times the equivalent of TCEP, followed by desalting to remove small molecules, yielding an aqueous solution of the nucleic acid aptamer with four coupling sites. (2) Preparation of nucleic acid aptamer conjugate drug S4M with a drug loading ratio of 4: Add an aqueous solution (1 equivalent) of the PTK7 aptamer with four conjugation sites and a mixed solution (2-30 equivalents, preferably 15 equivalents) of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of the aurestatin microtubule inhibitor MMAE to a centrifuge tube. Maintain the temperature at 4-40°C, preferably 25°C, and stir for 2-24 hours, preferably 12 hours. Purify by reverse-phase preparative column chromatography and freeze-dry to obtain the PTK7 aptamer conjugate drug S4M (Sgc8c-4MMAE) with a drug loading ratio of 4, with a yield of approximately 70%. After desalting, freeze-dry for later use. Mass spectra are shown in Figure 1. MS: Calculated: 19146.4 (Found: 19151.0). Example 2: Preparation of PTK7 aptamer conjugate drug S2M with a drug loading ratio of 2 In this embodiment, a PTK7 aptamer-conjugated drug S2M with a drug loading ratio of 2 was prepared. It was constructed by using a PTK7 aptamer with two conjugation sites and the microtubule inhibitor MMAE of aurestatin. The PTK7 aptamer with two conjugation sites was prepared by solid-phase synthesis. The nucleic acid aptamer-conjugated drug S2M with a drug loading ratio of 2 was synthesized by a chemical reaction using mercaptomaleimide. The reaction formula is as follows: The preparation process is as follows: (1) Preparation of aqueous solution of PTK7 aptamer for dual coupling sites: First, oligonucleotide chains were synthesized using solid-phase synthesis technology. Controlled-pore glass (CPG) was selected as the solid-phase support for the synthesis reaction. Strict dehydration and deoxygenation of the synthesis reagents were required during the reaction. The nucleic acid sequence (sgc8c: 5'-3': ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GTA CGG TTA GA) was input into the solid-phase synthesizer control software. Phosphoramidite 1 (x=1) was introduced at the 5' end for modification and functional group modification. Phosphoramidite monomer for the bifurcation linker was prepared and prepared to a concentration of 0.1M for coupling. After one modification of the bifurcation linker, thiol groups were modified, and the oligonucleotide chains were subjected to ammonolysis with 30% concentrated ammonia to remove the protecting groups on the oligonucleotide chains and to hydrolyze them off the support. After heat treatment, the cooled reaction solution was mixed with 10% (by volume) 3M sodium chloride solution, followed by 2.5 times the volume of ammonia. After mixing again, anhydrous ethanol was added. A white flocculent precipitate formed, which was the crude product obtained from the synthesis. The supernatant was removed by centrifugation and the product was dried as much as possible. Then, pure water was added to reconstitute the product, and the crude product was obtained by filtration. Purification was performed using HPLC, and the corresponding fractions were collected. At this point, the thiol groups of the nucleic acid aptamer product were protected by disulfide bonds. Reduction was performed using 20 times the equivalent of TCEP, followed by desalting to remove small molecules, yielding an aqueous solution of the nucleic acid aptamer with two coupling sites. (2) Preparation of nucleic acid aptamer conjugate drug S2M with a drug loading ratio of 2: Add an aqueous solution (1 equivalent) of the dual-conjugation site PTK7 aptamer and a mixed solution (2-20 equivalents, preferably 8 equivalents) of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of the auristatin microtubule inhibitor MMAE to centrifuge tubes. Maintain the temperature at 4-40°C, preferably 25°C, and stir for 2-24 hours, preferably 16 hours. Purify by reverse-phase preparative column chromatography and freeze-dry to obtain PTK7 aptamer-conjugated drug S2M (Sgc8c-2MMAE) with a drug loading ratio of 2, with a yield of approximately 80%. After desalting, freeze-dry for later use. Mass spectra are shown in Figure 2. MS: Calculated: 15817.0 (Found: 15816.4). Example 3: Preparation of PTK7 aptamer-conjugated drug S3M with a drug loading ratio of 3 In this embodiment, a PTK7 aptamer-conjugated drug S3M with a drug loading ratio of 3 was prepared. It was constructed by using a PTK7 aptamer with three conjugation sites and the microtubule inhibitor MMAE, which is a type of auristatin. The PTK7 aptamer with three conjugation sites was prepared by solid-phase synthesis. The nucleic acid aptamer-conjugated drug S3M with a drug loading ratio of 3 was synthesized by a chemical reaction using mercaptomaleimide. The reaction formula is as follows: The preparation process is as follows: (1) Preparation of aqueous solution of PTK7 aptamer with triple coupling site: First, oligonucleotide chains were synthesized using solid-phase synthesis technology. Controlled-pore glass (CPG) was selected as the solid-phase support for the synthesis reaction. Strict dehydration and deoxygenation of the synthesis reagents were required during the reaction. The nucleic acid sequence (sgc8c: 5'-3': ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GTA CGG TTA GA) was input into the solid-phase synthesizer control software. Phosphoramidite 3-branched linker (x=3) and reactive functional group modifications were introduced at the 5' end. Phosphoramidite monomer for the branched linker was prepared and prepared to a concentration of 0.1M for coupling. After one modification of the branched linker, thiol groups were modified, and the oligonucleotide chains were subjected to ammonolysis with 30% concentrated ammonia to remove the protecting groups on the oligonucleotide chains and to hydrolyze them off the support. After heat treatment, the cooled reaction solution was mixed with 10% (by volume) 3M sodium chloride solution, followed by 2.5 times the volume of ammonia. After mixing again, anhydrous ethanol was added. A white flocculent precipitate formed, which was the crude product obtained from the synthesis. The supernatant was removed by centrifugation and the product was dried as much as possible. Then, pure water was added to reconstitute the product, and the crude product was obtained after filtration. Purification was performed using HPLC, and the corresponding fraction was collected. At this point, the thiol groups of the nucleic acid aptamer product were protected by disulfide bonds. Reduction was performed using 20 times the equivalent of TCEP, followed by desalting to remove small molecules, yielding an aqueous solution of the nucleic acid aptamer with three coupling sites. (2) Preparation of nucleic acid aptamer conjugate drug S3M with a drug loading ratio of 3: Add an aqueous solution (1 equivalent) of the PTK7 aptamer Sgc8c with three conjugation sites and a mixed solution (2-20 equivalents, preferably 12 equivalents) of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of the auristatin microtubule inhibitor MMAE to centrifuge tubes. Maintain the temperature at 4-40°C, preferably 25°C, and stir for 2-24 hours, preferably 16 hours. Purify by reverse-phase preparative column chromatography and freeze-dry to obtain the PTK7 aptamer conjugate drug S3M (Sgc8c-3MMAE) with a drug loading ratio of 3, with a yield of approximately 75%. After desalting, freeze-dry for later use. Mass spectra are shown in Figure 3. MS: Calculated: 17599.0 (Found: 17598.3). Example 4: Preparation of CMET aptamer conjugate drug SL1-3M with a drug loading ratio of 3 In this embodiment, a CMET nucleic acid aptamer-conjugated drug SL1-3M with a drug loading ratio of 3 was prepared. It was constructed by using a CMET nucleic acid aptamer with three conjugation sites and the microtubule inhibitor MMAE of aurestatin. The CMET nucleic acid aptamer with three conjugation sites was prepared by solid-phase synthesis. The nucleic acid aptamer-conjugated drug SL1-3M with a drug loading ratio of 3 was synthesized by a chemical reaction using mercaptomaleimide. The reaction formula is as follows: The preparation process is as follows: (1) Preparation of aqueous solution of CMET nucleic acid aptamer with triple coupling site: First, oligonucleotide chains (nucleic acid aptamer products were synthesized in this experiment) were synthesized using solid-phase synthesis technology. Controlled-pore glass (CPG) was selected as the solid-phase support for the synthesis reaction. Strict dehydration and deoxygenation of the synthesis reagents were required during the reaction. The nucleic acid sequence (SL-1: ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGGTGGGTTGGCAAGTCTGAT) was input into the solid-phase synthesizer control software. Phosphoramidite 3-branched linker (x=3) and reactive functional group modifications were introduced at the 5' end. Phosphoramidite monomer for the branched linker was prepared at a concentration of 0.1M for coupling. After one branched linker modification, thiol groups were modified, and the oligonucleotide chains were subjected to ammonolysis with 30% concentrated ammonia to remove protecting groups and hydrolyze them off the support. After heat treatment, the cooled reaction solution was mixed with 10% (by volume) 3M sodium chloride solution, followed by 2.5 times the volume of ammonia. After mixing again, anhydrous ethanol was added. A white flocculent precipitate formed, which was the crude product obtained from the synthesis. The supernatant was removed by centrifugation and the product was dried as much as possible. Then, pure water was added to reconstitute the product, and the crude product was obtained after filtration. Purification was performed using HPLC, and the corresponding fraction was collected. At this point, the thiol groups of the nucleic acid aptamer product were protected by disulfide bonds. Reduction was performed using 20 times the equivalent of TCEP, followed by desalting to remove small molecules, yielding an aqueous solution of the nucleic acid aptamer with three coupling sites. (2) Preparation of nucleic acid aptamer conjugate drug SL1-3M with a drug loading ratio of 3: Add an aqueous solution (1 equivalent) of the triple-conjugated cMET aptamer SL1 and a mixed solution (2-20 equivalents, preferably 12 equivalents) of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of the aurestatin microtubule inhibitor MMAE to a centrifuge tube. Maintain the temperature at 4-40°C, preferably 25°C, and stir for 2-24 hours, preferably 16 hours. Purify by reverse-phase preparative column chromatography and freeze-dry to obtain the aptamer-conjugated drug SL1-3M (SL1-3MMAE) with a drug loading ratio of 3, with a yield of approximately 78%. After desalting, freeze-dry for later use. Mass spectra are shown in Figure 4. MS: Calculated: 20646.0 (Found: 20647.2). Example 5: Preparation of PTK7 aptamer-conjugated drug S2D with a drug loading ratio of 2 In this embodiment, a PTK7 aptamer-conjugated drug S2D with a drug loading ratio of 2 was prepared. It was constructed by using a PTK7 aptamer with two coupling sites and a DNA topoisomerase I inhibitor Dxd. The PTK7 aptamer with two coupling sites was prepared by solid-phase synthesis. The nucleic acid aptamer-conjugated drug S2D with a drug loading ratio of 2 was synthesized using a thiol maleimide chemical reaction, as shown in the following reaction formula: The preparation process is as follows: (1) The preparation of the aqueous solution of the PTK7 nucleic acid aptamer with the dual coupling site is as shown in Example 2. (2) Preparation of nucleic acid aptamer conjugate S2D with a drug loading ratio of 2: Add an aqueous solution (1 equivalent) of the PTK7 aptamer with dual coupling sites and a mixed solution (2-20 equivalents, preferably 8 equivalents) of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of the DNA topoisomerase I inhibitor Dxd to a centrifuge tube. Maintain the temperature at 4-40°C, preferably 25°C, and stir for 2-24 hours, preferably 8 hours. Purify by reverse-phase preparative column chromatography and freeze-dry to obtain the PTK7 aptamer-conjugated drug S2D (Sgc8c-2Dxd) with a drug loading ratio of 2, with a yield of approximately 70%. After desalting, freeze-dry for later use. Mass spectra are shown in Figure 5. MS: Calculated: 15253.0 (Found: 15251.1). Example 6: Preparation of CMET aptamer-conjugated drug SL1-3D with a drug loading ratio of 3 In this embodiment, a CMET nucleic acid aptamer-conjugated drug SL1-3D with a drug loading ratio of 3 was prepared. It was constructed by using a CMET nucleic acid aptamer with three coupling sites and a DNA topoisomerase I inhibitor Dxd. The CMET nucleic acid aptamer with three coupling sites was prepared by solid-phase synthesis. The nucleic acid aptamer conjugate drug SL1-3D with a drug loading ratio of 3 was synthesized by a chemical reaction using mercaptomaleimide. The reaction formula is as follows: The preparation process is as follows: (1) The preparation of the aqueous solution of the triple-coupled site CMET nucleic acid aptamer is as shown in Example 4; (2) Preparation of nucleic acid aptamer conjugate SL1-3D with a drug loading ratio of 3: Add an aqueous solution (1 equivalent) of the CMET aptamer with three coupling sites and a mixed solution (2-20 equivalents, preferably 12 equivalents) of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of DNA topoisomerase I inhibitor Dxd to a centrifuge tube. Maintain the temperature at 4-40°C, preferably 25°C, and stir for 2-24 hours, preferably 8 hours. Purify by reverse-phase preparative column chromatography and freeze-dry to obtain CMET aptamer-conjugated drug SL1-2D (SL1-3Dxd) with a drug loading ratio of 3, with a yield of approximately 70%. Desalt and freeze-dry for later use. Mass spectra are shown in Figure 6. MS: Calculated: 19800.0 (Found: 19799.1). Example 7: S4D mass spectrometry characterization of PTK7 aptamer-conjugated drugs with a drug loading ratio of 4. In this embodiment, a PTK7 aptamer-conjugated drug S4D with a drug loading ratio of 4 was prepared. It was constructed by using a PTK7 aptamer with four conjugation sites and the DNA topoisomerase I inhibitor Dxd. The PTK7 aptamer with four conjugation sites was prepared by solid-phase synthesis. The nucleic acid aptamer-conjugated drug S4D with a drug loading ratio of 4 was synthesized using a thiol maleimide chemical reaction, as shown in the following reaction formula: The preparation process is as follows: (1) The preparation of the aqueous solution of the PTK7 nucleic acid aptamer with the tetra-coupling site is as shown in Example 1; (2) Preparation of nucleic acid aptamer conjugate drug S4D with a drug loading ratio of 4: Add an aqueous solution (1 equivalent) of the PTK7 aptamer with four coupling sites and a mixed solution (2-30 equivalents, preferably 15 equivalents) of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of the DNA topoisomerase I inhibitor Dxd to a centrifuge tube. Maintain the temperature at 4-40°C, preferably 25°C, and stir for 2-24 hours, preferably 8 hours. Purify by reverse-phase preparative column, and freeze-dry to obtain PTK7 aptamer-conjugated drug S4D (Sgc8c-4Dxd) with a drug loading ratio of 4, with a yield of approximately 70%. After desalting, freeze-dry for later use. Mass spectra are shown in Figure 7. MS: Calculated: 18016 (Found: 18019.0). Example 8: S3D mass spectrometry characterization of PTK7 aptamer-conjugated drugs with a drug loading ratio of 3. In this embodiment, a PTK7 aptamer-conjugated drug S3D with a drug loading ratio of 3 was prepared. It was constructed by using a triple-coupling site PTK7 aptamer and a DNA topoisomerase I inhibitor Dxd. The triple-coupling site PTK7 aptamer was prepared by solid-phase synthesis. The nucleic acid aptamer-conjugated drug S3D with a drug loading ratio of 3 was synthesized using a thiol maleimide chemical reaction. The reaction formula is as follows: The preparation process is as follows: (1) The preparation of the aqueous solution of the triple-coupled site PTK7 nucleic acid aptamer is as shown in Example 3; (2) Preparation of nucleic acid aptamer conjugate drug S3D with a drug loading ratio of 3: Add an aqueous solution (1 equivalent) of the PTK7 aptamer with three coupling sites and a mixed solution (2-30 equivalents, preferably 15 equivalents) of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of the DNA topoisomerase I inhibitor Dxd to a centrifuge tube. Maintain the temperature at 4-40°C, preferably 25°C, and stir the reaction for 2-24 hours, preferably 8 hours. Purify using a reverse-phase preparative column, and freeze-dry to obtain the PTK7 aptamer-conjugated drug S3D (Sgc8c-3Dxd) with a drug loading ratio of 3, with a yield of approximately 70%. Desalt and freeze-dry for later use. Example 9: Mass spectrometry characterization of PTK7 aptamer-conjugated drug S6D with a drug loading ratio of 6 In this embodiment, a PTK7 aptamer-conjugated drug S6D with a drug loading ratio of 6 was prepared. It was constructed by using a six-conjugation-site PTK7 aptamer and the DNA topoisomerase I inhibitor Dxd. The six-conjugation-site PTK7 aptamer was prepared by solid-phase synthesis. The nucleic acid aptamer-conjugated drug S6D with a drug loading ratio of 6 was synthesized using a thiol maleimide chemical reaction, as shown in the following reaction formula: The preparation process is as follows: (1) Preparation of aqueous solution of PTK7 nucleic acid aptamer with six coupling sites: First, oligonucleotide chains (nucleic acid aptamer products were synthesized in this experiment) were synthesized using solid-phase synthesis technology. Controlled-pore glass (CPG) was selected as the solid-phase support for the synthesis reaction. The synthesis reagents required strict dehydration and deoxygenation during the reaction. The nucleic acid sequence (sgc8c: 5'-3': ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GTA CGG TTA GA) was input into the solid-phase synthesis instrument control software. At the 5' end, Phosphoramidite 3 with x=3 and Phosphoramidite 1 with x=1 were introduced successively for modification and reactive functional group modification. Phosphoramidite monomers with branched linkers were prepared and formulated to a concentration of 0.1 M for coupling. After modification with the three-branched linker Phosphoramidite 3 (x=3), the two-branched linker Phosphoramidite 1 (x=1) was modified, followed by modification of the thiol groups. The mixture was then subjected to ammonolysis with 30% concentrated ammonia to remove protecting groups on the oligonucleotide chains and to hydrolyze them off the support. After heat treatment, the cooled reaction solution was mixed with 10% (v / v) of 3M sodium chloride solution, and then anhydrous ethanol was added at 2.5 times the volume of ammonia. After mixing again, a white flocculent precipitate was formed, which was the crude product obtained from the synthesis. The supernatant was removed by centrifugation and the product was dried as much as possible. It was then reconstituted with pure water, filtered, and the crude product was obtained. Purification was performed using HPLC, and the corresponding fractions were collected. At this point, the thiol groups of the nucleic acid aptamer product were protected by disulfide bonds. Reduction was performed using 20 times the equivalent of TCEP, followed by desalting to remove small molecules, yielding an aqueous solution of the nucleic acid aptamer with six coupling sites. (2) Preparation of nucleic acid aptamer conjugate S6D with a drug loading ratio of 6: Add an aqueous solution (1 equivalent) of the PTK7 aptamer with six conjugation sites and a mixed solution (2-30 equivalents, preferably 15 equivalents) of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of the DNA topoisomerase I inhibitor Dxd to a centrifuge tube. Maintain the temperature at 4-40°C, preferably 25°C, and stir the reaction for 2-24 hours, preferably 8 hours. Purify using a reverse-phase preparative column, and freeze-dry to obtain the PTK7 aptamer conjugate S6D (Sgc8c-6Dxd) with a drug loading ratio of 6, with a yield of approximately 70%. Desalt and freeze-dry for later use. Example 10: Mass spectrometry characterization of PTK7 aptamer-conjugated drug S8D with a drug loading ratio of 8 In this embodiment, a PTK7 aptamer-conjugated drug S8D with a drug loading ratio of 8 was prepared. It was constructed by using an eight-conjugation-site PTK7 aptamer and the DNA topoisomerase I inhibitor Dxd. The eight-conjugation-site PTK7 aptamer was prepared by solid-phase synthesis. The nucleic acid aptamer conjugate drug S8D with a drug loading ratio of 8 was synthesized using a thiol maleimide chemical reaction. The reaction formula is as follows: The preparation process is as follows: (1) Preparation of aqueous solution of PTK7 aptamer with eight coupling sites: First, oligonucleotide chains were synthesized using solid-phase synthesis (SPR). Controlled-pore glass (CPG) was selected as the solid-phase support for the synthesis reaction, requiring strict dehydration and deoxygenation of the synthetic reagents during the process. The nucleic acid sequence (sgc8c: 5'-3': ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GTA CGG TTA GA) was input into the SPR synthesizer control software. At the 5' end, three x=1 Phosphoramidite 1 branching linker modifications and reactive functional group modifications were introduced. The phosphoramidite monomer for the branching linker was prepared at a concentration of 0.1M for coupling. After the first branching linker modification, thiol groups were modified, and the oligonucleotide chains were subjected to ammonolysis with 30% concentrated ammonia to remove protecting groups and hydrolyze them off the support. After heat treatment, the cooled reaction solution was mixed with 10% (by volume) 3M sodium chloride solution, followed by 2.5 times the volume of ammonia. Anhydrous ethanol was then added and mixed again. A white flocculent precipitate formed, which was the crude product obtained from the synthesis. The supernatant was removed by centrifugation and the product was dried as much as possible. Then, pure water was added to reconstitute the product, and the crude product was obtained after filtration. Purification was performed using HPLC, and the corresponding fractions were collected. At this point, the thiol groups of the nucleic acid aptamer product were protected by disulfide bonds. Reduction was performed using 20 times the equivalent of TCEP, followed by desalting to remove small molecules, yielding an aqueous solution of the eight-coupling site nucleic acid aptamer. (2) Preparation of nucleic acid aptamer conjugate S8D with a drug loading ratio of 8: Add an aqueous solution (1 equivalent) of the 8-conjugation site PTK7 aptamer to a centrifuge tube, and a mixed solution (2-30 equivalents, preferably 15 equivalents) of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of the DNA topoisomerase I inhibitor Dxd. Maintain the temperature at 4-40°C, preferably 25°C, and stir the reaction for 2-24 hours, preferably 8 hours. Purify using a reverse-phase preparative column, and freeze-dry to obtain the PTK7 aptamer conjugate S8D (Sgc8c-8Dxd) with a drug loading ratio of 8, with a yield of approximately 70%. Desalt and freeze-dry for later use. Example 11: S4E mass spectrometry characterization of PTK7 aptamer-conjugated drug with a drug loading ratio of 4 In this embodiment, a PTK7 aptamer-conjugated drug S4E with a drug loading ratio of 4 was prepared. It was constructed by using a PTK7 aptamer with four conjugation sites and the DNA topoisomerase I inhibitor Exatecan. The PTK7 aptamer with four conjugation sites was prepared by solid-phase synthesis. The nucleic acid aptamer conjugate drug S4E with a drug loading ratio of 4 was synthesized using a thiol maleimide chemical reaction. The reaction formula is as follows: The preparation process is as follows: (1) The preparation of the aqueous solution of the PTK7 nucleic acid aptamer with the tetra-coupling site is as shown in Example 1; (2) Preparation of nucleic acid aptamer conjugate S4E with a drug loading ratio of 4: Add an aqueous solution (1 equivalent) of the PTK7 aptamer with four coupling sites and a mixed solution (2-30 equivalents, preferably 15 equivalents) of the DNA topoisomerase I inhibitor Exatecan in acetonitrile / water (1 / 5-3 / 1, preferably 2 / 1) to a centrifuge tube. Maintain the temperature at 4-40°C, preferably 25°C, and stir for 2-24 hours, preferably 12 hours. Purify by reverse-phase preparative column, and freeze-dry to obtain the PTK7 aptamer-conjugated drug S4E (Sgc8c-4EXA) with a drug loading ratio of 4, with a yield of approximately 65%. After desalting, freeze-dry for later use. Mass spectra are shown in Figure 8. MS: Calculated: 17672.0 (Found: 17674.5). In this embodiment, the PTK7 aptamer with two coupling sites was further prepared according to the method provided in Example 2, thereby obtaining the aptamer-conjugated drug S2E with a drug loading ratio of 2, which was verified by mass spectrometry. Example 12: Effects of different drug loading ratios on the inhibitory effect of nucleic acid aptamer conjugates on the proliferation of SKOV-3 ovarian cancer cells. This embodiment uses S2D and S4D prepared in Examples 5 and 7, respectively, as well as SD prepared by directly coupling PTK7 aptamers with the DNA topoisomerase I inhibitor Dxd (obtained by reacting a thiol-modified sgc8c aqueous solution obtained through solid-phase synthesis with maleimide-modified Deruxtecan), for ovarian cancer SKOV-3 cell proliferation inhibition experiments. The specific process is as follows: SKOV-3 cells were seeded into 96-well plates (4000 cells per well) and cultured at 37°C with 5% CO2 for 24 hours. Different drug loading ratios of PTK7 aptamer-conjugated drugs SD (Sgc8c-Dxd), S2D (Sgc8c-2Dxd), and S4D (Sgc8c-4Dxd) were added, each containing the same drug concentration. After culturing at 37°C with 5% CO2 for 24 hours, the drug-containing medium was discarded, and the cells were cultured in drug-free medium for another 108 hours. After a total of 120 hours, the inhibitory effect of the drugs was measured using an MTS kit, and the results are shown in Figure 9. As shown in Figure 9, the inhibitory effect of the aptamer-conjugated drugs SD, S2D, and S4D on ovarian cancer SKOV-3 cells gradually increased with increasing drug loading, with the inhibitory activity being S4D > S2D > SD. The IC50 of S4D was more than 8-fold lower than that of SD. Example 13: Effects of different drug loading ratios of nucleic acid aptamer-conjugated drugs on the tumor inhibition effect of HT29 colon cancer. In this embodiment, S2D and S4D prepared in Examples 5 and 7, respectively, and SD prepared by directly coupling PTK7 aptamers with the DNA topoisomerase I inhibitor Dxd (obtained by reacting a thiol-modified sgc8c aqueous solution obtained through solid-phase synthesis with maleimide-modified Deruxtecan) were used for tumor suppression experiments in a colon cancer HT29 xenograft model. The specific process is as follows: A mouse model bearing human colon cancer cells HT29 was established, with tumor volume ranging from 100-200 mm. 3 Six mice were randomly divided into two groups. Each group received a drug injection every four days, specifically saline, the first-line clinical chemotherapy drug eczema (EXA, 4 μmol / kg), PTK7-targeting aptamer conjugate SD (4 μmol / kg equivalent Dxd) with a drug loading ratio of 1, S2D (4 μmol / kg equivalent Dxd) with a drug loading ratio of 2, S3D (4 μmol / kg equivalent Dxd) with a drug loading ratio of 3, S4D (4 μmol / kg equivalent Dxd) with a drug loading ratio of 4, S6D (4 μmol / kg equivalent Dxd) with a drug loading ratio of 6, and S8D (4 μmol / kg equivalent Dxd) with a drug loading ratio of 8, for a total of five injections. At each injection, the mice's body weight, tumor length (a), and tumor width (b) were measured and recorded. The tumor volume (V) was calculated using the formula: V = (a × b) / (a ​​× b) 2 ) / 2. For tumors exceeding 1500 mm². 3The experiment was terminated when mice experienced a weight loss exceeding 15%, at which point they were euthanized. The results are shown in Figure 10. Different drug loading ratios of nucleic acid aptamer conjugates exhibited different antitumor effects. At the same drug dosage, the antitumor efficacy gradually increased with increasing drug loading ratio. This example further verified the effects of S3D, S6D, and S8D (prepared in Examples 8, 9, and 10). It was found that when the drug loading ratio was greater than 4, the antitumor effect did not change significantly, but systemic toxicity significantly increased. This may be because at this drug dosage, the structure of S4D is optimal for its tumor-suppressing effect, exhibiting lower toxicity; other nucleic acid aptamer conjugate structures cannot achieve this effect. S4D exhibits the best in vivo tumor-suppressing effect, enabling the DNA topoisomerase I inhibitor Dxd to reach or even exceed the in vivo tumor-suppressing effect of eczema EXA, achieving a tumor inhibition efficiency of over 95%. Meanwhile, the body weight of mice was observed, and the results are shown in Figure 11. The body weight of mice in the S4D group with a drug loading ratio of 4 was not significantly different from that in the saline group, indicating that the high drug loading ratio nucleic acid aptamer conjugate has good biosafety at this dose. Example 14: Effect of S4D concentration on the tumor-suppressive effect of SKOV-3 ovarian cancer cells. The tumor volume of the SKOV-3 subcutaneous tumor model of ovarian cancer cells was 200-400 mm. 3 Twelve mice were randomly divided into four groups. Each group received an intravenous injection every four days, consisting of saline, eczema (EXA), or a nucleic acid aptamer conjugate (S4D, Sgc8c-4Dxd) (1 μmol / kg equivalent Dxd) with a drug loading ratio of 4, for a total of three administrations. At each injection, the mouse's body weight, tumor length (a), and tumor width (b) were measured and recorded. The tumor volume (V) was calculated using the formula: V = (a × b) / (a ​​× b) 2 ) / 2. For tumors exceeding 1500 mm². 3 The experiment was terminated when mice experienced a weight loss exceeding 15%, at which point they were euthanized. The results, shown in Figure 12, indicate that a dose of 1 μmol / kg effectively inhibited tumor growth in mice, achieving an inhibition rate of over 92%, significantly better than that of eczemab (EXA). Mouse weight was also monitored, and the results, shown in Figure 13, show no significant difference in weight between the S4D group (with a drug loading ratio of 4) and the Saline group (control group) and the eczemab group, indicating that the S4D group (with a drug loading ratio of 4) has good safety at this dosage. Example 15: Effect of S4M on the tumor-suppressive effect of PDX cells in triple-negative breast cancer Six mice with triple-negative breast cancer PDX model tumors ranging from 50 to 150 mm³ were randomly divided into two groups. Each group received a drug injection every four days, either via tail vein into saline or S4M (a PTK7-targeting aptamer conjugate with a drug loading ratio of 4), at a dose of 0.5 μmol / kg MMAE equivalent, for a total of six injections. At each injection, the mice's body weight, tumor length (a), and tumor width (b) were measured and recorded. The tumor volume (V) was calculated using the formula: V = (a × b) / (a ​​× b) 2 ) / 2. For tumors exceeding 1500 mm². 3 The experiment was terminated when mice experienced a weight loss exceeding 15%, at which point they were euthanized. The results, shown in Figures 14-16, indicate that tumors in the mice were effectively inhibited, with an inhibition rate exceeding 95.4%. Simultaneously, mouse weight was observed, and the results, shown in Figures 17-18, show no significant difference in weight between the mice in the PTK7-targeting aptamer conjugate S4M group (drug loading ratio of 4) and the saline group, indicating that this dose of PTK7-targeting aptamer conjugate S4M at a drug loading ratio of 4 has good biocompatibility. Example 16: Antitumor effect of high drug loading ratio nucleic acid aptamer-conjugated drugs on lung adenocarcinoma cells. The tumor volume of the NCI-H1975 lung adenocarcinoma subcutaneous tumor model was 150-200 mm. 3 Eighteen mice were randomly divided into six groups. Administered drugs every four days (a total of three times) or seven days (a total of two times), via tail vein injection: saline, paclitaxel (10 mg / kg), and PTK7-targeting aptamer conjugates S2M and S4M with drug loading ratios of 2 and 4, respectively, at doses of 1.0 μmol / kg and 0.5 μmol / kg equivalent MMAE. At each injection, the mice's body weight, tumor length (a), and tumor width (b) were measured and recorded. Tumor volume (V) was calculated using the formula: V = (a × b) / (a ​​× b) 2 ) / 2. For tumors exceeding 1500 mm². 3The experiment was terminated when mice experienced a weight loss exceeding 15%, at which point euthanasia was performed. The results are shown in Figures 19-20. Compared to the first-line chemotherapy drug paclitaxel, PTK7 aptamer conjugates at a 0.5 μmol / kg equivalent MMAE dose effectively inhibited tumor growth in mice with different drug loading ratios. Furthermore, 0.5 μmol / kg equivalent S4M achieved the same effect as 1.0 μmol / kg equivalent S2M, with an inhibition rate exceeding 90%. It was also observed that at the same MMAE dose, aptamer conjugates S2M and S4M with a drug loading ratio of 2 exhibited similarly good tumor-suppressing effects, indicating that S4M is not superior to S2M against the aurestatin-like microtubule inhibitor MMAE. According to Example 13, S4D showed a significant advantage over SD, S2D, S3D, S6D, and S8D drugs, suggesting that the structure of S4D is more suitable for the DNA topoisomerase I inhibitor Dxd, but S4M is not superior to S2M. Example 17: Effect of S4M concentration on the tumor-suppressive effect of HT29 colon cancer cells. A mouse model bearing human colon cancer cells HT29 was established, with tumor volume ranging from 50 to 150 mm. 3 Fifteen mice were randomly divided into five groups. Each group was administered medication every four days via tail vein injection: saline, MMAE (0.5 μmol / kg), or PTK7-targeting aptamer conjugate S4M with a drug loading ratio of 4 at doses of 0.125, 0.25, and 0.5 μmol / kg equivalent MMAE, respectively, for a total of three administrations. At each injection, the mice's body weight, tumor length (a), and tumor width (b) were measured and recorded. Tumor volume (V) was calculated using the formula: V = (a × b) / (a ​​× b) 2 ) / 2. For tumors exceeding 1500 mm². 3 The experiment was terminated when mice experienced a weight loss exceeding 15%, at which point they were euthanized. The results, shown in Figure 21, indicate that tumors in mice were effectively inhibited. At the same MMAE dose, the efficacy of the nucleic acid aptamer conjugate S4M with a drug loading ratio of 4 was significantly enhanced. The efficacy of S4M with a drug loading ratio of 4 was dose-dependent, increasing with increasing dosage within the range of 0.125–0.5 μmol / kg equivalent MMAE. At a 0.5 μmol / kg equivalent MMAE dose, the inhibition rate of S4M with a drug loading ratio of 4 (0.125 μmol / kg) reached over 95.5%. Mouse weight was also observed, and the results, shown in Figure 22, indicate no significant difference in weight between the S4M group and the saline group, suggesting that the high drug loading ratio nucleic acid aptamer conjugate has good biocompatibility at this dosage. Example 18: Antitumor effect of high drug loading ratio nucleic acid aptamer conjugates on ovarian cancer OVCAR3 cells A mouse model bearing human ovarian cancer cells (OVCAR3) was established, with tumor volume ranging from 100 to 200 mm. 3 Twelve mice were randomly divided into four groups. Drug administration was performed every four days, with the mice receiving either saline, MMAE (0.5 μmol / kg), 0.25 μmol / kg equivalent of PTK7-targeting aptamer conjugate S2M with a drug loading ratio of 2, or 0.125 μmol / kg equivalent of PTK7-targeting aptamer conjugate S4M with a drug loading ratio of 4 via tail vein injection, for a total of three administrations. At each injection, the mice's body weight, tumor length (a), and tumor width (b) were measured and recorded. The tumor volume (V) was calculated using the formula: V = (a × b) / (a ​​× b) 2 ) / 2. The experiment was terminated by euthanasia of mice when the tumor volume exceeded 1500 mm³ or the body weight decreased by more than 15%. The results are shown in Figure 23. Compared with the MMAE drug group and the control group, the tumors in the S2M and S4M groups were effectively inhibited, with inhibition rates of 92.2% and 94.8%, respectively. This indicates that at the same MMAE dose, the nucleic acid aptamer conjugate S4M with a drug loading ratio of 4 is more effective. Simultaneously, mouse body weight was observed, and the results are shown in Figure 24. The body weight of mice with different drug loading ratios fluctuated slightly after administration, but there was no significant difference compared with the saline group, indicating that the high drug loading ratio nucleic acid aptamer conjugate has good biocompatibility at this dose. Example 19: Inhibitory effect of high drug loading ratio nucleic acid aptamer conjugates on non-small cell lung cancer NCI-H1975 cells NCI-H1975 cells were seeded into 96-well plates (4000 cells per well) and cultured at 37°C and 5% CO2 for 24 hours. Different concentrations of PTK7 aptamer-conjugated drugs SD (Sgc8c-Dxd), S2D (Sgc8c-2Dxd), and S4D (Sgc8c-4Dxd) with varying drug loading ratios were then added. After 24 hours of incubation at 37°C and 5% CO2, the drug-containing medium was discarded, and the cells were cultured in drug-free medium for another 108 hours. After a total of 120 hours, the inhibitory effect of the drugs was measured using an MTS kit, and the results are shown in Figure 25. Figure 25 shows that, compared to SD, S2D, and S4D, the inhibitory effect on NCI-H1975 non-small cell lung cancer cells gradually increased with increasing drug loading, with the inhibitory activity being S4D > S2D > SD. The IC50 of S4D was more than 4-fold lower than that of SD. This indicates that, for different drugs, multidrug loading can enhance drug toxicity and improve efficacy. Example 20: Comparison of the effects of nucleic acid aptamer conjugates with high drug loading ratios A mouse model bearing human colon cancer cells HT29 was established, with tumor volume ranging from 50 to 150 mm. 3 Twenty mice were randomly divided into 5 groups. Each group was administered medication every four days via tail vein injection: saline, SE (2 μmol / kg), S2E (1 μmol / kg), S4E (0.5 μmol / kg), and S4D (0.5 μmol / kg), each equivalent to a 2 μmol / kg dose, for a total of 5 administrations. At each injection, the mouse's body weight, tumor length (a), and tumor width (b) were measured and recorded. The tumor volume (V) was calculated using the formula: V = (a × b) / (a ​​× b) 2 ) / 2. For tumors exceeding 1500 mm². 3 The experiment was terminated when mice experienced a weight loss exceeding 15%, at which point they were euthanized. The results, as shown in Figure 26, demonstrated effective tumor suppression in mice. At the same EXA dose, the nucleic acid aptamer-conjugated drugs S2E and S4E, with a drug loading ratio of 2, exhibited similarly good tumor-suppressing effects, with inhibition rates exceeding 96.8%. This indicates that S4E does not offer an advantage over S2E against the DNA topoisomerase I inhibitor Exa. Furthermore, according to Example 13, S4D showed a significant advantage over SD, S2D, S3D, S6D, and S8D drugs, suggesting that the structure of S4D is more suitable for the DNA topoisomerase I inhibitor Dxd. Figure 26 also shows that there was no significant difference between S4D and S4E at a dose of 0.5 μmol / kg. This indicates that a low concentration of S4D can achieve the same effect as S4E, and also suggests that the structure of S4D is particularly suitable for the DNA topoisomerase I inhibitor Dxd, significantly enhancing its antitumor efficacy. The body weight of mice was observed, and the results are shown in Figure 27. The body weight of mice in different drug loading ratio nucleic acid aptamer conjugate groups decreased after administration, but the body weight of mice quickly recovered to the same level as the saline group after drug withdrawal, indicating that the high drug loading ratio nucleic acid aptamer conjugate has tolerable toxicity at this dose. Example 21: Drug conjugation at both ends of a nucleic acid aptamer This embodiment examines the difference between linking drugs to both ends of a nucleic acid aptamer and linking drugs only to the 5' end. MMAE drugs were linked to both ends of the nucleic acid aptamer sgc8c (PTK7) to obtain PTK7-targeted nucleic acid aptamer conjugates MSM with one MMAE drug at each end and a drug loading ratio of 2. The construction process of MSM is as follows: The construction process was as follows: sgc8c, with thiol-modified groups at both ends, was synthesized using a solid-phase synthesizer. After purification, it was reacted with vcMMAE to construct MSM, with reaction conditions as described in Example 2. After HPLC purification, MSMs with one MMAE drug attached to each end were obtained. The stability of MSM in mouse plasma was compared with that of S2M (connected at the 5' end) constructed based on a bifurcated linker in Example 2. Both drugs were incubated with mouse plasma, and samples were taken at 0.5 h, 1 h, and 3 h for characterization using gel electrophoresis and liquid chromatography-mass spectrometry. The results are shown in the figure. MSM rapidly degraded in mouse plasma, showing degraded bands, while S2M showed no significant degradation in mouse plasma after 3 hours. Further characterization of its metabolites by liquid chromatography-mass spectrometry showed that the dipeptide linker in vcMMAE of MSM was broken in mouse plasma, resulting in drug degradation. However, no obvious dipeptide linker breakage was observed in S2M after 3 hours, indicating that MSM constructed with two-end linkages has poor stability and is significantly less effective than S2M. This also demonstrates that multidrug loading ApDCs constructed based on bifurcated linkers with connections at the 5' end can significantly improve drug performance, exhibit better linker stability, and prevent drug release from non-target sites, thus preventing toxicity. While the present invention has been disclosed above, it is not limited thereto. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention; therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.

Claims

1. A nucleic acid aptamer-conjugated drug with high drug loading capacity, comprising: Nucleic acid aptamers, which are conjugated to drugs; The aptamer has a dendritic phosphoramidite monomer coupled to its 3' and / or 5' ends, the dendritic phosphoramidite monomer including any one or more of Phosphoramidite 1, Phosphoramidite 2, and Phosphoramidite 3, wherein Phosphoramidite 1, Phosphoramidite 2, and Phosphoramidite 3 each have the following structural formulas: Where x = any integer from 1 to n; y = any integer from 1 to n; z = any integer from 1 to n; and DMTr is a 4,4'-dimethoxytriphenylmethyl protecting group. i Pr stands for isopropyl, and CNEt stands for cyanoethyl.

2. The nucleic acid aptamer conjugate drug as described in claim 1, wherein, One or more active groups selected from thiol, amino, DBCO, azide, and maleimide are coupled to the 3' and / or 5' ends of the nucleic acid aptamer, and the active groups are coupled to the dendritic phosphoramide monomer.

3. The nucleic acid aptamer conjugate drug as described in claim 2, wherein, One or more active groups selected from thiol, amino, DBCO, azide, and maleimide are coupled to the 3' end of the nucleic acid aptamer, and the active groups are coupled to the dendritic phosphoramide monomer.

4. The nucleic acid aptamer-conjugated drug as described in claim 1, characterized in that, The specific types of cell lines containing the following types of cells are CD5, CD19, CD20, CD25, CD37, CD30, CD33, and CD45. CAMPATH-1, HLD-DR, CEA, TAG-72, EpCAM, MUC1, MUC15, folate-binding protein、A33、G250、PSMA、ferritin、GD2、GD3、GM2、Leg、CA-125、CA19-9、epidermal growth factor、p185HER2、IL-2receptor、tenascin、a metalloproteinase、endosialin、vascular endothelial growth factor, avB3, WT1, LMP2, HPV E6, HPV E7, EGFRvIII, Her-2 / neu, MAGE A3, p53 nonmutant, NY-ESO-1, MelanA / MART1, Ras mutant, gp100, p53 mutant、PR1、bcr-abl、tyrosinase、survivin、PSA、hTERT、a Sarcoma translocation breakpoint fusion protein、EphA2、PAP、ML-IAP、AFP、ERG、NA17、PAX3、ALK、androgen receptor、cyclin Bl, polysialic acid, MYCN, RhoC, TRP-2, fucosyl GM1, MSLN, PSCA, MAGE Al, MAGE-A3, sLe, CYP1B1, PLAV1, GM3, BORIS, Tn, GloboH, ETV6-AML, NY-BR-1, RGS5, SART3, STn, Carbonic anhydrase IX,PAX5, OY-TESL Sperm protein 17. LCK, HMWMAA, AKAP-4, 55X2, XAGE 1, B7H3, Legumain, Tie 3 Page4 VEGFR2 MAD-CT-1 PDGFR-B MAD-CT-2 ROR2 CMET HER3 EPCAM CA6 NAPI2B TROP2 CLDN18.2、FAP、RON、LY6E、FRA、DLL3、PTK7、LIV1、ROR1、Fos-related antigen 1、VEGFR、endoglin、PD-L1、CD204、CD206、CD301、VTCN1、VISTA。.

5. The nucleic acid aptamer-conjugated drug as described in claim 1, characterized in that, The drug includes any one or more of auristatin E (MMAE), deructetcan (Dxd), ixotecan, or derivatives having the same or similar core structure as auristatin E, Dxd, or ixotecan.

6. The nucleic acid aptamer-conjugated drug as described in claim 5, characterized in that, The number of coupling sites of the nucleic acid aptamer is 2, 3, 4, 6, or 8; the drug also includes a linker that is coupled to the 5' end of the nucleic acid aptamer.

7. The nucleic acid aptamer-conjugated drug as described in claim 5, characterized in that, When the drug is Dxd, the number of coupling sites of the multi-coupling site aptamer is 4.

8. The nucleic acid aptamer-conjugated drug as described in claim 5, characterized in that, When the drug is ethiophene citrate, the number of coupling sites of the multi-coupling site aptamer is 2 or 4.

9. The nucleic acid aptamer-conjugated drug as described in claim 5, characterized in that, When the drug is Aurestatin E, the number of coupling sites of the multi-coupling site aptamer is 2 or 4.

10. The nucleic acid aptamer-conjugated drug as described in claim 7, characterized in that, When the drug is Dxd, the nucleic acid aptamer-conjugated drug is S4D, and its structural formula is:

11. The nucleic acid aptamer-conjugated drug as described in claim 8, characterized in that, When the drug is ixotecan, the nucleic acid aptamer conjugate is S2E or S4E, and the structural formula of S2E is: The structural formula of S4E is:

12. The nucleic acid aptamer-conjugated drug as described in claim 9, characterized in that, When the drug is aurestatin E, the nucleic acid aptamer-conjugated drug is S2M or S4M, and the structural formula of S2M is: The structural formula of S4M is:

13. The use of a nucleic acid aptamer-conjugated drug in the preparation of a reagent to enhance the tumor-suppressive effect of colon cancer, characterized in that, The nucleic acid aptamer-conjugated drug is S4D, and its structural formula is:

14. The use of a nucleic acid aptamer-conjugated drug in the preparation of a reagent that enhances the efficacy of the DNA topoisomerase I inhibitor Dxd, thereby exceeding the in vivo tumor-suppressing effect of eczemab, characterized in that, The nucleic acid aptamer-conjugated drug is S4D, and its structural formula is:

Images