Method for treatment of neurodegenerative diseases with growth hormone releasing hormone and synthetic analogs thereof
GHRH agonists stabilize HIF-1α to improve mitochondrial function and reduce oxidative stress, addressing the challenges of treating FRDA by enhancing cardiac and neuronal health.
Patent Information
- Application Number
- PCT/GR2025/050025
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2026-03-05
AI Technical Summary
There is currently no effective therapeutic strategy for neurodegenerative diseases such as Friedreich's Ataxia (FRDA), particularly due to the difficulty in accessing affected tissues like the heart and sensory neurons, and the lack of suitable animal models, limiting treatment options.
Administering growth hormone releasing hormone (GHRH) agonists, including native GHRH (1-44) and synthetic analogs like CJC-1295, to stabilize HIF-1α protein levels, thereby improving mitochondrial function and reducing oxidative stress in cardiomyocytes and neuronal cells.
GHRH agonists stabilize HIF-1α, enhancing mitochondrial function and reducing oxidative stress, leading to improved cardiac function and neuronal health, thus alleviating symptoms and slowing disease progression in FRDA.
Smart Images

Figure 00000042_0000 
Figure 00000043_0000 
Figure 00000044_0000
Abstract
Description
METHOD FOR TREATMENT OF NEURODEGENERATIVE DISEASES WITH GROWTH HORMONE RELEASING HORMONE AND SYNTHETIC ANALOGS THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application which claims priority to U.S. Provisional Patent Application No. . 63 / 689,169, filed August 30, 2024, the disclosure of which is hereby incorporated by reference in its entirety.INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0002] Incorporated by reference in its entirety is a computer-readable nucleotide / amino acid sequence listing submitted concurrently herewith and identified as follows: “59646P_SeqListing.xml” ; Size: 140,768 bytes; Created: August 26, 2024.STATEMENT OF GOVERNMENT SUPPORT
[0003] This invention was made with government support under HL107110 granted by the National Institutes of Health. The government has certain rights in this invention.BACKGROUND
[0004] Friedreich’s Ataxia (FRDA) is a rare, autosomal recessive neurodegenerative disease from which it is estimated that approximately 25,000 patients suffer from worldwide1. The disease is caused by an inherited mutation in the FXN gene that causes progressive degeneration of sensory neurons and heart failure1 5. Symptoms usually appear in the peri-adolescent stage, leading the children to a gradual immobilization in a wheelchair and, finally, to heart failure 15-25 years later1 5. The FXN gene encodes the frataxin protein, which is essential for proper mitochondrial function and iron homeostasis. In individuals with FRDA, reduced levels of frataxin result in mitochondrial dysfunction, oxidative stress, and iron accumulation in the affected tissues, ultimately causing cellular damage and death. There is currently no cure for FRDA. Ongoing research is focused on understanding the molecular mechanisms underlying the disease and developing potential therapeutic strategies toalleviate symptoms and slow disease progression. There is an unmet need for effective therapeutic strategies for FRDA and other neurodegenerative diseases.SUMMARY
[0005] The present disclosure provides materials and methods for the treatment of a neurodegenerative disease in a subject in need thereof, wherein the method comprises administering a GHRH agonist to a subject in need thereof. In some embodiments, the neurodegenerative disease is FRDA. In other aspects, provided herein is a method of improving cardiac function in a subject suffering from FRDA, wherein the method comprises administering a GHRH agonist to the subject. In various aspects, the GHRH agonist comprises GHRH (1 -44), or a synthetic GHRH analog selected from the group consisting of GHRH (1 -29), CJC-1295, tesamorelin, Sermorelin, Hexarelin, TH9507, MK-677,JI-38, MR-326, MR-327, MR-351 , MR-356, MR-361 , MR-367, MR401 , MR-403, MR-404, MR-405, MR-406, MR-407, MR-408, MR-409, MR-410, MR-420, MR-421 , MR-502, MR-504, and MR-702.
[0006] Additional embodiments and aspects of the presently disclosed methods and compositions are provided below. The use of section headings is merely for the convenience of reading; it should be understood that the disclosure should be read as a whole and all combinations of features described herein are contemplated.BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIG. 1 is a graph depicting qPCR analysis results obtained on days (D) 2, 3, 5, 7, and 9 of hiPSC differentiation. The data indicate that GHRH and GHRH-R receptor synthesis is induced at stages D7 and D9, following the earlier expression of GH / IGF1 , which is confined to D5. Concurrently, synthesis of the GHRH antagonist, SST, is also observed, which according to previous studies promotes the specialization of nociceptive versus proprioceptive sensory neurons. The findings support the time-specific induction of GHRH / GHRH-R signaling in cardiomyocytes and sensory axons.
[0008] FIG. 2A-2B provide a heatmap (FIG. 2A) and reactome analysis (FIG. 2B) of the 83 DEGs identified after 45 min exposure of hiPSC cardiomyoblasts to 0, 150, and 300nM GHRH.
[0009] FIG. 3A-3D demonstrate that knockout of HIF-1 a does not impact the renewal and cardiomyocyte differentiation of hiPSCs. FIG. 3A provides a schematic illustrationof HIF1A gene editing in two distinct regions through CRISPR-Cas9. FIGs. 3B-3C provide qPCR and western blot analyses that demonstrate successful generation of two HIF1A-K0 hiPSCs lines. FIG. 3D shows that WT and HIF1A-K0 hiPSCs are phenotypically indistinguishable.
[0010] FIG. 4A-4C provides the determination of cardiac gene regulatory programs under the control of HIF-1 a through CRISPR / Cas HIF-1 a knockout, via unsupervised hierarchical clustering of the top-20 up- and down- regulated genes (n=3 replicates / group).
[0011] FIG. 5A-5B show that GHRH / GHRH-R signaling dose-dependently affects the expression of HIF1A target genes in hiPSC-derived cardiomyoblasts. (FIG. 5A), IGV genome viewer snapshots depicting HIF1A ChlP-seq tracks (black, n=2) relative to input (magenta, n=1 ). SST, LDHA, GLUT1 and NKX2-5 are HIF1A target genes, whereas GHRH and GHRH-R are not. (FIG. 5B), qPCR analysis of HIF1A targets in day-7 WT and HIF1A-KO cardiomyoblasts, in response to 45-min stimulation with increasing recombinant human (rh)GHRH concentrations (n=2 / group).
[0012] FIG. 6A-6E show the determination of cardiac gene regulatory programs under the control of H I F1 A through ChlP-seq analysis. FIG. 6A provides a MEME motif of the DNA sequences ±50bp from the HIF-1 a ChlP-seq peak summits with a q-val < 1x1 O’100. FIG. 6B shows a venn plot illustrating the overlaps between the RNA-seq (green, yellow) and ChlP-seq (blue) datasets (note a common gene in HIF1A-KO UP and DOWN datasets corresponding to different transcript variants). FIG. 6C shows the top-10 HDSigDB terms enriched in HIF1A target- and non-target upregulated genes. FIG 6D shows a HIF-1 a ChlP-seq peak spanning approximately 1 kilobase around exon 1 of the FXN gene. FIG. 6E shows a UCSC genome browser snapshot (GRCh38 / hg38), illustrating that the HIF-1a bound region is enriched in promoter-like (E2694913 / prom, E2694914 / prom, E2694915 / prom, E2694916 / prom) and enhancerlike (E2694917 / enhP, E2694918 / enhP) cis-regulatory elements.
[0013] FIG. 7A-7C provide metabolomic analyses indicating that the induction of an FRDA-like gene expression profile in HIF-1 a knockout cardiomyoblasts impairs aerobic glycolysis during human cardiomyogenesis. FIG. 7A provides GC / MS analysis of intracellular (green) and extracellular (orange) metabolites on day 0 of cardiac differentiation showing decreased intracellular levels of D-Glucose and increased levels of Krebs cycle intermediates (e.g., citrate and malate) in WT versus HIF1a-KO hiPSCs, indicating impaired aerobic glucose metabolism (Warburg effect) in HIF1 a-KO hiPSCs. FIG. 7B shows that on day 10, WT hiPSC cardiomyocytes display increased extracellular lactic acid, decreased glucose concentration, and accumulation of Krebs cycle intermediates (e.g., fumarate, citrate, 2-ketoglutarate, malate, and succinate). In contrast, HIF1 a-KO hiPSC cardiomyocytes show increased intracellular levels of palmitate and stearate, suggesting that HIF-1a knockout redirects glycolytically-derived citrate toward saturated fatty acid biosynthesis. FIG. 7C provides a graphic summary of metabolomic studies on day 10 hiPSC cardiomyocytes (n=3 / group). Collectively, these data suggest that HIF1 a-mediated activation of aerobic glycolysis may serve as a compensatory mechanism for FRDA-associated metabolic dysfunction.
[0014] FIG. 8A-8B provide functional enrichment analyses of HIF1 A target and nontarget differentially expressed genes between wild type (WT) and HIF1A-KO human induced pluripotent stem cells (hiPSC)-derived cardiomyocytes. FIG. 8A shows a dot plot of top-25 Small Molecule Pathway Database (SMPDB)-enriched terms following over representation analysis of significantly different extracellular metabolites between WT and HIF1 a-KO hiPSC-derived cardiomyocytes. FIG. 8B shows SMPDB-enriched terms following over representation analysis of significantly different intracellular metabolites between WT and HIF1A-KO hiPSC-derived cardiomyocytes.
[0015] FIG. 9 provides a KEGG pathway diagram with DEGs highlighted.
[0016] FIG. 10A-1 OF demonstrate that GHRH / GHRH-R activation induces metabolic changes in hiPSC-derived cardiomyocytes. FIG. 10A provides western blot analysis demonstrating that reduced expression of mitochondrial oxidative phosphorylation complexes in response to recombinant human (rh)GHRH stimulation. In FIG. 10B, Seahorse Live-cell Metabolic Assay measurements of oxygen consumption rate (OCR). (FIG. 10C), Total ATP production; (FIG. 10D), Extracellular acidification rate (ECAR), representing glycolysis. In FIG. 10E-10F, glycolytic rate (glycolysis induction subtracted for basal ECAR) (FIG. 10E) and glycolytic capacity (maximal glycolysis subtracted for basal ECAR) (FIG. 10F) are derived from the ECAR curve. The data were pooled from three independent experiments in duplicates or triplicates (n=6-9). *p<0.05.
[0017] FIG. 11 A-11 D show that GHRH / GHRH-R signaling dose-dependently affects the expression of HIF1 A target genes in hiPSC-derived cardiomyoblasts. In FIG. 11 A, IICSC genome browser snapshot depicting the position of gRNAs #7 and #8 which were simultaneously expressed along with dCas9-VP64 to activate GHRH-R. In FIG.11 B, Western blot confirming stable overexpression of GHRH-R in hiPSCs (GHRH-R- OE). In FIG. 110, Quantitative (q)PCR analysis of GHRH-R and HIF1A in dCas9- VP64, GHRH-R-OE and HIF1a-K0 hiPSCs. In FIG. 11 D, qPCR analysis demonstrates that upregulation of GHRH-R enhances NKX2-5 expression and, consequently, cardiomyogenic differentiation, compared to HIF1A-K0 and dCas9- VP64 hiPSC lines. (***p<0.005, **p<0.005, *p<0.05) (n=3 / group).
[0018] FIG. 12A-12C illustrate the use of iPSC-derived neuromyocardial organoids as a novel in vitro model of Friedreich’s Ataxia (FRDA). FIG. 12A presents representative confocal immunofluorescence images demonstrating the codevelopment of spontaneously beating cardiomyocytes (a-sarcomeric actinin-positive) and proprioceptive neurons (parvalbumin-positive) within the organoid structure. FIG. 12B shows quantitative analyses of mRNA expression levels of IGF-1 and FXN (left bar graphs), as well as the corresponding extracellular protein concentrations of IGF- 1 and human growth hormone (hGH) in organoid culture media (right bar graphs), following treatment with GHRH analogs. FIG. 12C displays reactive oxygen species (ROS) levels in FRDA and isogenic control organoids, and the effect of CJC-1295 treatment on ROS reduction.
[0019] FIG. 13A-13E illustrate the therapeutic effects of CJC-1295 treatment in YG8JR mice, a transgenic model of Friedreich’s Ataxia (FRDA). FIG. 13A shows representative images of mice from the placebo group (top row) and the CJC-1295- treated group (bottom row), captured at baseline (Day 0, left three images) and after five weeks of treatment (right three images). Notable differences in coat condition and overall size are observed. FIG. 13B displays the average body weight gain over the five-week treatment period, highlighting improved growth trajectory in CJC-1295- treated animals compared to placebo controls. FIG. 13C-13E summarize performance on the beam walk test. CJC-1295-treated mice exhibited superior motor coordination, as evidenced by greater distances traveled (FIG. 13C), reduced traversal time (FIG. 13D), and significantly fewer motor errors, including hindlimb slips and dragging events (FIG. 13E).DETAILED DESCRIPTION
[0020] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which thisdisclosure belongs. All patents and publications referred to herein are incorporated by reference in their entireties.
[0021] The disclosure provides methods of treating neurodegenerative diseases in a subject in need thereof. The methods comprise administering a growth hormone releasing hormone (GHRH) agonist to a subject in need thereof, thereby treating the neurodegenerative disease. In various aspects the neurodegenerative disease is Friedreich’s ataxia.
[0022] A “subject in need thereof” is a mammal, which refers to any member of the class Mammalia, including, without limitation, humans and nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domesticated mammals, such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like. The term does not denote a particular age or sex. Thus, adults (i.e. , human subjects aged 18 years or more), children (i.e., human subjects aged one to eighteen years) and newborns (i.e., human subjects aged one year or less), whether male or female, are intended to be included within the scope of ’’subject.”
[0023] The GHRH agonist of the instant disclosure may be administered to a mammalian subject in a pharmaceutically effective dose (i.e., a dose that achieves a desired biological effect in a clinically relevant period of time) by any clinically appropriate route, including but not limited to intravenous, intraarterial injection or infusion directly into a tissue parenchyma, etc. Where necessary or desired, administration can include, but is not limited to, orally, via inhalation, via a pulmonary route of administration, topically, transdermally, intraplurally, intraperitoneally, via application to a mucous membrane, parenterally, intravenously, subcutaneously, intramuscularly, or intranasally.
[0024] The terms “treat,” “treatment,” “treating,” or “amelioration” refer to any degree of reversal, alleviation, amelioration, inhibition, or halting of the progression or seventy of a neurodegenerative disease itself or any symptom associated with the neurodegenerative disease. In this regard, the term “treating” includes reducing or alleviating at least one adverse effect or symptom of a neurodegenerative disease. Treatment is generally “effective” if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective” if the progression of a disease is reduced or halted. That is, “treatment” includes not just the improvement of symptoms or markers, but also a cessation or at least slowing of progress or worsening ofsymptoms that would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
[0025] The term “effective amount” as used herein refers to the amount of a GHRH agonist or composition comprising the GHRH agonist needed to alleviate at least one or more symptoms of the disease. An effective amount also includes an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom disease (for example, but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease.
[0026] The disclosure provides a method of treating a neurodegenerative disorder in a subject in need thereof. Neurodegenerative diseases include, but are not limited to, Friedreich’s ataxia (FRDA), Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), Parkinson’s disease, frontotemporal dementia (FTLD), frontotemporal lobar degeneration, Lewy body dementia (LBD), prion disease, Motor neuron diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), traumatic brain injury, neuronal ceroid lipofuscinosis (NCL), multiple sclerosis, aigyrophilic grain dementia, Alexander’s disease Alper's disease, cerebral palsy, Cockayne syndrome, corticobasal degeneration, Creutzfeldt-Jakob disease, dementia pugilistica, diffuse neurofibrillary tangles with calcification, HIV-associated dementia, Lewy body dementia, Kennedy's disease, neuroborreliosis, primary lateral sclerosis, Refsum's disease, Gerstmann-Straussler-Scheinker disease, Hallevorden- Spatz disease, hereditary diffuse leukoencepholopathy with spheroids (HDLS), inclusion body myositis, multiple system atrophy, myotonic dystrophy, Nasu-Hakola disease, Schilder's disease, Wobbly Hedgehog Syndrome (WHS), Duchenne-Aran muscular atrophy, progressive bulbar palsy, pseudobulbar palsy, HIV-associated neurocognitive disorder (HAND), tauopathy, chronic traumatic encephalopathy, cerebellar downbeat nystagmus, stroke, ischemic damage to the nervous system, Guillian-Barre syndrome, acute motor axonal neuropathy, acute inflammatory demyelinating polyneuropathy, Fisher syndrome, HIV / AIDS dementia complex, axonomy, diabetic neuropathy, vascular dementia, multi-infarct dementia, Lewy body dementia, Pick’s disease, subcortical dementias, and focal cortical atrophy syndromes.
[0027] FRDA is caused by mutations of the FXN gene, specifically GAA triplet expansions in the first intron of the gene that are inherited from carrier parents and lead to reduced production of FXN, at levels ranging from 5-40% of normal expression1. In humans, the FXN gene encodes a cytoplasmic protein of 210 amino acids, which is then transported to the mitochondria where the signal sequence is cleaved by mitochondrial peptidases to give its mature, mitochondrial isoform of 130 amino acids (81 -210)11 12. The role of FXN in mitochondria is not fully understood, but its primary function seems to be in the biosynthesis of iron-sulfur (Fe-S) complexes. FXN accelerates the transfer of persulfide from the desulfurase NFS1 to the ISCU scaffold protein, facilitating the formation of 2Fe-2S complexes by combining with iron ions. These Fe-S complexes are crucial cofactors for activating many metalloproteins involved in essential cellular processes, such as the Krebs cycle (e.g., aconitase, succinic dehydrogenase), the electron transport chain (complexes l / ll / lll), and gene expression11’13Therefore, reduced FXN synthesis slows down 2Fe-2S biogenesis, leading to mitochondrial dysfunction and altered gene expression. Despite its vital role in metabolism, FXN deficiency seems to be partially mitigated by unknown molecular compensatory mechanisms, as the effects of FRDA on normal development and homeostasis are somewhat limited. Specifically, the pathology primarily originates in the myocardium and in large myelinated proprioceptive neurons in the dorsal root ganglia before gradually progressing to degeneration of the dorsal column of the neural tube and eventually expanding cranially to the cerebellum, leading to the gradual destruction of the afferent nervous system. FRDA is also marked by scoliosis in the thoracolumbar region, vestibular system disorders, and eventual heart failure1 5. The first symptoms usually appear in the peri-adolescent stage, with the number of GAA expansions determining the severity of the disease - the more GAA repeats, the faster and more severe the onset of the disease1 5. Furthermore, a particularly interesting symptom of FRDA is the complications in growth mechanisms, as both FRDA patients14’16and mice with FXN17’19silencing mutations show significantly smaller size at birth and also the growth spurt during puberty is significantly limited.
[0028] A number of factors have contributed to a lack of treatment options for FRDA, such as: (a) FRDA affecting two of the most difficult-to-access tissues, namely the heart and sensory neurons, making it difficult to directly assess the safety and efficacy of new potential treatments7 8, (b) the disease is human-specific, and thus existing animal models do not fully cover the spectrum of FRDA7 8, and (c) the need to conductlong-term clinical trials leads is often limited by the relatively small pool of FRDA patients, as the decision to participate in a clinical trial removes the ability of patients to participate in another study concurrently, usually for several years after the initial study has concluded6’9’10.
[0029] There are various symptoms exhibited by a subject in need thereof who is suffering from FRDA. In the nervous system, FRDA particularly affects the spinal cord and peripheral nerves. Sensory neurons in the dorsal root ganglia (DRG) are among the most impacted cell populations in FRDA. DRG neurons are responsible for transmitting sensory information, including pain, touch, and temperature from peripheral tissues to the spinal cord. Damage to these neurons in FRDA patients leads to a loss of sensory function, including proprioception (the sense of body position), which contributes to the characteristic gait ataxia and impaired coordination observed in this disease.
[0030] FRDA can also impact the cerebellum, which is crucial for maintaining balance and coordination, and the corticospinal tracts, which are involved in motor function. The progressive degeneration of these neural structures leads to the typical clinical features of FRDA, including ataxia, muscle weakness, loss of reflexes, and dysarthria.
[0031] FRDA is also known to cause heart disease, specifically a condition called hypertrophic cardiomyopathy, in a significant proportion of affected individuals. Hypertrophic cardiomyopathy is characterized by the thickening of the heart muscle, particularly the left ventricle, which can lead to impaired cardiac function, heart failure, and, in some cases, sudden death. The exact mechanisms by which FRDA causes hypertrophic cardiomyopathy are not completely understood, but several factors have been implicated. One such factor is frataxin deficiency; as FRDA results from mutations in the FXN gene, affected individuals have reduced levels of the frataxin protein. Frataxin deficiency in cardiac cells leads to mitochondrial dysfunction, which impairs energy production and contributes to oxidative stress due to increased production of reactive oxygen species (ROS). Another factor is oxidative stress; the increased ROS production caused by mitochondrial dysfunction damages cellular structures, including proteins, lipids, and DNA, ultimately contributing to cardiomyocyte dysfunction and cell death. The heart’s high energy demand makes it particularly vulnerable to oxidative stress. Still another factor is iron accumulation; frataxin deficiency also results in abnormal iron accumulation within the mitochondriaof cardiac cells. Excess iron catalyzes the production of more ROS, exacerbating oxidative stress and further damaging the cells. Moreover, iron overload can directly impair the function of vital cellular processes and structures, including the electron transport chain and other iron-sulfur cluster-containing proteins. Another factor is inflammation; the cellular damage and oxidative stress triggered by frataxin deficiency and iron accumulation can lead to an inflammatory response, which has been implicated in the pathogenesis of hypertrophic cardiomyopathy in FRDA.
[0032] Contemplated herein are methods of treating a subject in need thereof, wherein the subject in need thereof is suffering from FRDA, and wherein administration of one or more GHRH agonists ameliorates, reduces, or mitigates one or more adverse effects or symptoms of FRDA. In various embodiments, administration of one or more GHRH agonists improves cardiac function in a subject suffering from FRDA.
[0033] Hypoxia represents a potential therapeutic strategy for treating FRDA. Oxygen scarcity, known as hypoxia, promotes survival of in vivo models of FRDA by restoring the necessary signaling pathways for Fe-S metabolism associated with mitochondrial function. HIF-1 a, a key transcription factor encoded by HIF1A, facilitates cellular adaptation to hypoxia and is considered as the molecular sensor of hypoxia. When oxygen levels are low, HIF-1 a accumulates and partners with constitutively expressed subunit HIF-113 and coactivators such as cAMP response element-binding protein binding protein (CBP / p300), activating a range of target genes involved in angiogenesis, erythropoiesis, tissue repair, and acclimatization to high altitudes. Under normoxia, hydroxylation of two proline residues and acetylation of a lysine residue at the oxygen-dependent degradation domain of HIF-1 a triggers its association with pVHL E3 ligase complex, leading to HIF-1 a degradation via the ubiquitin-proteasome pathway (Ke and Costa, Molecular Pharmacology, 70(5): 1469- 80, 2006). HIF-1 a dysregulation contributes to the development and progression of pathological conditions, including cancer, where it fosters tumor expansion, metastasis, and therapy resistance.
[0034] GHRH, a neuropeptide primarily produced in the hypothalamus, is vital for stimulating the release of growth hormone (GH) from the anterior pituitary gland. GHRH achieves this by interacting with GHRH-R on somatotroph cells' surface in the anterior pituitary. This interaction activates intracellular signaling pathways, mainly involving adenylyl cyclase activation and increased cAMP production. The subsequentelevation in cAMP levels prompts PKA activation, stimulating GH synthesis and secretion. The GHRH / GHRH-R signaling pathway is a critical component of the hypothalamic-pituitary growth axis, which oversees body growth, development, and metabolism. Disruption of this pathway has been linked to growth-related disorders, such as GH deficiency and pituitary dwarfism.
[0035] Surprisingly, it has been determined that GHRH agonists have a beneficial effect on pathways associated with neurodegenerative diseases, such as FRDA, and are suitable for use in the treatment of the disease (and / or alleviation of symptoms associated therewith). Indeed, this disclosure is based, at least in part, upon the discovery that GHRH and its synthetic analogs can stabilize HIF-1 a in cardiomyocytes, and indirectly in neuronal cells, through endocrine, paracrine, and autocrine signaling mechanisms. It is hypothesized that this stabilization occurs via the activation of the GHRH / GHRH-R signaling pathway, which has been found to enhance HIF-1 a stability and function in an oxygen-independent manner. While not wishing to be bound by any particular theory, the ability of GHRH and GHRH-R to stabilize HIF-1 a protein levels directly in cardiomyocytes and indirectly in neuronal cells can lead to beneficial effects on mitochondrial function, cell survival, and oxidative stress reduction. Many synthetic analogs of GHRH have been prepared based on the structure of the native peptide, and are contemplated herein for use in the context of the method.
[0036] A GHRH agonist is an agent that activates the GHRH / GHRH-R signaling pathway. In various aspects, the GHRH agonist is native GHRH (1 -44) or a synthetic GHRH analog. In various aspects, the GHRH agonist is a GHRH mimetic. Synthetic analogs of GHRH include, but are not limited to, GHRH (1 -29), CJC-1295, tesamorelin, MR409, JI-38, MR-326, MR-327, MR-351 , MR-356, MR-361 , MR-367, MR401 , MR-403, MR-404, MR-405, MR-406, MR-407, MR-408, MR-409, MR-410, MR-420, MR-421 , MR-502, MR-504, MR-702, and others with similar biological activities. GHRH analogs are further disclosed in International Patent Publication No. WO 2014 / 100809, which is herein incorporated by reference in its entirety.
[0037] Examples of synthetic hGHRH agonist peptides are listed below:
[0038] P-20103 [N-Me-Tyr1 , Fpa56, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0039] P-20105 [N-Me-Tyr1 , D-Ala2, Fpa56, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0040] P-20107 [N-Me-Tyr1 , Fpa56, Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0041] P-20109 [N-Me-Tyr1 , D-Ala2, Fpa56, Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0042] P-20110 [N-Me-Tyr1 , D-Ala2, Fpa56, Orn12, Abu15, Orn21 , Nle27, Agm29]hGHRH(129)
[0043] P-20111 [N-Me-Tyr1 , D-Ala2, Fpa56,Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0044] P-20113 [N-Me-Tyr1 , Fpa56, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0045] P-20115 [N-Me-Tyr1 , Fpa56, Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0046] P-20117 [N-Me-Tyr1 , D-Ala2, Fpa56, Gln8, Orn12, Abu15, Orn21 , Nle27, Agm29]hGHRH(1 -29)
[0047] P-20350 [Dat1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0048] P-20351 [Ac-N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0049] P-20356 [N-Me-Tyr1 , Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0050] P-20357 [Dat1 , D-Ala2, N-Me-Ala8, Orn12, Abul 5, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0051] P-20358 [N-Me-Tyr1 , D-Ala2, N-Me-Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0052] P-20359 [N-Me-Tyr1 , D-Ala2, Fpa56, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0053] P-20360 [N-Me-Tyr1 , D-Ala2, Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0054] P-20361 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abul 5, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0055] P-20367 [N-Me-Tyr1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH (1 -29)
[0056] P-20370 [N-Me-Tyr1 , Orn12, Abu15, Orn21 , Nle27, Asp28, Agm29]hGHRH(1 -29)
[0057] P-20371 [N-Me-Tyr1 , Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28,Agm29]hGHRH(1-29)
[0058] P-20372 [N-Me-Tyr1 , Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28,Agm29]hGHRH(1-29)
[0059] P-20373 [N-Me-Tyr1 , Gln8, Orn12, Abu15, Orn21, Nle27,Agm29]hGHRH(1-29)
[0060] P-20374 [N-Me-Tyr1 , Orn12, Abu15, Orn21, Nle27, Agm29]hGHRH(1 -29)
[0061] P-20375 [N-Me-Tyr1 , Thr8, Orn12, Abu15, Orn21 , Nle27,Agm29]hGHRH(1-29)
[0062] P-20376 [N-Me-Tyr1 , Ala8, Orn12, Abu15, Orn21, Nle27,Agm29]hGHRH(1-29)
[0063] P-21300 [Dat1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27, Asp28, Amc30]hGHRH(1 -30)NH2
[0064] P-21301 [N-Me-Tyr1 , Orn12, Abu15, Orn21 , Nle27, Asp28,Amc30]hGHRH(1-30)NH2
[0065] P-21303 [N-Me-Tyr1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27, Asp28,Amc30]hGHRH(1-30)NH2
[0066] P-21304 [Dat1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28,Amc30]hGHRH(1-30)NH2
[0067] P-21305 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28,Amc30]hGHRH(1-30)NH2
[0068] P-21306 [Dat1 , D-Ala2, Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28,Amc30]hGHRH(1-30)NH2
[0069] P-21307 [N-Me-Tyr1 , D-Ala2, Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28,Amc30]hGHRH(1-30)NH2
[0070] P-21308 [Dat1 , D-Ala2, Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28, Amc30]hGHRH(1-30)NH2
[0071] P-21309 [N-Me-Tyr1 , D-Ala2, Orn12, Ala8, Abu15, Orn21, Nle27, Asp28, Amc30]hGH- RH(1-30)NH2
[0072] P-21310 [Dat1 -D-Ala2, His11 , Orn12, Abu15, His20, Orn21 , Nle27, Asp28, Amc30]hGHRH(1-30)NH2
[0073] P-21311 [N-Me-Tyr1 , D-Ala2, His11 , Orn12, Abu15, His20, Orn21, Nle27, Asp28,Amc30]hGHRH(1 -30)NH2
[0074] P-22325 [N-Me-Tyr1 , Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Apa30]hGHRH (1-30)NH2
[0075] P-22326 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Apa30]hGHRH(1-30)NH2
[0076] P-22327 [Dat1 , Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Apa30]hGHRH(1-30)NH2
[0077] P-22328 [Ac-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Apa30]hGHRH(1-30)NH2
[0078] P-22329 [N-Me-Tyr1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27, Apa30]hGHRH(1-30)NH2
[0079] P-22330 [N-Me-Tyr1 , D-Ala2, Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28, Apa30]hGHRH(1-30)NH2
[0080] P-22331 [N-Me-Tyr1 , D-Ala2, Ala8, Orn12, Abu15, Orn21, Nle27, Asp28, Apa30]hGHRH(1-30)NH2
[0081] P-22332 [N-Me-Tyr1 , Orn12, Abu15, Orn21 , Nle27, Asp28, Apa30]hGHRH(1-30)NH2
[0082] P-22334 [N-Me-Tyr1 , Orn12, Abu15, Orn21 , Nle27, Apa30]hGHRH(1 - 30)NH2
[0083] P-22335 [N-Me-Tyr1 , Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28, Apa30]hGHRH(1-30)NH2
[0084] P-22336 [N-Me-Tyr1 Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28, Apa30]hGHRH(1-30)NH2
[0085] P-22337 [N-Me-Tyr1 , D-Ala2, Cpa6, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Apa30]hGHRH(1 -30)NH2
[0086] P-23250 [Dat1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Har30]hGHRH(1-30)NH2
[0087] P-23251 [Dat1 , Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28,Har30]hGHRH(1-30)NH2
[0088] P-23252 [Dat1-D-Ala2, Orn12, Abu15, Orn21, Nle27, Asp28,Har30]hGHRH(1-30)NH2
[0089] P-23253 [Dat1 , Orn12, Abu15, Orn21 , Nle27, Asp28, Har30]hGHRH(1 - 30)NH2
[0090] P-23254 [Dat1 , D-Ala2, Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28, Har30]hGHRH(1-30)NH2
[0091] P-23255 [Dat1 , Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28,Har30]hGHRH(1-30)NH2
[0092] P-23256 [Dat1 , D-Ala2, Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28, Har30]hGHRH(1-30)NH2
[0093] P-23257 [Dat1 , Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28,Har30]hGHRH(1 -30)NH2
[0094] P-23258 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abul 5, Orn21 , Nle27, Asp28, Har30]hGHRH(1-30)NH2
[0095] P-23259 [N-Me-Tyr1 , Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28,Har30]hGHRH(1-30)NH2
[0096] P-23260 [N-Me-Tyr1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27, Asp28,Har30]hGHRH(1-30)NH2
[0097] P-23261 [N-Me-Tyr1 , Orn12, Abu15, Orn21, Nle27, Asp28,Har30]hGHRH(1-30)NH2
[0098] P-23262 [N-Me-Tyr1 , D-Ala2, Thr8, Orn12, Abul 5, Orn21 , Nle27, Asp28, Har30] hGHRH(1-30)NH2
[0099] P-23263 [N-Me-Tyr1 , Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28, Har30]hGHRH(1-30)NH2
[0100] P-23264 [N-Me-Tyr1 , D-Ala2, Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28, Har30] hGHRH(1-30)NH2
[0101] P-23265 [N-Me-Tyr1 , Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28, Har30]hGHRH(1-30)NH2
[0102] P-24340 [N-Me-Tyr1 , Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Aha30]hGHRH(1-30)NH2
[0103] P-24341 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Aha30] hGHRH(1-30)NH2
[0104] P-24342 [Dat1 , Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Aha30]hGHRH(1-30)NH2
[0105] P-24344 [Dat1 -D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Aha30]hGH RH(1-30)NH2
[0106] P-24345 [N-Me-Tyr1 , D-Ala2, Orn12, Abu15, Orn21, Nle27, Asp28, Aha30] hGHRH(1-30)NH2
[0107] P-24346 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21, Nle27, Aha30]hGH RH(1-30)NH2
[0108] P-24347 [N-Me-Tyr1 , D-Ala2, Thr8, Orn12, Abu15, Orn21, Nle27, Asp28, Aha30]hGHRH(1-30)NH2
[0109] P-24348 [N-Me-Tyr1 , D-Ala2, Ala8, Orn12, Abu15, Orn21, Nle27, Asp28, Aha30]hGHRH(1-30)NH2
[0110] P-25501 [N-Me-Tyr1 , D-Ala2, Orn12, Abu15, Orn21, Nle27, Gab30]hGHRH(1-30)NH2
[0111] P-25502 [Dat1 , D-Ala2, Fpa56, Orn12, Abu15, Orn21, Nle27,Gab30]hGHRH(1-30)NH2
[0112] P-25503 [N-Me-Tyr1 , Abu2, Orn12, Abu15, Orn21, Nle27,Gab30]hGHRH(1-30)NH2
[0113] P-25504 [Dat1, D-Abu2, Orn12, Abu15, Orn21, Nle27, Gab30]hGHRH(1- 30)NH2
[0114] P-25506 [N-Me-Tyr1 , D-Abu2, Orn12, Abu15, Orn21, Nle27,Gab30]hGHRH(1-30)NH2
[0115] P-25508 [Tfa-Tyr1, D-Ala2, Orn12, Abu15, Orn21, Nle27,Gab30]hGHRH(1-30)NH2
[0116] P-25516 [N-Me-Tyr1, D-Ala2, Orn12, Abu15, Orn21, Nle27, Asp28, Gab30]hGH RH(1-30)NH2
[0117] P-26802 [Dat1 , D-Ala2, Thr8, His11 , Orn12, Abu15, His20, Orn21 , Nle27, Ada30]hGHRH(1-30)NH2
[0118] P-26803 [N-Me-Tyr1 , D-Ala2, Gln8, His11, Orn12, Abu15, His20, Orn21, Nle27, Ada30]hGHRH(1 -30)NH-CH3
[0119] P-26804 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21, Nle27, Ada30]hGH RH(1-30)NH2
[0120] P-27400 [Dat1, D-Ala2, Orn12, Abu15, Orn21, Nle27, Asp28]hGHRH(1- 29)NH-CH3
[0121] P-27401 [Dat1, D-Ala2, Gln8, Orn12, Abu15, Orn21, Nle27, Asp28, D- Arg29]hGH RH(1-29)NH-CH3
[0122] P-27403 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21, Nle27, Asp28]hGH RH(1-29)NH-CH3
[0123] P-27404 [N-Me-Tyr1, D-Ala2, Fpa56, Orn12, Abu15, Orn21, Nle27, Asp28]hGH RH(1-29)NH-CH3
[0124] P-27405 [N-Me-Tyr1, Gln8, Orn12, Abu15, Orn21, Nle27]hGHRH(1- 29)NH-CH3
[0125] P-27406 [N-Me-Tyr1 , Gln8, Orn12, Abu15, Orn21 , Nle27,Asp28]hGHRH(1 - 29)NH-CH3
[0126] P-27407 [Dat1 , Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28]hGHRH(1 -29)NH-CH3
[0127] P-27408 [Dat1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28]hGHRH(1 -30)NH-CH3
[0128] P-27409 [N-Me-Tyr1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27,Asp28]hGHRH(1 -29)NH-CH3
[0129] P-27410 [N-Me-Tyr1 , D-Ala2, Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28]hGH RH(1 -29)NH-CH3
[0130] P-27411 [N-Me-Tyr1 , D-Ala2, Thr8, Orn12, Abu15, Orn21 ,Nle27]hGHRH(1 -29)NH-CH3
[0131] P-27412 [N-Me-Tyr1 , D-Ala2, Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28]hGH RH(1 -29)NH-CH3
[0132] P-27413 [Dat1 , Gln8, His11 , Orn12, Abu15, His20, Orn21 , Nle27, Asp28]hGH RH(1 -29)NH-CH3
[0133] P-27414 [N-Me-Tyr1 , D-Ala2, Fpa56, Orn12, Abu15, Orn21 , Nle27, Gab30]hGH RH(1 -30)NH-CH3
[0134] P-27415 [N-Me-Tyr1 , Orn12, Abu15, Orn21 , Nle27, Gab30]hGHRH(1 -30)NH-CH3
[0135] P-27416 [N-Me-Tyr1 , D-Ala2, Gln8, His11 , Orn12, Abu15, His20, Orn21 , Nle27, Asp28]hGHRH(1 -29)NH-CH3
[0136] P-27417 [Ac-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28]hGH RH(1 -29)NH-CH3
[0137] P-27418 [Ac-Tyr1 , D-Ala2, Fpa56, Orn12, Abu15, Orn21 , Nle27, Asp28]hGH RH(1 -29)NH-CH3
[0138] P-27419 [Ac-Tyr1 , Thr8, Orn12, Abu15, Orn21 , Nle27]hGHRH(1 -29)NH- CH3
[0139] P-27422 [N-Me-D-Tyr1 , Gln8, Orn12, Abu15, Orn21 , Nle27,Asp28]hGHRH(1 -29)NH-CH3
[0140] P-27423 [N-Me-D-Tyr1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27, Asp28]hGHRH(1 -29)NH-CH3
[0141] P-27424 [Dat1 , Thr8, Orn12, Abu15, Orn21 , Nle27]hGHRH(1 -29)NH-CH3
[0142] P-27425 [N-Me-D-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28]hGHRH(1 -29)NH-CH3
[0143] P-27440 [Dat1 , Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, D- Arg29]hGHRH(1 -29)NH-CH3
[0144] P-27441 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, D-Arg29]hGHRH(1 -29)NH-CH3
[0145] P-27442 [N-Me-Tyr1 , D-Ala2, Fpa56, Orn12, Abu15, Orn21 , Nle27, Asp28, D-Arg29]hGHRH(1 -29)NH-CH3
[0146] P-27443 [N-Me-Tyr1 , Orn12, Abu15, Orn21 , Nle27, D-Arg29]hGHRH(1 - 29)NH-CH3
[0147] P-27444 [N-Me-Tyr1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27, Asp28, D- Arg29]hGHRH(1 -29)NH-CH3
[0148] P-27445 [N-Me-Tyr1 , D-Ala2, Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28, D-Arg29] hGHRH(1 -29)NH-CH3
[0149] P-27446 [N-Me-Tyr1 , D-Ala2, Ala8, Orn12, Abu15, Orn21 , Nle27, Asp28, D-Arg29] hGHRH(1 -29)NH-CH3
[0150] P-27447 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Apa30]hGHRH(1 -30)NH-CH3
[0151] P-27448 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Aha30]hGHRH(1 -30)NH-CH3
[0152] P-27449 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Amc30]hGHRH(1 -30)NH-CH3
[0153] P-27450 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Har30]hGHRH(1 -30)NH-CH3
[0154] P-27451 [N-Me-Tyr1 , D-Ala2, Gln8, His11 , Orn12, Abu15, His20, Orn21 , Nle27, Asp28, Apa30]hGHRH(1 -30)NH-CH3
[0155] P-28420 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28]hGHRH(1 -29)NH-CH2-CH3
[0156] P-28421 [N-Me-Tyr1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27,Asp28]hGHRH(1 -29)NH-CH2-CH3
[0157] P-28430 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27] hGHRH (1 -29)NH-CH2-CH3
[0158] P-28431 [N-Me-Tyr1 , D-Ala2, Thr8, Orn12, Abu15, Orn21 , Nle27, Asp28] hGHRH(1 -29)NH-CH2-CH3
[0159] P-28460 [N-Me-Tyr1 , D-Ala2, Fpa56, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28]hGHRH(1 -29)NH-CH2-CH3
[0160] P-28461 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 ,Nle27]hGHRH(1 -29)NH-CH2-CH3
[0161] P-28462 [N-Me-Tyr1 , D-Ala2, Fpa56, Orn12, Abu15, Orn21 ,Nle27]hGHRH(1 -29)NH-CH2-CH3
[0162] P-28463 [N-Me-Tyr1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27]hGHRH(1 - 29)NH-CH2-CH3
[0163] P-28464 [N-Me-Tyr1 , D-Ala2, Fpa56, Gln8, Orn12, Abu15, Orn21 , Nle27] hGHRH(1 -29)NH-CH2-CH3
[0164] P-28465 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28] hGHRH(1 -29)NH-CH2-CH3
[0165] P-28466 [N-Me-Tyr1 , D-Ala2, Fpa56, Orn12, Abu15, Orn21 , Nle27, Asp28] hGHRH(1 -29)NH-CH2-CH3
[0166] P-28467 [N-Me-Tyr1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27,Asp28]hGHRH(1 -29)NH-CH2-CH3
[0167] P-28468 [N-Me-Tyr1 , D-Ala2, Fpa56, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28]hGHRH(1 -29)NH-CH2-CH3
[0168] P-28469 [Dat1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27]hGHRH(1 - 29)NH-CH2-CH3
[0169] P-28470 [Dat1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27]hGHRH(1 -29)NH- CH2-CH3
[0170] P-28471 [Dat1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27,Asp28]hGHRH(1 -29)NH-CH2-CH3
[0171] P-28472 [Dat1 , D-Ala2, Fpa56, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28] hGHRH(1 -29)NH-CH2-CH3
[0172] P-28473 [Dat1 , D-Ala2, Fpa56, Orn12, Abu15, Orn21 , Nle27, Asp28]hGHRH(1 -29)NH-CH2-CH3
[0173] P-28474 [Dat1 , D-Ala2, Orn12, Abu15, Orn21 , Nle27, Asp28] hGHRH(1 - 29)NH-CH2-CH3
[0174] P-28475 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Apa30] hGHRH(1 -30)NH-CH2-CH3
[0175] P-28476 [N-Me-Tyr1 , D-Ala2, Gln8, Orn12, Abu15, Orn21 , Nle27, Asp28, Aha30]hGHRH(1 -30)NH-CH2-CH3
[0176] P-28477 [N-Me-Tyr1, D-Ala2, Gln8, Orn12, Abu15, Orn21, Nle27, Asp28, Amc30]hGHRH(1 -30)NH-CH2-CH3
[0177] P-28478 [N-Me-Tyr1, D-Ala2, Gln8, Orn12, Abu15, Orn21, Nle27, Asp28, Har30] hGHRH(1-30)NH-CH2-CH3
[0178] P-28479[N-Me-Tyr1 , D-Ala2, Gln8, His11 , Orn12, Abu15, His20, Orn21, Nle27, Asp28, Apa30]hGHRH(1-30)NH-CH2-CH3
[0179] P-29701 [N-Me-Tyr1,D-Ala2,Gln8, Orn12,Abu15,Orn21,Nle27,Asp28,Gln-Gab30] hGHRH](1-30)NH2
[0180] P-29702 [Dat1, D-Ala2, Orn12, Abu15, Orn21, Nle27, Gln-Gab30]hGHRH(1-30)NH2
[0181] P-29703 [N-Me-Tyr1,Gln8, Orn12, Abu15, Orn21, Nle27, Gln-Gab30]hGHRH(1-30)NH2
[0182] P-29704 [Dat1, D-Ala2, Gln8, Orn12, Abu15, Orn21'22, Nle27, Gln- Gab30]hGHRH(1-30)NH2
[0183] P-29706 [Tfa-Tyr1, D-Abu2, Gln8, Orn12, Abu15, Orn21, Nle27, Gln- Gab30] hGHRH(1-30)NH2
[0184] P-29708 [N-Me-Tyr1, D-Ala2, Fpa56, Orn12, Abu15, Orn21, Nle27, Gln- Gab30] hGHRH(1-30)NH2
[0185] P-29710 [N-Me-Tyr1, D-Ala2, Fpa56, Ala8, Orn12, Abu15, Orn21, Nle27, Gln-Gab30] hGHRH(1-30)NH2
[0186] P-29720 [Dat1, D-Ala2, Orn12, Abu15, Orn21, Nle27, Asp28, Gln- Gab30]hGHRH(1-30)NH2
[0187] P-29721 [Dat1 , D-Ala2, Gln8, Orn12, Abu15, Orn2122, Nle27, Asp28, Gln- Gab30] hGHRH(1-30)NH2
[0188] P-29722 [Tfa-Tyr1, D-Abu2, Gln8, Orn12, Abu15, Orn21, Nle27, Asp28, Gln30, Gab31] hGHRH(1-30)NH2
[0189] P-29723 [N-Me-Tyr1 , D-Ala2, Fpa56, Orn12, Abu15, Orn21, Nle27, Asp28, Gln-Gab30] hGHRH(1-30)NH2
[0190] P-29724 [N-Me-Tyr1, D-Ala2, Fpa56, Ala8, Orn12, Abu15, Orn21, Nle27, Asp28, Gln-Gab30]hGHRH(1-30)NH
[0191] The amino acid sequences of the synthetic peptides listed above are numbered in correspondence with the amino acid residues in wild-type hGHRH(1-30) (SEQ ID NO: 1) (i.e., the synthetic peptides are based on the wild-type hGHRH(1-30) backbone). The peptides listed above correspond to the peptides with “MR”designations, for instance, MR-351 (P-20351 ); MR-356(P-20356); MR-361 (P-20361 ); MR-367(P-20367); MR-401 (P-27401 ); MR-403(P-27403); MR-404(P-27404); MR- 405(P-27405); MR-406(P-27406); MR-407(P-27407); MR-408(P-27408); MR-409(P- 27409); MR-410(P-27410); MR-420( P-28421 ); MR-421 (28421 ); MR-326(P-22326): MR-327(P-22327); MR-502(P-25502); MR-504(P-25504); and MR-702(P-29702).
[0192] In various embodiments, the treatment may be used alone or in combination with other therapies, such as therapies for FRDA, which include, for example, antioxidants, iron chelators, biguanides, or gene therapies targeting the FXN gene.
[0193] While not wishing to be bound by any particular theory, potential mechanisms of action involving stabilization of HIF-1 a by GHRH / GHRH-R signaling to provide a protective effect in FRDA include (but are not limited to): (1 ) Increasing the expression of HIF1A target genes, including the FXN gene itself which encodes Frataxin, as well as genes involved in glucose metabolism, angiogenesis, and erythropoiesis, which may support tissue-specific upregulation of FXN gene expression in FRDA cardiac and neuronal cells; (2) Cellular energy balancing and promotion of tissue repair, (3) Reduction of oxidative stress through the upregulation of antioxidant enzymes, which can counteract the detrimental effects of frataxin deficiency on mitochondrial function, (4) Enhancement of cardiogenesis and neurogenesis and promoting the survival of cardiac and neuronal cells, which may help mitigate the progressive neurodegeneration associated with FRDA, and / or (5) Restoration of iron-sulfur cluster biogenesis, which is thought as the primary mechanism underlying FRDA.
[0194] The materials and methods disclosed herein differ significantly from existing treatment options for FRDA. Unlike current therapies, which primarily focus on symptomatic relief or supportive care, disclosed herein are methods targeting the underlying molecular pathology of the disease. Without wishing to be bound by any particular theory, embodiments of the methods center on the stabilization of HIF-1 a in cardiomyocytes and neuronal cells expressing the GHRH receptor through activation of the GHRH / GHRH-R signaling pathway. This approach aims to enhance endogenous expression of the FXN gene as well as other HIF-1a responsive genes involved in glucose metabolism, angiogenesis, and erythropoiesis. This may improve cellular energy balance and reduce oxidative stress in affected tissues via the upregulation of antioxidant enzymes. Moreover, the use of GHRH and its synthetic analogs may promote cardiomyogenesis and neurogenesis, and improve survival of cardiac and neuronal cells — addressing both the cardiologic and neurologicdegeneration characteristic of FRDA. This is in contrast to existing therapies, which typically do not simultaneously target both affected systems. Importantly, the disclosure proposes repurposing GHRH analogs, such as tesamorelin (EGRIFTA®), for FRDA. These compounds, while primarily used to treat HIV-associated lipodystrophy — a metabolic condition involving abnormal fat distribution and insulin resistance — have not been widely explored in the context of FRDA. Finally, because HIF-1 a stabilization by GHRH / GHRH-R signaling addresses a core molecular defect of FRDA, this strategy holds potential for benefit across multiple disease stages, unlike certain current treatments that are effective only during specific manifestations or phases of the disorder.
[0195] The materials and methods of the disclosure also are distinct from current gene therapy approaches for FRDA treatment. The disclosure is based, at least in part, on the use of GHRH and its synthetic analogs as pharmacological agents, rather than directly targeting or modifying the patient’s DNA. Gene therapy approaches typically involve the introduction, alteration, or replacement of genetic material within a patient’s cells to correct or compensate for the underlying genetic defect. In contrast, this disclosure focuses on stabilizing HIF-1 a through GHRH / GHRH-R signaling, providing a therapeutic benefit without directly modifying the frataxin gene. Additionally, gene therapy approaches for FRDA often aim to address the root cause of the disease by increasing frataxin expression or correcting the mutated FXN gene. This disclosure, in some iterations, seeks to mitigate the effects of frataxin deficiency by stabilizing HIF-1 a in cardiomyocytes and neuronal cells expressing the GHRH receptor. This approach targets the downstream consequences of frataxin deficiency rather than directly increasing frataxin levels. Also, gene therapy often involves the use of viral vectors to deliver the therapeutic genetic material, which can potentially trigger immune responses in the patient. In some cases, these immune responses may reduce the efficacy of the therapy or cause adverse effects. The instant disclosure, based on the administration of GHRH and its synthetic analogs, is less likely to induce significant immune responses, potentially offering a safer treatment option. Further, the materials and methods of the present disclosure may be considered complementary to gene therapy approaches, as it targets a different aspect of the disease pathogenesis. While gene therapy aims to directly address the genetic defect causing FRDA, the disclosure herein focuses on mitigating the downstream consequences of frataxin deficiency through HIF-1 a stabilization. Thesetwo strategies may be employed concomitantly or sequentially to enhance the overall therapeutic benefit in a subject in need thereof, such as a subject suffering from FRDA.
[0196] This disclosure and embodiments illustrating the methods and materials used may be further understood by reference to the following non-limiting examples. The present disclosure is described in connection with the following examples which are set forth for the purposes of illustration only.EXAMPLESExample 1
[0197] It was recently identified that the development of the myocardium and spinal ganglia in humans and mice are accompanied by the chronohistological synthesis of the Growth Hormone Releasing Hormone Receptor (GHRH-R), as well as its ligand, GHRH (Fig. 1). GHRH-R belongs to the family of G protein-coupled receptors (GPCRs), while their ligand GHRH is a hormone that, in postnatal life, is secreted by the hypothalamus and participates in the regulation of Growth Hormone (GH) by the pituitary20 21. Especially during puberty, the GHRH / GH feed-forward mechanism is essential for the male and female growth spurt, and is enhanced by the androgens and estrogens produced during maturation of the gametic system21 22. In contrast, the actions of GHRH and GH are suppressed by the insulin-like growth factor IGF-1 and somatostatin21 22.
[0198] To study the role of GHRH / GHRH-R signaling, functional studies were performed in human cardiomyocytes previously differentiated from hiPSCs (hiPSC- CMs)20. First, hiPSC-CMs were exposed for 45 min to 0 nM, 150 nM or 300 nM of recombinant human GHRH (rhGHRH), followed by next-generation sequencing of the transcriptome (RNA sequencing, RNAseq). Bioinformatic analysis showed that GHRH exposure led to dose-dependent changes in the expression of 83 genes (DEGs)20(Fig. 2A) Reactome ontology analysis revealed that genes with differential gene expression were associated with the hypoxia transcription factor (HIF), as well as changes in the electron transport chain and the Krebs cycle (Fig. 2B). HIF proteins are heterodimeric transcription factors composed of an oxygen-regulated alpha subunit, or HIF-1 a, and a continuously expressed beta subunit, or HIF-113, also known as ARNT23. Both subunits belong to the bHLH-PAS DNA-binding protein family. Active heterodimers bind to hypoxia response elements (HRE), conserved DNA sequences located in the promoter or enhancer regions of their target genes, causingtheir transcriptional activation or deactivation23. There are three isoforms of HIF-a. HIF-1 a is expressed in all cells and tissues, whereas HIF-2a (or EPAS1 ) has tissuespecific expression. The third HIF-3a isoform is much less studied and its exact function is not known23. However, in addition to oxygen concentration, the expression and activity of HIF proteins are also controlled by oxygen-independent mechanisms that regulate transcription, mRNA translation, protein interactions, post-translational modifications and subcellular distribution of the HIF subunit-a24’28.
[0199] Various HIF-1 a- / - mouse models have produced inconsistent phenotypes that have obscured the role of HIF-1 a signaling in cardiac development and regeneration as well as in FRDA. To overcome these inconsistencies and examine the role of HIF-1 a in human cells, two HIF1A-KO human induced pluripotent stem cell (hiPSCs) lines were generated using CRISPR / spCas9-based genome editing (Fig. 3A). Compared to the current experimental models, the HIF1A-KO hiPSCs approach offers several advantages. Firstly, hiPSCs can be subjected to highly efficient, chemically defined, guided differentiation into cardiomyocytes, thereby providing tissue-specific modeling capabilities with minimal confounding effects secondary to extracardiac HIF-1 a mechanisms. Secondly, the global HIF1A knockout used in this model can minimize any tissue- or stage-specific inconsistencies, such as those observed in response to Cre / LoxP-mediated HIF-1 a- / - mice. Thirdly, the system is human and, therefore, eliminates any potential species-specific evolutionary differences that may govern cardiac HIF-1 a signaling. Both HIF1A-KO hiPSC lines exhibited loss of HIF-1 a protein expression and could be propagated in E8 medium at 37°C and 5% CO2, without obvious phenotypic differences compared to wild-type (WT) parent cells (Fig. 3B-3D). Importantly, both HIF1A-KO lines exhibited similar cardiomyocyte differentiation capacities, and therefore have been used interchangeably throughout the study. Intriguingly, during the phenotypic characterization, HIF1A-KO hiPSCs generated beating cardiomyocytes more consistently, compared to their WT hiPSCs counterparts.
[0200] To gain further insights, WT and HIF1A-KO hiPSCs were differentiated into cardiomyocytes and then subjected to next-generation RNA sequencing profiling (RNA-seq). A total of 27,868 protein-coding and non-coding genes were found to be expressed in both WT and HIF1A-KO cardiomyocytes. Of these, 1 ,445 genes were significantly down-regulated, and 1 ,267 genes were significantly up-regulated in HIF1A-KO compared to WT cardiomyocytes (q-val<0.05), (Fig. 4A), which isconsistent with HIF-1a operating both as a transcriptional activator, as well as repressor in the developing human myocardium. Importantly, since all experiments were performed under normal atmospheric oxygen levels, these findings indicate that HIF-1 a operates in an O2-independent manner during human cardiomyogenesis. This result is consistent with previous in vivo experiments in mice, which show that HIF-1 a activity becomes spatiotemporally compartmentalized in the developing mouse heart; and this compartmentalization is unlikely to be O2-dependent because the staining patterns of the hypoxia reporter pimonidazole and nuclear HIF-1a do not consistently overlap.
[0201] Strikingly, HDSigDB (High-Definition Signatures database) analysis of the 1 ,267 HIF1A-KO upregulated genes demonstrated dramatic enrichments in FRDA- related terms (Fig. 4B), whereas the 1 ,445 HIF1A-KO downregulated genes were enriched in non-FRDA related terms (Fig. 4C). These findings indicate that HIF-1 a is a repressor of the FRDA gene regulatory program, because its genetic inactivation in hiPSC-CMs produces a gene signature that resembles FRDA.
[0202] To investigate the extent to which HIF-1 a mediates GHRH / GHRH-R signaling, the HIF1A-knockout hiPSCs (HIF1A-KO) cell lines described above underwent cardiac differentiation alongside wild-type (WT) hiPSCs20. This was followed by a 45 min exposure of WT and HIF1A-KO cardiomyoblasts to 0 nM, 150 nM or 300 nM GHRH and analysis of the samples by RNAseq as described above. Bioinformatic analysis revealed that, relative to the 83 DEGs in WT cells, GHRH exposure to HIF1 A-KO cardiomyoblasts induced an expression change in only 2 of a total of >57,000 transcripts analyzed (data not shown)20. qPCR analysis on selected genes confirmed the complete inactivation of GHRH action in HIF-1 a-depleted cells (Fig. 5A-5B).
[0203] The above data suggests the efficacy of GHRH as a novel treatment of FRDA: namely, that the administration of GHRH or its synthetic analogs will suppress the FRDA gene regulatory program by activating HIF-1 a in sensory neurons and cardiomyocytes, thus allowing them to switch to an advantageous transcriptional state, thus compensating for FRDA.Example 2
[0204] Additional studies were performed to build on the Example 1 data as follows. ChlP-seq analysis was performed to determine which of the differentially expressedgenes were directly regulated by HIF-1 a. Accordingly, WT hiPSC-cardiomyocytes were treated with the hydroxylase inhibitor C0CI2 (100pM for 24h) to stabilize HIF-1 a and ensure maximal DNA binding capacity. The HIF-1 a bound chromatin was crosslinked, sonicated, immunoprecipitated using the previously KO- validated HIF-1 a antibodies, and sequenced. 1 ,416 peaks were identified, corresponding to 1 ,344 genes, ~57% of which were in promoter regions. Motif discovery analysis identified a motif containing 5’-RCGTG-3’ and 5’-CACA-3’ sequences (E-value= 4.6x1 O’218), closely resembling the hypoxia response element (HRE) motif to which HIF-1 a binds (Fig. 6A)28. Alignment of the RNA-seq and ChlP-seq datasets revealed that only 131 / 1 ,445 and 73 / 1 ,267 significantly down- and up-regulated genes in the HIF1A-K0 cells compared to the HIF-1 a isogenic parental cells, respectively, were HIF-1 a targets (Fig. 6B), suggesting that >90% of the RNAseq-detected differentially expressed genes were indirectly regulated by HIF-1 a. HDSigDB functional enrichment analysis demonstrated that both the 73 HIF1A target and 1 ,193 non-target genes that were upregulated in HIF1A-KO hiPSC-cardiomyocytes were significantly overrepresented in FRDA-related terms (Fig. 6C), suggesting that HIF-1 a protects against FRDA both in a direct and indirect manner. Moreover, analysis of the ChlP-seq datasets illustrated a distinct HIF-1 a binding peak spanning approximately 1 Kb around exon 1 of the FXN gene (Fig. 6D). This region is known to be enriched in cis-regulatory elements (CREs) with promoter- and enhancer-like activity (Fig. 6E), suggesting that HIF-1 a may play a direct transcriptional regulatory role in FXN expression. The localization of the peak near exon 1 , a region often associated with core promoter elements and regulatory hotspots, further supports the hypothesis that HIF-1 a acts as a transcriptional activator of FXN under hypoxic or stress-related conditions. This finding is consistent with the emerging view of FXN as a HIF-1 a target gene, linking hypoxia signaling pathways to the transcriptional control of mitochondrial homeostasis and iron-sulfur cluster biogenesis, both of which are disrupted in Friedreich’s Ataxia.
[0205] Given the strong direct and indirect effects of HIF-1 a on the transcriptional regulation of FRDA, WT and HIF1A-KO hiPSCs were subjected to gas chromatography-mass spectrometry (GC-MS)-based analysis of intracellular and extracellular metabolites, both before and after cardiomyocyte differentiation. A total of 37 intracellular and 29 extracellular metabolites were detected. Among these, statistical analysis detected 7 / 37 intracellular and 1 / 29 extracellular metabolites to differ significantly between undifferentiated (differentiation day 0) WT and HIF1A-KOhiPSCs (Fig. 7 A). The strongest effect was observed in D-glucose levels which did not differ extracellularly but were significantly reduced intracellularly (~2.3-fold decrease, p=0.0016) in WT relative to HIF1 A-KO hiPSCs (Fig. 7A). These findings, in addition to increased intracellular levels of Krebs cycle intermediates (i.e. , citrate and malate), indicate increased glycolysis in WT relative to HIF1A-K0 hiPSCs through aerobic activation of HIF-1 a.
[0206] In day 10 spontaneously beating WT and HIF1A-KO hiPSC-cardiomyocytes, there were a total of 3 / 37 intracellular and 11 / 29 extracellular metabolites that were significantly different (Fig. 7B-7C). Metaboanalyst enrichment analysis of extracellular metabolites demonstrated significant overrepresentation in Warburg effect- and Krebs cycle-related processes (Fig. 8A); whereas intracellular metabolites showed weak enrichment in inositol and glycerolipid metabolism (Fig. 8B).
[0207] Combined, the RNA-seq, HIF-1 a ChlP-seq and metabolomic data demonstrate that HIF-1 a is stabilized in an O2-independent manner to activate a glycolytic gene program that leads to fetal cardiac overflow metabolism (Warburg effect), as indicated by the elevated lactate / decreased glucose levels and accumulation of Krebs cycle intermediates in the extracellular space of WT, but not HIF1A-KO hiPSC-cardiomyocytes. In addition, the increased intracellular saturated long-chain fatty acid levels in HIF1 A-KO hiPSC-cardiomyocytes suggest that induction of aerobic glycolysis through HIF-1 a promotes oxidation and extracellular leakage of citrate, prohibiting its shuttling toward fatty acid biosynthesis (Fig. 7B-7C).
[0208] In line with the HIF-1 a metabolomic data, KEGG analyses of the 83 GHRH- induced DEGs demonstrated functional enrichment in complex I, III, IV and V electron transport chain (ETC) genes (Fig. 9). Consistently, western blot analysis revealed reduced ETC activity in response to 0.3 pM rhGHRH, although seahorse analysis of hiPSC-cardiomyocyte bioenergetics did not record any changes in oxygen consumption rate, an indicator of mitochondrial respiration (Fig. 10A-10B). However, the levels of extracellular acidification rate and total ATP were significantly increased compared to controls, indicative of the induction of aerobic glycolysis in response to rhGHRH stimulation (Fig. 10C-10F). Specifically, real time analysis of glycolysis showed that rhGHRH-treated hiPSC-cardiomyocytes exhibited higher maximum glycolysis when induced by oligomycin in the presence of glucose (Fig. 10D), as well as higher glycolytic rate (Fig. 10E), and glycolytic capacity (Fig. 10F), compared to controls.
[0209] GHRH is secreted from the hypothalamus and acts on somatotropes through GHRH-R to regulate the activity of the GH / IGF-1 axis. During fetal and postnatal growth, the activity of GHRH itself is regulated through steroid sex hormones. Gene expression analysis in the hiPSC model of human cardiomyogenesis (Fig. 1A) showed that both GHRH and GHRH-R expression increased over the time course of differentiation, consistent with the increased expression of the bHLH master cardiac transcription factor NKX2-5 (Fig. 1 B). Confocal and flow cytometric analyses confirmed that GHRH-R is expressed on the surface of most, if not all, NKX2-5- expressing cardiomyoblasts, both before and after their differentiation into cardiac troponin-T+ beating cardiomyocytes. Moreover, co-localization with the LIM homeodomain transcription factor ISL1 indicated that GHRH-R is expressed in both left- and right-sided cardiomyoblasts (data not shown). Finally, the relationship between GHRH / GHRH-R signaling and NKX2-5 expression was genetically interrogated using a GHRH-R over-expressing hiPSC line (GHRH-R-OE), generated by using the CRISPR activation (CRISPRa) system (Fig. 11A-11C). Remarkably, GHRH-R over-expressing cells (GHRH-R-OE) exhibited more robust cardiomyocyte differentiation capacity than either the WT (dCas9-VP64 alone) or the HIF1 A-KO cells (Fig. 11 D). This increase in the cardiomyocyte differentiation capacity was accompanied by an upregulation in NKX2-5 expression (Fig. 11 D). Thus, these findings illustrate that during embryonic development, the growth and differentiation of NKX2-5 cardiomyoblasts is regulated through a lineage-specific, autocrine rather than endocrine, GHRH / GHRH-R signaling mechanism.
[0210] Further analyses revealed that the developmental induction of GHRH / GHRH- R and NKX2-5 is preceded by a spike in Growth Hormone 1 (GH1 ) mRNA synthesis, which in turn is preceded by a transient spike in Insulin-like Growth Factor 1 (IGF-1 ) and HIF-1 a transcription (Fig. 1B). The latter findings agree with previous studies that demonstrated a reciprocal positive regulation of HIF-1 a by insulin / IGF-1. Interestingly, at later stages of differentiation, the GH / IGF1 / HIF-1 a axis is likely antagonized by GHRH / GHRH-R, as indicated by the down-regulation of HIF-1 a, GH1 and IGF-1 mRNA synthesis and induction of the GH / IGF-1 antagonist Somatostatin (SST) from day 7 onwards (Fig. 1 B). These autocrine hormonal changes are accompanied by increased PGC1 a and GLUT1 , as well as a decreased LDHA expression (Fig. 1 B), indicating a metabolic transition from non-oxidative to oxidative glucose metabolism.
[0211] HIF-1 a Chip-seq analysis illustrated that both NKX2-5 and SST are HIF1A target genes (Fig. 5A), suggesting that their activation could be enhanced through the aerobic stabilization of HIF-1 a. Consistent with this hypothesis, 45-min stimulation of day-7 WT hiPSC-cardiomyoblasts with recombinant human (rh)GHRH led to a dosedependent response in SST as well as the HIF1A target genes LDHA and GLUT1 , and these effects were blunted in HIF1 A-KO cells (Fig. 5B). Notably, in WT cells, the expression of SST and GLUT1 increased dose-dependently at lower concentrations (<1 pM rhGHRH) and declined at higher (3pM rhGHRH), supporting regulation via a somatotrope-like feedback loop (Fig. 5B).
[0212] These findings demonstrate that cardiac GHRH / GHRH-R may act through a cardiomyoblast-specific signaling pathway. Collectively, these studies suggest that GHRH, acting via its receptor GHRH-R, can stabilize HIF-1 a protein levels in an oxygen-independent manner. This stabilization can lead to the repression of the FRDA gene program. Consequently, treatment with GHRH or its synthetic analogs may alleviate the symptoms and slow the progression of FRDA.Example 3
[0213] To evaluate the therapeutic potential of GHRH / GHRH-R activation in FRDA, neuromyocardial organoids were generated from induced pluripotent stem cell (iPSC) lines derived from FRDA patients and their respective gene-corrected isogenic controls. These organoids recapitulate key disease-relevant cell types, including parvalbum in-expressing proprioceptive neurons and spontaneously beating cardiomyocytes, both of which are known to be affected in FRDA (Fig. 12A)75. Gene expression and biochemical analyses revealed significant impairments in both FXN expression and the GH / IGF-1 signaling axis in FRDA organoids compared to isogenic controls (Fig. 12B). Remarkably, this organoid phenotype is consistent with previous clinical studies in FRDA patients76.
[0214] To determine whether activation of the GHRH pathway could reverse these deficits, the organoids were treated with two structurally distinct GHRH analogs- CJC- 1295 acetate (Targetmol, Cat# TP2328L; CAS Registry Number 446262-90-4; PubChem CID 91976842; Henninge et al. (2010) Drug Test Analysis, 2: 647-650) and Tesamorelin acetate (Biosynth, Cat# FT176033)- for 48 hours. Both treatments restored GH / IGF-1 axis activity and led to a marked increase in FXN transcription (Fig. 12B). In FRDA organoids, FXN expression levels were restored to approximately 60-100% of those observed in isogenic controls. In the isogenic control organoids themselves, GHRH analog treatment induced an approximate 2-fold increase in FXN expression, highlighting a strong transcriptional activation effect (Fig. 12B).
[0215] Given the well-established role of oxidative stress in the pathophysiology of FRDA, reactive oxygen species (ROS) levels were next evaluated in the organoid model. Excessive ROS accumulation is a hallmark of FRDA, resulting from mitochondrial dysfunction and impaired frataxin (FXN) expression, and contributes to progressive cellular damage in affected tissues. To quantify intracellular ROS a fluorometric ROS detection assay kit (Abbexa, Cat# abx295093) was employed, which enables sensitive and reliable measurement of ROS activity within live cells.
[0216] Consistent with the disease phenotype, FRDA neuromyocardial organoids exhibited a significant increase in ROS levels compared to their isogenic controls. Remarkably, treatment with CJC-1295 led to a dramatic reduction in ROS levels, restoring them to levels even lower than those observed in control organoids (Fig. 12C). These findings indicate that GHRH analog treatment not only enhances FXN expression and GH / IGF-1 axis activity but also confers functional antioxidant effects in FRDA organoids, further supporting its therapeutic potential (Fig. 12C).
[0217] The effects of GHRH / GHRH receptor activation were next evaluated in YG8JR mice [Fxnnull::YG8s(GAA)>800, Jax strain #030395], a well-established and robust transgenic model for studying FRDA77. These mice exhibit a pronounced disease phenotype, characterized by reduced body size, extensive hair loss relative to wild-type littermates, and progressive development of ataxia77(see also detailed description in www.jax.org / strain / 030395). A total of six YG8JR mice (three males and three females) were enrolled in the study. Based on established protocols in prior mouse studies78, animals were randomized to receive either daily subcutaneous injections of C JC-1295 (2 pg / animal) or placebo for a duration of five weeks, beginning at five weeks of age. The placebo group included two males and one female, while the CJC-1295 treatment group consisted of one male and two females.
[0218] Notably, by the end of the five-week treatment period, all mice in the placebo group exhibited extensive hair loss, a prominent external manifestation of the FRDA- associated phenotype. In contrast, this phenotype was markedly attenuated in the group treated with CJC-1295 (Fig. 13A). Additionally, consistent with the growth- retarded phenotype characteristic of YG8JR mice, animals in the placebo group demonstrated a progressive reduction in weight gain over the study period. In contrast,mice treated with CJC-1295 exhibited a progressive increase in weight gain, indicating a marked improvement in growth trajectory (Fig. 13B).
[0219] To further assess motor coordination and balance- functional domains commonly impaired in FRDA, a beam walk test was conducted on YG8JR mice at the end of the five-week treatment period. The test utilized an elevated narrow beam with increasing complexity: the first 60 cm segment had a diameter of 11 mm, followed by a 40 cm segment with a reduced diameter of 8 mm. This design enables sensitive detection of gait disturbances and fine motor deficits.
[0220] Mice treated with CJC-1295 showed significantly improved motor performance relative to placebo-treated animals. Specifically, CJC-treated mice traversed a greater distance on the beam in a shorter amount of time and demonstrated significantly fewer motor coordination errors. These errors included both foot slips and dragging of the hind limbs — phenotypic indicators of neuromuscular dysfunction in FRDA. These results indicate that GHRH-R activation leads to measurable improvements in motor coordination, further supporting its therapeutic potential in FRDA (Fig. 13C-E).
[0221] Materials and methods.
[0222] hiPSC differentiation towards cardiomyocytes. Culture and differentiation of hiPSCs (SC101A from System Biosciences; the following lines from Friedreich’s Ataxia Cell Line Repository (FACLR): F4230 clones #21 and #1 A11 ; F4676 clones #2 and #2B1 ) were performed as previously described, with slight modifications71. Briefly, hiPSCs grown in E8 medium on Matrigel-coated dishes were single-cell suspended with TrypLE (GIBCO) and seeded at a density of 1x105cells / well of a 12-well plate and grown for 96h to 90% confluence in a humidified incubator with 5% CO2 at 37°C. On day 0, the medium was replaced with RPMI 1640 supplemented with B27 without insulin and 6 pM CHIR99021 (2520691 , Biogems). On day 1 , the medium was changed to RPM1 1640, supplemented with B27 without insulin for 72h, supplemented with 5pM IWP2 (6866167, Biogems) after the first 24h. On Day 4, the medium was switched to RPM1 1640 supplemented with 3pg / mL heparin until day 8, with a medium change every 2 days. From that day on, fresh RPMI 1640 with 3pg / mL heparin and 20pg / mL insulin was changed every two days. For the GHRH induction experiments, WT and HIF1A-KO cells were treated for 45min with 0, 0.15 or 0.3pM recombinant human GHRH (ab52521 , Abeam, n=3 / genotype / dose). For ChlP-seq experiments, WT cells (n=2) were treated overnight with 100pM CoCI2 (232696, Sigma-Aldrich).
[0223] Immunohistochemistry and immunocytochemistry. For immunocytochemical analysis, cells were fixed in 4% paraformaldehyde, blocked for 1 hour with 10% normal donkey serum or 2% BSA, and incubated with primary antibody overnight at 4°C. Next, the cells were incubated with an Alexa Fluorconjugated secondary antibody (1 :500; Thermo Fisher Scientific) for 1 h at room temperature, stained with fluoroshield-DAPI mounting medium and visualized on a Zeiss LSM 780 confocal microscope. Accordingly, immunofluorescence analysis of mouse heart tissues was performed in 5- to 10-pm-thick cryosections. For HIF-1 a, the signal was enhanced by incubating the sections in biotinylated anti-rabbit IgG antibody (1 :500; BA1000, Vector Laboratories) for 2h, followed by incubation in streptavidin- Alexa Fluor 488 dye (1 :1000; S32354, Life Technologies) for 1 h. For Hypoxyprobe injected mice and embryos, cryosections were incubated overnight with Hypoxyprobe Red Mab 549 (1 :200; HP7-100, Hypoxyprobe Inc.). Immunofluorescence analysis of human fetal heart samples was performed in 4- to 5-pm-thick formalin fixed paraffin- embedded tissue sections. Antigen unmasking was performed by microwaving the slides for 2 x 10 min in citrate buffer solution (pH 6) (Thermo Fisher Scientific). Sections were then blocked for 1 hour at room temperature with 10% normal donkey serum (Chemicon International Inc., Temecula, CA), followed by overnight incubation at 4°C with the primary antibody. The following primary antibodies were used: HIF-1 a (1 :100; NB100-479, Novus Biologicals); sarcomeric a-actinin (1 :400; ab9465, Abeam); PH3-Alexa Fluor488-conjugated (1 :3000; ab200614, Abeam); T-Brachyury (1 :50; AF2085, R&D systems); ISL-1 (a mixture of 1 :10 of #40.2D6 and 1 :100 of #39.4D5, Developmental Studies Hybridoma Bank); cardiac troponin-T (1 :200; ab83774, Abeam); GHRH-R (1 :500; ab28692, Abeam); NKX2-5 (1 :50; Santa Cruz Biotechnology, SC8697).
[0224] Western blotting. Whole cell and tissue protein was extracted using the Active Motif protein extraction Kit and quantified with the Bradford assay (Bio-Rad). Snap-frozen cardiac apical tissues were homogenized using Dounce tissue grinder (Sigma-Aldrich). Electrophoresis was performed in precast, NuPage 4 to 12% bis-tris protein gels (NP0323, Thermo Scientific; or MP42G15; Merck) before transferring into 0.22pm pore size polyvinylidene difluoride (PVDF) membranes (LC2002; Thermo Fisher Scientific) using the TransBlot Turbo transfer system (Bio-Rad) or the Mini Blot Module (B1000, Thermo Fisher Scientific). Western blots were performed after blocking with 3% Blotto (2325, Santa Cruz Biotechnology, Inc.) for 40’, usingantibodies against: HIF-1a (1 :2000; D1 S7W, Cell Signaling), GHRH-R (1 :500; ab76263, Abeam for mouse tissue), GHRH-R (1 :1000; LS-C383690, LSBio, for human cells) [3-actin (1 :6000; 8H10D10, Cell Signaling), PCNA (1 :2000; D3H8P, Cell Signaling), Gapdh (1 :2000; D16H11 , Cell Signaling Technology), Cas9 (1 :2000; 14697, Cell signaling), AMPKa (1 :2000; 5831 S, Cell signaling), Thr172-phospho- AMPKa (1 :2000; 2535S, Cell signaling), Total OXPHOS WB Antibody Cocktail (ab110413, Abeam), anti-Rabbit and anti-Mouse IgG, HRP-linked secondary antibodies (1 :500; 7074 and 7076, Cell Signaling). The blots were visualized using the iBright imaging system (Thermo Fisher Scientific) and densitometry analysis was performed on Fiji Imaged.
[0225] Flow Cytometry. Flow cytometry analysis was performed on different stages of hiPSC-cardiomyocyte differentiation. Cells were collected using TrypLE (12604- 021 , GIBCO) and fixed in 70% methanol. For cell cycle analysis, cells were incubated with Fx-Cycle PI / RNase Staining Solution (F10797, Thermo Fisher Scientific) for 30’ in room temperature, and analyzed in a BD Accuri C6 Plus cytometer. Flow cytometry data analysis was performed on FlowJo 10.8.0. In addition, the following antibodies were used in day-7 hiPSC-derived cardiomyoblasts, which were analyzed in a BD LSR-II cytometer: Troponin (BS10648-PE, Bioss), GHRH-R (C717859, LsBio), NKX2- 5 (orb-103103, Biorbyt).
[0226] Quantitative PCR. Briefly, following total RNA extraction with the RNeasy mini kit (74106, Qiagen) and complementary DNA synthesis with the high-capacity cDNA reverse-transcription kit (4368814, Applied Biosystems), the samples were subjected to quantitative PCR in an iQ5 real-time PCR detection system (Bio-Rad), using the TaqMan Universal Master mix (Applied Biosystems). The following probes were used: TBP (Hs00427621 ), T-Brachyury (Hs00610080), Mespl (Hs00251489), Nkx2-5 (Hs00231763), Oct4 (Hs04260367), Nanog (Hs02387400), GHRH-R (Hs0181591 ), GHRH (Hs00184139), HIF-1 a (Hs00153153), Gh1 (Hs00236859), SST (Hs00356144), LDHA (Hs01378790), VHL (Hs00184451 ), IGF1 (Hs01547656), SLC2A1 (Hs00892681 ), PPARGC1 (Hs00173304).
[0227] CRISPR / CAS-mediated gene knockout and activation. The hiPSC lines stably expressing spCas9 and dCas9-VP64 were generated by transduction with lentiCas9-Blast (52962, Addgene) and lenti-dCas9-VP64-Blast (61425, Addgene) lentiviral particles, as described before22 49. For HIF-1 a knockout, sgRNA vectors targeting TTCACACATACAATGCACTG and GATGGTAAGCCTCATCACAG of thehuman HIF-1 a gene (ENSG00000100644) were cloned into the pLH-spsgRNA2 vector (64114, Addgene). For GHRH-R activation, sgRNA vectors targeting TGTCAGGGGACAGCAGGGGA and AGCAGAGGGTGCGGTGGAAA of the human GHRH-R gene (ENSG00000106128) were cloned into the lenti-sgRNA (MS2) puro backbone vector (73795, Addgene). Lentiviral particles were generated by transient co-transfection with the pMD2.G (12259, Addgene) and psPAX2 (12260, Addgene) plasmids into H293TN cells, using the jetPRIME kit (Polyplus), according to manufacturer’s instructions. At 48 hours following lentiviral transduction, hiPSCs were selected with hygromycin B (50pg / ml; 843555001 , Roche Diagnostics), puromycin (1 pg / ml; A11138-03, GIBCO) or blasticidin (10pg / ml; A11138-03, GIBCO) for a total period of 5-7 days.
[0228] RNA sequencing. RNA was isolated with RNeasy plus mini kit (Qiagen) according to the manufacturer’s protocol. Libraries were prepared and sequenced by the Center for Genome Technology, John P. Hussman Institute for Human Genomics, University of Miami Miller School of Medicine. Briefly, total RNA was prepped with the Nugen Universal Plus mRNA-Seq (M01442 v2) using 50ng via Qubit and 17 PCR cycles. Libraries were sequenced on Illumina Novaseq 6000 and >40M single-end 100-bp reads were generated per sample. Next generation sequencing quality was assessed using FastQC (vO.11.3). Reads were trimmed using trim galore or Trimmomatic, aligned to the human genome build hg38 / GRCH38 using Hisat2 or STAR, and counts were generated using Stringtie or RSEM. Differential expression analysis was performed with EdgeR. A false discovery rate (FDR) <0.05 was used as cut-off criteria.
[0229] HIF-1a ChlP-seq. HIF-1 a-bound chromatin immunoprecipitation, sequencing, and bioinformatics (ChlP-seq) were performed on hiPSC-CMs, according to previously described protocols72. Briefly, chromatin was sonicated to an average fragment size of 200 base pairs (bp) with a Covaris M220 sonicator before ChlP. A total of 5pL of HIF-1 alpha antibody (36169, Cell Signaling) was used for each ChlP (n=2). Libraries were prepared using the NEBNext Ultra 2 kit and sequenced on the Illumina Novaseq 6000 (2 x 75 bp). Peak-calling on the ChlP-seq datasets was performed with MACS2 and the resulting peaks with a q-value < 1x10’100were annotated with genomic context information using ChIPpeakAnno73. Motif discovery analysis of the DNA sequences ±50bp from the peak summits was performed with MEME.
[0230] Seahorse real-time metabolic characterization. The mitochondrial oxygen consumption rate (OCR, 02 mpH / min) and extracellular acidification rate (ECAR, mpH / min) of hiPSCs were analyzed by a Seahorse XFe96 extracellular flux analyzer (Agilent technologies). For OCR studies, hiPSCs were kept in OCR medium [RPMI base, 25mM glucose, 1 mM pyruvate, 2mM L-glutamine (pH 7.35)], and were analyzed using the Mito Stress Kit (103015-100, Agilent technologies). Cells were plated in 96- well flat-bottom Matrigel-treated plates and incubated in a non-CO2 incubator for 1 h at 37°C. The ATP-linked respiration was quantified by subtracting the proton leak to the basal OCR. The total cellular ATP production rate is the sum of glycolytic and mitochondrial ATP (ATP Rate assay Kit; 103592-100, Agilent technologies). For ECAR analysis, hiPSCs were kept in ECAR medium (DMEM base [no bicarbonate] with 2mM L-glutamine, 143mM NaCI, and 0.5% phenol red [pH 7.35]). The complete ECAR analysis (Glycolysis Stress Kit; 103017-100, Agilent technologies) consisted of four stages: basal (without drugs), glycolysis induction (10mM glucose), maximal glycolysis induction (2mM oligomycin), and glycolysis inhibition (100mM 2-DG).
[0231] Metabolomics GC-MS analysis. Exometabolites were extracted from 24- hour incubated day-0 hiPSCs or day-10 differentiated cardiomyocytes by saving the spent medium in -80°C. For the endometabolome extraction, the cells were washed with serum, followed by incubation with 100% MeOH in -20°C for 20’. Next, cells were scraped and centrifuged in 5000rpm for 15’, and the metabolites pellet was stored in -80°C until analyzed.
[0232] For GC-MS analysis, 10pL of myristic acid-d27 (100 pg / mL; 60658-41 -5, Sigma-Aldrich) and 10pL 4-phenylbutyric acid (100 pg / mL; 1821 -12-1 , Sigma-Aldrich) were added to 140pL of intracellular and extracellular extracts followed by evaporation to dryness under vacuum (Speedvac Eppendorf). The dried residues were reconstituted in 50pL of 2% MeOX in anhydrous pyridine (110-86-1 , Sigma-Aldrich) followed by derivatization at 70oC for 2hours. After completion of the first reaction, the samples were cooled to room temperature. Then, 100pL MSTFA 1 % TMCS (24589- 78-4, Sigma-Aldrich) were added and the second derivatization was performed for 1 h at 70°C. Ten (10)pL of injection standard (N-pentadecane, 100pg / mL; 629-62-9, Sigma-Aldrich) were added and the samples were split into 2 vials for targeted and untargeted analysis.
[0233] GC-MS analysis was performed on an EVOQ 456 GC-TQ-MS system (Broker, Billerica, MA, USA) equipped with a CTC automatic sampler and PTV injector,controlled by Compass Hystar software. A 30m HP-5 MS III (Agilent J&W) column (0.25mm, ID of 0.25pm) was used. Analytical conditions are provided in more detail previously74. Data were processed with AMDIS software used to achieve chromatographic peak deconvolution and identification. NIST (mainlib) and FIEHN libraries were used for peak identification. Peak areas of the compounds extracted by AMDIS were calculated using the Gavin3 script in MATLAB.
[0234] Reactive Oxygen Species (ROS) Assay. Quantification of intracellular reactive oxygen species in human iPSC-derived organoids was performed using a commercially available fluorometric detection kit (Abbexa, Cat# abx295093), in accordance with the manufacturer’s protocol. This assay enables sensitive measurement of ROS activity within live cells, providing an indicator of oxidative stress relevant to the FRDA phenotype.
[0235] Quantification of GH and IGF-1 Levels. Concentrations of growth hormone (GH) and insulin-like growth factor 1 (IGF-1 ) in the spent culture medium of human iPSC-derived organoids were measured using the Elecsys hGH and IGF-1 assays on a Cobas e411 immunoassay analyzer (Roche Diagnostics). All measurements were performed according to the manufacturer's standardized operating procedures to ensure analytical accuracy and reproducibility.
[0236] Animal Model and Treatment Protocol. All in vivo experiments were conducted using the YG8JR transgenic mouse model of FRDA, obtained from The Jackson Laboratory (strain #030395). This model recapitulates key features of the human FRDA phenotype, including frataxin deficiency, progressive motor impairment, reduced body size, and neuromuscular degeneration. Animal studies were performed in collaboration with the George Papanicolaou Hospital (Thessaloniki, Greece) under institutionally approved protocols. Mice were randomized into treatment groups and administered daily subcutaneous injections of CJC-1295 (2 pg / animal) or placebo for a duration of five weeks, starting at five weeks of age. The dosing regimen and compound formulation followed a previously established protocol78.
[0237] Beam Walk Test. To assess motor coordination and balance, mice were subjected to a beam walk test at the conclusion of the treatment period. The apparatus consisted of an elevated metal beam 100 cm in total length, with two consecutive segments of increasing difficulty. The initial 60 cm segment had a diameter of 11 mm, allowing for relatively easy traversal, while the remaining 40 cm narrowed to 8 mm, posing a greater challenge to balance and fine motor control. Mice were placed at oneend of the beam and allowed to traverse its full length and enter a darkened escape box. Performance metrics included total distance walked, time to completion, and the number of motor coordination errors, defined as hindlimb slips and dragging events.References:1 Daiou, A., Petahdou, K., Siokatas, G., Papadopoulos, E. I. & Hatzistergos, K. E. Developmental and regenerative biology of cardiomyocytes. I nt J Dev Biol 66, 59-75, doi: 10.1387 / ijd b.210159kh (2022).2 Hirose, K. et al. Evidence for hormonal control of heart regenerative capacity during endothermy acquisition. Science 364, 184-188, doi:10.1126 / science.aar2038 (2019).3 Mitoh, S. & Yusa, Y. Extreme autotomy and whole-body regeneration in photosynthetic sea slugs. Curr Biol 31 , R233-R234, doi:10.1016 / j.cub.2021 .01 .014 (2021).4 Bise, T., Sallin, P., Pfefferli, C. & Jazwiriska, A. Multiple cryoinjuries modulate the efficiency of zebrafish heart regeneration. Scientific Reports 10, 11551 , doi:10.1038 / s41598-020-68200-1 (2020).5 Vargas-Gonzalez, A., Prado-Zayago, E., Leon-Olea, M., Guarner-Lans, V. & Cano-Martinez, A. [Myocardial regeneration in Ambystoma mexicanum after surgical injury]. Arch Cardiol Mex 75 Suppl 3, S3-21-29 (2005).6 Porrello, E. R. et al. Transient regenerative potential of the neonatal mouse heart. Science 331 , 1078-1080, doi:10.1126 / science.1200708 (2011).7 Tsao, C. W. et al. Heart Disease and Stroke Statistics-2022 Update: A Report From the American Heart Association. Circulation 145, e153-e639, doi:10.1161 / CIR.0000000000001052 (2022).8 Jopling, C., Sune, G., Faucherre, A., Fabregat, C. & Izpisua Belmonte, J. C. Hypoxia induces myocardial regeneration in zebrafish. Circulation 126, 3017-3027, doi:10.1161 / CIRCULATIONAHA.112.107888 (2012).9 Puente, B. N. et al. The oxygen-rich postnatal environment induces cardiomyocyte cell-cycle arrest through DNA damage response. Ce / / 157, 565-579, doi: 10.1016 / j. cell.2014.03.032 (2014).10 Nakada, Y. et al. Hypoxia induces heart regeneration in adult mice. Nature 541 , 222-227, doi:10.1038 / nature20173 (2017).11 Honkoop, H. et al. Single-cell analysis uncovers that metabolic reprogramming by ErbB2 signaling is essential for cardiomyocyte proliferation in the regenerating heart. Elife 8, doi:10.7554 / eLife.50163 (2019).12 Iyer, N. V. et al. Cellular and developmental control of 02 homeostasis by hypoxia-inducible factor 1 alpha. Genes & development 12, 149-162, doi:10.1101 / gad.12.2.149 (1998).13 Ryan, H. E., Lo, J. & Johnson, R. S. HIF-1 alpha is required for solid tumor formation and embryonic vascularization. The EMBO journal 17 , 3005-3015, doi:10.1093 / emboj / 17.11 .3005 (1998).14 Menendez-Montes, I. et al. Myocardial VHL-HIF Signaling Controls an Embryonic Metabolic Switch Essential for Cardiac Maturation. Developmental cell 39, 724-739, doi:10.1016 / j.devcel.2016.11.012 (2016).15 Compernolle, V. et al. Cardia bifida, defective heart development and abnormal neural crest migration in embryos lacking hypoxia-inducible factor-1 alpha. Cardiovascular research 60, 569-579, doi:10.1016 / j.cardiores.2003.07.003 (2003).16 Guimaraes-Camboa, N. et al. HIF1 alpha Represses Cell Stress Pathways to Allow Proliferation of Hypoxic Fetal Cardiomyocytes. Developmental cell 33, 507-521 , doi:10.1016 / j.devcel.2015.04.021 (2015).17 Kotch, L. E., Iyer, N. V., Laughner, E. & Semenza, G. L. Defective vascularization of HIF-1 alpha-null embryos is not associated with VEGF deficiency but with mesenchymal cell death. Developmental biology 209, 254-267, doi:10.1006 / dbio.1999.9253 (1999).18 Ahmed, M. S. & Sadek, H. A. Hypoxia Induces Cardiomyocyte Proliferation in Humans∗. JACC: Basic to Translational Science 5, 461-462, doi :do i : 10.1016 / j.jacbts.2020.04.008 (2020).19 Yuan, X. et al. Disruption of spatiotemporal hypoxic signaling causes congenital heart disease in mice. The Journal of clinical investigation 127, 2235-2248, doi:10.1172 / JCI88725 (2017).20 Bishop, T. & Ratcliffe, P. J. HIF hydroxylase pathways in cardiovascular physiology and medicine. Circ Res 117, 65-79, doi:10.1161 / CIRCRESAHA.117.305109 (2015).21 Krishnan, J. et al. Essential role of developmentally activated hypoxia-inducible factor 1 alpha for cardiac morphogenesis and function. Circ Res 103, 1139-1146, doi: 10.1161 / 01 .RES.0000338613.89841 ,c1 (2008).22 Sanjana, N. E., Shalem, O. & Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature methods 11 , 783-784, doi:10.1038 / nmeth.3047 (2014).23 Menendez-Montes, I. et al. Metabolic reprogramming from glycolysis to amino acid utilization in cardiac HIF1 a deficient mice. bioRxiv, 579433, doi:10.1101 / 579433 (2019).24 Ream, M., Ray, A. M., Chandra, R. & Chikaraishi, D. M. Early fetal hypoxia leads to growth restriction and myocardial thinning. Am J Physiol Regul Integr Comp Physiol 295, R583-595, doi:10.1152 / ajpregu.00771 .2007 (2008).25 Lee, Y. M. et al. Determination of hypoxic region by hypoxia marker in developing mouse embryos in vivo: a possible signal for vessel development. Developmental dynamics : an official publication of the American Association of Anatomists 220, 175-186, doi: 10.1002 / 1097-0177(20010201)220:2<175::AID-DVDY1101 >3.0.CO;2-F (2001).26 O'Reilly, V. C. et al. Gene-environment interaction demonstrates the vulnerability of the embryonic heart. Developmental biology 391 , 99-110, doi:10.1016 / j.ydbio.2014.03.005 (2014).27 Dunwoodie, S. L. The role of hypoxia in development of the Mammalian embryo. Developmental cell 17, 755-773, doi:10.1016 / j.devcel.2009.11.008 (2009).28 Semenza, G. L. Hypoxia-inducible factor 1 and cardiovascular disease. Annual review of physiology 76, 39-56, doi:10.1146 / annurev-physiol-021113-170322 (2014).29 Solmonson, A. et al. Compartmentalized metabolism supports midgestation mammalian development. Nature 604, 349-353, doi:10.1038 / s41586-022-04557-9 (2022).30 Oginuma, M. et al. A Gradient of Glycolytic Activity Coordinates FGF and Wnt Signaling during Elongation of the Body Axis in Amniote Embryos. Developmental cell 40, 342-353 e310, doi:10.1016Zj.devcel.2017.02.001 (2017).31 Sun, Z. & Xu, Y. Nuclear Receptor Coactivators (NCOAs) and Corepressors (NCORs) in the Brain. Endocrinology 161 , doi:10.1210 / endocr / bqaa083 (2020).32 Croteau, W., Davey, J. C., Galton, V. A. & St Germain, D. L. Cloning of the mammalian type II iodothyronine deiodinase. A selenoprotein differentially expressed and regulated in human and rat brain and other tissues. The Journal of clinical investigation 98, 405-417, doi:10.1172 / JCI118806 (1996).33 Deda, O. et al. A metabolic phenotyping study in mice following acute and chronic exposures to ethanol. J Proteome Res, doi:10.1021 / acs.jproteome.0c00440 (2020).34 Gu, W. et al. Glycolytic Metabolism Plays a Functional Role in Regulating Human Pluripotent Stem Cell State. Cell Stem Cell 19, 476-490, doi:10.1016 / j.stem.2016.08.008 (2016).35 Tohyama, S. et al. Distinct metabolic flow enables large-scale purification of mouse and human pluripotent stem cell-derived cardiomyocytes. Cell Stem Cell 12, 127-137, doi:10.1016 / j.stem.2012.09.013 (2013).36 Xia, J., Psychogios, N., Young, N. & Wishart, D. S. MetaboAnalyst: a web server for metabolomic data analysis and interpretation. Nucleic Acids Res 37, W652-660, doi:10.1093 / nar / gkp356 (2009).37 Mylonis, I., Simos, G. & Paraskeva, E. Hypoxia-Inducible Factors and the Regulation of Lipid Metabolism. Cells 8, doi:10.3390 / cells8030214 (2019).38 Zhao, M. et al. Palmitic Acid Downregulates Thyroglobulin (Tg), Sodium Iodide Symporter (NIS), and Thyroperoxidase (TPO) in Human Primary Thyrocytes: A Potential Mechanism by Which Lipotoxicity Affects Thyroid? Int J Endocrinol 2018, 4215848, doi:10.1155 / 2018 / 4215848 (2018).39 Chen, G. et al. Chemically defined conditions for human iPSC derivation and culture. Nature methods 8, 424-429, doi:10.1038 / nmeth.1593 (2011).40 Polizzotti, B. D., Ganapathy, B., Haubner, B. J., Penninger, J. M. & Kuhn, B. A cryoinjury model in neonatal mice for cardiac translational and regeneration research. Nature protocols 11 , 542-552, doi:10.1038 / nprot.2016.031 (2016).41 Yeo, E. J. et al. YC-1 : a potential anticancer drug targeting hypoxia-inducible factor 1 . J Natl Cancer Inst95, 516-525, doi: 10.1093 / jnci / 95.7.516 (2003).42 Wang, G. L., Jiang, B. H., Rue, E. A. & Semenza, G. L. Hypoxia-inducible factor 1 is a basic- helix-loop-helix-PAS heterodimer regulated by cellular 02 tension. Proceedings of theNational Academy of Sciences of the United States of America 92, 5510-5514, doi:10.1073 / pnas.92.12.5510 (1995).43 Kimura, W. et al. Hypoxia fate mapping identifies cycling cardiomyocytes in the adult heart. Nature 523, 226-230, doi:10.1038 / nature14582 (2015).44 Bae, J. et al. Malonate Promotes Adult Cardiomyocyte Proliferation and Heart Regeneration. Circulation 143, 1973-1986, doi:10.1161 / CIRCULATIONAHA.120.049952 (2021).45 Vazquez-Borrego, M. C. et al. The Pituitary Gland is a Novel Major Site of Action of Metformin in Non-Human Primates: a Potential Path to Expand and Integrate Its Metabolic Actions. Cell Physiol Biochem 49, 1444-1459, doi:10.1159 / 000493448 (2018).46 Miller, R. A. et al. Biguanides suppress hepatic glucagon signalling by decreasing production of cyclic AMP. Nature 494, 256-260, doi:10.1038 / nature11808 (2013).47 Emelyanova, L. et al. Biphasic effect of metformin on human cardiac energetics. Transl Res 229, 5-23, doi:10.1016 / j.trsl.2020.10.002 (2021).48 Kanashiro-Takeuchi, R. M. et al. Activation of growth hormone releasing hormone (GHRH) receptor stimulates cardiac reverse remodeling after myocardial infarction (Ml). Proceedings of the National Academy of Sciences of the United States of America 109, 559-563, doi:10.1073 / pnas.1119203109 (2012).49 Konermann, S. et al. Genome-scale transcriptional activation by an engineered CRISPR- Cas9 complex. Nature 517, 583-588, doi:10.1038 / nature14136 (2015).50 Feldser, D. et al. Reciprocal positive regulation of hypoxia-inducible factor 1 alpha and insulinlike growth factor 2. Cancer Res 59, 3915-3918 (1999).51 Treins, C., Giorgetti-Peraldi, S., Murdaca, J., Semenza, G. L. & Van Obberghen, E. Insulin stimulates hypoxia-inducible factor 1 through a phosphatidylinositol 3-kinase / target of rapamycin-dependent signaling pathway. J Biol Chem 277, 27975-27981 , doi: 10.1074 / jbc.M204152200 (2002).52 Chavez, J. C. & LaManna, J. C. Activation of hypoxia-inducible factor-1 in the rat cerebral cortex after transient global ischemia: potential role of insulin-like growth factor-1. The Journal of neuroscience : the official journal of the Society for Neuroscience 22, 8922-8931 , doi:10.1523 / JNEUROSCI.22-20-08922.2002 (2002).53 Bertherat, J. et al. Chronic growth hormone (GH) hypersecretion induces reciprocal and reversible changes in mRNA levels from hypothalamic GH-releasing hormone and somatostatin neurons in the rat. The Journal of clinical investigation 91 , 1783-1791 , doi:10.1172 / JCI116389 (1993).54 McCarthy, D. J., Chen, Y. & Smyth, G. K. Differential expression analysis of multifactor RNA- Seq experiments with respect to biological variation. Nucleic Acids Res 40, 4288-4297, doi:10.1093 / nar / gks042 (2012).55 Nanka, O. et al. Abnormal myocardial and coronary vasculature development in experimental hypoxia. Anat Rec (Hoboken) 291 , 1187-1199, doi:10.1002 / ar.20738 (2008).56 Ye, L. et al. Role of Blood Oxygen Saturation During Post-Natal Human Cardiomyocyte Cell Cycle Activities. JACC Basic Transl Sci 5, 447-460, doi:10.1016 / j.jacbts.2020.02.008 (2020).57 Nagao, K. et al. HIF-1 alpha signaling upstream of NKX2.5 is required for cardiac development in Xenopus. J Biol Chem 283, 11841-11849, doi:10.1074 / jbc.M702563200 (2008).58 Moskowitz, I. P. et al. A molecular pathway including Id2, Tbx5, and Nkx2-5 required for cardiac conduction system development. Cell 129, 1365-1376, doi: 10.1016 / j. cell.2007.04.036 (2007).59 Sedmera, D. et al. Spatiotemporal pattern of commitment to slowed proliferation in the embryonic mouse heart indicates progressive differentiation of the cardiac conduction system. Anat Rec A Discov Mol Cell Evol Biol 274, 773-777, doi:10.1002 / ar.a.10085 (2003).60 Pashmforoush, M. et al. Nkx2-5 pathways and congenital heart disease; loss of ventricular myocyte lineage specification leads to progressive cardiomyopathy and complete heart block. Ce / / 117, 373-386, doi:10.1016 / s0092-8674(04)00405-2 (2004).61 Koivunen, P. et al. Inhibition of hypoxia-inducible factor (HIF) hydroxylases by citric acid cycle intermediates: possible links between cell metabolism and stabilization of HIF. J Biol Chem 282, 4524-4532, doi:10.1074 / jbc.M610415200 (2007).62 Vander Heiden, M. G., Cantley, L. C. & Thompson, C. B. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324, 1029-1033, doi: 10.1126 / science.1160809 (2009).63 Buikema, J. W. et al. Wnt Activation and Reduced Cell-Cell Contact Synergistically Induce Massive Expansion of Functional Human iPSC-Derived Cardiomyocytes. Cell Stem Cell 27, 50-63 e55, doi:10.1016 / j.stem.2020.06.001 (2020).64 Cardoso, A. C. et al. Mitochondrial Substrate Utilization Regulates Cardiomyocyte Cell Cycle Progression. Nat Metab 2, 167-178 (2020).65 Spielmann, N. et al. Publisher Correction: Extensive identification of genes involved in congenital and structural heart disorders and cardiomyopathy. Nature Cardiovascular Research '], 529-531 , doi: 10.1038 / S44161 -022-00072-2 (2022).66 Bundgaard, H. et al. A Novel Familial Cardiac Arrhythmia Syndrome with Widespread ST- Segment Depression. The New England journal of medicine 379, 1780-1781 , doi:10.1056 / NEJMcl 807668 (2018).67 Dulce, R. A. et al. Synthetic growth hormone-releasing hormone agonist ameliorates the myocardial pathophysiology characteristic of HFpEF. Cardiovascular research, doi:10.1093 / cvr / cvac098 (2022).68 Gesmundo, I. et al. Growth hormone-releasing hormone attenuates cardiac hypertrophy and improves heart function in pressure overload-induced heart failure. Proceedings of the National Academy of Sciences of the United States of America 114, 12033-12038, doi:10.1073 / pnas.1712612114 (2017).69 Bagno, L. L. et al. Growth hormone-releasing hormone agonists reduce myocardial infarct scar in swine with subacute ischemic cardiomyopathy. Journal of the American Heart Association 4, doi:10.1161 / JAHA.114.001464 (2015).70 Hatzistergos, K. E. et al. A novel cardiomyogenic role for Isl1 (+) neural crest cells in the inflow tract. Sei Adv 6, doi:10.1126 / sciadv.aba9950 (2020).71 Lian, X. et al. Directed cardiomyocyte differentiation from human pluripotent stem cells by modulating Wnt / beta-catenin signaling under fully defined conditions. Nature protocols 8, 162- 175, doi:10.1038 / nprot.2012.150 (2013).72 Kuznetsov, J. N. et al. BAP1 regulates epigenetic switch from pluripotency to differentiation in developmental lineages giving rise to BAP1 -mutant cancers. Sei Adv 5, eaax1738, doi: 10.1126 / sciadv.aax1738 (2019).73 Zhu, L. J. et al. ChIPpeakAnno: a Bioconductor package to annotate ChlP-seq and ChlP-chip data. BMC Bioinformatics 11 , 237, doi:10.1186 / 1471-2105-11-237 (2010).74 Deda, O. et al. Metabolic Phenotyping Study of Mouse Brain Following Microbiome Disruption by C.difficile Colonization. Metabolites 12, doi:10.3390 / metabo12111039 (2022).75 Piguet F. et al. Rapid and Complete Reversal of Sensory Ataxia by Gene Therapy in a Novel Model of Friedreich Ataxia. Mol Ther . 2018 Aug 1 ;26(8):1940-1952. doi:10.1016 / j.ymthe.2018.05.006. Epub 2018 May 28.76 Shinnick JE, Schadt K, Strawser C, Wilcox N, Perlman SL, Wilmot GR, Gomez CM, Mathews KD, Yoon G, Zesiewicz T, Hoyle C, Subramony SH, Yiu EM, Delatycki MB, Brocht AF, Farmer JM, Lynch DR. Comorbid Medical Conditions in Friedreich Ataxia: Association With Inflammatory Bowel Disease and Growth Hormone Deficiency. J Child Neurol. 2016 Aug;31 (9):1161-5. doi: 10.1177 / 0883073816643408. Epub 2016 Apr 12. PMID: 27071470.77 Kalef-Ezra E, Edzeamey FJ, Valle A, Khonsari H, Kleine P, Oggianu C, Al-Mahdawi S, Pook MA, Anjomani Virmouni S. A new FRDA mouse model [Fxnnull:YG8s(GAA) > 800] with more than 800 GAA repeats. Front Neurosci. 2023 Jan 26;17:930422. doi: 10.3389 / fnins.2023.930422. PMID: 36777637; PMCID: PMC990953878 Alba M, Fintini D, Sagazio A, Lawrence B, Castaigne JP, Frohman LA, Salvatori R. Once- daily administration of CJC-1295, a long-acting growth hormone-releasing hormone (GHRH) analog, normalizes growth in the GHRH knockout mouse. Am J Physiol Endocrinol Metab. 2006 Dec;291 (6):E1290-4. doi: 10.1152 / ajpendo.00201 .2006. Epub 2006 Jul 5. PMID: 16822960.
Claims
Claims1. A method of treating a neurodegenerative disorder, the method comprising administering a GHRH agonist to a subject in need thereof.
2. The method of claim 1, wherein the neurodegenerative disorder is Friedreich’s ataxia.
3. A method of improving cardiac function in a subject suffering from Friedreich’s ataxia, the method comprising administering to the subject a GHRH agonist.
4. The method of any one of claims 1-3 wherein the GHRH agonist is GHRH (1-44) or a synthetic GHRH analog selected from the group consisting of GHRH (1-29), CJC-1295, tesamorelin, Sermorelin, Hexarelin, TH9507, MK-677, JI-38, MR-326, MR-327, MR-351, MR- 356, MR-361, MR-367, MR401 , MR-403, MR-404, MR-405, MR-406, MR-407, MR-408, MR- 409, MR-410, MR-420, MR-421 , MR-502, MR-504, and MR-702.
Citation Information
Patent Citations
GHRH agonists for the treatment of ischemic disorders
WO2014100809A2
Use of indole acetic acid or derivatives thereof to increase IGF-1 serum levels
CA2541090C
Application of growth hormone-releasing hormone agonist GHRH-A in preparation of anti-aging drug
CN111407884A
Cardioprotective effects of GHRH agonists
US8507433B1