Compositions and methods of therapy

Abstract

The present invention relates to compositions, combinations and methods for the expression of a gene sequence of interest in a target cell wherein the composition comprises; (a) a first vector comprising a non-native receptor sequence, wherein the first vector is capable of introducing and / or expressing the non-native receptor sequence in the target cell, resulting in the exhibition of the non-native receptor on the target cell surface; and (b) a second vector comprising the gene sequence of interest wherein the second vector uses the non-native receptor for cell entry and enables the expression of the gene of interest in the target cell.

Description

[0001] COMPOSITIONS AND METHODS OF THERAPY

[0002] Technical Field of the Invention

[0003] The present invention relates to compositions and methods for incorporating large capacity vectors into target cells for gene therapy. In particular, the invention relates to compositions and methods for gene therapy in ocular conditions such as Stargardt disease.

[0004] Background to the Invention

[0005] Gene therapy is a medical technology which aims to produce a therapeutic effect through the manipulation of gene expression or through altering the biological properties of living cells. A number of gene therapy approaches harness adeno-associated viruses (AAVs) or lentiviruses for performing gene insertions either in vivo or ex vivo. AAV vectors have been widely used to deliver gene products due to their low toxicity, high immune tolerance and efficient transduction of many mammalian cell types. AAV vectors have the ability to transduce both dividing and nondividing cells and the potential to integrate into specific sites in the genome and are also able to achieve long-term expression in-vivo. However, AAV capacity is known to be limited to less than 5kb, which makes AAV vectors unsuitable to carry larger genes, precluding their use for several prevalent genetic conditions including Duchenne muscular dystrophy, cystic fibrosis, haemophilia A and Dysferlinopathies, amongst many others. Several conditions affecting photoreceptors are due to mutations in large genes and remain untreatable. These include: Stargardt disease (ABCA4 gene), the leading cause of juvenile macular degeneration and most common inherited retinal dystrophy; Leber Congenital Amaurosis (CEP290 gene), the most common cause of childhood blindness; Usher Syndrome (USH2A and MY07A genes) the most common cause of combined deafness and blindness; IFT140 ciliopathy (IFT140 gene).

[0006] Numerous lentiviruses, a type of retrovirus, have been utilised in gene therapy. They have the ability to infect non-dividing cells, they have a large genetic payload capacity (~9kb), low immunogenicity, and modified versions have been engineered which can selectively prevent or permit integration of the viral-derived DNA into the host genome. Integration into the host genome enables the genetic information inserted by the lentivirus to be inherited by cells derived from the initial host cell. These characteristics make lentivirus gene therapy applicable in a wider range of potential applications. Human lentivirus infection of a cell does not rely on a single receptor to target cells. This limits the ability to develop lentiviral vectors that can be used efficiently for a range of applications for which lentiviral gene therapy is otherwise suitable.

[0007] One of the issues of AAV technology is the inability to successfully deliver and effect the expression of larger genes. It is therefore at least one object of the present invention to address the issue of delivering and expressing larger genes.

[0008] Summary of the Invention

[0009] In accordance with a first aspect of the present invention, there is provided a composition for expression of a gene sequence of interest in a target cell, wherein the composition comprises; (a) a first vector comprising a non-native receptor sequence, wherein the first vector is capable of introducing and / or expressing the non-native receptor sequence in the target cell, resulting in the exhibition of the non-native receptor on the target cell surface and (b) a second vector comprising the gene sequence of interest, wherein the second vector uses the non-native receptor for cell entry and enables the expression of the gene of interest in the target cell.

[0010] In a second aspect of the present invention, there is provided a combination for the expression of a gene sequence of interest in a target cell, wherein the combination comprises the first vector according to the first aspect and the second vector according to the first aspect.

[0011] In another aspect, there is provided a combination for the expression of a gene sequence of interest in a target cell, wherein the combination comprises; (a) a first vector comprising a non- native receptor sequence, wherein the first vector is capable of introducing and / or expressing the non-native receptor sequence in the target cell, resulting in the exhibition of the non-native receptor on the target cell surface; and (b) a second vector comprising the gene sequence of interest wherein the second vector uses the non-native receptor for cell entry and enables the expression of the gene of interest in the target cell.

[0012] In a further aspect of the invention, there is provided a method for introducing a gene sequence of interest in a target cell, the method comprising applying the composition or combination according to any embodiment of the invention to the target cell.

[0013] In a further aspect of the invention, there is provided a kit of parts for the expression of a gene sequence of interest in a target cell, wherein the kit comprises the composition or combination according to any aspect of the invention. A kit may include instructions for use.

[0014] In a further aspect of the invention, there is provided a method of treatment comprising administering the composition or combination according to any embodiment, or the kit according to any embodiment to a patient in need thereof.

[0015] In a further aspect of the invention, there is provided a composition or combination according to any embodiment, and / or a kit according to any embodiment for use in a method or treatment.

[0016] In a further aspect of the invention, there is provided a target cell having a non-native receptor and a vector comprising a gene sequence of interest, wherein the vector uses the non-native receptor for cell entry and enables the expression of a gene of interest in the target cell and wherein the second vector is a lentivirus. In a related embodiment, there is provided a combination of a target cell having a non-native receptor and a vector comprising a gene sequence of interest, wherein the vector uses the non-native receptor for cell entry and enables the expression of the gene sequence of interest in the target cell and wherein the second vector is a lentivirus.

[0017] Also provided is a combination of a first construct comprising a non-native receptor sequence, wherein the first construct is adapted to express the non-native receptor sequence in a target cell when the construct is used in conjunction with a first vector resulting in the exhibition of the non-native receptor on the target cell surface, and a second construct comprising a gene sequence of interest, wherein the second construct is adapted to express the gene of interest in a target cell when the construct is used in conjunction with a second vector enabling expression of the gene sequence of interest in the target cell, and wherein the second vector is a lentivirus.

[0018] In embodiments of the aspects above, the second vector is a lentivirus.

[0019] Detailed description

[0020] The aspects and embodiments of the invention will now be further described. In the following passages, different embodiments are described. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of immunology, molecular biology, chemistry, biochemistry and recombinant DNA technology, which are within the skill of the art. Such techniques are explained fully in the literature.

[0021] Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, pathology, oncology, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the present disclosure are generally performed according to conventional methods well-known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Green and Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012).

[0022] Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclatures used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients

[0023] The inventors have developed a “trojan horse” approach to gene therapy which is able to efficiently transduce a large gene of interest into host cells lacking this gene. By transducing ABCA4 into the retinal cells of a disease model the inventors were able improve the disease phenotype in a disease model of Stargardt disease. They were also able to efficiently transduce the gene of interest (ABCA4) into human-derived retinal cells cultured in a three- dimensional organoid in vitro.

[0024] In accordance with a first aspect of the present invention, there is provided a composition for expression of a gene sequence of interest in a target cell, wherein the composition comprises; (a) a first vector comprising a non-native receptor sequence, wherein the first vector is capable of introducing and / or expressing the non-native receptor sequence in the target cell, resulting in the exhibition of the non-native receptor on the target cell surface and (b) a second vector comprising the gene sequence of interest, wherein the second vector uses the non-native receptor for cell entry and enables the expression of the gene of interest in the target cell.

[0025] In another aspect, there is provided a combination for the expression of a gene sequence of interest in a target cell, wherein the combination comprises; (a) a first vector comprising a non- native receptor sequence, wherein the first vector is capable of introducing and / or expressing the non-native receptor sequence in the target cell, resulting in the exhibition of the non-native receptor on the target cell surface; and (b) a second vector comprising the gene sequence of interest wherein the second vector uses the non-native receptor for cell entry and enables the expression of the gene of interest in the target cell.

[0026] Embodiments of these aspects are set out below. In one embodiment, the second vector is a lentivirus.

[0027] In one embodiment, the non-native receptor sequence and / or the gene sequence of interest may be under the control of a promoter.

[0028] In one embodiment, the first vector is a non-viral vector. In a further related embodiment, the first vector is an adeno associated virus (AAV). In a related embodiment, the first vector is a nanoparticle, and optionally the non-viral vector is a lipid nanoparticle.

[0029] In one embodiment, the second vector is a vector which is capable of using only the nonnative receptor exhibited on the target cell for cell entry.

[0030] In one embodiment, the non-native receptor sequence encodes a lentiviral target, optionally the non-native receptor sequence encodes an equine and / or an avian lentivirus target. In a related embodiment, the non-native receptor sequence encodes equine lentivirus receptor-1 (ELR1) and / or transmembrane receptor of virus type A (TV A).

[0031] ELR1 may comprise a nucleic acid sequence as shown in SEQ ID NO: 42. In one embodiment, the nucleic acid may be a variant of SEQ ID NO: 42. TVA may comprise a nucleic acid sequence as shown in SEQ ID NO: 49 or in SEQ ID NO: 50. In one embodiment, the nucleic acid may be a variant of SEQ ID NO: 49 or SEQ ID NO: 50. GenBank Numbers are AY531262.1 (TVA800) and AY531261.1 (TVA950).

[0032] A variant as used herein has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the reference sequence.

[0033] The non-native receptor may be any receptor that is not normally expressed by the target cell. Such a non-native receptor may be described as a recombinant receptor. The non-native receptor may be a receptor that is derived from the same organism of the target cell but is not usually expressed on the target cell. Alternatively, the non-native receptor may be a receptor that is derived from an organism that differs from the organism of the target cell. The non- native receptor may be a eukaryotic, prokaryotic, or viral receptor. In one embodiment, the non-native receptor is a wild type protein.

[0034] In a related embodiment, the second vector is a modified lentivirus. In a further related embodiment, the second vector comprises an HIV-based lentivirus backbone and / or a nonintegrating lentiviral backbone and / or the Equine Infectious Anaemia Virus (EIAV) backbone and / or an equine lentivirus.

[0035] In a further related embodiment, the second vector comprises an avian lentivirus backbone and / or an avian lentivirus. In a yet further related embodiment, the second vector is pseudotyped with a cell surface protein, optionally the cell surface protein is an equine and / or avian cell surface protein and / or glycoprotein. The equine cell surface receptor may be Infectious Anaemia Virus (EIAV) envelope glycoprotein and / or the avian cell surface receptor may be Avian Sarcoma Leukosis Virus (ASLV) envelope glycoprotein. For example, the second vector comprises an HIV-based lentivirus backbone pseudotyped with an equine cell surface protein.

[0036] In a further related embodiment, the non-native receptor sequence encodes equine lentivirus receptor-1 (ELR1) and the equine cell surface protein is a glycoprotein such as gp90. In an alternative embodiment the non-native receptor sequence encodes trans-membrane receptor virus type A (TVA) and the avian cell surface protein is a glycoprotein such as Avian Sarcoma Leukosis Virus (ASLV) envelope glycoprotein.

[0037] In one embodiment, the lentivirus is pseudotyped for a lentivirus serogroup which requires only a single type of receptor for cell entry. Unlike human lentiviruses, the Equine Infectious Anaemia Virus (EIAV) virus and avian sarcoma leukosis virus require only one receptor molecule (ELR1 in the case of EIAV) to enter cells whereas human LV typically require complex interactions with several surface molecules to achieve cell entry. In one embodiment, ELR1 is first delivered to target cells by suitable means (e.g. AAV, LBNP or LNP). Upon delivery, specific expression of ELR1 in the target cell of choice is achieved through a cell type specific promoter. The transgene of interest is subsequently delivered to the resulting target cells exhibiting the ELR1 receptor on their cell surface, via a large capacity human LV, pseudotyped with the EIAV glycoprotein (gp90). Thus, ELR1 priming enables specific and efficient transgene transduction, by way of the pseudotyped LV, into a population of otherwise poorly transducible target cells.

[0038] The inventors have advantageously used an AAV to express this receptor molecule in the target cell and have then used a human lentivirus pseudo-typed with the equine glycoprotein to carry the gene of interest into the cells. In this way, the first vector acts as a ‘Trojan horse’, enabling transduction of the gene of interest by the pseudo-typed lentivirus.

[0039] Therefore, the skilled person will understand from the work of the inventors that it is the combination of the non-native receptor introduced and / or expressed by the first vector in the target cell and the corresponding cell surface protein expressed on the surface of the second vector which are central to the “trojan horse” approach developed by the inventors.

[0040] In a yet further related embodiment, the target cell is one or more cells selected from the following: photoreceptor cell, a cell affected by Retinitis Pigmentosa, a cell affected by Stargardt disease, a cell affected by Usher syndrome, a cell affected by retinal degeneration, a cell affected by Cystic Fibrosis, a cell affected by Duchenne muscular dystrophy and / or a cell affected by Leber Congenital Amaurosis (LCA).

[0041] As used herein, the terms “gene” and “gene sequence” are used interchangeably. These terms refer to a nucleic acid sequence which may be transcribed and / or translated by the target cell to express and / or synthesise a protein with the desired function. Thus, in one embodiment, the gene of interest may comprise the coding sequence. The gene of interest may include only exons, or exons and introns, and in certain embodiments, it may include noncoding sequences, such as any auxiliary nucleic acid sequences such as promoter sequences required for translation or expression to express and / or synthesise a protein. Thus, in certain embodiments, a gene sequence of interest refers to the entire nucleic acid sequence, including regulatory sequences, such as one or more promoters for initiating transcription of the gene of interest, enhancers, fluorescent markers, antibiotic resistance markers, a nuclear localisation signal, posttranscriptional regulatory elements, long terminal repeat (LTR), amongst other features, which is introduced into the target cell by the second vector binding to the non-native receptor expressed on the surface of the target cell. The gene sequence of interest is often referred to as a nucleic acid construct in the art. It will be well within the knowledge of the skilled person to select appropriate auxiliary sequence features that may be included in the gene sequence of interest.

[0042] The nucleic acid sequence may be one or more selected from the following: The nucleic acid sequence may be DNA (e.g. genomic, cDNA, plasmid, linear, circular), RNA (e.g. mRNA, tRNA, rRNA, snRNA, snoRNA, miRNA, siRNA, shRNA, IncRNA, gRNA, antisense RNA, circRNA), viral RNA or DNA, or synthetic analogues thereof, including chemically modified bases, backbones, or nucleotides.

[0043] The sequence encoding the gene sequence of interest and / or the gene of interest may be greater than about 4.5 kb, optionally greater than about 5 kb, greater than about 5.5 kb, greater than about 6 kb, greater than about 6.5 kb, greater than about 7 kb, greater than about 7.5 kb, greater than about 8 kb, or greater than about 8.5 kb. Alternatively, the sequence encoding the gene sequence of interest and / or the gene of interest is greater than about 9 kb, optionally the sequence is up to about 12 kb. Alternatively, the sequence encoding the gene sequence of interest and / or the gene of interest is between about 4.5 kb and about 12 kb, optionally between 5 kb and about 12 kb, between about 5.5 kb and about 12 kb, between about 6 kb, and about 12 kb, between about 6.5 kb and about 12 kb, between about 7 kb and about 12 kb, between about 7.5 kb and about 12 kb, between about 8 kb and about 12 kb, between about 8.5 kb and about 12 kb. Further alternatively, the sequence encoding the gene and / or the gene sequence of interest is between about 4.5 kb and about 9 kb, optionally between 5 kb and about 9 kb, between about 5.5 kb and about 9 kb, between about 6 kb, and about 9 kb, between about 6.5 kb and about 9 kb, between about 7 kb and about 9 kb, between about 7.5 kb and about 9 kb, between about 8 kb and about 9 kb, between about 8.5 kb and about 9 kb.

[0044] The skilled addressee could identify that the gene of interest is a gene implicated in a disease, disorder and and / or syndrome. The gene of interest may be a large gene (e.g. a gene requiring a gene sequence larger than about 4.5 kb) that would not be suitable for introducing into a target cell using non-lentiviral methods such as AAV. The skilled addressee will appreciate that the composition of the invention would potentially treat any disease, disorder and / or syndrome.

[0045] The skilled person will appreciate that the composition, combination and method of the present invention are particularly suited to introducing a gene of interest that requires a large amount of nucleic acid into the target cell. The skilled person will appreciate that examples of such genes of interest include, but are not limited to, transporters, macromolecules, ion channels, viral receptors, membrane-bound or transmembrane proteins.

[0046] In one embodiment, the gene of interest is a gene implicated in an ocular disease, disorder and / or syndrome. In a yet further related embodiment, the gene of interest is one or more selected from the following: ATP Binding Cassette Subfamily A Member 4 (ABCA4) (SEQ ID No. 12), Myosin VIIA (MY07A), Usherin (USH2A), Centrosomal Protein of 290kDA (CEP290) and / or I ntraflagellar Transport 140 homolog (IFT140).

[0047] In a related embodiment the lentivirus vector comprises a lentiviral vector that integrates into the genome of the target cell. The lentiviral vector may comprise an integrating human, equine, or avian lentivirus backbone and / or an integrating lentivirus. In an alternative embodiment, the lentivirus vector may comprise a non-integrating human, equine, or avian lentivirus backbone and / or non-integrating lentivirus.

[0048] A retroviral vector and / or particle can be based on any suitable retrovirus vector and / or particle which is able to deliver genetic information to eukaryotic cells. For example, the retroviral vector and / or particle may be an alpharetroviral vector and / or particle, a gammaretroviral vector and / or particle, a lentiviral vector and / or particle or a spumaretroviral vector and / or particle. Such vectors and / or particles have been used extensively in gene therapy treatment and other gene delivery applications. In some embodiments, the retroviral vector and / or particle is a lentiviral vector and / or particle. In some instances, the retroviral vector and / or particle may be based on HIV-1. Preferably, the vector and / or particle is derived from a lentivirus.

[0049] The lentiviral genome is constituted by essential viral elements that are flanked between noncoding sequences that control gene transcription and protein synthesis. In some embodiments, the vector genome further comprises an exogenous nucleotide sequence for delivery into a target cell. This exogenous nucleotide sequence may be any sequence, which the skilled person might want to insert into a target cell. For example, the exogenous nucleotide sequence may be an expressible transgene, an RNA interference cassette, or a molecular barcode, for example, for marking the lineage of different cells. The exogenous nucleotide sequence should be located between the PBS and the 3’ LTR. Plasmids encoding retroviral vectors containing a sequence encoding the protein of interest are transfected into suitable host cells (or packaging cells) by standard methods known to one of ordinary skill in the art and include, for example, HEK293T cells.

[0050] Modified lentiviral vector systems are typically generated by trans-complementation whereby suitable packaging cells are co-transfected with a plasmid containing the vector genome and additional plasmids containing the packaging constructs encoding only the proteins essential for LV assembly and production of the viral genome. Splitting of the genome into multiple plasmids prevent the formation of replication-competent lentiviral particles. These additional plasmids typically include and separate the gag / pol gene sequences; the rev packaging sequence; and the envelope (env) sequence. In a related embodiment the env sequence may instead be contained within the viral genome. These components and how they relate to making a lentiviral vector are well known to those skilled in the art (e.g. see Matrai et al. Janka et al. Molecular Therapy, Volume 18, Issue 3, 477 - 490, 2010). In one embodiment, the envelope sequence (env) contains the protein sequence encoding the protein used to pseudotype the virion envelope, including an equine and / or avian cell surface protein and / or glycoprotein.

[0051] In some embodiments a self-inactivating (SIN) LV configuration may also be used, in which the intrinsic promoter / enhancer activity of the HIV-1 LTR has been abolished by suitable modification of the viral genome. This modification reduces the expression of coding sequences located adjacent to the vector integration site and prevents mobilisation of replication competent virus following accidental recombination with wild-type HIV-1.

[0052] In some embodiments a non-integrating lentiviral (NILV) vector may also be used. Such vectors contain suitable modifications to disrupt the function of the LV integrase enzyme, reducing or preventing DNA integration into the host genome. Such modified vectors are well known to those skilled in the art (e.g. Gurumoorthy N et al. Biomedicines, Jan 5;10(1):107. 2022).

[0053] Recombinant retrovirus produced from the transfected cells may be harvested by standard methods. The harvested retrovirus, in the form of virions, may be used to transduce a permissive target cell by standard techniques. A target cell is defined herein as any cell that is permissive to infection by the virus produced by the retroviral vector of the present invention. The target cell can be in vivo, in vitro or ex vivo. Representative target cells include, for example, bone marrow stem cells, hepatocytes, muscle cells, tumour cells, neurons, retinal cells, and airway epithelial cells. After entry into the target cell the virally derived DNA can then express the transgene or polypeptide of interest. Because the viral genome contains no packaging sequence, it is replication incompetent.

[0054] In a further embodiment the non-native receptor sequence of the first vector is under the control of a promoter and / or the gene of interest of the second vector is under the control of a promoter. In a related embodiment, the promoter that controls the non-native receptor sequence is a tissue-specific or cell-specific promoter of the target cell. Alternatively, the promoter that controls the non-native receptor is not tissue-specific or cell-specific to the target cell.

[0055] In a further related embodiment, the promoter that controls the gene of interest is a tissuespecific or cell-specific promoter of the target cell. Alternatively, the promoter that controls the gene of interest is not tissue-specific or cell-specific to the target cell.

[0056] The promoter that controls the non-native receptor and the promoter that controls the gene of interest may be a prokaryotic promoter, eukaryotic promoter, bacterial promoter, viral promoter, mammalian promoters, and / or synthetic promoter. Examples of suitable promoters will be readily apparent to the skilled person and include but are not limited to any of the following: prokaryotic promoters such as lac, tac, trp, araBAD, and T7; yeast promoters such as GAL1 , ADH1 , and PGK1 ; plant promoters such as CaMV 35S and maize ubiquitin; viral promoters such as CMV immediate-early, SV40 early, RSV LTR, and adenovirus major late; mammalian promoters such as EF1a, PGK, CAG, p-actin, GAPDH, and ubiquitin C; cellspecific promoters such as synapsin, GFAP, albumin, and Lek, Photoreceptor-specific such as Rho, Cone Opsin, RK, Crx, Nrl; Ganglion cell promoters such as hSyn; Horizontal cell promoters such as hSyn and Gja10; inducible promoters such as tetracycline-responsive, metallothionein, and heat shock protein promoters; and synthetic promoters or chimeric constructs comprising combinations of enhancer and minimal promoter elements.

[0057] A person skilled in the art would be able to select suitable non-viral vectors for delivery of genetic materials to target cells. Preferred non-viral vectors may include Lipid-based Nanoparticles (LBNPs) or Lipid Nanoparticles (LNPs), including charged LBNPs or LNPs (e.g. Cationic Lipid Nanoparticles, Anionic Lipid Nanoparticles) Niosomes, Nanoemulsions, Solid Lipid Nanoparticles (SLP), Nanostructured Lipid Carriers (NLC), Nonlamellar LNPs or Echogenic Liposomes. Suitable particle are described in Zhai et al, ACS NanoVol 13 / lssue 6, 2019; Hart et al Human Gene Therapy Vol. 9, No. 4, 2008. Alternatively, preferred LNPs may be formulated using any combination of previously described materials including cationic lipids, ionizable lipids, zwitterionic ionizable lipids, cholesterol, phospholipids, PEG-lipids and / or lipid-like materials (Hou at al. Nat Rev Mater 6, 1078-1094 (2021)). Anionic LNPs, e.g. anionic PEGylated nanocomplexes, are for example described in WO 2019 / 138235 and Tagalakis, UCL Open Access, 10.1002 / adfm.202104843, both incorporated herein by reference. Precirol based LNPs may also be used. The skilled person would be able to select suitable formulations for LBNPs and LNPs. LNPs and LBNPs may be used to deliver RNA or DNA cargo.

[0058] In a related embodiment of the invention, there is provided a method of treatment comprising administering the composition, combination, cell, construct, and / or kit according to the invention to a patient in need thereof.

[0059] In a further related embodiment of the invention, there is provided a composition, combination, cell, construct, and / or kit for use in a method of treatment.

[0060] In a related embodiment of the present invention, there is provided a composition or combination for use in the production of a medicament for the expression of a gene of interest in a target cell wherein the composition or combination comprises the composition or combination of any of the previous embodiments.

[0061] In another embodiment the invention provides a method of introducing a gene sequence of interest in a target cell, wherein the method comprises applying the composition or combination of any previous embodiments to the target cell.

[0062] In a related embodiment, the method comprises the steps of: exposing the target cell to a first vector comprising a non-native receptor sequence under the control of a cell specific promoter of the target cell, wherein the first vector is capable of expressing the non-native receptor sequence in the target cell, resulting in the exhibition of the non-native receptor on the target cell surface; and exposing the target cell to a second vector comprising the gene sequence of interest under the control of a promoter, wherein the second vector uses the non-native receptor for cell entry and enables the expression of the gene of interest in the target cell.

[0063] The skilled addressee will appreciate that the steps of the previous embodiment may be carried out simultaneously and / or sequentially.

[0064] In a related embodiment, the method may be carried out in vitro and / or ex vivo and / or in vivo.

[0065] Where the method of this embodiment is carried out in vivo it may be a method of treatment. Where the method of this embodiment is carried out in vitro and / or ex vivo the products of the method may be used in a method of treatment. Where the method of this embodiment is carried out in vitro and / or ex vivo the method may be used as part of and / or in conjunction with a method of treatment. In a related embodiment, the method is a method of treating a genetic condition and / or an ocular in a patient in need thereof. In a yet further related embodiment, the genetic condition is an ocular condition. The genetic and / or ocular condition may be selected from: Stargardt disease, Usher syndrome, cystic fibrosis, and Duchenne muscular dystrophy, and Leber Congenital Amaurosis (LCA), Aged Macular Degeneration (AMD).

[0066] Where the method of this embodiment is carried out in vitro and / or ex vivo the target cell may be contained within an organoid or 3D culture of cells.

[0067] Generally, unless indicated otherwise herein, the compositions, combinations, methods, kits, cells, or constructs referred to herein will be intended for use in prophylaxis or treatment of diseases or disorders in man (and / or optionally also in warm-blooded animals and in particular mammals). Thus, generally, the compositions, combinations, methods, kits, cells, or constructs described herein are preferably such that they can be used as, and / or can suitably be a part of, a (biological) drug or other pharmaceutically or therapeutically active compound and / or of a pharmaceutical product or composition. Thus, the invention also relates to a pharmaceutical composition or formulation comprising the compositions, combinations, methods, kits, cells, or constructs as described herein, e.g. a first and second vector for expression of a gene of interest in a target cell as described herein. The pharmaceutical composition may optionally comprise a pharmaceutically acceptable carrier. The compositions, combinations, methods, kits, cells, constructs, or the pharmaceutical composition can be administered by any convenient route, including but not limited to oral, topical, parenteral, sublingual, rectal, vaginal, ocular, intranasal, pulmonary, intradermal, intravitreal, intramuscular, intraperitoneal, intravenous, subcutaneous, intracerebral, transdermal, transmucosal, by inhalation, or topical, particularly to the ears, nose, eyes, or skin or by inhalation.

[0068] Parenteral administration includes, for example, intravenous, intramuscular, intraarterial, intraperitoneal, intranasal, rectal, intravesical, intradermal, topical or subcutaneous administration. Preferably, the compositions are administered parenterally.

[0069] The pharmaceutically acceptable carrier or vehicle can be particulate, so that the compositions are, for example, in tablet or powder form. The term "carrier" refers to a diluent, adjuvant or excipient, with which a drug antibody conjugate of the present invention is administered. Such pharmaceutical carriers can be liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. The carriers can be saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like. In addition, auxiliary, stabilizing, thickening, lubricating and coloring agents can be used. In one embodiment, when administered to an animal, the compositions, combinations, methods, kits, cells, or constructs of the present invention or compositions and pharmaceutically acceptable carriers are sterile. Water is a preferred carrier when the drug antibody conjugates of the present invention are administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical carriers also include excipients such as starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The present compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.

[0070] The pharmaceutical composition of the invention can be in the form of a liquid, e.g., a solution, emulsion or suspension. The liquid can be useful for delivery by injection, infusion (e.g., IV infusion) or sub-cutaneously. When intended for oral administration, the composition is preferably in solid or liquid form, where semi-solid, semi-liquid, suspension and gel forms are included within the forms considered herein as either solid or liquid.

[0071] As a solid composition for oral administration, the composition can be formulated into a powder, granule, compressed tablet, pill, capsule, chewing gum, wafer or the like form. Such a solid composition typically contains one or more inert diluents. In addition, one or more of the following can be present: binders such as carboxymethylcellulose, ethyl cellulose, microcrystalline cellulose, or gelatin; excipients such as starch, lactose or dextrins, disintegrating agents such as alginic acid, sodium alginate, corn starch and the like; lubricants such as magnesium stearate; glidants such as colloidal silicon dioxide; sweetening agents such as sucrose or saccharin; a flavoring agent such as peppermint, methyl salicylate or orange flavoring; and a coloring agent. When the composition is in the form of a capsule (e. g. a gelatin capsule), it can contain, in addition to materials of the above type, a liquid carrier such as polyethylene glycol, cyclodextrin or a fatty oil.

[0072] The composition can be in the form of a liquid, e. g. an elixir, syrup, solution, emulsion or suspension. The liquid can be useful for oral administration or for delivery by injection. When intended for oral administration, a composition can comprise one or more of a sweetening agent, preservatives, dye / colorant and flavor enhancer. In a composition for administration by injection, one or more of a surfactant, preservative, wetting agent, dispersing agent, suspending agent, buffer, stabilizer and isotonic agent can also be included. Compositions can take the form of one or more dosage units. In specific embodiments, it can be desirable to administer the composition locally to the area in need of treatment, or by intravenous injection or infusion.

[0073] In another aspect of the invention the composition or combination may be for use as a medicament.

[0074] In another aspect, the composition or combination may be for use in the treatment of a genetic condition. The genetic condition may be an ocular condition. In a further related embodiment, the genetic condition is one caused by a dysfunctional cell membrane transporter protein, optionally the membrane transporter protein is ABCA4. In a yet further related embodiment, the genetic condition is one or more selected from: Stargardt disease, Usher syndrome, cystic fibrosis, and Duchenne muscular dystrophy, Leber Congenital Amaurosis (LCA).

[0075] In another aspect, the invention provides a kit of parts for expression of gene sequence of interest in a target cell, wherein the kit comprises the composition or combination according to any previous embodiment. The kit may comprise instructions for use.

[0076] In a related embodiment the first vector is in a separate part to the second vector. Alternatively, the first vector is in the same part as the second vector.

[0077] The term “AAV” or “adeno-associated virus” refers to a Dependoparvovirus within the Parvoviridae genus of viruses. The AAV can be an AAV derived from a naturally occurring “wildtype” virus, an AAV derived from a rAAV genome packaged into a capsid comprising capsid proteins encoded by a naturally occurring cap gene and / or from a rAAV genome packaged into a capsid comprising capsid proteins encoded by a non-naturally occurring capsid cap gene. An example of the latter includes a rAAV having a capsid protein comprising a peptide insertion into the amino acid sequence of the naturally occurring capsid. The term “rAAV” refers to a “recombinant AAV.” In some embodiments, a recombinant AAV has an AAV genome in which part or all the rep and cap genes have been replaced with heterologous sequences.

[0078] The term “vector” is intended to be interpreted differently depending on the context in which it is used. For example, vector may be a whole viral particle or non-viral particle that acts to introduce a genetic sequence into a target cell. In other situations, the term vector may refer to the specific genetic information within the genetic backbone.

[0079] Features, integers, characteristics, compounds, molecules, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and figures), and / or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and / or steps are mutually exclusive. The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.

[0080] Description of the Drawings

[0081] Embodiments of the present invention will now be described, by way of example only, with reference to the following experiments and accompanying figures, in which:

[0082] Figure 1 is a schematic diagram of the gene transfer approach used. The Equine Infectious Anaemia Virus (EIAV) receptor, ELR1 , is delivered to cells by means of a viral vector (e.g. an AAV vector) or a non-viral vector (e.g. an LNP). This receptor makes the cells permissive to transduction with a lentiviral vector pseudotyped with the EIAV glycoprotein gp90.

[0083] Figure 2 is fluorescent microscopy images showing ABCA4 protein expression in wildtype mouse retina and in an Abca4' / _mouse model of Stargardt disease. Scale bar: 60 pm.

[0084] Figure 3 are a fluorescent microscopy image and a graph showing the reconstitution of ABCA4 protein expression in the Abca4' / _Stargardt mouse model after transduction with the UCL-LCV. (A) is an image showing ABCA4 protein expression in Abca4' / _mice at 3 months of age and 6 weeks post-injection. (B) is a graph showing the quantification of photoreceptor transduction following transduction using the VSV-G pseudotyped lentivirus with no priming step from two earlier studies vs the vector of the present invention. (1 . Bainbridge et al. Gene Ther 8, 1665-1668 (2001): 0%. 2. Gruter et al. Gene Ther. 2005 Jun;12(11):942-7: 3%; 3. UCL-LCV: 91±12%; n = 7 for each approach). Quantification was performed in retina wholemounts.

[0085] Figure 4 includes fluorescent microscopy images of ABCA4 transgene expression in retinal wholemounts following transduction with AAV followed by the lentiviral vector. (A) shows GFP labelling of transduced photoreceptors; (B) shows immunohistochemical staining for PNA, which specifically labels cone photoreceptors. (C) shows the overlay of A and B.

[0086] Figure 5 are fundus images of wild-type and Abca4' / _mice.

[0087] Figure 6 is an electroretinogram of wild-type and Abca4' / _mice at 6 months of age. Electroretinography was performed using 50 cd / m2stimuli with only 1 second recovery time between sweeps.

[0088] Figure 7 are images and graphs of wild-type and Abca4' / _mice at 6 months of age. (a) are optical coherence tomography (OCT) images of retinal layers, (b) are OCT images from wild-type and Abca4' / _mice, (c) is a graph showing the measurement of outer nuclear layer (ONL) thickness in wild-type and Abca4' / _mice. Figure 8 is a graph showing the quantification of the autofluorescence ratio between wild-type and Abca4' / _mice 6 months post injection. Top line: sham-treated eyes; bottom line: eyes treated with UCL-LCV (n=12 for each group).

[0089] Figure 9 is a graph showing the measurement of a\\-trans retinol fluorescence recovery after bleaching from rod photoreceptor outer segments 3 months post-injection. Top line: wildtype mice line; middle line: Abca4' / _mice treated with UCL-LCV; and Bottom line: Abca4' / _mice untreated (n=30 for each group).

[0090] Figure 10 is an average peak amplitude of the b-wave of electroretinograms showing the improvement of retinal function in 6-month-old Abca4' / _mice following treatment in comparison with wild-type and untreated Abca4' / _mice (1 : Wild Type mice 2: Abca4' / _- untreated 3: Abca4' / _- treated with UCL-LCV).

[0091] Figure 11 are confocal fluorescent microscopy images showing the co-transduction of ELR1 DNA using a LNP and a pseudo-typed lentivirus carrying ABCA4-HIS. (A) is an image of a single optical section. (B) is a 3D reconstruction of PR segments. Scale bar: 30 pm.

[0092] Figure 12 shows the results of experiments testing Lipid nanoparticles that were assembled with different lipid compositions and carrying GFP mRNA (panels A-D) or ELR1 (panel E).

[0093] The invention is further described in the following non-limiting examples.

[0094] Examples

[0095] Example 1 - Abca4 knockout mouse model of Stargardt disease

[0096] Background

[0097] Stargardt disease is caused by a deficiency in or lack of functioning of the ABCA4 membrane transporter protein in retinal cells. Therefore, it was necessary to produce an Abca4 knockout mouse model that lacked ABCA4 expression so that the effect of any treatment may be observed.

[0098] Method

[0099] Abca4'' mice were obtained from The Jackson Laboratory (JAX stock #026800; https: / / www.jax.org / strain / 026800). In brief, the mice were produced using a targeting vector designed to replace the promoter sequence and exon 1 of the Abca4 gene with a neomycin resistance (neo) cassette in reverse orientation to the gene. The construct was electroporated into 129S4 / SvJae-derived J1 embryonic stem cells (ES) cells. Correctly targeted ES cells were injected into C57BL / 6 blastocysts and the resulting chimeric males were bred to 129SvEv females. These mice were maintained on a 129SvEv background upon arrival at The Jackson Laboratory. Some mice were bred to C57BL / 6J inbred mice for many generations using a marker-assisted, speed congenic approach to generate this C57BL / 6J- congenic strain.

[0100] Eyes for histological analysis were taken post-mortem. Retinas were extracted and fixed in 4% PFA overnight. For flatmount preparation, a histological clearing procedure (adapted from Costantini et al., Sci Rep. 2015 May 7:5:9808) was performed on whole retinas to maximize imaging quality and aid verification of expression. For cryosectioning, fixed retinas were embedded in OCT and snap frozen in liquid nitrogen. Embedded retinas were cut to a 30 .m thickness using a cryostat. Retinal sections and wholemounts were stained for the HIS-tag using an anti-HIS antibody (Abeam) and were then imaged using a confocal microscope. Quantification of transduction was performed using 6 regions in 4 sections, with DAPI staining used to verify the total cell count. Additional specific staining of rod or cone photoreceptors was achieved using conjugated antibodies against rhodopsin and PNA, respectively, to aid cell type identification.

[0101] Subretinal injections were used to administer UCL-LCV into the eye. Mice were anesthetized with an intraperitoneal injection of a 0.007 ml / g mixture of medetomidine hydrochloride (1 mg / ml), ketamine (100 mg / ml), and water at a ratio of 5:3:4. Pupils were dilated with a Tropicamide / Phenylephrine mix. Subretinal injection was performed using Hamilton glass syringe coupled with a 33-guage beveled needle. Injections were performed by inserting the needle through the sclera into the subretinal space, while viewing the back of the eye through the pupil under a surgical microscope. Animals received either UCL-LCV in a total dose volume of 0.4ul per eye or sham injections of the same volume of PBS.

[0102] Optical coherence tomography (OCT) was used to image retinal structure in vivo. Animals were anesthetized with an intraperitoneal injection of a 0.007 ml / g mixture of medetomidine hydrochloride (1 mg / ml), ketamine (100 mg / ml), and water at a ratio of 5:3:42. Eyes were imaged with a Micron III imaging platform (Phoenix Research Laboratories).

[0103] Fundus images were acquired to measure retinal autofluorescence. Animals were anesthetized with an intraperitoneal injection of a 0.007 ml / g mixture of medetomidine hydrochloride (1 mg / ml), ketamine (100 mg / ml), and water at a ratio of 5:3:42. Both eyes were imaged with a Micron III imaging platform (Phoenix Research Laboratories), using the same imaging objective and acquisition settings.

[0104] Electroretinograms were recorded using a Celeris setup by Diagnosys. The animals were anesthetized with an intraperitoneal injection of a 0.007ml / g mixture of medetomidine hydrochloride (1 mg / ml), ketamine (100 mg / ml), and water at a ratio of 5:3:42 before recording. Pupils were fully dilated using 1.0% tropicamide. Subdermal ground was inserted in the mouse left cheek. A drop of Viscotears 0.2% liquid gel was placed between the electrode and the eye. Bandpass filter cutoff frequencies were 0.312 Hz and 1000 Hz. 10x 10ms full field mixed wavelength (white) flashes (50 cd / m2), delivered with a 1s inter-flash recovery interval, were used to elicit retinal responses.

[0105] Measurement of alltrans-retinol fluorescence recovery after bleaching was performed in ex- vivo in live retinas as performed by Koutalos and colleagues (Adler et al., Exp Eye Res. Feb;155:121-127.2017). Example sequences that can be used in construct of the inventionare shown in SEQ ID NO: 1 to 48.

[0106] Results

[0107] Figure 2 shows that in the wildtype mouse ABCA4 is expressed as normal in the retinal cells (top row). When looking at the bottom row of Figure 2 the expression of ABCA4 is lost. This showed that the Abca4 knockout mouse did not express ABCA4 and is a good potential candidate for being a model of Stargardt disease. Although knocking out Abca4 caused a lack of expression of ABCA4 in retinal cells there was a need to ensure that this lack of expression also caused a phenotype that matched naturally occurring Stargardt disease.

[0108] In order to determine whether the lack of ABCA4 expression caused a Stargardt phenotype the accumulation of fluorescent material in the retinal cells was examined. The increase in fluorescent material build up in the retinal cell due to the lack of clearance via ABCA4 is the mechanism by which Stargardt disease manifests. Figure 5 shows images of the wild type retina and the Abca4 knockout mouse retina captured using fundus imaging. It can be seen from these images that the Abca4 knockout mouse develop higher autofluorescence with ageing.

[0109] This was confirmed when the electroretinography traces of wildtype and Abca4 knockout retina were examined (as shown in Figure 6). At six months of age the Abca4 knockout mice have clear differences in electroretinography traces compared to wildtype mice and confirms that the knockout mice have developed a Stargardt disease phenotype.

[0110] Figure 7A shows the various layers of the wildtype eye as imaged using optical coherence tomography (OCT). Figure 7B shows an image of the wildtype layers of the eye and the disease model eye using OCT. The outer nuclear layer (ONL) is the main layer of the retina in which it is possible to measure photoreceptor degradation. In Figure 7C the thickness of each layer of the eye is shown in both the wildtype and disease model. The distance between the outer plexiform layer (OPL) and external limiting membrane (ELM) layers can be inferred as the thickness of the ONL. Figure 7C shows that the thickness of the ONL is reduced in the disease model as is the situation in the disease state of an individual.

[0111] Example 2 - Expression of ABCA4 in the Abca4 knockout mouse model

[0112] Background

[0113] Having confirmed that the Abca4 knockout mice display a Stargardt phenotype the “trojan horse” approach to alter (increase) the expression of ABCA4 in the disease model was investigated. An overview of this approach is shown in Figure 1. In this approach an adeno adeno-associated virus (AAV) (SEQ ID No. 34) that carried the genetic sequence for Equine Infectious Anaemia Virus (EIAV) receptor ELR1 was applied to the retinal cells of the disease model. Also applied to the retina of the disease model was a lentivirus (SEQ ID No. 1) pseudotyped with EIAV glycoprotein gp90 which contained genetic information coding for the ABCA4 cell surface transporter. The hypothesis was that the EIAV receptor would be expressed on the cell surface of the retinal cells thereby allowing the pseudotyped lentivirus to bind to this receptor and deliver the ABCA4 genetic information within the lentivirus into the cell and cause expression of ABCA4 in the Stargardt disease model.

[0114] Method

[0115] The mouse model and methods used in this example are as described above in relation to Example 1.

[0116] Results

[0117] Figure 3A shows the ABCA4 expression in the Stargardt disease model six weeks post injection in 3-month-old mice. The top layer in Figure 3A is the outer segment of the eye and is the photosensitive region which expresses ABCA4 in wildtype individuals that do not have Stargardt disease. As shown in Figure 3A there is a high level of ABCA4 expression in the disease model which prior to treatment did not display any ABCA4 expression. The level of ABCA4 expression after treatment using the “trojan horse” method illustrated by Figure 1 is compared in Figure 3B to two alternative methods that have been previously published (1 = Bainbridge et al., 2001 , supra and 2 = Gruter et al., 2004, supra). The trojan horse method employed by the inventors showed approximately 90% transduction of the photoreceptors with ABCA4 in the disease model. The two previously published methods were limited to a maximum transduction rate of approximately 5%.

[0118] To confirm that ABCA4 transduction was not localised to a single region of the retina the transduced disease model retina were examined from above looking into the eye as shown in Figure 4. The left-hand panel shows the stained nuclei, the middle panel is stained ABCA4 and panel C is an overlay of the left and middle panels. These images show that a large area of the retina has been transduced with ABCA4 which indicates that the “trojan horse” approach transduces a wide area of the retina with a high rate of transduction. This approach restores ABCA4 expression in the majority of cells across a large area of the retina rather than sparse cells or an isolated patch.

[0119] Example 3 - Restoring ABCA4 function in a mouse model of Stargardt Disease

[0120] Background

[0121] Previous examples have shown that the disease model of an ABCA4 mouse is an accurate representation of the disease phenotype in a patient and that the trojan horse method of gene therapy is able to restore ABCA4 expression in the majority of retinal cells. The inventors therefore sought to determine whether the restoration of ABCA4 expression linked to an improvement in disease phenotype of the ABCA4 knockout mouse model of Stargardt disease.

[0122] Method

[0123] The mouse model and methods used in this example are as described above in relation to Example 1 . Results

[0124] Figure 8 shows the autofluorescence observed in the back of the mouse eye. The data presented is the ratio between either the Abca4' / _disease model treated using the trojan horse gene therapy and the wild type mouse (bottom line) or the sham treated Abca4' / _disease model and the wild type mouse (top line). This data shows that the Abca4 knockout mouse treated using the trojan horse gene therapy approach has a much lower autofluorescence ratio than the sham treated Abca4 knockout mouse. The ratio of the knockout mouse treated with the trojan horse gene therapy is approaching 1.2:1 which indicates that the autofluorescence has returned towards the baseline observed in wild type mice. The ratio in the untreated Abca4 knockout mouse is above 2:1 which indicates a much higher level of autofluorescence than the treated mouse. This indicates that the trojan horse gene therapy approach of transducing ABCA4 has improved the disease phenotype of the Abca4 knockout disease model mouse.

[0125] Figure 9 shows the measurement of a\\-trans retinol fluorescence recovery after bleaching from rod photoreceptor outer segments 3 months post injection in explanted retinas from the wild type mouse (top line), Abca4 knockout mouse treated using the trojan horse gene therapy approach (middle line), and the Abca4 knockout mouse (bottom line). The Abca4' / _retina are not able to cycle the vitamins required to give good vision when exposed to flashes of light. The trojan horse gene therapy treatment rescues this ability to cycle the vitamins required for vision as shown in Figure 9.

[0126] Figure 10 shows the average peak amplitude of the b-wave of electroretinograms recorded in response to a series of 10 bright light flashes applied with an inter-stimulus interval of 1s to the retina of wild type mice, untreated Abca4 knockout mice, and treated Abca4 knockout mice. Patients with Stargardt disease often struggle to recover after exposure to bright lights, which cause a bleaching of the photoreceptors. The recovery is hampered by a loss of, or lack of functioning, ABCA4 membrane transporter in retinal cells. Figure 10 shows that the trojan horse gene therapy reduces the bleaching effect in an Abca4 knockout model of Stargardt disease.

[0127] Example 4 - Transduction of ABCA4 into three-dimensional (3D) organoids in vitro

[0128] Background

[0129] The previous examples demonstrate that the trojan horse method of gene therapy can successfully and efficiently transduce a gene of interest (ABCA4) into retinal cells and that this approach caused an improvement in the phenotype of a disease model of Stargardt disease. In this example the inventors demonstrate that it is possible to use the same approach to successfully transduce a gene of interest (ABCA4) into a three-dimensional (3D) organoid composed of retinal cells. Transduction was caried out by co-transduction of ELR1 DNA using a Lipid Nanoparticle (LNP) and a pseudo-typed lentivirus carrying ABCA4-HIS.

[0130] Method

[0131] Retinal organoids were created using a protocol adapted from Gonzalez-Cordero et al., Stem Cell Reports. 2017 Sep 12;9(3):820-837. Briefly iPSCs colonies were grown in a 6 well plate using Essential 8™ Flex Medium until confluent (90-95%). Neural induction protocol was initiated by switching the culture media to a Neural Induction Medium (NIM). Neuroretinal vesicles (NRVs) were collected by dissection between 2-4 weeks later and each NRV was transferred into one well of a 96-well ultra-low-attachment plate. Plated NRVs were cultured in Retinal Differentiation Media (RDM) for 30 days and then in Retinal Maturation Media (RMM1) for the subsequent 40 days, RMM2 media for the subsequent 30 days and RMM3 beyond 100 days of differentiation. Media changes were performed every 2-3 days throughout the culturing process. UCL-LCV was applied to differentiated organoids at -day 110 by diluting into the culture media and incubating for 24h before washing off with fresh culture media. For analysis, organoids were removed from culture media and fixed in 4% PFA overnight. A histological clearing procedure (adapted from Costantini et al., 2015, supra) was performed to maximize imaging quality and aid verification of expression. Whole organoids were stained for the HIS-tag and were then imaged using a confocal microscope.

[0132] Results

[0133] Figure 11 is two images of retinal cells cultured from human stem cells in vitro in a 3D organoid. Figure 11 shows that a histidine tagged version of ABCA4 was transduced into the retinal cells of the organoid using the trojan horse gene therapy approach. The top panel of Figure 11 is a section through the organoid which represents a section of the retina and shows that the histidine tagged ABCA4 was transduced into the retinal cells of the outer layers of the organoid and is primarily located in the photoreceptor segments out the outer edge of the organoid. The bottom panel is an alternate view of the surface of the organoid and represents what would be the surface of the retina that interacts with any light entering the eye. Similar to Figure 4, Figure 11 demonstrates that the majority of the surface of the retina has been successfully transduced with ABCA4.

[0134] Example 5 Lipid nanoparticle transduction of LNPs carrying mRNA

[0135] Methods: Lipid nanoparticles were assembled with different lipid compositions and carrying, GFP mRNA (panels A-D) or ELR1 (panel E). LNPs were injected subretinally in adult anaesthetized mice alone (panels A-D) or in conjuction with Lentiviral particles driving ABCA4 expression (panel E). Imaging and data analysis were performed following humane culling, enucleation of the eyes and 4% PFA fixation. Images were obtained with confocal microscopy from wholemount retinas, which had been cleared with a tissue clearing solution (based on Costantini et al., 2015, supra).

[0136] Results: Different LNPs were tested, with varying degrees of transduction. Results are shown in Figure 12. These included LNPs with surface peptides (charged LNPs, designated charged LNP A and charged LNP B), as well as Precirol-based LNPs. mRNA expression leads to rapid expression of the fluorescent protein (Panel A, with significant expression detected already at 6 hours post-injection (Panel B). This particle showed transduction as high as Precirol based nanoparticles, which have previously been shown to transduce the retina (Del Pozo et al, Journal of Ocular Pharmacology and TherapeuticsVol. 29, No. 2, 2013). Panel C shows transduction rates of photoreceptors in wild-type (top) and Abca4 knock-out (bottom) mice, measured as fraction of photoreceptor cells expressing the fluorescent protein. Panel D shows expression of GFP protein (driven by mRNA from LNPs) in wholemount retinas transduced with a charged LNP (top) and Precirol-based LNPs (bottom). Panel E shows high transduction rate of photoreceptors with LNP+Lenti system (top image LNPs consist of a charged LNP (A), carrying ELR1 mRNA; bottom image: Lenti-only expression of ABCA4 in photoreceptors; Transduction rates: LNP+Lenti 85.6% ± 11.5%; Lenti only 4.3% ± 1.9%). Scale bars: A: 40 urn, B: 50 urn, E; 70 urn.

[0137] Conclusion

[0138] The inventors have advantageously, and unexpectedly, shown in the examples above that a trojan horse approach of gene therapy is able to efficiently transduce a gene of interest (ABCA4) into host cells which are lacking this gene. By transducing ABCA4 into the retinal cells of a disease model the inventors were able improve the disease phenotype in a disease model of Stargardt disease. They were also able to efficiently transduce a gene of interest (ABCA4) into human-derived retinal cells cultured in a three-dimensional organoid in vitro. The inventors envisage that this approach can be applied in a multitude of disease and with a range of (large) genes of interest in a variety of cell types.

[0139] The forgoing embodiments are not intended to limit the scope of the protection afforded by the claims, but rather to describe examples of how the invention may be put into practice.

[0140] The invention is also further described in the following clauses:

[0141] 1. A composition for the expression of a gene sequence of interest in a target cell wherein the composition comprises;

[0142] (a) a first vector comprising a non-native receptor sequence under the control of a promoter, wherein the first vector is capable of expressing the non-native receptor sequence in the target cell, resulting in the exhibition of the non-native receptor on the target cell surface; and

[0143] (b) a second vector comprising the gene sequence of interest under the control of a promoter wherein the second vector uses the non-native receptor for cell entry and enables the expression of the gene of interest in the target cell. A combination for the expression of a gene sequence of interest in a target cell wherein the combination comprises a first vector according to clause 1 and a second vector according to clause 1. The composition or combination according to any preceding clause, wherein the first vector is a non-viral vector. The composition or combination according to any preceding clause, wherein the first vector is an adeno associated virus (AAV). The composition or combination according to any preceding clause, wherein the first vector is a nanoparticle, and optionally the vector is a lipid nanoparticle. The composition or combination according to any preceding clause, wherein the second vector is a modified lentivirus, and optionally the second vector is a lentivirus. The composition or combination according to any preceding clause, wherein the second vector comprises an HIV-based lentivirus backbone and / or a non-integrating lentiviral backbone and / or an Equine Infectious Anaemia Virus (EIAV) backbone and / or an equine lentivirus. The composition or combination according to any of clauses 1 to 6, wherein the second vector comprises an avian lentivirus backbone and / or an avian lentivirus. The composition or combination according to any preceding clause, wherein the nonnative receptor sequence encodes a lentiviral target, or optionally the non-native receptor sequence encodes an equine and / or avian lentivirus target. The composition or combination according to any preceding clause, wherein the nonnative receptor sequence encodes equine lentivirus receptor-1 (ELR1) or transmembrane receptor of virus type A (TVA). The composition or combination according to any of clauses 6 to 10, wherein the second vector is pseudotyped with a cell surface protein, optionally an equine or avian cell surface protein. The composition or combination according to any preceding clause, wherein the equine cell surface protein is Infectious Anaemia Virus (EIAV) envelope glycoprotein and / or the avian cell surface protein is Avian Sarcoma Leukosis Virus (ASLV) envelope glycoprotein. The composition or combination according to any preceding clause, wherein the target cell is one or more cells selected from the following: photoreceptor cell, a cell affected by Retinitis Pigmentosa, a cell affected by Stargardt disease, a cell affected by Usher syndrome, a cell affected by Cystic Fibrosis, a cell affected by Duchenne muscular dystrophy, a cell affected by Leber Congenital Amaurosis (LCA). The composition or combination according to any preceding clause, wherein the gene sequence of interest is greater than about 4.5 kb. The composition or combination according to any preceding clause, wherein the gene sequence of interest is greater than about 9 kb, and optionally, the sequence is up to about 12 kb. The composition or combination according to any preceding clause, wherein the gene sequence of interest encodes a polypeptide implicated in an ocular disease, disorder and / or syndrome. The composition or combination according to any preceding clause, wherein the gene of interest is one or more selected from the following: ATP Binding Cassette Subfamily A Member 4 (ABCA4) (SEQ ID No. 12), Myosin VI IA (MY07A), Usherin (USH2A), Centrosomal Protein of 290kDA (CEP290), and / or I ntraflagellar Transport 140 homolog (IFT140). The composition or combination according to any preceding clause, wherein the second vector comprises an integrating equine or avian lentivirus backbone and / or an integrating lentivirus or a non-integrating equine or avian lentivirus backbone and / or non-integrating lentivirus. The composition or combination according to any preceding clause, wherein the promoter that controls the non-native receptor sequence is a cell-specific promoter of the target cell. A method for introducing a gene sequence of interest in a target cell, the method comprising applying the composition or combination according to any of clauses 1 to 21 to the target cell. The method according to clause 20 wherein the method comprises the steps of: exposing the target cell to a first vector comprising a non-native receptor sequence under the control of a cell specific promoter of the target cell wherein the first vector is capable of expressing the non-native receptor sequence in the target cell, resulting in the exhibition of the non-native receptor on the target cell surface ; and exposing the target cell to a second vector comprising the gene sequence of interest under the control of a promoter wherein the second vector uses the non-native receptor for cell entry and enables the expression of the gene of interest in the target cell. The method according to any of clauses 20 to 21 , wherein the steps are carried out simultaneously and / or sequentially. The method according to any of clauses 20 to 22, wherein the method is carried out in vitro and / or ex vivo and / or in vivo. The method according to any of clauses 20 to 23, wherein the method is a method of treating a genetic condition. The method according to clause 24, wherein the genetic condition is an ocular condition. The method according to clause 24, wherein the genetic condition is one or more selected from: Stargardt disease, Usher syndrome, cystic fibrosis, Duchenne, muscular dystrophy, and Leber Congenital Amaurosis (LCA). The method according to any of clauses 20 to 23, wherein the target cell is contained within an organoid or 3D culture of cells. The composition or combination according to any of clauses 1 to 19 for use as a medicament. The composition or combination for use according to clause 28, wherein the composition is for use in the treatment of a genetic condition and / or ocular condition. The composition or combination for use according to clause 29, wherein the genetic condition is an ocular condition. The composition or combination for use according to any of clauses 29 to 30, wherein the genetic condition is one caused by a dysfunctional cell membrane transporter protein. 32. The composition or combination for use according to any of clauses 29 to 31 , wherein the genetic and / or ocular condition is one or more selected from: Stargardt disease, Usher syndrome, cystic fibrosis, and Duchenne, muscular dystrophy, Leber Congenital Amaurosis (LCA), Aged Macular Degeneration (AMD).

[0144] 33. The composition or combination for use according to any of clauses 30 to 32, wherein the genetic condition is associated with dysfunctional ABCA4.

[0145] 34. A kit of parts for the expression of a gene sequence of interest in a target cell, wherein the kit comprises the composition or combination according to any of clauses 1 to 19.

[0146] 35. The kit according to clause 34 wherein the first vector is in a separate part to the second vector or the first vector is in the same part as the second vector.

[0147] Sequences

[0148] SEQ ID NO:1 pLV-CAF-hABCA4-P2A-NLS-EGFP

[0149] > mol_type, other DNA

[0150] > organism, synthetic construct gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 60 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120 cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180 ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240 gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300 tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360 cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420 attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 480 atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540 atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600 tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660 actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720 aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780 gtaggcgtgt acggtgggag gtctatataa gcagcgcgtt ttgcctgtac tgggtctctc 840 tggttagacc agatctgagc ctgggagctc tctggctaac tagggaaccc actgcttaag 900 cctcaataaa gcttgccttg agtgcttcaa gtagtgtgtg cccgtctgtt gtgtgactct 960 ggtaactaga gatccctcag acccttttag tcagtgtgga aaatctctag cagtggcgcc 1020 cgaacaggga cctgaaagcg aaagggaaac cagagctctc tcgacgcagg actcggcttg 1080 ctgaagcgcg cacggcaaga ggcgaggggc ggcgactggt gagtacgcca aaaattttga 1140 ctagcggagg ctagaaggag agagatgggt gcgagagcgt cagtattaag cgggggagaa 1200 ttagatcgcg atgggaaaaa attcggttaa ggccaggggg aaagaaaaaa tataaattaa 1260 aacatatagt atgggcaagc agggagctag aacgattcgc agttaatcct ggcctgttag 1320 aaacatcaga aggctgtaga caaatactgg gacagctaca accatccctt cagacaggat 1380 cagaagaact tagatcatta tataatacag tagcaaccct ctattgtgtg catcaaagga 1440 tagagataaa agacaccaag gaagctttag acaagataga ggaagagcaa aacaaaagta 1500 agaccaccgc acagcaagcg gccgctgatc ttcagacttg gaggaggaga tatgagggac 1560 aattggagaa gtgaattata taaatataaa gtagtaaaaa ttgaaccatt aggagtagca 1620 cccaccaagg caaagagaag agtggtgcag agagaaaaaa gagcagtggg aataggagct 1680 ttgttccttg ggttcttggg agcagcagga agcactatgg gcgcagcctc aatgacgctg 1740 acggtacagg ccagacaatt attgtctggt atagtgcagc agcagaacaa tttgctgagg 1800 gctattgagg cgcaacagca tctgttgcaa ctcacagtct ggggcatcaa gcagctccaa 1860 gcaagaatcc tagctgtgga aagataccta aaggatcaac agctcctagg gatttggggt 1920 tgctctggaa aactcatttg caccactgct gtgccttgga atgctagttg gagtaataaa 1980 tctctggaac agatctggaa tcacacgacc tggatggagt gggacagaga aattaacaat 2040 tacacaagct taatacactc cttaattgaa gaatcgcaaa accagcaaga aaagaatgaa 2100 caagaattat tggaattaga taaatgggca agtttgtgga attggtttaa cataacaaat 2160 tggctgtggt atataaaatt attcataatg atagtaggag gcttggtagg tttaagaata 2220 gtttttgctg tactttctat agtgaataga gttaggcagg gatattcacc attatcgttt 2280 cagacccacc tcccaatccc gaggggaccc gacaggcccg aaggaataga agaagaaggt 2340 ggagagagag acagagacag atccattcga ttagtgaacg gatcaacttt taaaagaaaa 2400 ggggggattg gggggtacag tgcaggggaa agaatagtag acataatagc aacagacata 2460 caaactaaag aattacaaaa acaaattaca aaaattcaaa attttatcga tgtcgacatt 2520 gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 2580 tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 2640 cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 2700 attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 2760 atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 2820 atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 2880 tcgctattac catggtcgag gtgagcccca cgttctgctt cactctcccc atctcccccc 2940 cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca gcgatggggg 3000 cggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg gggcggggcg 3060 aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt tccttttatg 3120 gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc gggagtcgct 3180 gcgttgcctt cgccccgtgc cccgctccgc gccgcctcgc gccgcccgcc ccggctctga 3240 ctgaccgcgt tactcccaca ggtgagcggg cgggacggcc cttctcctcc gggctgtaat 3300 tagcgcttgg tttaatgacg gctcgtttct tttctgtggc tgcgtgaaag ccttaaaggg 3360 ctccgggagg gccctttgtg cgggggggag cggctcgggg ggtgcgtgcg tgtgtgtgtg 3420 cgtggggagc gccgcgtgcg gcccgcgctg cccggcggct gtgagcgctg cgggcgcggc 3480 gcggggcttt gtgcgctccg cgtgtgcgcg aggggagcgc ggccgggggc ggtgccccgc 3540 ggtgcggggg ggctgcgagg ggaacaaagg ctgcgtgcgg ggtgtgtgcg tgggggggtg 3600 agcagggggt gtgggcgcgg cggtcgggct gtaacccccc cctgcacccc cctccccgag 3660 ttgctgagca cggcccggct tcgggtgcgg ggctccgtgc ggggcgtggc gcggggctcg 3720 ccgtgccggg cggggggtgg cggcaggtgg gggtgccggg cggggcgggg ccgcctcggg 3780 ccggggaggg ctcgggggag gggcgcggcg gccccggagc gccggcggct gtcgaggcgc 3840 ggcgagccgc agccattgcc ttttatggta atcgtgcgag agggcgcagg gacttccttt 3900 gtcccaaatc tggcggagcc gaaatctggg aggcgccgcc gcaccccctc tagcgggcgc 3960 gggcgaagcg gtgcggcgcc ggcaggaagg aaatgggcgg ggagggcctt cgtgcgtcgc 4020 cgcgccgccg tccccttctc catctccagc ctcggggctg ccgcaggggg acggctgcct 4080 tcggggggga cggggcaggg cggggttcgg cttctggcgt gtgaccggcg gctctagagc 4140 ctctgctaac catgttcatg ccttcttctt tttcctacag ctcctgggca acgtgctggt 4200 tattgtgctg tctcatcatt ttggcaaaga attcgctagt ggatccgcca ccatgggctt 4260 cgtgagacag atacagcttt tgctctggaa gaactggacc ctgcggaaaa ggcaaaagat 4320 tcgctttgtg gtggaactcg tgtggccttt atctttattt ctggtcttga tctggttaag 4380 gaatgccaac ccactctaca gccatcatga atgccatttc cccaacaagg cgatgccctc 4440 agcaggaatg ctgccgtggc tccaggggat cttctgcaat gtgaacaatc cctgttttca 4500 aagccccacc ccaggagaat ctcctggaat tgtgtcaaac tataacaact ccatcttggc 4560 aagggtatat cgagattttc aagaactcct catgaatgca ccagagagcc agcaccttgg 4620 ccgtatttgg acagagctac acatcttgtc ccaattcatg gacaccctcc ggactcaccc 4680 ggagagaatt gcaggaagag gaatacgaat aagggatatc ttgaaagatg aagaaacact 4740 gacactattt ctcattaaaa acatcggcct gtctgactca gtggtctacc ttctgatcaa 4800 ctctcaagtc cgtccagagc agttcgctca tggagtcccg gacctggcgc tgaaggacat 4860 cgcctgcagc gaggccctcc tggagcgctt catcatcttc agccagagac gcggggcaaa 4920 gacggtgcgc tatgccctgt gctccctctc ccagggcacc ctacagtgga tagaagacac 4980 tctgtatgcc aacgtggact tcttcaagct cttccgtgtg cttcccacac tcctagacag 5040 ccgttctcaa ggtatcaatc tgagatcttg gggaggaata ttatctgata tgtcaccaag 5100 aattcaagag tttatccatc ggccgagtat gcaggacttg ctgtgggtga ccaggcccct 5160 catgcagaat ggtggtccag agacctttac aaagctgatg ggcatcctgt ctgacctcct 5220 gtgtggctac cccgagggag gtggctctcg ggtgctctcc ttcaactggt atgaagacaa 5280 taactataag gcctttctgg ggattgactc cacaaggaag gatcctatct attcttatga 5340 cagaagaaca acatcctttt gtaatgcatt gatccagagc ctggagtcaa atcctttaac 5400 caaaatcgct tggagggcgg caaagccttt gctgatggga aaaatcctgt acactcctga 5460 ttcacctgca gcacgaagga tactgaagaa tgccaactca acttttgaag aactggaaca 5520 cgttaggaag ttggtcaaag cctgggaaga agtagggccc cagatctggt acttctttga 5580 caacagcaca cagatgaaca tgatcagaga taccctgggg aacccaacag taaaagactt 5640 tttgaatagg cagcttggtg aagaaggtat tactgctgaa gccatcctaa acttcctcta 5700 caagggccct cgggaaagcc aggctgacga catggccaac ttcgactgga gggacatatt 5760 taacatcact gatcgcaccc tccgcctggt caatcaatac ctggagtgct tggtcctgga 5820 taagtttgaa agctacaatg atgaaactca gctcacccaa cgtgccctct ctctactgga 5880 ggaaaacatg ttctgggccg gagtggtatt ccctgacatg tatccctgga ccagctctct 5940 accaccccac gtgaagtata agatccgaat ggacatagac gtggtggaga aaaccaataa 6000 gattaaagac aggtattggg attctggtcc cagagctgat cccgtggaag atttccggta 6060 catctggggc gggtttgcct atctgcagga catggttgaa caggggatca caaggagcca 6120 ggtgcaggcg gaggctccag ttggaatcta cctccagcag atgccctacc cctgcttcgt 6180 ggacgattct ttcatgatca tcctgaaccg ctgtttccct atcttcatgg tgctggcatg 6240 gatctactct gtctccatga ctgtgaagag catcgtcttg gagaaggagt tgcgactgaa 6300 ggagaccttg aaaaatcagg gtgtctccaa tgcagtgatt tggtgtacct ggttcctgga 6360 cagcttctcc atcatgtcga tgagcatctt cctcctgacg atattcatca tgcatggaag 6420 aatcctacat tacagcgacc cattcatcct cttcctgttc ttgttggctt tctccactgc 6480 caccatcatg ctgtgctttc tgctcagcac cttcttctcc aaggccagtc tggcagcagc 6540 ctgtagtggt gtcatctatt tcaccctcta cctgccacac atcctgtgct tcgcctggca 6600 ggaccgcatg accgctgagc tgaagaaggc tgtgagctta ctgtctccgg tggcatttgg 6660 atttggcact gagtacctgg ttcgctttga agagcaaggc ctggggctgc agtggagcaa 6720 catcgggaac agtcccacgg aaggggacga attcagcttc ctgctgtcca tgcagatgat 6780 gctccttgat gctgctgtct atggcttact cgcttggtac cttgatcagg tgtttccagg 6840 agactatgga accccacttc cttggtactt tcttctacaa gagtcgtatt ggcttggcgg 6900 tgaagggtgt tcaaccagag aagaaagagc cctggaaaag accgagcccc taacagagga 6960 aacggaggat ccagagcacc cagaaggaat acacgactcc ttctttgaac gtgagcatcc 7020 agggtgggtt cctggggtat gcgtgaagaa tctggtaaag atttttgagc cctgtggccg 7080 gccagctgtg gaccgtctga acatcacctt ctacgagaac cagatcaccg cattcctggg 7140 ccacaatgga gctgggaaaa ccaccacctt gtccatcctg acgggtctgt tgccaccaac 7200 ctctgggact gtgctcgttg ggggaaggga cattgaaacc agcctggatg cagtccggca 7260 gagccttggc atgtgtccac agcacaacat cctgttccac cacctcacgg tggctgagca 7320 catgctgttc tatgcccagc tgaaaggaaa gtcccaggag gaggcccagc tggagatgga 7380 agccatgttg gaggacacag gcctccacca caagcggaat gaagaggctc aggacctatc 7440 aggtggcatg cagagaaagc tgtcggttgc cattgccttt gtgggagatg ccaaggtggt 7500 gattctggac gaacccacct ctggggtgga cccttactcg agacgctcaa tctgggatct 7560 gctcctgaag tatcgctcag gcagaaccat catcatgtcc actcaccaca tggacgaggc 7620 cgacctcctt ggggaccgca ttgccatcat tgcccaggga aggctctact gctcaggcac 7680 cccactcttc ctgaagaact gctttggcac aggcttgtac ttaaccttgg tgcgcaagat 7740 gaaaaacatc cagagccaaa ggaaaggcag tgaggggacc tgcagctgct cgtctaaggg 7800 tttctccacc acgtgtccag cccacgtcga tgacctaact ccagaacaag tcctggatgg 7860 ggatgtaaat gagctgatgg atgtagttct ccaccatgtt ccagaggcaa agctggtgga 7920 gtgcattggt caagaactta tcttccttct tccaaataag aacttcaagc acagagcata 7980 tgccagcctt ttcagagagc tggaggagac gctggctgac cttggtctca gcagttttgg 8040 aatttctgac actcccctgg aagagatttt tctgaaggtc acggaggatt ctgattcagg 8100 acctctgttt gcgggtggcg ctcagcagaa aagagaaaac gtcaaccccc gacacccctg 8160 cttgggtccc agagagaagg ctggacagac accccaggac tccaatgtct gctccccagg 8220 ggcgccggct gctcacccag agggccagcc tcccccagag ccagagtgcc caggcccgca 8280 gctcaacacg gggacacagc tggtcctcca gcatgtgcag gcgctgctgg tcaagagatt 8340 ccaacacacc atccgcagcc acaaggactt cctggcgcag atcgtgctcc cggctacctt 8400 tgtgtttttg gctctgatgc tttctattgt tatccctcct tttggcgaat accccgcttt 8460 gacccttcac ccctggatat atgggcagca gtacaccttc ttcagcatgg atgaaccagg 8520 cagtgagcag ttcacggtac ttgcagacgt cctcctgaat aagccaggct ttggcaaccg 8580 ctgcctgaag gaagggtggc ttccggagta cccctgtggc aactcaacac cctggaagac 8640 tccttctgtg tccccaaaca tcacccagct gttccagaag cagaaatgga cacaggtcaa 8700 cccttcacca tcctgcaggt gcagcaccag ggagaagctc accatgctgc cagagtgccc 8760 cgagggtgcc gggggcctcc cgccccccca gagaacacag cgcagcacgg aaattctaca 8820 agacctgacg gacaggaaca tctccgactt cttggtaaaa acgtatcctg ctcttataag 8880 aagcagctta aagagcaaat tctgggtcaa tgaacagagg tatggaggaa tttccattgg 8940 aggaaagctc ccagtcgtcc ccatcacggg ggaagcactt gttgggtttt taagcgacct 9000 tggccggatc atgaatgtga gcgggggccc tatcactaga gaggcctcta aagaaatacc 9060 tgatttcctt aaacatctag aaactgaaga caacattaag gtgtggttta ataacaaagg 9120 ctggcatgcc ctggtcagct ttctcaatgt ggcccacaac gccatcttac gggccagcct 9180 gcctaaggac aggagccccg aggagtatgg aatcaccgtc attagccaac ccctgaacct 9240 gaccaaggag cagctctcag agattacagt gctgaccact tcagtggatg ctgtggttgc 9300 catctgcgtg attttctcca tgtccttcgt cccagccagc tttgtccttt atttgatcca 9360 ggagcgggtg aacaaatcca agcacctcca gtttatcagt ggagtgagcc ccaccaccta 9420 ctgggtgacc aacttcctct gggacatcat gaattattcc gtgagtgctg ggctggtggt 9480 gggcatcttc atcgggtttc agaagaaagc ctacacttct ccagaaaacc ttcctgccct 9540 tgtggcactg ctcctgctgt atggatgggc ggtcattccc atgatgtacc cagcatcctt 9600 cctgtttgat gtccccagca cagcctatgt ggctttatct tgtgctaatc tgttcatcgg 9660 catcaacagc agtgctatta ccttcatctt ggaattattt gagaataacc ggacgctgct 9720 caggttcaac gccgtgctga ggaagctgct cattgtcttc ccccacttct gcctgggccg 9780 gggcctcatt gaccttgcac tgagccaggc tgtgacagat gtctatgccc ggtttggtga 9840 ggagcactct gcaaatccgt tccactggga cctgattggg aagaacctgt ttgccatggt 9900 ggtggaaggg gtggtgtact tcctcctgac cctgctggtc cagcgccact tcttcctctc 9960 ccaatggatt gccgagccca ctaaggagcc cattgttgat gaagatgatg atgtggctga 10020 agaaagacaa agaattatta ctggtggaaa taaaactgac atcttaaggc tacatgaact 10080 aaccaagatt tatccaggca cctccagccc agcagtggac aggctgtgtg tcggagttcg 10140 ccctggagag tgctttggcc tcctgggagt gaatggtgcc ggcaaaacaa ccacattcaa 10200 gatgctcact ggggacacca cagtgacctc aggggatgcc accgtagcag gcaagagtat 10260 tttaaccaat atttctgaag tccatcaaaa tatgggctac tgtcctcagt ttgatgcaat 10320 tgatgagctg ctcacaggac gagaacatct ttacctttat gcccggcttc gaggtgtacc 10380 agcagaagaa atcgaaaagg ttgcaaactg gagtattaag agcctgggcc tgactgtcta 10440 cgccgactgc ctggctggca cgtacagtgg gggcaacaag cggaaactct ccacagccat 10500 cgcactcatt ggctgcccac cgctggtgct gctggatgag cccaccacag ggatggaccc 10560 ccaggcacgc cgcatgctgt ggaacgtcat cgtgagcatc atcagagaag ggagggctgt 10620 ggtcctcaca tcccacagca tggaagaatg tgaggcactg tgtacccggc tggccatcat 10680 ggtaaagggc gcctttcgat gtatgggcac cattcagcat ctcaagtcca aatttggaga 10740 tggctatatc gtcacaatga agatcaaatc cccgaaggac gacctgcttc ctgacctgaa 10800 ccctgtggag cagttcttcc aggggaactt cccaggcagt gtgcagaggg agaggcacta 10860 caacatgctc cagttccagg tctcctcctc ctccctggcg aggatcttcc agctcctcct 10920 ctcccacaag gacagcctgc tcatcgagga gtactcagtc acacagacca cactggacca 10980 ggtgtttgta aattttgcta aacagcagac tgaaagtcat gacctccctc tgcaccctcg 11040 agctgctgga gccagtcgac aagcccagga cggaagcgga gccacgaact tctctctgtt 11100 aaagcaagca ggagatgttg aagaaaaccc cgggcctatg ccaaaaaaga agagaaaggt 11160 aatggtgagc aagggcgagg agctgttcac cggggtggtg cccatcctgg tcgagctgga 11220 cggcgacgta aacggccaca agttcagcgt gtccggcgag ggcgagggcg atgccaccta 11280 cggcaagctg accctgaagt tcatctgcac caccggcaag ctgcccgtgc cctggcccac 11340 cctcgtgacc accctgacct acggcgtgca gtgcttcagc cgctaccccg accacatgaa 11400 gcagcacgac ttcttcaagt ccgccatgcc cgaaggctac gtccaggagc gcaccatctt 11460 cttcaaggac gacggcaact acaagacccg cgccgaggtg aagttcgagg gcgacaccct 11520 ggtgaaccgc atcgagctga agggcatcga cttcaaggag gacggcaaca tcctggggca 11580 caagctggag tacaactaca acagccacaa cgtctatatc atggccgaca agcagaagaa 11640 cggcatcaag gtgaacttca agatccgcca caacatcgag gacggcagcg tgcagctcgc 11700 cgaccactac cagcagaaca cccccatcgg cgacggcccc gtgctgctgc ccgacaacca 11760 ctacctgagc acccagtccg ccctgagcaa agaccccaac gagaagcgcg atcacatggt 11820 cctgctggag ttcgtgaccg ccgccgggat cactctcggc atggacgagc tgtacaagcc 11880 tgctgccaag agggtcaagt tggactaggt ttaaacctgg aaaaacatgg agcaatcaca 11940 agtagcaata cagcagctac caatgctgat tgtgcctggc tagaagcaca agaggaggag 12000 gaggtgggtt ttccagtcac acctcagaca atcaacctct ggattacaaa atttgtgaaa 12060 gattgactgg tattcttaac tatgttgctc cttttacgct atgtggatac gctgctttaa 12120 tgcctttgta tcatgctatt gcttcccgta tggctttcat tttctcctcc ttgtataaat 12180 cctggttgct gtctctttat gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt 12240 gcactgtgtt tgctgacgca acccccactg gttggggcat tgccaccacc tgtcagctcc 12300 tttccgggac tttcgctttc cccctcccta ttgccacggc ggaactcatc gccgcctgcc 12360 ttgcccgctg ctggacaggg gctcggctgt tgggcactga caattccgtg gtgttgtcgg 12420 ggaagctgac gtcctttcca tggctgctcg cctgtgttgc cacctggatt ctgcgcggga 12480 cgtccttctg ctacgtccct tcggccctca atccagcgga ccttccttcc cgcggcctgc 12540 tgccggctct gcggcctctt ccgcgtcttc gccttcgccc tcagacgagt cggatctccc 12600 tttgggccgc ctccccgcct ggaattcgag ctcggtacct ttaagaccaa tgacttacaa 12660 ggcagctgta gatcttagcc actttttaaa agaaaagggg ggactggaag ggctaattca 12720 ctcccaaaga agacaagata tccttgatct gtggatctac cacacacaag gctacttccc 12780 tgattgacag aactacacac cagggccagg ggtcagatat ccactgacct ttggatggtg 12840 ctacaagcta gtaccagttg agccagataa gatagaagag gccaataaag gagagaacac 12900 cagcttgtta caccctgtga gcctgcatgg gatggatgac ccggagagag aagtgttaga 12960 gtggaggttt gacagccgcc tagcatttca tcacgtggcc cgagagctgc atccggactg 13020 tactgggtct ctctggttag accagatctg agcctgggag ctctctggct aactagggaa 13080 cccactgctt aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct 13140 gttgtgtgac tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc 13200 tagcagggcc gctttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat 13260 ctgttgtttg cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc 13320 tttcctaata aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg 13380 ggggtggggt ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg 13440 gggatgcggt gggctctatg gcttctgagg cggaaagaac cagctggggc tctagggggt 13500 atccccacgc gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg 13560 tgaccgctac acttgccagc gccctagcgc ccgctccttt cgctttcttc ccttcctttc 13620 tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg gggcatccct ttagggttcc 13680 gatttagtgc tttacggcac ctcgacccca aaaaacttga ttagggtgat ggttcacgta 13740 gtgggccatc gccctgatag acggtttttc gccctttgac gttggagtcc acgttcttta 13800 atagtggact cttgttccaa actggaacaa cactcaaccc tatctcggtc tattcttttg 13860 atttataagg gattttgggg atttcggcct attggttaaa aaatgagctg atttaacaaa 13920 aatttaacgc gaattaattc tgtggaatgt gtgtcagtta gggtgtggaa agtccccagg 13980 ctccccaggc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca accaggtgtg 14040 gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc aattagtcag 14100 caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc 14160 attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag gccgcctctg 14220 cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa 14280 agctcccggg agcttgtata tccattttcg gatctgatca gcacgtgttg acaattaatc 14340 atcggcatag tatatcggca tagtataata cgacaaggtg aggaactaaa ccatggccaa 14400 gttgaccagt gccgttccgg tgctcaccgc gcgcgacgtc gccggagcgg tcgagttctg 14460 gaccgaccgg ctcgggttct cccgggactt cgtggaggac gacttcgccg gtgtggtccg 14520 ggacgacgtg accctgttca tcagcgcggt ccaggaccag gtggtgccgg acaacaccct 14580 ggcctgggtg tgggtgcgcg gcctggacga gctgtacgcc gagtggtcgg aggtcgtgtc 14640 cacgaacttc cgggacgcct ccgggccggc catgaccgag atcggcgagc agccgtgggg 14700 gcgggagttc gccctgcgcg acccggccgg caactgcgtg cacttcgtgg ccgaggagca 14760 ggactgacac gtgctacgag atttcgattc caccgccgcc ttctatgaaa ggttgggctt 14820 cggaatcgtt ttccgggacg ccggctggat gatcctccag cgcggggatc tcatgctgga 14880 gttcttcgcc caccccaact tgtttattgc agcttataat ggttacaaat aaagcaatag 14940 catcacaaat ttcacaaata aagcattttt ttcactgcat tctagttgtg gtttgtccaa 15000 actcatcaat gtatcttatc atgtctgtat accgtcgacc tctagctaga gcttggcgta 15060 atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat 15120 acgagccgga agcataaagt gtaaagcctg gggtgcctaa tgagtgagct aactcacatt 15180 aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta 15240 atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc 15300 gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa 15360 ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa 15420 aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct 15480 ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac 15540 aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc 15600 gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc 15660 tcaatgctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg 15720 tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga 15780 gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag 15840 cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta 15900 cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag 15960 agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg 16020 caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac 16080 ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc 16140 aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag 16200 tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc 16260 agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac 16320 gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc 16380 accggctcca gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg 16440 tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag 16500 tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc 16560 acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac 16620 atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag 16680 aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac 16740 tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg 16800 agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc 16860 gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact 16920 ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg 16980 atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa 17040 tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt 17100 tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg 17160 tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga 17220 cgtc 17224

[0151] SEQ ID NO: 2

[0152] CMV enhancer

[0153] > mol_type, genomic DNA

[0154] > organism, Human cytomegalovirus gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 60 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 120 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 180 ctttccattg acgtcaatgg gtggactatt tacggtaaac tgcccacttg gcagtacatc 240 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 300 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 360 tagtcatcgc tattaccatg 380

[0155] SEQ ID NO: 3

[0156] CMV promoter

[0157] > mol_type, genomic DNA

[0158] > organism, Human cytomegalovirus tgatgcggtt ttggcagtac atcaatgggc gtggatagcg gtttgactca cggggatttc 60 caagtctcca ccccattgac gtcaatggga gtttgttttg gcaccaaaat caacgggact 120 ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat gggcggtagg cgtgtacggt 180 gggaggtcta tataagcag 199

[0159] SEQ ID NO: 4

[0160] Truncated 5’ long terminal repeat (LTR) from HIV-1

[0161] > mol_type, genomic DNA

[0162] > organism, Human immunodeficiency virus 1 gggtctctct ggttagacca gatctgagcc tgggagctct ctggctaact agggaaccca 60 ctgcttaagc ctcaataaag cttgccttga gtgcttcaag tagtgtgtgc ccgtctgttg 120 tgtgactctg gtaactagag atccctcaga cccttttagt cagtgtggaa aatctctagc 180 a 181

[0163] SEQ ID NO: 5

[0164] Packaging signal (Psi) of HIV-1

[0165] > mol_type, genomic DNA

[0166] > organism, Human immunodeficiency virus 1 ctctctcgac gcaggactcg gcttgctgaa gcgcgcacgg caagaggcga ggggcggcga 60 ctggtgagta cgccaaaaat tttgactagc ggaggctaga aggagagaga tgggtgcgag 120 agcgtc 126

[0167] SEQ ID NO: 6

[0168] Rev Response Element of HIV-1

[0169] > mol_type, genomic DNA

[0170] > organism, Human immunodeficiency virus 1 aggagctttg ttccttgggt tcttgggagc agcaggaagc actatgggcg cagcctcaat 60 gacgctgacg gtacaggcca gacaattatt gtctggtata gtgcagcagc agaacaattt 120 gctgagggct attgaggcgc aacagcatct gttgcaactc acagtctggg gcatcaagca 180 gctccaagca agaatcctag ctgtggaaag atacctaaag gatcaacagc tcct 234

[0171] SEQ ID NO: 7 central polypurine tract and central termination sequence of HIV-1

[0172] > mol_type, genomic DNA

[0173] > organism, Human immunodeficiency virus 1 ttttaaaaga aaagggggga ttggggggta cagtgcaggg gaaagaatag tagacataat 60 agcaacagac atacaaacta aagaattaca aaaacaaatt acaaaaattc aaaatttt 118

[0174] SEQ ID NO: 8 CMV enhancer

[0175] > mol_type, genomic DNA

[0176] > organism, Human cytomegalovirus gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 60 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 120 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 180 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 240 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 300 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 360 tagtcatcgc tattaccatg 380

[0177] SEQ ID NO: 9

[0178] Chicken beta actin promoter

[0179] > mol_type, other DNA

[0180] > organism, synthetic construct tcgaggtgag ccccacgttc tgcttcactc tccccatctc ccccccctcc ccacccccaa 60 ttttgtattt atttattttt taattatttt gtgcagcgat gggggcgggg gggggggggg 120 cgcgcgccag gcggggcggg gcggggcgag gggcggggcg gggcgaggcg gagaggtgcg 180 gcggcagcca atcagagcgg cgcgctccga aagtttcctt ttatggcgag gcggcggcgg 240 cggcggccct ataaaaagcg aagcgcgcgg cgggcg 276

[0181] SEQ ID NO: 10

[0182] Chimera between introns from chicken beta-actin and rabbit beta-globin

[0183] > mol_type, other DNA

[0184] > organism, synthetic construct ggagtcgctg cgttgccttc gccccgtgcc ccgctccgcg ccgcctcgcg ccgcccgccc 60 cggctctgac tgaccgcgtt actcccacag gtgagcgggc gggacggccc ttctcctccg 120 ggctgtaatt agcgcttggt ttaatgacgg ctcgtttctt ttctgtggct gcgtgaaagc 180 cttaaagggc tccgggaggg ccctttgtgc gggggggagc ggctcggggg gtgcgtgcgt 240 gtgtgtgtgc gtggggagcg ccgcgtgcgg cccgcgctgc ccggcggctg tgagcgctgc 300 gggcgcggcg cggggctttg tgcgctccgc gtgtgcgcga ggggagcgcg gccgggggcg 360 gtgccccgcg gtgcgggggg gctgcgaggg gaacaaaggc tgcgtgcggg gtgtgtgcgt 420 gggggggtga gcagggggtg tgggcgcggc ggtcgggctg taaccccccc ctgcaccccc 480 ctccccgagt tgctgagcac ggcccggctt cgggtgcggg gctccgtgcg gggcgtggcg 540 cggggctcgc cgtgccgggc ggggggtggc ggcaggtggg ggtgccgggc ggggcggggc 600 cgcctcgggc cggggagggc tcgggggagg ggcgcggcgg ccccggagcg ccggcggctg 660 tcgaggcgcg gcgagccgca gccattgcct tttatggtaa tcgtgcgaga gggcgcaggg 720 acttcctttg tcccaaatct ggcggagccg aaatctggga ggcgccgccg caccccctct 780 agcgggcgcg ggcgaagcgg tgcggcgccg gcaggaagga aatgggcggg gagggccttc 840 gtgcgtcgcc gcgccgccgt ccccttctcc atctccagcc tcggggctgc cgcaggggga 900 cggctgcctt cgggggggac ggggcagggc ggggttcggc ttctggcgtg tgaccggcgg 960 ctctagagcc tctgctaacc atgttcatgc cttcttcttt ttcctacag 1009

[0185] SEQ ID NO: 11

[0186] Kozak sequence

[0187] > mol_type, other DNA

[0188] > organism, synthetic construct gccaccatgg 10

[0189] SEQ ID NO: 12

[0190] Human ABCA4 gene

[0191] > mol_type, genomic DNA

[0192] > organism, Homo sapiens atgggcttcg tgagacagat acagcttttg ctctggaaga actggaccct gcggaaaagg 60 caaaagattc gctttgtggt ggaactcgtg tggcctttat ctttatttct ggtcttgatc 120 tggttaagga atgccaaccc actctacagc catcatgaat gccatttccc caacaaggcg 180 atgccctcag caggaatgct gccgtggctc caggggatct tctgcaatgt gaacaatccc 240 tgttttcaaa gccccacccc aggagaatct cctggaattg tgtcaaacta taacaactcc 300 atcttggcaa gggtatatcg agattttcaa gaactcctca tgaatgcacc agagagccag 360 caccttggcc gtatttggac agagctacac atcttgtccc aattcatgga caccctccgg 420 actcacccgg agagaattgc aggaagagga atacgaataa gggatatctt gaaagatgaa 480 gaaacactga cactatttct cattaaaaac atcggcctgt ctgactcagt ggtctacctt 540 ctgatcaact ctcaagtccg tccagagcag ttcgctcatg gagtcccgga cctggcgctg 600 aaggacatcg cctgcagcga ggccctcctg gagcgcttca tcatcttcag ccagagacgc 660 ggggcaaaga cggtgcgcta tgccctgtgc tccctctccc agggcaccct acagtggata 720 gaagacactc tgtatgccaa cgtggacttc ttcaagctct tccgtgtgct tcccacactc 780 ctagacagcc gttctcaagg tatcaatctg agatcttggg gaggaatatt atctgatatg 840 tcaccaagaa ttcaagagtt tatccatcgg ccgagtatgc aggacttgct gtgggtgacc 900 aggcccctca tgcagaatgg tggtccagag acctttacaa agctgatggg catcctgtct 960 gacctcctgt gtggctaccc cgagggaggt ggctctcggg tgctctcctt caactggtat 1020 gaagacaata actataaggc ctttctgggg attgactcca caaggaagga tcctatctat 1080 tcttatgaca gaagaacaac atccttttgt aatgcattga tccagagcct ggagtcaaat 1140 cctttaacca aaatcgcttg gagggcggca aagcctttgc tgatgggaaa aatcctgtac 1200 actcctgatt cacctgcagc acgaaggata ctgaagaatg ccaactcaac ttttgaagaa 1260 ctggaacacg ttaggaagtt ggtcaaagcc tgggaagaag tagggcccca gatctggtac 1320 ttctttgaca acagcacaca gatgaacatg atcagagata ccctggggaa cccaacagta 1380 aaagactttt tgaataggca gcttggtgaa gaaggtatta ctgctgaagc catcctaaac 1440 ttcctctaca agggccctcg ggaaagccag gctgacgaca tggccaactt cgactggagg 1500 gacatattta acatcactga tcgcaccctc cgcctggtca atcaatacct ggagtgcttg 1560 gtcctggata agtttgaaag ctacaatgat gaaactcagc tcacccaacg tgccctctct 1620 ctactggagg aaaacatgtt ctgggccgga gtggtattcc ctgacatgta tccctggacc 1680 agctctctac caccccacgt gaagtataag atccgaatgg acatagacgt ggtggagaaa 1740 accaataaga ttaaagacag gtattgggat tctggtccca gagctgatcc cgtggaagat 1800 ttccggtaca tctggggcgg gtttgcctat ctgcaggaca tggttgaaca ggggatcaca 1860 aggagccagg tgcaggcgga ggctccagtt ggaatctacc tccagcagat gccctacccc 1920 tgcttcgtgg acgattcttt catgatcatc ctgaaccgct gtttccctat cttcatggtg 1980 ctggcatgga tctactctgt ctccatgact gtgaagagca tcgtcttgga gaaggagttg 2040 cgactgaagg agaccttgaa aaatcagggt gtctccaatg cagtgatttg gtgtacctgg 2100 ttcctggaca gcttctccat catgtcgatg agcatcttcc tcctgacgat attcatcatg 2160 catggaagaa tcctacatta cagcgaccca ttcatcctct tcctgttctt gttggctttc 2220 tccactgcca ccatcatgct gtgctttctg ctcagcacct tcttctccaa ggccagtctg 2280 gcagcagcct gtagtggtgt catctatttc accctctacc tgccacacat cctgtgcttc 2340 gcctggcagg accgcatgac cgctgagctg aagaaggctg tgagcttact gtctccggtg 2400 gcatttggat ttggcactga gtacctggtt cgctttgaag agcaaggcct ggggctgcag 2460 tggagcaaca tcgggaacag tcccacggaa ggggacgaat tcagcttcct gctgtccatg 2520 cagatgatgc tccttgatgc tgctgtctat ggcttactcg cttggtacct tgatcaggtg 2580 tttccaggag actatggaac cccacttcct tggtactttc ttctacaaga gtcgtattgg 2640 cttggcggtg aagggtgttc aaccagagaa gaaagagccc tggaaaagac cgagccccta 2700 acagaggaaa cggaggatcc agagcaccca gaaggaatac acgactcctt ctttgaacgt 2760 gagcatccag ggtgggttcc tggggtatgc gtgaagaatc tggtaaagat ttttgagccc 2820 tgtggccggc cagctgtgga ccgtctgaac atcaccttct acgagaacca gatcaccgca 2880 ttcctgggcc acaatggagc tgggaaaacc accaccttgt ccatcctgac gggtctgttg 2940 ccaccaacct ctgggactgt gctcgttggg ggaagggaca ttgaaaccag cctggatgca 3000 gtccggcaga gccttggcat gtgtccacag cacaacatcc tgttccacca cctcacggtg 3060 gctgagcaca tgctgttcta tgcccagctg aaaggaaagt cccaggagga ggcccagctg 3120 gagatggaag ccatgttgga ggacacaggc ctccaccaca agcggaatga agaggctcag 3180 gacctatcag gtggcatgca gagaaagctg tcggttgcca ttgcctttgt gggagatgcc 3240 aaggtggtga ttctggacga acccacctct ggggtggacc cttactcgag acgctcaatc 3300 tgggatctgc tcctgaagta tcgctcaggc agaaccatca tcatgtccac tcaccacatg 3360 gacgaggccg acctccttgg ggaccgcatt gccatcattg cccagggaag gctctactgc 3420 tcaggcaccc cactcttcct gaagaactgc tttggcacag gcttgtactt aaccttggtg 3480 cgcaagatga aaaacatcca gagccaaagg aaaggcagtg aggggacctg cagctgctcg 3540 tctaagggtt tctccaccac gtgtccagcc cacgtcgatg acctaactcc agaacaagtc 3600 ctggatgggg atgtaaatga gctgatggat gtagttctcc accatgttcc agaggcaaag 3660 ctggtggagt gcattggtca agaacttatc ttccttcttc caaataagaa cttcaagcac 3720 agagcatatg ccagcctttt cagagagctg gaggagacgc tggctgacct tggtctcagc 3780 agttttggaa tttctgacac tcccctggaa gagatttttc tgaaggtcac ggaggattct 3840 gattcaggac ctctgtttgc gggtggcgct cagcagaaaa gagaaaacgt caacccccga 3900 cacccctgct tgggtcccag agagaaggct ggacagacac cccaggactc caatgtctgc 3960 tccccagggg cgccggctgc tcacccagag ggccagcctc ccccagagcc agagtgccca 4020 ggcccgcagc tcaacacggg gacacagctg gtcctccagc atgtgcaggc gctgctggtc 4080 aagagattcc aacacaccat ccgcagccac aaggacttcc tggcgcagat cgtgctcccg 4140 gctacctttg tgtttttggc tctgatgctt tctattgtta tccctccttt tggcgaatac 4200 cccgctttga cccttcaccc ctggatatat gggcagcagt acaccttctt cagcatggat 4260 gaaccaggca gtgagcagtt cacggtactt gcagacgtcc tcctgaataa gccaggcttt 4320 ggcaaccgct gcctgaagga agggtggctt ccggagtacc cctgtggcaa ctcaacaccc 4380 tggaagactc cttctgtgtc cccaaacatc acccagctgt tccagaagca gaaatggaca 4440 caggtcaacc cttcaccatc ctgcaggtgc agcaccaggg agaagctcac catgctgcca 4500 gagtgccccg agggtgccgg gggcctcccg cccccccaga gaacacagcg cagcacggaa 4560 attctacaag acctgacgga caggaacatc tccgacttct tggtaaaaac gtatcctgct 4620 cttataagaa gcagcttaaa gagcaaattc tgggtcaatg aacagaggta tggaggaatt 4680 tccattggag gaaagctccc agtcgtcccc atcacggggg aagcacttgt tgggttttta 4740 agcgaccttg gccggatcat gaatgtgagc gggggcccta tcactagaga ggcctctaaa 4800 gaaatacctg atttccttaa acatctagaa actgaagaca acattaaggt gtggtttaat 4860 aacaaaggct ggcatgccct ggtcagcttt ctcaatgtgg cccacaacgc catcttacgg 4920 gccagcctgc ctaaggacag gagccccgag gagtatggaa tcaccgtcat tagccaaccc 4980 ctgaacctga ccaaggagca gctctcagag attacagtgc tgaccacttc agtggatgct 5040 gtggttgcca tctgcgtgat tttctccatg tccttcgtcc cagccagctt tgtcctttat 5100 ttgatccagg agcgggtgaa caaatccaag cacctccagt ttatcagtgg agtgagcccc 5160 accacctact gggtgaccaa cttcctctgg gacatcatga attattccgt gagtgctggg 5220 ctggtggtgg gcatcttcat cgggtttcag aagaaagcct acacttctcc agaaaacctt 5280 cctgcccttg tggcactgct cctgctgtat ggatgggcgg tcattcccat gatgtaccca 5340 gcatccttcc tgtttgatgt ccccagcaca gcctatgtgg ctttatcttg tgctaatctg 5400 ttcatcggca tcaacagcag tgctattacc ttcatcttgg aattatttga gaataaccgg 5460 acgctgctca ggttcaacgc cgtgctgagg aagctgctca ttgtcttccc ccacttctgc 5520 ctgggccggg gcctcattga ccttgcactg agccaggctg tgacagatgt ctatgcccgg 5580 tttggtgagg agcactctgc aaatccgttc cactgggacc tgattgggaa gaacctgttt 5640 gccatggtgg tggaaggggt ggtgtacttc ctcctgaccc tgctggtcca gcgccacttc 5700 ttcctctccc aatggattgc cgagcccact aaggagccca ttgttgatga agatgatgat 5760 gtggctgaag aaagacaaag aattattact ggtggaaata aaactgacat cttaaggcta 5820 catgaactaa ccaagattta tccaggcacc tccagcccag cagtggacag gctgtgtgtc 5880 ggagttcgcc ctggagagtg ctttggcctc ctgggagtga atggtgccgg caaaacaacc 5940 acattcaaga tgctcactgg ggacaccaca gtgacctcag gggatgccac cgtagcaggc 6000 aagagtattt taaccaatat ttctgaagtc catcaaaata tgggctactg tcctcagttt 6060 gatgcaattg atgagctgct cacaggacga gaacatcttt acctttatgc ccggcttcga 6120 ggtgtaccag cagaagaaat cgaaaaggtt gcaaactgga gtattaagag cctgggcctg 6180 actgtctacg ccgactgcct ggctggcacg tacagtgggg gcaacaagcg gaaactctcc 6240 acagccatcg cactcattgg ctgcccaccg ctggtgctgc tggatgagcc caccacaggg 6300 atggaccccc aggcacgccg catgctgtgg aacgtcatcg tgagcatcat cagagaaggg 6360 agggctgtgg tcctcacatc ccacagcatg gaagaatgtg aggcactgtg tacccggctg 6420 gccatcatgg taaagggcgc ctttcgatgt atgggcacca ttcagcatct caagtccaaa 6480 tttggagatg gctatatcgt cacaatgaag atcaaatccc cgaaggacga cctgcttcct 6540 gacctgaacc ctgtggagca gttcttccag gggaacttcc caggcagtgt gcagagggag 6600 aggcactaca acatgctcca gttccaggtc tcctcctcct ccctggcgag gatcttccag 6660 ctcctcctct cccacaagga cagcctgctc atcgaggagt actcagtcac acagaccaca 6720 ctggaccagg tgtttgtaaa ttttgctaaa cagcagactg aaagtcatga cctccctctg 6780 caccctcgag ctgctggagc cagtcgacaa gcccaggac 6819

[0193] SEQ ID NO: 13

[0194] 2A peptide from porcine teschovirus-1 polyprotein

[0195] > mol_type, genomic DNA

[0196] > organism, Porcine teschovirus-1 gccacgaact tctctctgtt aaagcaagca ggagatgttg aagaaaaccc cgggcct 57

[0197] SEQ ID NO: 14

[0198] Nuclear localization signal of SV40

[0199] > mol_type, genomic DNA

[0200] > organism, Simian virus 40 ccaaaaaaga agagaaaggt a 21

[0201] SEQ ID NO: 15

[0202] Enhanced GFP

[0203] > mol_type, other DNA

[0204] > organism, Synthetic construct atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaag 717

[0205] SEQ ID NO: 16

[0206] Nuclear localization signal of human c-Myc

[0207] > mol_type, genomic DNA

[0208] > organism, Homo sapiens cctgctgcca agagggtcaa gttggac 27

[0209] SEQ ID NO: 17

[0210] Woodchuck hepatitis virus posttranscriptional regulatory element

[0211] > mol_type, genomic DNA

[0212] > organism, Woodchuck hepatitis virus aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60 ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120 atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180 tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240 ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300 attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360 ttgggcactg acaattccgt ggtgttgtcg gggaagctga cgtcctttcc atggctgctc 420 gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480 aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540 cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgc 589 SEQ ID NO: 18

[0213] Factor Xa recognition and cleavage site

[0214] > mol_type, genomic DNA

[0215] > organism, Homo sapiens tcggccctca at

[0216] SEQ ID NO: 19

[0217] Truncated 5’ long terminal repeat (LTR) from HIV-1

[0218] > mol_type, genomic DNA

[0219] > organism, Human immunodeficiency virus 1 gggtctctct ggttagacca gatctgagcc tgggagctct ctggctaact agggaaccca 60 ctgcttaagc ctcaataaag cttgccttga gtgcttcaag tagtgtgtgc ccgtctgttg 120 tgtgactctg gtaactagag atccctcaga cccttttagt cagtgtggaa aatctctagc 180 a 181

[0220] SEQ ID NO: 20

[0221] Bovine growth hormone polyadenylation signal

[0222] > mol_type, genomic DNA

[0223] > organism, Bos taurus ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 60 tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 120 tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 180 gggaagacaa tagcaggcat gctggggatg cggtgggctc tatgg 225

[0224] SEQ ID NO: 21 : f1 bacteriophage origin of replication

[0225] > mol_type, genomic DNA

[0226] > organism, Bacteriophage f1 acgcgccctg tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg 60 ctacacttgc cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca 120 cgttcgccgg ctttccccgt caagctctaa atcggggcat ccctttaggg ttccgattta 180 gtgctttacg gcacctcgac cccaaaaaac ttgattaggg tgatggttca cgtagtgggc 240 catcgccctg atagacggtt tttcgccctt tgacgttgga gtccacgttc tttaatagtg 300 gactcttgtt ccaaactgga acaacactca accctatctc ggtctattct tttgatttat 360 aagggatttt ggggatttcg gcctattggt taaaaaatga gctgatttaa caaaaattta 420 acgcgaatt 429

[0227] SEQ ID NO: 22

[0228] SV40 enhancer and early promoter

[0229] > mol_type, genomic DNA

[0230] > organism, Simian virus 40 gtgtgtcagt tagggtgtgg aaagtcccca ggctccccag gcaggcagaa gtatgcaaag 60 catgcatctc aattagtcag caaccaggtg tggaaagtcc ccaggctccc cagcaggcag 120 aagtatgcaa agcatgcatc tcaattagtc agcaaccata gtcccgcccc taactccgcc 180 catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct gactaatttt 240 ttttatttat gcagaggccg aggccgcctc tgcctctgag ctattccaga agtagtgagg 300 aggctttttt ggaggcctag gcttttgcaa a 331

[0231] SEQ ID NO: 23

[0232] SV40 origin of replication

[0233] > mol_type, genomic DNA

[0234] > organism, Simian virus 40 atcccgcccc taactccgcc cagttccgcc cattctccgc cccatggctg actaattttt 60 tttatttatg cagaggccga ggccgcctct gcctctgagc tattccagaa gtagtgagga 120 ggcttttttg gaggcc 136

[0235] SEQ ID NO: 24

[0236] EM7 promoter

[0237] > mol_type, other DNA

[0238] > organism, synthetic construct gttgacaatt aatcatcggc atagtatatc ggcatagtat aatacgac 48

[0239] SEQ ID NO: 25

[0240] Antibiotic-binding protein

[0241] > mol_type, genomic DNA

[0242] > organism, Streptoalloteichus hindustanus atggccaagt tgaccagtgc cgttccggtg ctcaccgcgc gcgacgtcgc cggagcggtc 60 gagttctgga ccgaccggct cgggttctcc cgggacttcg tggaggacga cttcgccggt 120 gtggtccggg acgacgtgac cctgttcatc agcgcggtcc aggaccaggt ggtgccggac 180 aacaccctgg cctgggtgtg ggtgcgcggc ctggacgagc tgtacgccga gtggtcggag 240 gtcgtgtcca cgaacttccg ggacgcctcc gggccggcca tgaccgagat cggcgagcag 300 ccgtgggggc gggagttcgc cctgcgcgac ccggccggca actgcgtgca cttcgtggcc 360 gaggagcagg actga 375

[0243] SEQ ID NO: 26:

[0244] SV40 poly(A) signal

[0245] > mol_type, genomic DNA

[0246] > organism, Simian virus 40 aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60 aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120 ta 122

[0247] SEQ ID NO 27:

[0248] M13 rev

[0249] > mol_type, other DNA

[0250] > organism, synthetic construct gtcatagctg tttcctg 17

[0251] SEQ ID NO: 28:

[0252] Lac operator

[0253] > mol_type, genomic DNA

[0254] > organism, Escherichia coli ttgttatccg ctcacaa 17

[0255] SEQ ID NO: 29:

[0256] Lac promoter

[0257] > mol_type, genomic DNA

[0258] > organism, Escherichia coli caacatacga gccggaagca taaagtgtaa a 31

[0259] SEQ ID NO: 30:

[0260] CAP binding site

[0261] > mol_type, genomic DNA

[0262] > organism, Escherichia coli atgagtgagc taactcacat ta 22

[0263] SEQ ID NO: 31 :

[0264] Jigh-copy-number ColE1 / pMB1 / pBR322 / pUC origin of replication.

[0265] > mol_type, other DNA

[0266] > organism, synthetic construct tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg 60 gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg 120 ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag 180 cgtggcgctt tctcaatgct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc 240 caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa 300 ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg 360 taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc 420 taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac 480 cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg 540 tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaa 589 SEQ ID NO: 32:

[0267] Ampicillin Orf frame 3

[0268] > mol_type, other DNA

[0269] > organism, synthetic construct ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat 60 agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc 120 cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa 180 ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca 240 gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa 300 cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt 360 cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc 420 ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact 480 catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc 540 tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg 600 ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct 660 catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc 720 cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag 780 cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac 840 acggaaatgt tgaatactca t 861

[0270] SEQ ID NO: 33:

[0271] AmpR promoter

[0272] > mol_type, other DNA

[0273] > organism, synthetic construct actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata 60 catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcg 105

[0274] SEQ ID NO: 34: pAAV-shortCAG-ELR1 -P2A-mCherry-WPRE

[0275] > mol_type, other DNA

[0276] > organism, synthetic construct gcgatcggtg cgggcctctt cgctattacg ccagctgcgc gctcgctcgc tcactgaggc 60 cgcccgggca aagcccgggc gtcgggcgac ctttggtcgc ccggcctcag tgagcgagcg 120 agcgcgcaga gagggagtgg ccaactccat cactaggggt tccttgtagt taatgattaa 180 cccgccatgc tacttatcta cgtagccatg ctctaggaag atcgtaggtt aattaaccat 240 tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc 300 aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 360 caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt 420 acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 480 ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 540 ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 600 ggggggggcg cgcgccaggc ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga 660 gaggtgcggc ggcagccaat cagagcggcg cgctccgaaa gtttcctttt atggcgaggc 720 ggcggcggcg gcggccctat aaaaagcgaa gcgcgcggcg ggcgggagtc gctgcgacgc 780 tgccttcgcc ccgtgccccg ctccgccgcc gcctcgcgcc gcccgccccg gctctgactg 840 accgcgttac tcccacaggt gagcgggcgg gacggccctt ctcctccggg ctgtaattag 900 cgcttggttt aatgacggct tgtttctttt ctgtggctgc gtgaaagcct tgaggggctc 960 cgggagggcc ctttgtgcgg ggggagcggc tcggggctgt ccgcgggggg acggctgcct 1020 tcggggggga cggggcaggg cggggttcgg cttctggcgt gtgaccggcg gctctagagc 1080 ctctgctaac catgttcatg ccttcttctt tttcctacag ctcctgggca acgtgctggt 1140 tattgtgctg tctcatcatt ttggcaaaga attggatccc cgggtaccgg tcgccaccat 1200 ggagcctctg cgaggctggg ggccaccccc atggagcccg gcacccaagg ctgatgccct 1260 gagcctggcc ttgtatctcc tccttctggg gtccccccgc tacaccctgg cgacgcccca 1320 gtgcaaagag gaggagtacc cagtggggac cgagtgctgc cccaaatgca gtccaggtta 1380 ccgcgtgaag caggcctgtg gggagctgac tggcacggtg tgcgttccct gcgcccccag 1440 gaccttctca gcccacctca acggcctgag caagtgtctg ccgtgccgac cctgtgaccc 1500 agccatgggc ctggtgatca ggcgggactg ctcgagcacg gaaaacaccg agtgtggctg 1560 cgaccaaggc cacttctgcg ttagcgagaa gggggatgat tgtgtcgagt gccagcccca 1620 cacgacctgc agaccaggcc agagggtaca ggagagaggc accgagcggc aggacacggt 1680 gtgtgaagac tgccagcccg ggaccttctc tcccaatggg accctggggg agtgccggcc 1740 ctggaccaag tgcagcggcc tctttgagat ggaagtggaa cctgggacta gcagcacaga 1800 cgtcacgtgc tcctcccagg gcctcagtgt tcttgtgggc gttctcgtgc ttgtgttggc 1860 tggcctgata gtcctctgcg tgtggatgaa aatgagaagg acatctgatg gattcacccc 1920 agtgagattc ctctctcagt ggacacgtcc tggtgtagga cgggaagaca cagccgccca 1980 ggccctgcag cccacgccgg acgtcaccac ggtggccgtg gaggagacag cagccatgtt 2040 ccctgagagg gagcaacatg ctgaccgaca gcctcagatg cagccatctg agaaatccct 2100 gactgtgtct gccgagagct gccaggccct caagggcgga tccggagcta ctaacttcag 2160 cctgctgaag caggctggag acgtggagga gaaccctgga cctatggtga gcaagggcga 2220 ggaggataac atggccatca tcaaggagtt catgcgcttc aaggtgcaca tggagggctc 2280 cgtgaacggc cacgagttcg agatcgaggg cgagggcgag ggccgcccct acgagggcac 2340 ccagaccgcc aagctgaagg tgaccaaggg tggccccctg cccttcgcct gggacatcct 2400 gtcccctcag ttcatgtacg gctccaaggc ctacgtgaag caccccgccg acatccccga 2460 ctacttgaag ctgtccttcc ccgagggctt caagtgggag cgcgtgatga acttcgagga 2520 cggcggcgtg gtgaccgtga cccaggactc ctccctgcag gacggcgagt tcatctacaa 2580 ggtgaagctg cgcggcacca acttcccctc cgacggcccc gtaatgcaga agaagaccat 2640 gggctgggag gcctcctccg agcggatgta ccccgaggac ggcgccctga agggcgagat 2700 caagcagagg ctgaagctga aggacggcgg ccactacgac gctgaggtca agaccaccta 2760 caaggccaag aagcccgtgc agctgcccgg cgcctacaac gtcaacatca agttggacat 2820 cacctcccac aacgaggact acaccatcgt ggaacagtac gaacgcgccg agggccgcca 2880 ctccaccggc ggcatggacg agctgtacaa gtaagaattc gatatcaagc ttatcgataa 2940 tcaacctctg gattacaaaa tttgtgaaag attgactggt attcttaact atgttgctcc 3000 ttttacgcta tgtggatacg ctgctttaat gcctttgtat catgctattg cttcccgtat 3060 ggctttcatt ttctcctcct tgtataaatc ctggttgctg tctctttatg aggagttgtg 3120 gcccgttgtc aggcaacgtg gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg 3180 ttggggcatt gccaccacct gtcagctcct ttccgggact ttcgctttcc ccctccctat 3240 tgccacggcg gaactcatcg ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt 3300 gggcactgac aattccgtgg tgttgtcggg gaaatcatcg tcctttcctt ggctgctcgc 3360 ctgtgttgcc acctggattc tgcgcgggac gtccttctgc tacgtccctt cggccctcaa 3420 tccagcggac cttccttccc gcggcctgct gccggctctg cggcctcttc cgcgtcttcg 3480 ccttcgccct cagacgagtc ggatctccct ttgggccgcc tccccgcatc gataccgtcg 3540 acccgggcgg ccgcttcgag cagacatgat aagatacatt gatgagtttg gacaaaccac 3600 aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt 3660 tgtaaccatt ataagctgca ataaacaagt taacaacaac aattgcattc attttatgtt 3720 tcaggttcag ggggagatgt gggaggtttt ttaaagcaag taaaacctct acaaatgtgg 3780 taaaatcgat aaggatcttc ctagagcatg gctacgtaga taagtagcat ggcgggttaa 3840 tcattaacta caaggaaccc ctagtgatgg agttggccac tccctctctg cgcgctcgct 3900 cgctcactga ggccgggcga ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct 3960 cagtgagcga gcgagcgcgc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg 4020 tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg 4080 gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg 4140 ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa 4200 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 4260 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 4320 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 4380 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 4440 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 4500 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 4560 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 4620 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 4680 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 4740 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 4800 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 4860 acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa 4920 ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta 4980 ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt 5040 tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag 5100 tgctgcaatg ataccgcgcg acccacgctc accggctcca gatttatcag caataaacca 5160 gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc 5220 tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt 5280 tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag 5340 ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt 5400 tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat 5460 ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt 5520 gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc 5580 ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat 5640 cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag 5700 ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt 5760 ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg 5820 gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta 5880 ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc 5940 gcgcacattt ccccgaaaag tgccacctaa attgtaagcg ttaatatttt gttaaaattc 6000 gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaaaatc 6060 ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt ttggaacaag 6120 agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt ctatcagggc 6180 gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag gtgccgtaaa 6240 gcactaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg aaagccggcg 6300 aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc gctggcaagt 6360 gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc gctacagggc 6420 gcgtcccatt cgccattcag gctgcgcaac tgttgggaag g 6461

[0277] SEQ ID NO: 35:

[0278] N2c-deltaGa

[0279] > mol_type, other DNA

[0280] > organism, synthetic construct ggagctacta acttcagcct gctgaagcag gctggagacg tggaggagaa ccctggacct 60 atggtgagca agggcgagga ggataacatg gccatcatca aggagttcat gcgcttcaag 120 gtgcacatgg agggctccgt gaacggccac gagttcgaga tcgagggcga gggcgagggc 180 cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggtgg ccccctgccc 240 ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgtgaagcac 300 cccgccgaca tccccgacta cttgaagctg tccttccccg agggcttcaa gtgggagcgc 360 gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 420 ggcgagttca tctacaaggt gaagctgcgc ggcaccaact tcccctccga cggccccgta 480 atgcagaaga agaccatggg ctgggaggcc tcctccgagc ggatgtaccc cgaggacggc 540 gccctgaagg gcgagatcaa gcagaggctg aagctgaagg acggcggcca ctacgacgct 600 gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 660 aacatcaagt tggacatcac ctcccacaac gaggactaca ccatcgtgga acagtacgaa 720 cgcgccgagg gccgccactc caccggcggc atggacgagc tgtacaagta agaattcgat 780 atcaagctta tcgataatca acctctggat tacaaaattt gtgaaagatt gactggtatt 840 cttaactatg ttgctccttt tacgctatgt ggatacgctg ctttaatgcc tttgtatcat 900 gctattgctt cccgtatggc tttcattttc tcctccttgt ataaatcctg gttgctgtct 960 ctttatgagg agttgtggcc cgttgtcagg caacgtggcg tgg 1003

[0281] SEQ ID NO: 36:

[0282] N2c-deltaGa

[0283] > mol_type, other DNA

[0284] > organism, synthetic construct gctactaact tcagcctgct gaagcaggct ggagacgtgg aggagaaccc tggacct 57

[0285] SEQ ID NO: 37:

[0286] N2c-deltaGa

[0287] > mol_type, other DNA

[0288] > organism, synthetic construct atggtgagca agggcgagga ggataacatg gccatcatca aggagttcat gcgcttcaag 60 gtgcacatgg agggctccgt gaacggccac gagttcgaga tcgagggcga gggcgagggc 120 cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggtgg ccccctgccc 180 ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgtgaagcac 240 cccgccgaca tccccgacta cttgaagctg tccttccccg agggcttcaa gtgggagcgc 300 gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 360 ggcgagttca tctacaaggt gaagctgcgc ggcaccaact tcccctccga cggccccgta 420 atgcagaaga agaccatggg ctgggaggcc tcctccgagc ggatgtaccc cgaggacggc 480 gccctgaagg gcgagatcaa gcagaggctg aagctgaagg acggcggcca ctacgacgct 540 gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 600 aacatcaagt tggacatcac ctcccacaac gaggactaca ccatcgtgga acagtacgaa 660 cgcgccgagg gccgccactc caccggcggc atggacgagc tgtacaag 708

[0289] SEQ ID NO: 38:

[0290] Inverse Terminal Repeat (ITR)

[0291] > mol_type, genomic DNA

[0292] > organism, Adeno-associated virus gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc gggcgacctt 60 tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca actccatcac 120 taggggttcc ttgtagttaa tgattaaccc gccatgctac ttatctacgt agccatgctc 180 taggaagatc 190

[0293] SEQ ID NO: 39:

[0294] R-ITR

[0295] > mol_type, genomic DNA

[0296] > organism, Adeno-associated virus ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct 130

[0297] SEQ ID NO: 40: shortCAG

[0298] > mol_type, other DNA

[0299] > organism, synthetic construct ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac tttccattga 60 cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca agtgtatcat 120 atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg gcattatgcc 180 cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt agtcatcgct 240 attaccatgg tcgaggtgag ccccacgttc tgcttcactc tccccatctc ccccccctcc 300 ccacccccaa ttttgtattt atttattttt taattatttt gtgcagcgat gggggcgggg 360 gggggggggg ggcgcgcgcc aggcggggcg gggcggggcg aggggcgggg cggggcgagg 420 cggagaggtg cggcggcagc caatcagagc ggcgcgctcc gaaagtttcc ttttatggcg 480 aggcggcggc ggcggcggcc ctataaaaag cgaagcgcgc ggcgggcggg agtcgctgcg 540 acgctgcctt cgccccgtgc cccgctccgc cgccgcctcg cgccgcccgc cccggctctg 600 actgaccgcg ttactcccac aggtgagcgg gcgggacggc ccttctcctc cgggctgtaa 660 ttagcgcttg gtttaatgac ggcttgtttc ttttctgtgg ctgcgtgaaa gccttgaggg 720 gctccgggag ggccctttgt gcggggggag cggctcgggg ctgtccgcgg ggggacggct 780 gccttcgggg gggacggggc agggcggggt tcggcttctg gcgtgtgacc ggcggctcta 840 gagcctctgc taaccatgtt catgccttct tctttttcct acagctcctg ggcaacgtgc 900 tggttattgt gctgtctcat cattttggca aagaatt 937

[0300] SEQ ID NO: 41 : chicken beta-actin promoter

[0301] > mol_type, other DNA

[0302] > organism, synthetic construct tcgaggtgag ccccacgttc tgcttcactc tccccatctc ccccccctcc ccacccccaa 60 ttttgtattt atttattttt taattatttt gtgcagcgat gggggcgggg gggggggggg 120 ggcgcgcgcc aggcggggcg gggcggggcg aggggcgggg cggggcgagg cggagaggtg 180 cggcggcagc caatcagagc ggcgcgctcc gaaagtttcc ttttatggcg aggcggcggc 240 ggcggcggcc ctataaaaag cgaagcgcgc ggcgggcg 278

[0303] SEQ ID NO: 42:

[0304] Equine lentivirus receptor-1

[0305] > mol_type, genomic DNA

[0306] > organism, Equine infectious anemia virus atggagcctc tgcgaggctg ggggccaccc ccatggagcc cggcacccaa ggctgatgcc 60 ctgagcctgg ccttgtatct cctccttctg gggtcccccc gctacaccct ggcgacgccc 120 cagtgcaaag aggaggagta cccagtgggg accgagtgct gccccaaatg cagtccaggt 180 taccgcgtga agcaggcctg tggggagctg actggcacgg tgtgcgttcc ctgcgccccc 240 aggaccttct cagcccacct caacggcctg agcaagtgtc tgccgtgccg accctgtgac 300 ccagccatgg gcctggtgat caggcgggac tgctcgagca cggaaaacac cgagtgtggc 360 tgcgaccaag gccacttctg cgttagcgag aagggggatg attgtgtcga gtgccagccc 420 cacacgacct gcagaccagg ccagagggta caggagagag gcaccgagcg gcaggacacg 480 gtgtgtgaag actgccagcc cgggaccttc tctcccaatg ggaccctggg ggagtgccgg 540 ccctggacca agtgcagcgg cctctttgag atggaagtgg aacctgggac tagcagcaca 600 gacgtcacgt gctcctccca gggcctcagt gttcttgtgg gcgttctcgt gcttgtgttg 660 gctggcctga tagtcctctg cgtgtggatg aaaatgagaa ggacatctga tggattcacc 720 ccagtgagat tcctctctca gtggacacgt cctggtgtag gacgggaaga cacagccgcc 780 caggccctgc agcccacgcc ggacgtcacc acggtggccg tggaggagac agcagccatg 840 ttccctgaga gggagcaaca tgctgaccga cagcctcaga tgcagccatc tgagaaatcc 900 ctgactgtgt ctgccgagag ctgccaggcc ctcaagggc 939

[0307] SEQ ID NO: 43: mCherry - mammalian codon-optimised

[0308] > mol_type, other DNA

[0309] > organism, synthetic construct atggtgagca agggcgagga ggataacatg gccatcatca aggagttcat gcgcttcaag 60 gtgcacatgg agggctccgt gaacggccac gagttcgaga tcgagggcga gggcgagggc 120 cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggtgg ccccctgccc 180 ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgtgaagcac 240 cccgccgaca tccccgacta cttgaagctg tccttccccg agggcttcaa gtgggagcgc 300 gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 360 ggcgagttca tctacaaggt gaagctgcgc ggcaccaact tcccctccga cggccccgta 420 atgcagaaga agaccatggg ctgggaggcc tcctccgagc ggatgtaccc cgaggacggc 480 gccctgaagg gcgagatcaa gcagaggctg aagctgaagg acggcggcca ctacgacgct 540 gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 600 aacatcaagt tggacatcac ctcccacaac gaggactaca ccatcgtgga acagtacgaa 660 cgcgccgagg gccgccactc caccggcggc atggacgagc tgtacaagta a 711

[0310] SEQ ID NO: 44:

[0311] SV40 poly(A) signal

[0312] > mol_type, genomic DNA

[0313] > organism, Simian virus 40 taagatacat tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta 60 tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag 120 tt 122

[0314] SEQ ID NO: 45: ITR

[0315] > mol_type, genomic DNA

[0316] > organism, Adeno-associated virus gatcttccta gagcatggct acgtagataa gtagcatggc gggttaatca ttaactacaa 60 ggaaccccta gtgatggagt tggccactcc ctctctgcgc gctcgctcgc tcactgaggc 120 cgggcgacca aaggtcgccc gacgcccggg ctttgcccgg gcggcctcag tgagcgagcg 180 agcgcgcagc 190

[0317] SEQ ID NO: 46: ITR

[0318] > mol_type, genomic DNA

[0319] > organism, Adeno-associated virus aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60 ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 120 gagcgcgcag 130

[0320] SEQ ID NO: 47: beta-lactamase

[0321] > mol_type, other DNA > organism, synthetic construct ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat 60 agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc 120 cagtgctgca atgataccgc gcgacccacg ctcaccggct ccagatttat cagcaataaa 180 ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca 240 gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa 300 cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt 360 cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc 420 ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact 480 catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc 540 tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg 600 ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct 660 catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc 720 cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag 780 cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac 840 acggaaatgt tgaatactca t 861

[0322] SEQ ID NO: 48:

[0323] F1 bacteriophage origin of replication

[0324] > mol_type, genomic DNA

[0325] > organism, Bacteriophage f1 aaattgtaag cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat 60 tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagaccgaga 120 tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca 180 acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccct 240 aatcaagttt tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc 300 cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag 360 cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca 420 cacccgccgc gcttaatgcg ccgctacagg gcgcgt 456

[0326] SEQ ID NO: 49: TVA800 atggtgcggttgttggagctgctggtgctgctgcgcgccgtccgcccgctgcccacccccacctccgcgcccggcaacggttctttggcgcagt gctcacccgagcagttccactgttcggagccgcgcgatccccaaaccgactgctacccgctggagtggctctgcgacgggcatcccggactg cgacgatggacgggacgagtggggctgcggagcgagcgggagccccgcggtgcccaccgccggcggcacagagacttcagctgtccct gtgcctgggcgtgctctgccatccaggaaccacggccgcatgtggatgctgatcgttgcagggatctttcactgtgaggtggtaagatgggact ga

[0327] SEQ ID NO: 50: TVA950 atggtgcggttgttggagctgctggtgctgctgcgcgccgtccgcccgctgcccacccccacctccgcgcccggcaacggttctttggcgcagt gctcacccgagcagttccactgttcggagccgcgcgatccccaaaccgactgctacccgctggagtggctctgggacgggcatcccgactgc gacgatggacgggacgagtggggctgcggagcgagcgggagccccgcggtgcccaccgccggcggcacagagacttcagctgtccctg tgcctgggcgtgctctgccatccaggaaccacggccgcatgtggatgctgatcgttgcagggatctttcactgtgaggtggtaagatgggactg a

Claims

Claims1. A composition for the expression of a gene sequence of interest in a target cell wherein the composition comprises;(a) a first vector comprising a non-native receptor sequence, wherein the first vector is capable of introducing and / or expressing the non-native receptor sequence in the target cell, resulting in the exhibition of the non-native receptor on the target cell surface; and(b) a second vector comprising the gene sequence of interest wherein the second vector uses the non-native receptor for cell entry and enables the expression of the gene of interest in the target cell and wherein the second vector is a lentivirus.

2. A combination for the expression of a gene sequence of interest in a target cell wherein the combination comprises:(a) a first vector comprising a non-native receptor sequence, wherein the first vector is capable of introducing and / or expressing the non-native receptor sequence in the target cell, resulting in the exhibition of the non-native receptor on the target cell surface; and(b) a second vector comprising the gene sequence of interest wherein the second vector uses the non-native receptor for cell entry and enables the expression of the gene of interest in the target cell.

3. The composition or combination according to any preceding claim, wherein the first vector is a non-viral vector.

4. The composition or combination according to any preceding claim, wherein the first vector is an adeno associated virus (AAV).

5. The composition or combination according to any preceding claim, wherein the first vector is a nanoparticle, and optionally the first vector is a lipid nanoparticle.

6. The composition or combination according to any preceding claim, wherein the second vector is a modified lentivirus.

7. The composition or combination according to any preceding claim, wherein the second vector comprises an HIV-based lentivirus backbone and / or a non-integrating lentiviral backbone and / or an Equine Infectious Anaemia Virus (EIAV) backbone and / or an equine lentivirus.

8. The composition or combination according to any of claims 1 to 6, wherein the second vector comprises an avian lentivirus backbone and / or an avian lentivirus.

9. The composition or combination according to any preceding claim, wherein the lentivirus is pseudotyped and requires only the non-native receptor exhibited on the target cell for cell entry.

10. The composition or combination according to any preceding claim, wherein the nonnative receptor sequence encodes a lentiviral target, or optionally the non-native receptor sequence encodes an equine and / or avian lentivirus target.

11. The composition or combination according to any preceding claim, wherein the non- native receptor sequence encodes equine lentivirus receptor-1 (ELR1) or transmembrane receptor of virus type A (TVA).

12. The composition or combination according to any of claims 1 to 11, wherein the second vector is pseudotyped with a cell surface protein, optionally an equine or avian cell surface protein.

13. The composition or combination according to any preceding claim, wherein the equine cell surface protein is Infectious Anaemia Virus (EIAV) envelope glycoproteinand / or the avian cell surface protein is Avian Sarcoma Leukosis Virus (ASLV) envelope glycoprotein.

14. The composition or combination according to any preceding claim, wherein the target cell is one or more cells selected from the following: photoreceptor cell, a cell affected by Retinitis Pigmentosa, a cell affected by Stargardt disease, a cell affected by Usher syndrome, a cell affected by Cystic Fibrosis, a cell affected by Duchenne muscular dystrophy, a cell affected by Leber Congenital Amaurosis (LCA).

15. The composition or combination according to any preceding claim, wherein the gene sequence of interest is greater than about 4.5 kb,16. The composition or combination according to any preceding claims wherein the gene sequence of interest is greater than about 9 kb, and optionally, the gene sequence is up to about 12 kb.

17. The composition or combination according to any preceding claim, wherein the gene of interest encodes a polypeptide implicated in an ocular disease, disorder and / or syndrome,18. The composition or combination according to any preceding claim wherein the gene of interest is one or more selected from the following: ATP Binding Cassette Subfamily A Member 4 (ABCA4) (SEQ ID No. 12), Myosin VIIA (MY07A), Usherin (USH2A), Centrosomal Protein of 290kDA (CEP290), and / or I ntraflagellar Transport 140 homolog (IFT140).

19. The composition or combination according to any preceding claim, wherein the second vector comprises an integrating equine or avian lentivirus backbone and / or an integrating lentivirus or a non-integrating equine or avian lentivirus backbone and / or non-integrating lentivirus.

20. The composition of combination according to any preceding claim, wherein the nonnative receptor sequence of the first vector is under the control of a promoter and / or the gene sequence of interest of the second vector is under the control of a promoter.

21. The composition or combination according to claim 20, wherein the promoter that controls the non-native receptor sequence is a cell-specific promoter of the target cell.

22. A method for introducing a gene sequence of interest in a target cell, the method comprising applying the composition or combination according to any of claims 1 to 21 to the target cell.

23. The method according to claim 22 wherein the method comprises the steps of: exposing the target cell to a first vector comprising a non-native receptor sequence of the target cell wherein the first vector is capable of introducing and / or expressing the non-native receptor sequence in the target cell, resulting in the exhibition of the non-native receptor on the target cell surface; and exposing the target cell to a second vector comprising the gene sequence of interest wherein the second vector uses the non-native receptor for cell entry and enables the expression of the gene of interest in the target cell.

24. The method according to any of claims 22 to 23, wherein the steps are carried out simultaneously and / or sequentially.

25. The method according to any of claims 22 to 24, wherein the method is carried out in vitro and / or ex vivo and / or in vivo.

26. The method according to any of claims 22 to 25, wherein the method is a method of treating a genetic condition,27. The method according to claim 26, wherein the genetic condition is an ocular condition.

28. The method according to any of claims 26 to 27, wherein the genetic condition is one or more selected from: Stargardt disease, Usher syndrome, cystic fibrosis, Duchenne, muscular dystrophy, and Leber Congenital Amaurosis (LCA).

29. The method according to any of claims 22 to 28, wherein the target cell is contained within an organoid or 3D culture of cells.

30. The composition or combination according to any of claims 1 to 21 for use as a medicament,31. The composition or combination according to any of claims 1 to 21 , wherein the composition is for use in the treatment of a genetic condition and / or ocular condition.

32. The composition or combination according to claim 32, wherein the genetic condition is one caused by a dysfunctional cell membrane transporter protein.

33. The composition or combination according to any of claims 31 to 32, wherein the genetic and / or ocular condition is one or more selected from: Stargardt disease, Usher syndrome, cystic fibrosis, and Duchenne, muscular dystrophy, Leber Congenital Amaurosis (LCA), Aged Macular Degeneration (AMD),34. The composition or combination according to any of claims 31 to 33, wherein the genetic condition is associated with dysfunctional ABCA4.

35. A kit of parts for the expression of a gene sequence of interest in a target cell, wherein the kit comprises the composition or combination according to any of claims 1 to 21 , and optionally instructions for use.

36. The kit of parts according to claim 35, wherein the first vector is in a separate part to the second vector or the first vector is in the same part as the second vector.

37. A method of treatment comprising administering the composition or combination according to any of claims 1 to 21, or the kit according to any of claims 35 to 36 to a patient in need thereof.

38. A composition or combination according to any of claims 1 to 21, and / or a kit according to any of claims 35 to 36 for use in a method or treatment.

Images