Microbiome-derived extracellular vesicles and use thereof

Abstract

The present application relates to microbiome-derived extracellular vesicles and a use thereof. The microbiome-derived extracellular vesicles of the present application can be effectively used for skin condition improvement, anti-inflammatory activity and / or for the prevention, treatment or alleviation of inflammatory diseases.

Description

Microbiome-derived extracellular vesicles and their uses

[0001] Cross-citation with related application(s)

[0002] This application claims the benefit of priority to Republic of Korea Patent Application No. 10-2024-0120326, dated September 4, 2024, and Republic of Korea Patent Application No. 10-2024-0124873, dated September 12, 2024, the entire contents of which are incorporated herein by reference.

[0003] Numerous papers and patents are referenced and cited throughout this application. The disclosures of these cited papers and patents are incorporated into this application in their entirety by reference, providing a clearer understanding of the state of the art and the scope of the present invention.

[0004] The present application relates to microbiome-derived extracellular vesicles and uses thereof.

[0005] Extracellular vesicles (EVs) are lipid bilayer-enclosed vesicles secreted by cells and range in size from approximately 20 nm to 1,000 nm. EVs contain diverse biologically active substances, including membrane proteins, lipids, nucleic acids such as mRNA, miRNA, and DNA, and other metabolites. They also contain various effective factors such as cytokines, hormones, and neurotransmitters. EVs are released from cells in response to specific stimuli or environmental changes, and are known to play a crucial role in biological systems, including intercellular signaling, tissue regeneration, and physiological regulation.

[0006] Recently, it has become known that extracellular vesicles possess a wide range of physiological functions, including immune regulation, signaling, and tissue regeneration. Research is currently underway to utilize these functions for diagnostic and therapeutic purposes. While previous research has primarily focused on extracellular vesicles derived from mammalian cells, recent research has also begun on extracellular vesicles derived from plants and microorganisms. Identifying microorganisms capable of producing extracellular vesicles with useful functionalities and isolating them from these microorganisms are critical technical challenges.

[0007] Ultracentrifugation is a commonly used technique for isolating and recovering extracellular vesicles from microorganisms on a laboratory scale. However, its limited processing capacity makes it unsuitable for mass production. Therefore, there is a pressing need for a technology capable of isolating large quantities of extracellular vesicles with useful physiological functions, with high purity and yield.

[0008] [Prior Art Literature]

[0009] [Patent Document]

[0010] (Patent Document 01) Republic of Korea Publication No. 10-2023-0079158

[0011] (Patent Document 02) Republic of Korea Patent No. 10-2579898

[0012] (Patent Document 03) Republic of Korea Publication Patent No. 10-2024-0008911

[0013] Against this backdrop, the present inventors have discovered that a composition comprising extracellular vesicles derived from one or more microorganisms selected from the group consisting of Lactiplantibacillus plantarum, Bifidobacterium breve, Enterococcus faecium, Latilactobacillus sakei, and Staphylococcus epidermidis has a skin condition improvement effect and an anti-inflammatory effect, and have discovered that when the microorganisms are separated using tangential flow filtration, a large amount of highly pure extracellular vesicles can be separated while having a skin condition improvement effect and an anti-inflammatory effect at the same level as when the microorganisms are separated using ultracentrifugation, thereby completing the present invention.

[0014] Accordingly, the purpose of the present application is to provide a composition for improving skin condition, an anti-inflammatory composition, a cosmetic and / or a food comprising the composition, the composition comprising extracellular vesicles derived from one or more microorganisms selected from the group consisting of Lactiplantibacillus plantarum, Bifidobacterium breve, Enterococcus faecium, Latilactobacillus sakei and Staphylococcus epidermidis.

[0015] Another object of the present application is to provide a method for producing extracellular vesicles derived from microorganisms, comprising the steps of (a) centrifuging a microbial culture to obtain a centrifugation supernatant containing extracellular vesicles; (b) filtering the centrifugation supernatant to remove bacterial cells; and (c) isolating extracellular vesicles from the centrifugation supernatant from which the bacterial cells have been removed, wherein the microorganisms are at least one microorganism selected from the group consisting of Lactiplantibacillus plantarum, Bifidobacterium breve, Enterococcus faecium, Latilactobacillus sakei (L. sakei), and Staphylococcus epidermidis.

[0016]

[0017] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly explain the level of the technical field to which the present invention pertains and the contents of the present invention.

[0018]

[0019] An example of the present application relates to a composition for improving skin condition and / or an anti-inflammatory composition comprising an extracellular vesicle derived from a microorganism and having an inhibitory ability to inhibit collagen decomposition.

[0020] Another example of the present application relates to a cosmetic comprising the composition.

[0021] Another example of the present application relates to a pharmaceutical composition for preventing or treating inflammatory diseases, comprising an extracellular vesicle derived from a microorganism and having an inhibitory ability to inhibit collagen degradation.

[0022] Another example of the present application relates to a food comprising extracellular vesicles derived from microorganisms and having collagen degradation inhibitory properties.

[0023] Another example of the present application relates to a method for producing extracellular vesicles derived from a microorganism, comprising the steps of: (a) centrifuging a microbial culture to obtain a centrifugation supernatant containing extracellular vesicles; (b) filtering the centrifugation supernatant to remove bacterial cells; and (c) isolating extracellular vesicles from the centrifugation supernatant from which the bacterial cells have been removed, wherein the microorganism is at least one microorganism selected from the group consisting of Lactiplantibacillus plantarum, Bifidobacterium breve, Enterococcus faecium, Latilactobacillus sakei (L. sakei), and Staphylococcus epidermidis.

[0024] Another example of the present application relates to the use of extracellular vesicles derived from microorganisms and having collagen decomposition inhibitory properties and / or compositions containing the same for improving skin condition and / or for anti-inflammatory purposes.

[0025] Another example of the present application relates to a method for improving skin condition, comprising administering to a subject an extracellular vesicle having a collagen degradation inhibitory ability derived from a microorganism and / or a composition containing the same.

[0026] Another example of the present application relates to the use of an extracellular vesicle derived from a microorganism and having an inhibitory ability on collagen degradation for use in the preparation of a composition for the prevention or treatment of an inflammatory disease.

[0027] Another example of the present application relates to a method for treating an inflammatory disease, comprising administering to a subject an extracellular vesicle having a collagen degradation inhibitory ability derived from a microorganism and / or a composition comprising the same.

[0028]

[0029] Hereinafter, the present application will be described in more detail.

[0030] One example of the present application provides a composition for improving skin condition, comprising an extracellular vesicle derived from a microorganism and having an ability to inhibit collagen decomposition.

[0031] In one embodiment, the improvement in skin condition may be at least one selected from the group consisting of improvement in skin wrinkles, improvement in skin elasticity, inhibition of skin aging, anti-inflammation, skin soothing, relief of skin irritation, skin moisturizing, and improvement in skin barrier.

[0032] In this application, 'improvement of skin wrinkles' means suppressing or inhibiting the formation of wrinkles on the skin or alleviating wrinkles that have already formed.

[0033] In this application, ‘improving skin elasticity’ means maintaining or increasing the elasticity of the skin to prevent sagging.

[0034] In this application, "skin aging" refers to symptoms such as decreased skin elasticity, loss of shine, wrinkle formation, weakened regenerative power, or severe dryness, and includes both intrinsic aging and extrinsic aging caused by the passage of time or the external environment. "Skin aging inhibition (skin anti-aging)" refers to delaying or alleviating changes associated with skin aging, such as cell damage, wrinkles, decreased elasticity, and pigmentation.

[0035] In this application, 'anti-inflammation' means suppressing inflammation, which includes reducing or suppressing inflammatory reactions in skin tissues to alleviate symptoms such as redness, swelling, and pain. The composition for improving skin may have the effect of preventing, improving, and / or treating diseases related to skin inflammation. The skin inflammation refers to inflammation that occurs on the skin, and may include eczema, which appears wet, among skin diseases. Skin inflammation can be divided into acute, subacute, and chronic, and acute and subacute may appear as erythema (red spots) and / or papules (protruding bumps the size of millet or rice grains) and then vesicles (small blisters), while chronic inflammation may appear as dry. The above skin inflammation-related disease may be at least one selected from the group consisting of acne, atopic dermatitis, seborrheic dermatitis, xerotic dermatitis, contact dermatitis, nummular dermatitis, allergic dermatitis, psoriasis, erythematous diseases triggered by radiation, chemicals, burns, acid burns, ultraviolet ray burns, bullous dermatoses, lichen, allergic pruritus, acne rosacea, pemphigus vulgaris, erythema multiforme exudative, erythema nodosum, balanitis, vulvitis, inflammatory hair loss such as alopecia areata, and cutaneous T-cell lymphoma, but is not limited thereto.

[0036] In this application, 'skin soothing' means stabilizing the skin condition that has become sensitive due to external stimuli, stress, inflammatory reactions, allergic reactions, etc., and alleviating discomfort or irritation.

[0037] In this application, 'alleviating skin irritation' means reducing or preventing symptoms such as stinging, itching, and redness of the skin caused by environmental factors such as physical or chemical irritation or inflammatory reactions.

[0038] In this application, 'improving skin barrier' means increasing or maintaining skin moisture content to prevent dryness and normalizing or strengthening the function of the skin barrier that protects the skin from external harmful factors (bacteria, pollutants, irritants).

[0039] In one embodiment, the composition for improving skin condition of the present application described above may have one or more properties selected from the group consisting of the following (1) to (4):

[0040] (1) Inhibition of expression of matrix metallopeptidase-1 (MMP-1);

[0041] (2) Inhibition of expression of inflammatory cytokines;

[0042] (3) Promotion of expression of hyaluronan synthase 3; and

[0043] (4) Promotion of filaggrin expression.

[0044] In a specific embodiment, the inflammatory cytokine is iNOS (inducible nitric oxide synthase; involved in B-cell immunity, which is humoral immunity), COX2 (cyclooxygenase-2; early anti-inflammation and cancer cell death, etc.), TNF-α (Tumor Necrosis Factor-alpha; cellular immune regulation, cell infection clearance, etc.), IFN-γ (Interferon; involved in innate and adaptive immune responses), RANKL (Receptor Activator of NF-KB Ligand; essential factor for lymph nodes, which are secondary immune organs), IL-1β (Interleukin-1; early anti-inflammatory function in infection), IL-6 (Interleukin-1; secreted from T lymphocytes and macrophages to alleviate inflammation), DKK-1 (Dikkopf-1; involved in T-cell immune cell regulation), IL-1a (Interleukin-1; early anti-inflammatory function in infection), IL-2 (Interleukin-2; early anti-inflammatory function in infection), It may be at least one selected from the group consisting of IL-3 (Interleukin-3; anti-inflammatory function in the early stage of infection), IL-4 (Interleukin-4; anti-inflammatory function in the early stage of infection), IFN-α (Interferon-α; involved in innate and adaptive immune responses), IFN-β (Interferon-β; involved in innate and adaptive immune responses), TNF-β (Tumor Necrosis Factor-β; anti-inflammatory function in the late stage of infection, cellular immune regulation, cell infection removal, etc.) and IL-10 (Interleukin-10; anti-inflammatory function in the late stage of infection), and more specifically, it may be TNF-α, but is not limited thereto.

[0045] Matrix metallopeptidase (MMP) is an enzyme that primarily breaks down the extracellular matrix of the dermis, including collagen and elastin. It plays a crucial role in reducing skin elasticity and the formation of wrinkles. Increased MMP expression or activity promotes skin aging, deepening wrinkles, and loss of elasticity. Therefore, the degree of MMP inhibition is widely used as an indicator of wrinkle improvement, skin elasticity improvement, and skin aging prevention. Furthermore, MMP inhibition is closely related to overall skin health improvements, including anti-inflammation, skin soothing, skin irritation relief, skin hydration, and skin barrier enhancement.

[0046] Hyaluronan synthase 3 (HAS3) is an enzyme that synthesizes hyaluronic acid in the dermis and epidermis. Hyaluronic acid has an excellent water-retaining capacity and plays a key role in maintaining skin hydration and elasticity. Increased HAS3 expression increases skin moisture content and strengthens the epidermal barrier function, protecting the skin from external irritants. Therefore, assessing HAS3 expression or activity can be used as an important indicator of skin barrier strengthening, skin hydration, improved skin elasticity, and overall skin condition.

[0047] Filaggrin (FLG), a major structural protein in keratinocytes, plays a crucial role in skin barrier formation and moisture retention. FLG enhances the mechanical strength of the stratum corneum by cohesively binding keratin fibers within keratinocytes. The amino acids produced during its decomposition process serve as precursors of natural moisturizing factors (NMF), contributing to skin moisture retention. Therefore, increased FLG expression can be used as an indicator of skin barrier strengthening, improved skin hydration, and relief of dryness and irritation.

[0048] As demonstrated in the examples described below, the composition for improving skin condition of the present application includes extracellular vesicles derived from microorganisms and having collagen decomposition inhibitory properties, thereby having the effect of inhibiting the expression of matrix metallopeptidase-1 (MMP-1), a collagen decomposition enzyme, inhibiting the expression of inflammatory cytokines (e.g., tumor necrosis factor-α, TNF-α), promoting the expression of hyaluronan synthase 3 (HAS3), which is an indicator of skin barrier strengthening, and / or promoting the expression of filaggrin (FLG), which is a keratinocyte structural protein, and thus can be usefully used for improving skin condition (e.g., at least one selected from the group consisting of improving skin wrinkles, improving skin elasticity, inhibiting skin aging, anti-inflammation, soothing skin, relieving skin irritation, moisturizing skin, and improving skin barrier).

[0049] In one embodiment, the microorganism may be one or more selected from the group consisting of, but is not limited to, Lactiplantibacillus plantarum, Bifidobacterium breve, Enterococcus faecium, Latilactobacillus sakei, and Staphylococcus epidermidis.

[0050] In one embodiment, the Lactibacillus plantarum may be the Lactibacillus plantarum KBL20066 strain having the accession number KCTC 15615BP. The Lactibacillus plantarum KBL20066 strain having the accession number KCTC 15615BP may have a 16S rRNA sequence of SEQ ID NO: 1.

[0051] In one embodiment, the Bifidobacterium breve may be a Bifidobacterium breve KBL3168 strain having accession number KCTC 16006BP. The Bifidobacterium breve KBL3168 strain having accession number KCTC 16006BP may have a 16S rRNA sequence of SEQ ID NO: 2.

[0052] In one embodiment, the Enterococcus faecium may be the Enterococcus faecium KBL1538 strain having the accession number KCTC 16002BP. The Enterococcus faecium KBL1538 strain having the accession number KCTC 16002BP may have a 16S rRNA sequence of SEQ ID NO: 3.

[0053] In one embodiment, the Raty Lactobacillus sakei may be the Raty Lactobacillus sakei KBL4353 strain having accession number KCTC 16051BP. The Raty Lactobacillus sakei KBL4353 strain may have a 16S rRNA sequence of sequence number 4.

[0054] In one embodiment, the Staphylococcus epidermis may be a Staphylococcus epidermis KBL4354 strain having accession number KCTC 16052BP. The Staphylococcus epidermis KBL4354 strain having accession number KCTC 16052BP may have a 16S rRNA sequence of SEQ ID NO: 5.

[0055] In one embodiment, the extracellular vesicles may be separated from the microorganism using a method selected from the group consisting of centrifugation, ultracentrifugation, aqueous two-phase system phase separation, differential centrifugation, equilibrium density centrifugation, density gradient, ultrafiltration, microfiltration, tangential flow filtration, dialysis, and free-flow electrophoresis, but is not limited thereto.

[0056] In one embodiment, the extracellular vesicles may have a diameter of, but is not limited to, 30 nm to 200 nm. More specifically, the extracellular vesicles may have a diameter of, but is not limited to, 30 nm to 200 nm, 30 nm to 180 nm, 30 nm to 160 nm, 30 nm to 150 nm, 50 nm to 200 nm, 50 nm to 180 nm, 50 nm to 160 nm, 50 nm to 150 nm, 70 nm to 200 nm, 70 nm to 180 nm, 70 nm to 160 nm, 70 nm to 150 nm, 80 nm to 200 nm, 80 nm to 180 nm, 80 nm to 160 nm, 80 nm to 150 nm, 90 nm to 200 nm, 90 nm to 180 nm, 90 nm to 160 nm, or 90 nm to 150 nm.

[0057] In one embodiment, the composition may be a cosmetic composition.

[0058] In one embodiment, the cosmetic composition may further comprise, in addition to the extracellular vesicles derived from the microorganism, cosmetic additives commonly used in the manufacture of cosmetics, such as conventional adjuvants, carriers, and antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances.

[0059] The "cosmetic composition" and / or "cosmetic" provided in the present application may be in any formulation form commonly manufactured in the art, and may be formulated as, for example, capsules, solutions, emulsions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansers, oils, powder foundations, emulsion foundations, wax foundations, packs, massage creams, and sprays, but is not limited thereto. Specifically, the formulation may be at least one selected from the group consisting of, but is not limited to, a toner (e.g., a flexible toner, a nourishing toner, etc.), an emulsion, a lotion (e.g., a body lotion, etc.), an essence, a cream (e.g., a gel cream, a massage cream, a body cream, a sunscreen, an eye cream, a cleansing cream, etc.), a gel, a pack, an oil, a makeup base, a foundation (e.g., a powder foundation, an emulsion foundation, a wax foundation, etc.), a lipstick, a patch, a spray, a cleanser, a mouthwash, a skin improver, a cleansing foam, a cleansing water, and / or a powder.

[0060] When the above cosmetic composition is in the form of a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier.

[0061] When the above cosmetic composition is a solution or emulsion formulation, a solvent, solubilizer or emulsifier may be used as a carrier, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

[0062] When the above cosmetic composition is a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. can be used as a carrier.

[0063] When the above cosmetic composition is in the form of a powder or spray formulation, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier, and particularly in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane / butane or dimethyl ether may be additionally included.

[0064] When the above cosmetic composition is a cleansing formulation containing a surfactant, a fatty alcohol sulfate, a fatty alcohol ether sulfate, a sulfosuccinic acid monoester, an isethionate, an imidazolinium derivative, a methyl taurate, a sarcosinate, a fatty acid amide ether sulfate, an alkyl amidobetaine, a fatty alcohol, a fatty acid glyceride, a fatty acid diethanolamide, a vegetable oil, a lanolin derivative, or an ethoxylated glycerol fatty acid ester may be used as a carrier component.

[0065] In one embodiment, the cosmetic composition is a soap or a cleansing formulation containing or not containing a surfactant, and can be applied to the skin and then wiped off, removed, or washed off with water. Specifically, the soap may be a liquid soap, a powder soap, a solid soap, or an oil soap, and the cleansing formulation containing a surfactant may be a cleansing foam, cleansing water, a cleansing towel, or a cleansing pack, and the cleansing formulation not containing a surfactant may be a cleansing cream, cleansing lotion, cleansing water, or cleansing gel, but is not limited thereto.

[0066] In addition, the cosmetic composition of the present application may be provided in the form of a skin injection (e.g., a subcutaneous injection, an intradermal injection, a filler injection for cosmetic purposes) or a form included in a microneedle (e.g., coded or inserted), and may be provided in the form applied to the skin after using a skin stimulation device such as a microneedle therapy system (MTS) (e.g., in the form of an ointment, cream, lotion, gel, emulsion, spray, etc.), but is not limited thereto.

[0067] The above cosmetic composition and / or cosmetic may further comprise, in addition to the extracellular vesicles derived from the microorganism of the present application described above and / or the composition containing the same, a carrier, excipient, and / or additive acceptable for cosmetics.

[0068] The above cosmetic or cosmetic composition may be used alone or in combination with other cosmetic compositions. Furthermore, the cosmetic composition of the present invention may be used according to conventional usage methods, but the frequency of use may vary depending on the user's skin condition or preference.

[0069] Another example of the present application provides a cosmetic comprising the composition described above.

[0070] Another example of the present application provides an anti-inflammatory composition comprising an extracellular vesicle derived from a microorganism and having an inhibitory ability to inhibit collagen degradation.

[0071] In this application, "anti-inflammation," "anti-inflammatory," or "improvement (alleviation) of inflammation" refers to the suppression of inflammation. Inflammation is a defense response of living tissues against stimuli, and refers to a complex lesion that causes three things: tissue degeneration, circulatory disturbance and exudation, and tissue proliferation. More specifically, inflammation is a part of innate immunity, and the inflammatory response is a non-specific defense mechanism that creates a hostile environment for microorganisms that can invade damaged tissue or wound sites. In the inflammatory response, white blood cells responsible for the initial immune response rush in and express cytokines. Therefore, the expression level of intracellular inflammatory cytokines serves as an indicator of inflammatory response activation.

[0072] In one embodiment, the anti-inflammatory composition of the present application described above may inhibit the expression of inflammatory cytokines (e.g., TNF-α).

[0073] Microorganisms, extracellular vesicles derived from microorganisms, inflammatory cytokines, and microorganisms have been described above.

[0074] In one embodiment, the anti-inflammatory composition of the present application described above may be a cosmetic composition, and another example of the present application provides a cosmetic comprising the anti-inflammatory composition of the present application described above.

[0075] The cosmetic composition and cosmetics are as described above.

[0076] As demonstrated in the examples described below, the inflammatory cytokine TNF-α

[0077] Accordingly, another example of the present application provides a pharmaceutical composition for preventing or treating an inflammatory disease, comprising an extracellular vesicle derived from a microorganism and having an ability to inhibit collagen degradation.

[0078] In the present application, the inflammatory disease is not limited to the above-described skin inflammation-related diseases, and may be one or more selected from the group consisting of, for example, allergies, dermatitis, atopy, conjunctivitis, periodontitis, rhinitis, otitis media, pharyngitis, tonsillitis, pneumonia, gastric ulcer, gastritis, Crohn's disease, colitis, gout, ankylosing spondylitis, rheumatic fever, lupus, fibromyalgia, psoriatic arthritis, osteoarthritis, rheumatoid arthritis, periarthritis of the shoulder joint, tendinitis, tenosynovitis, peritendinitis, myositis, hepatitis, cystitis, nephritis, Sjogren's syndrome, multiple sclerosis, and acute and chronic inflammatory diseases, but is not limited thereto.

[0079] The term "prevention" in this application refers to the suppression or delay of the onset of a disease, disorder, or condition. Prevention may be considered complete if the onset of the disease, disorder, or condition is suppressed or delayed for a predetermined period of time.

[0080] The term 'treatment' in this application means partially or completely alleviating, improving, palliating, inhibiting or delaying the symptoms of a specific disease, disorder and / or condition or condition, reducing the severity or reducing the occurrence of one or more symptoms or characteristics.

[0081] In one embodiment, the anti-inflammatory composition of the present application described above may inhibit the expression of inflammatory cytokines (e.g., TNF-α).

[0082] Microorganisms, extracellular vesicles derived from microorganisms, inflammatory cytokines, and microorganisms have been described above.

[0083] The pharmaceutical composition of the present application may additionally contain one or more active ingredients exhibiting the same or similar function in addition to the extracellular vesicles derived from the microorganism of the present application described above.

[0084] The pharmaceutical composition of the present invention may additionally contain a pharmaceutically acceptable carrier in addition to the extracellular vesicles derived from the microorganism of the present invention, which are the active ingredients of the present invention. The pharmaceutically acceptable carrier contained in the pharmaceutical composition of the present invention is one commonly used in formulation, and includes, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above components, the pharmaceutical composition of the present invention may additionally contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.

[0085] The pharmaceutical composition of the present invention can be administered orally or parenterally, and is preferably administered orally, topically, as a skin injection (e.g., subcutaneous injection, intradermal injection, filler injection for cosmetic purposes), or contained in a microneedle (e.g., encoded or inserted). The pharmaceutical composition of the present invention can be formulated into various oral or parenteral administration forms, but is not limited thereto.

[0086] Oral dosage forms include, for example, tablets, pills, hard / soft capsules, liquids, suspensions, emulsifiers, syrups, granules, elixirs, etc., and these dosage forms may use, in addition to the above-mentioned active ingredients, one or more diluents or excipients such as fillers, bulking agents, wetting agents, disintegrants, lubricants, binders, and surfactants that are commonly used. Disintegrants that can be used include agar, starch, alginic acid or its sodium salt, calcium hydrogen phosphate anhydride, etc., and lubricants that can be used include silica, talc, stearic acid or its magnesium or calcium salt, polyethylene glycol, etc., and binders that can be used include magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidine, low-substituted hydroxypropyl cellulose, etc. In addition, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, etc. can be used as diluents, and in some cases, commonly known boiling mixtures, absorbents, colorants, flavoring agents, sweeteners, etc. can be used together.

[0087] Among parenteral dosage forms, topical administration formulations include formulations that can be directly applied to the skin, such as ointments, creams, lotions, gels, pastes, suppositories, transdermal patches, sprays, emulsions, microneedles, etc. In addition, these formulations may further include moisturizers, anti-inflammatory agents, antibacterial agents, or excipients, as needed. The excipients may be at least one selected from the group consisting of solvents (e.g., purified water, glycerin, propylene glycol), viscosity modifiers (e.g., carbomer, hydroxyethylcellulose), emulsifiers (e.g., polysorbate, stearyl alcohol), preservatives (e.g., paraben, phenoxyethanol), flavoring agents, and coloring agents.

[0088] In addition, it may be provided in the form of a skin injection (e.g., subcutaneous injection, intradermal injection, filler injection for cosmetic purposes) or a form included in a microneedle (e.g., coded or inserted), and may be provided in the form applied to the skin after using a skin stimulation device such as a microneedle therapy system (MTS) (e.g., in the form of an ointment, cream, lotion, gel, emulsion, spray, etc.), but is not limited thereto.

[0089] The pharmaceutical composition of the present application may be sterilized or contain preservatives, stabilizers, wetting agents or emulsifying agents, salts for osmotic pressure control, buffers, and other therapeutically useful substances, and may be formulated according to conventional mixing, granulation, or coating methods.

[0090] The appropriate dosage of the pharmaceutical composition of the present application may vary depending on factors such as the formulation method, administration method, patient age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity. The typical dosage of the pharmaceutical composition of the present application is within the range of 0.001-1000 mg / kg for adults. For example, the composition according to the present application may be administered in an amount of 0.001 to 10,000 mg, 0.001 to 5,000 mg, 0.001 to 1,000 mg, 0.001 to 500 mg, 0.001 to 300 mg, 0.001 to 100 mg, 0.001 to 50 mg, 0.001 to 30 mg, 0.001 to 10 mg, 0.001 to 5 mg, 0.001 to 1 mg, 0.001 to 0.5 mg, 0.001 to 0.1 mg, 0.001 to 0.05 mg, 0.001 to 0.01 mg, 0.01 to 10,000 mg, 0.01 to 5,000 mg, per kg of body weight. 0.01 to 1,000 mg, 0.01 to 500 mg, 0.01 to 300 mg, 0.01 to 100 mg, 0.01 to 50 mg, 0.01 to 30 mg, 0.01 to 10 mg, 0.01 to 5 mg, 0.01 to 1 mg, 0.01 to 0.5 mg, 0.01 to 0.1 mg, 0.01 to 0.05 mg, 0.1 to 10,000 mg, 0.1 to 5,000 mg, 0.1 to 1,000 mg, 0.1 to 500 mg, 0.1 to 300 mg, 0.1 to 200 mg, 0.1 to 100 mg, 0.1 to 50 mg, 0.1 to 30 mg, 0.1 to 10 mg, 0.1 to 5 mg, 0.1 to 1 mg, 0.1 to 0.5 mg, 1 to 10,000 mg, 1 to 5,000 mg, 1 to 1,000 mg, 1 to 500 mg, 1 to 300 mg, 1 to 200 mg, 1 to 100 mg, 1 to 50 mg, 1 to 10 mg, 1 to 5 mg, 10 to 10,000 mg, 10 to 5,000 mg, 10 to 1,000 mg, 10 to 500 mg, 10 to 300 mg, 10 to 200 mg, 10 to 100 mg, 10 to 50 mg, 10 to 40 mg, 10 to 30 mg, 10 to 20 mg, 100 to 10,000 mg, 100 to 5,000 mg, 100 It can be administered in a daily dosage of, but is not limited to, 1,000 mg, 100 to 500 mg, 100 to 300 mg, or 100 to 200 mg. In addition, the human dosage can be converted based on animal experiments.

[0091] The pharmaceutical composition of the present invention can be manufactured in a unit dosage form or can be manufactured by inserting it into a multi-dose container by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily performed by a person having ordinary skill in the art to which the present invention pertains, and the like. In this case, the formulation may be in the form of a solution, suspension, syrup or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersing agent or stabilizer.

[0092] Another example of the present application provides a food comprising an extracellular vesicle derived from a microorganism and having an inhibitory ability to inhibit collagen degradation.

[0093] In one embodiment, the food described above may be for improving skin condition, preventing or improving inflammation and / or inflammatory diseases.

[0094] In one embodiment, the food described above may be a food for improving skin condition.

[0095] In one embodiment, the food described above may be an anti-inflammatory food.

[0096] In one embodiment, the food described above may be a food for preventing or improving an inflammatory disease.

[0097] As previously explained, the contents regarding microorganisms, extracellular vesicles derived from microorganisms, improvement of skin condition, anti-inflammation, inflammatory diseases, etc. are as follows.

[0098] As used herein, the term “improvement” means any act of reducing the severity of an inflammatory disease or symptoms of a disease by administering an extracellular vesicle derived from a microorganism of the present application, a composition comprising the same, and / or a food comprising the same.

[0099] In one embodiment, the food may be a health functional food, and the health functional food may be a health functional food for improving skin condition, anti-inflammation, or preventing or improving inflammatory diseases.

[0100] In one embodiment, the food may be in the form of, but is not limited to, meat, bread, chocolate, candy, jelly, snacks, confectionery, kimchi, soy sauce, cheese, dairy products, powders, beverages, vitamin complexes, water-soluble films, or food additives.

[0101] The food of the present application may additionally contain one or more active ingredients exhibiting the same or similar function in addition to the extracellular vesicles derived from the microorganism of the present application.

[0102] The food of the present application may contain not only extracellular vesicles derived from the microorganism of the present application as an effective ingredient, but also ingredients commonly added during food manufacturing. The added ingredients include, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. The carbohydrates include monosaccharides (e.g., glucose, fructose, etc.), disaccharides (e.g., maltose, sucrose, oligosaccharides, etc.), and polysaccharides (e.g., conventional sugars such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, erythritol, etc.). The flavoring agents may include natural flavoring agents (thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.).

[0103] For example, when the food of the present application is manufactured into a drink, in addition to the extracellular vesicles derived from the microorganism of the present application, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, jujube extract, or licorice extract, etc. may be additionally included.

[0104] The food of the present application includes processed forms of all natural ingredients, such as foods, functional foods, nutritional supplements, health foods, and food additives. These types of foods can be manufactured in various forms using conventional methods known in the art. For example, as a health food, the extracellular vesicles derived from the aforementioned microorganisms can be manufactured into tea, juice, and drinks for consumption, or granulated, encapsulated, or powdered for consumption. In addition, as food, beverages (including alcoholic beverages), fruits and processed foods thereof (e.g., canned fruits, bottled fruits, jams, marmalades, etc.), fish, meats and processed foods thereof (e.g., ham, sausages, corned beef, etc.), breads and noodles (e.g., udon, buckwheat noodles, ramen, spaghetti, macaroni, etc.), fruit juices, various drinks, cookies, taffy, dairy products (e.g., yogurt, fermented milk, butter, cheese, etc.), edible vegetable oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (e.g., soybean paste, soy sauce, sauces, etc.) can be produced by adding extracellular vesicles derived from the microorganism of the present application. In addition, in order to use the extracellular vesicles derived from the microorganism of the present application in the form of a food additive, they can be produced in the form of a powder or a concentrate and used.

[0105] The preferred dosage of the food of the present application may vary depending on the patient's condition and weight, age, sex, health status, dietary constitution, nature of the preparation, degree of disease, administration time of the composition, administration method, administration period or interval, excretion rate, and drug form, and may be appropriately selected by a person skilled in the art.

[0106] Another example of this application is,

[0107] (a) A step of centrifuging a microbial culture solution to obtain a centrifugation supernatant containing extracellular vesicles;

[0108] (b) a step of filtering the centrifuged supernatant to remove the bacterial cells; and

[0109] (c) A method for producing extracellular vesicles derived from a microorganism having collagen decomposition inhibitory activity is provided, comprising a step of isolating extracellular vesicles from a centrifugation supernatant from which the above-mentioned cells have been removed.

[0110] In one embodiment, the method for producing a microbial-derived extracellular vesicle of the present application described above may include a step of culturing a microorganism to prepare a culture medium prior to step (a).

[0111] In one embodiment, the microorganism may be one or more microorganisms selected from the group consisting of, but not limited to, Lactiplantibacillus plantarum, Bifidobacterium breve, Enterococcus faecium, Latilactobacillus sakei (L. sakei), and Staphylococcus epidermidis.

[0112] In one embodiment, the Lactibacillus plantarum may be the Lactibacillus plantarum KBL20066 strain having the accession number KCTC 15615BP. The Lactibacillus plantarum KBL20066 strain having the accession number KCTC 15615BP may have a 16S rRNA sequence of SEQ ID NO: 1.

[0113] In one embodiment, the Bifidobacterium breve may be a Bifidobacterium breve KBL3168 strain having accession number KCTC 16006BP. The Bifidobacterium breve KBL3168 strain having accession number KCTC 16006BP may have a 16S rRNA sequence of SEQ ID NO: 2.

[0114] In one embodiment, the Enterococcus faecium may be the Enterococcus faecium KBL1538 strain having the accession number KCTC 16002BP. The Enterococcus faecium KBL1538 strain having the accession number KCTC 16002BP may have a 16S rRNA sequence of SEQ ID NO: 3.

[0115] In one embodiment, the Raty Lactobacillus sakei may be the Raty Lactobacillus sakei KBL4353 strain having accession number KCTC 16051BP. The Raty Lactobacillus sakei KBL4353 strain may have a 16S rRNA sequence of sequence number 4.

[0116] In one embodiment, the Staphylococcus epidermis may be a Staphylococcus epidermis KBL4354 strain having accession number KCTC 16052BP. The Staphylococcus epidermis KBL4354 strain having accession number KCTC 16052BP may have a 16S rRNA sequence of SEQ ID NO: 5.

[0117] In one embodiment, the method for producing extracellular vesicles derived from microorganisms of the present application described above may be to isolate extracellular vesicles in step (c) using a method selected from the group consisting of centrifugation, ultracentrifugation, aqueous two-phase system phase separation, differential centrifugation, equilibrium density centrifugation, density gradient, ultrafiltration, microfiltration, tangential flow filtration, dialysis, and free-flow electrophoresis, and more specifically, to isolate extracellular vesicles using ultracentrifugation or tangential flow filtration, but is not limited thereto.

[0118] In one embodiment, the method for producing extracellular vesicles derived from microorganisms of the present application described above may be to filter in step (b) with a filter including pores having a diameter of 0.1 μm to 1 μm, and more specifically, pores having a diameter of 0.1 μm to 1 μm, 0.1 μm to 0.75 μm, 0.1 μm to 0.6 μm, 0.1 μm to 0.5 μm, 0.1 μm to 0.45 μm, 0.15 μm to 1 μm, 0.15 μm to 0.75 μm, 0.15 μm to 0.6 μm, 0.15 μm to 0.5 μm, 0.15 μm to 0.45 μm, 0.2 μm to 1 μm, 0.2 μm to 0.75 μm, 0.2 μm to 0.6 μm, It may be filtered with a filter having pores of 0.2 μm to 0.5 μm, or 0.2 μm to 0.45 μm, but is not limited thereto.

[0119] In one embodiment, the method for producing microbial-derived extracellular vesicles of the present application described above may perform filtration in step (b) using a method selected from the group consisting of ultrafiltration, microfiltration, and tangential flow filtration, but is not limited thereto.

[0120] In one embodiment, the method for producing extracellular vesicles derived from microorganisms of the present application described above may remove the cells using tangential flow filtration in step (b).

[0121] In a specific embodiment, the method for producing extracellular vesicles derived from microorganisms of the present application described above is performed at a shear rate of 8,000 s in step (b). -1 Below, more specifically 4,000 s -1 8,000 s -1It may be possible to perform tangential flow filtration by maintaining the shear rate at 4,000 s -1 8,000 s -1 , 4,000 s -1 7,000 s -1 , 4,000 s -1 6,000 s -1 , 4,000 s -1 Within 5,000 s -1 , 4,500 s -1 8,000 s -1 , 4,500 s -1 7,000 s -1 , 4,500 s -1 6,500 s -1 , 4,500 s -1 Within 5,000 s -1 , 5,000 s -1 8,000 s -1 , 5,000 s -1 7,000 s -1 , 5,000 s -1 6,000 s -1 , 6,000 s -1 8,000 s -1 , 6,000 s -1 7,000 s -1 , or 7,000 s -1 8,000 s -1 It may be performed by maintaining tangential flow filtration, but is not limited thereto.

[0122] In a specific embodiment, the method for producing extracellular vesicles derived from microorganisms of the present application described above may be to perform tangential flow filtration by maintaining the transmembrane pressure at 0.1 bar to 1 bar in step (b), and more specifically, the method may be to perform tangential flow filtration by maintaining the transmembrane pressure at 0.1 bar to 1 bar, 0.1 bar to 0.7 bar, 0.1 bar to 0.4 bar, 0.1 bar to 0.3 bar, 0.1 bar to 0.2 bar, 0.2 bar to 1 bar, 0.2 bar to 0.7 bar, 0.2 bar to 0.4 bar, 0.2 bar to 0.3 bar, 0.3 bar to 1 bar, 0.3 bar to 0.7 bar, or 0.3 bar to 0.4 bar, but is not limited thereto.

[0123] In one embodiment, the method for producing extracellular vesicles derived from a microorganism of the present application described above may be to separate extracellular vesicles by concentrating them using tangential flow filtration in step (c).

[0124] In a specific embodiment, the method for producing extracellular vesicles derived from microorganisms of the present application described above may be such that the molecular weight cut-off (MWCO) of the filter for tangential flow filtration in the step (c) is 100 kDa to 500 kDa, and more specifically, 100 kDa to 500 kDa, 100 kDa to 400 kDa, 100 kDa to 350 kDa, 100 kDa to 300 kDa, 200 kDa to 500 kDa, 200 kDa to 400 kDa, 200 kDa to 350 kDa, 200 kDa to 300 kDa, 250 kDa to 500 kDa, 250 kDa to 400 kDa, 250 kDa to It may be, but is not limited to, 350 kDa, or 250 kDa to 300 kDa.

[0125] In a specific embodiment, the method for producing extracellular vesicles derived from microorganisms of the present application described above is performed in step (c) at a shear rate of 4,000 s -1 Below, more specifically 1,000 s -1 Within 4,000 s -1 It may be possible to perform tangential flow filtration by maintaining the shear rate at 1,000 s -1 Within 4,000 s -1 , 1,000 s -1 3,500 s -1 , 1,000 s -1 Within 3,000 s -1 , 1,000 s -1 Within 2,500 s -1 , 1,000 s -1 Within 2,000 s -1 , 1,000 s -1 Within 1,500 s -1 , 1,500 s -1 Within 4,000 s -1 , 1,500 s -1 3,500 s -1 , 1,500 s -1 Within 3,000 s -1 , 1,500 s -1 Within 2,500 s -1 , 1,500 s -1 Within 2,000 s -1 , 2,000 s -1 Within 4,000 s -1 , 2,000 s -1 3,500 s -1 , 2,000 s -1 Within 3,000 s -1 , 2,000 s -1 Within 2,500 s -1 , 2,500 s -1 Within 4,000 s -1 , 2,500 s -1 3,500 s -1 , 2,500 s -1 Within 3,000 s -1, 3,000 s -1 Within 4,000 s -1 , 3,000 s -1 3,500 s -1 , or 3,500 s -1 Within 4,000 s -1 It may be performed by maintaining tangential flow filtration, but is not limited thereto.

[0126] In a specific embodiment, the method for producing extracellular vesicles derived from microorganisms of the present application described above may be to perform tangential flow filtration by maintaining the transmembrane pressure at 0.1 bar to 1 bar in step (c), and more specifically, the method may be to perform tangential flow filtration by maintaining the transmembrane pressure at 0.1 bar to 1 bar, 0.1 bar to 0.7 bar, 0.1 bar to 0.4 bar, 0.1 bar to 0.3 bar, 0.1 bar to 0.2 bar, 0.2 bar to 1 bar, 0.2 bar to 0.7 bar, 0.2 bar to 0.4 bar, 0.2 bar to 0.3 bar, 0.3 bar to 1 bar, 0.3 bar to 0.7 bar, or 0.3 bar to 0.4 bar, but is not limited thereto.

[0127] In a specific embodiment, the process of concentrating in step (c) may include a step of replacing the buffer after the concentration. The step of replacing the buffer may be performed repeatedly, and more specifically, may be performed repeatedly 2 to 20 times, 5 to 20 times, 5 to 15 times, 5 to 12 times, 7 to 15 times, 7 to 12 times, or 7 to 10 times, but is not limited thereto.

[0128] In a specific embodiment, the concentration multiple after the concentration in step (c) may be 10 to 80 times that of the centrifugation supernatant from which the cells have been removed after step (b), and more specifically, may be 10 to 80 times, 10 to 70 times, 10 to 50 times, 10 to 40 times, 20 to 80 times, 20 to 70 times, 20 to 50 times, 20 to 40 times, 30 to 80 times, 30 to 70 times, 30 to 50 times, or 30 to 40 times, but is not limited thereto.

[0129] In a specific embodiment, the purity of the extracellular vesicles after the concentration in step (c) may be increased by 40 to 80 times, more specifically, 40 to 80 times, 40 to 70 times, 40 to 60 times, 50 to 80 times, 50 to 70 times, or 50 to 60 times, compared to the centrifugation supernatant after step (a), but is not limited thereto.

[0130] As demonstrated in the examples described below, the skin aging inhibition activity and / or anti-inflammatory activity of the microbial-derived extracellular vesicles were observed both when the microbial-derived extracellular vesicles were separated using ultra-high-speed centrifugation and when the tangential flow filtration was used. In particular, when the tangential flow filtration was used, the MMP-1 expression inhibition activity, TNF-α expression inhibition activity, Hyaluronan synthase 3 expression promotion activity, and / or Filaggrin expression promotion activity were excellent, confirming that the functionality of the microbial-derived extracellular vesicles can be maintained while the microbial-derived extracellular vesicles are separated with high purity.

[0131] As previously explained, the contents regarding microorganisms, extracellular vesicles derived from microorganisms, improvement of skin condition, anti-inflammation, inflammatory diseases, etc. are as follows.

[0132] Another example of the present application provides an extracellular vesicle derived from a microorganism and having an inhibitory ability to decompose collagen, and / or a composition comprising the same for use in improving skin condition and / or for use as an anti-inflammatory agent.

[0133] Another example of the present application provides a method for improving skin condition, comprising administering to a subject an extracellular vesicle having a collagen degradation inhibitory ability derived from a microorganism and / or a composition containing the same.

[0134] Another example of the present application provides a use for the preparation of a composition for preventing or treating inflammatory diseases of an extracellular vesicle derived from a microorganism and having an inhibitory ability to inhibit collagen degradation.

[0135] Another example of the present application provides a method for treating an inflammatory disease, comprising administering to a subject an extracellular vesicle having a collagen degradation inhibitory ability derived from a microorganism and / or a composition comprising the same.

[0136] In the case of the use for improving skin condition and / or anti-inflammatory use, the method for improving skin condition, the use for preparing a composition for preventing or treating inflammatory diseases, and the method for treating inflammatory diseases, the microorganism of the present application, the extracellular vesicles derived from the microorganism, the composition containing the same, the content for improving skin condition, anti-inflammation, and treating inflammatory diseases, etc. are as described above.

[0137] The present application relates to extracellular vesicles derived from microorganisms based on vegetables (kimchi) and the human microbiome, their uses, and a method for producing the same. The extracellular vesicles derived from microorganisms of the present application can be usefully used for skin improvement, anti-inflammation, and / or prevention or treatment of inflammatory diseases, and the production method of the present application can be used to isolate extracellular vesicles derived from microorganisms with high purity while maintaining useful activities.

[0138] Figures 1a and 1b show the results of analyzing the shape and size of microbial-derived extracellular vesicles separated using ultra-high-speed centrifugation.

[0139] Figure 2 shows the results of analyzing the skin aging inhibition and anti-inflammatory activity of microbial-derived extracellular vesicles separated using ultra-high-speed centrifugation.

[0140] Figure 3 illustrates an extracellular vesicle separation process using tangential flow filtration.

[0141] Figure 4a is an image showing the removal of the cells by observing the concentrate and filtrate under a microscope after the cell removal process.

[0142] Figure 4b shows the results of analyzing extracellular vesicles (EVs) derived from L. plantarumKBL20066 separated and purified by tangential flow filtration using a nano-particle tracking analyzer (NTA).

[0143] Figure 4c shows the changes in yield and purity during the process of separating and purifying extracellular vesicles (EVs) derived from L. plantarumKBL20066 by tangential flow filtration.

[0144] Hereinafter, the present application will be described in more detail through examples. These examples are intended solely to illustrate the present application more specifically, and it will be apparent to those skilled in the art that the scope of the present application is not limited by these examples, in accordance with the gist of the present application.

[0145]

[0146] Example

[0147]

[0148] (Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise stated.)

[0149]

[0150] Example 1: Isolation and identification of highly functional probiotics based on vegetables (kimchi) and the human microbiome.

[0151] 1-1. Isolation and identification of Lactiplantibacillus plantarum (L. plantarum) KBL20066

[0152] Lactiplantibacillus plantarum (L. plantarum) KBL20066 is a strain isolated from kimchi. 10 g of fermented kimchi provided by Gokseong, Jeollanam-do, South Korea was mixed with 30 mL of 1X phosphate buffered saline (PBS) and homogenized using a grinding stomacher. 100 μL of the supernatant was plated onto Rogosa agar and cultured at 37°C for approximately 48 h. Colonies grown on the cultured medium were obtained, streaked onto LactobacilliMRS agar, and cultured again at 37°C for approximately 48 h. Afterwards, a single colony that grew was obtained and inoculated into 3 mL of LactobacilliMRS liquid medium, and cultured again at 37℃ for approximately 48 hours to obtain a single strain culture, and 1 mL of this was taken and centrifuged at 12,000 ×g for 2 minutes to obtain a single strain pellet. The genomic DNA of the above lactic acid bacteria was isolated using the Promega Wizard Genomic DNA Purification Kit according to the manufacturer's protocol.

[0153] The isolated genomic DNA was used to construct a sequence analysis library using the Oxford Nanopore Native Barcoding Kit 24 V14, and was injected into a Flow Cell (R10.4.1) for sequence analysis. The 16S rRNA coding gene sequence was then analyzed using the Geneious Prime genome analysis program. The determined base sequences were identified using the database of the Bacteria and Archaea: 16S ribosomal RNA project (ftp: / ftp.ncbi.nlm.nih.gov / refseq / TargetedLoci / Bacteria / ) and are presented in Table 1.

[0154] Based on 16S rRNA coding gene sequence analysis, the isolated strain was identified as L. plantarum and named L. plantarumKBL20066 strain. The strain was deposited with the Korean Collection for Type Cultures (KCTC), an international depository institution under the Budapest Treaty, and assigned the accession number KCTC 15615BP.

[0155]

[0156]

[0157] 1-2. Isolation and identification of Bifidobacterium breve (B. breve) KBL3168

[0158] Bifidobacterium breve (B. breve) KBL3168 is a safe strain derived from the intestine of a newborn. Feces provided from a healthy Korean newborn were homogenized in 1X PBS, 100 μL each was plated on BL agar medium, and anaerobically cultured at 37°C for 48 hours. A single colony grown on the cultured medium was obtained and inoculated into 3 mL of BL liquid medium, and cultured again at 37°C for approximately 48 hours to obtain a single strain culture. 1 mL of the culture was centrifuged at 12,000 × g for 2 minutes to obtain a single strain pellet. The genomic DNA of the above lactic acid bacteria was isolated using the Promega Wizard Genomic DNA Purification Kit according to the manufacturer's protocol.

[0159] Based on the analysis of the 16S rRNA coding gene sequence (Table 2 below), the isolated strain was identified as B. breve and named B. breveKBL3168 strain. The strain was deposited with the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology, an international depository under the Budapest Treaty, and was assigned the accession number KCTC 16006BP.

[0160]

[0161]

[0162] 1-3. Isolation and identification of Enterococcus faecium (E. faecium) KBL1538

[0163] Enterococcus faecium (E. faecium) KBL1538 is a strain derived from the vagina of a healthy Korean woman. The vaginal washing fluid provided was homogenized in 1X PBS, 100 μL was plated on Chocolate agar medium, and anaerobically cultured at 37°C for 48 hours. Colonies grown on the cultured medium were obtained, streaked on Chocolate agar medium, and cultured again at 37°C for approximately 48 hours. A single colony grown on the cultured medium was obtained, inoculated into 3 mL of LactobacilliMRS liquid medium, and cultured again at 37°C for approximately 48 hours to obtain a single strain culture. 1 mL of the cultured lactic acid bacteria was centrifuged at 12,000 × g for 2 minutes to obtain a single strain pellet. The genomic DNA of the lactic acid bacteria was isolated using the Promega Wizard Genomic DNA Purification Kit according to the manufacturer's protocol.

[0164] As a result of analysis of the 16S rRNA coding gene sequence (Table 3 below), the isolated strain was identified as E. faecium and named E. faeciumKBL1538 strain. The strain was deposited with the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology, an international depository institution under the Budapest Treaty, and was assigned the accession number KCTC 16002BP.

[0165]

[0166]

[0167] 1-4. Isolation and identification of Latilactobacillus sakei (L. sakei) KBL4353

[0168] Latilactobacillus sakei (L. sakei) KBL4353 is a strain isolated from kimchi. 10 g of fermented kimchi provided by Jeju Island, South Korea, was obtained, mixed with 30 mL of 1X PBS, and homogenized using a grinding stomacher. The supernatant was then plated (100 μL each) on Rogosa agar and cultured at 37°C for approximately 48 h. Colonies grown on the cultured medium were obtained, streaked onto LactobacilliMRS agar, and cultured again at 37°C for approximately 48 h. Afterwards, a single colony that grew was obtained and inoculated into 3 mL of LactobacilliMRS liquid medium, and cultured again at 37℃ for approximately 48 hours to obtain a single strain culture, and 1 mL of this was taken and centrifuged at 12,000 ×g for 2 minutes to obtain a single strain pellet. The genomic DNA of the above lactic acid bacteria was isolated using the Promega Wizard Genomic DNA Purification Kit according to the manufacturer's protocol.

[0169] As a result of analysis of the 16S rRNA coding gene sequence (Table 4 below), the isolated strain was identified as L. sakei and named L. sakeiKBL4353 strain. The strain was deposited with the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology, an international depository institution under the Budapest Treaty, and was assigned the accession number KCTC 16051BP.

[0170]

[0171]

[0172] 1-5. Isolation and identification of Staphylococcus epidermidis (S. epidermidis) KBL4354

[0173] Staphylococcus epidermidis (S. epidermidis) KBL4354 is a skin flora derived from a healthy Korean woman. The provided skin wash fluid was homogenized in 1X PBS, 100 μL each was plated on mannitol salt agar, and anaerobically cultured at 37℃ for 48 h. Colonies grown on the cultured medium were obtained, streaked on mannitol salt agar, and cultured again at 37℃ for approximately 48 h. A single colony grown on the cultured medium was obtained, inoculated into 3 mL of YBHI liquid medium, and cultured again at 37℃ for approximately 48 h to obtain a single strain culture. 1 mL of the colony was centrifuged at 12,000 × g for 2 minutes to obtain a single strain pellet. The genomic DNA of the above lactic acid bacteria was isolated using the Promega Wizard Genomic DNA Purification Kit according to the manufacturer's protocol.

[0174] As a result of analysis of the 16S rRNA coding gene sequence (Table 5 below), the isolated strain was identified as S. epidermidis and named S. epidermidis KBL4354 strain. The strain was deposited with the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology, an international depository under the Budapest Treaty, and was assigned the accession number KCTC 16052BP.

[0175]

[0176]

[0177] Example 2. Isolation of functional extracellular vesicles (EVs) derived from microbiome-based probiotics using ultra-high-speed centrifugation.

[0178] 1 L of the culture solution of the five strains isolated and identified in Example 1 was centrifuged at 6,000 ×g for 1 hour at 4°C. The supernatant was recovered and centrifuged again at 10,000 ×g and 39,000 ×g for 1 hour at 4°C. The supernatant was then recovered and filtered through a 0.45 μm filter. The filtrate was centrifuged at 120,000 ×g for 2 hours at 4°C to obtain pelleted extracellular vesicles (EV). The obtained EV was dispersed in 1X PBS.

[0179] The protein concentration of EVs was quantified using the Pierce Coomassie Protein Assay Kit. The morphology and size of EVs were analyzed by transmission electron microscopy (HT7800, Hitachi) and dynamic light scattering (DLS, ELSZ-2000, Otsuka Electronics) and are shown in Fig. 1a and Fig. 1b. Electron microscopic observations revealed circular and oval EVs. DLS analysis revealed that the average diameters were 81.8 nm for L. plantarum KBL20066, 58.0 nm for B. breve KBL3186, 97.8 nm for E. faecium KBL1538, 78.5 nm for L. sakei KBL4353, and 78.2 nm for S. epidermidis KBL4354.

[0180]

[0181] Example 3. Evaluation of the anti-aging and anti-inflammatory activities of functional extracellular vesicles derived from microbiome-based probiotics using ultra-high-speed centrifugation.

[0182] Keratinocyte HaCaT cells that have been passaged more than 30 times show increased expression of matrix metallopeptidase-1 (MMP-1), a major collagen-degrading enzyme, and tumor necrosis factor-α (TNF-α), a major skin inflammation inducer, even without separate stimulation. Inhibition of MMP-1 is used to evaluate skin aging inhibition (skin anti-aging) function such as wrinkle improvement, and TNF-α is a major inflammatory cytokine and a factor that regulates the expression of matrix metallopeptidase-2 (MMP-2) and matrix metallopeptidase-9 (MMP-9), so a decrease in TNF-α is an important indicator of skin aging inhibition and anti-inflammatory activity.

[0183] HaCaT cells passaged more than 30 times were seeded at 5 × 10 in a 96-well plate. 3 After dispensing cells / well, the cells were stabilized by culturing them in Dulbecco's Modified Eagle Medium containing 10% FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin at 5% CO₂ and 37°C for 24 hours. Afterwards, the isolated extracellular vesicle (EV) samples (L. plantarumKBL20066, E. faeciumKBL1538, L. sakeiKBL4353, S. epidermidisKBL4354, or B. breveKBL3186) were treated at 25 μg / mL each. After 24 hours of treatment, total RNA was extracted from the cells, and 1 μg was obtained. Complementary DNA was synthesized using SuperScript II reverse transcriptase from Thermo Fisher Scientific at 42°C for 90 minutes.

[0184] Reverse transcription polymerase chain reaction (RT-PCR) was performed using primers corresponding to each gene (Table 6) and AccuPower GoldHotstart Taq PCR premix and master mix from Bioneer. RT-PCR conditions were 95°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 48°C for 30 seconds, and 72°C for 60 seconds, and a final extension at 72°C for 10 minutes. The products were electrophoresed on a 1% agarose gel and stained with MIDORI Green Xtra from Nippon Genetics Europe for identification. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene, and gel band analysis was performed using the ImageJ program from the National Institutes of Health (NIH).

[0185] As a result of the analysis, all five EVs effectively inhibited MMP-1 expression, and in particular, EVs obtained from L. plantarumKBL20066, B. breveKBL3186, and E. faeciumKBL1538 were confirmed to also inhibit TNF-α expression (Fig. 2).

[0186] Primers used in the analysis of skin aging inhibition and anti-inflammatory activity of functional EV using ultracentrifugation Gene Name Primer Sequence (5'→3') Sequence number MMP-1 Matrix metallopeptidase-1 Forward primer GGTGTGAGTCCAAACAAGGTG6 Reverse primer CCTTGCCTATCCAGGGTGAC7 TNF-α Tumor necrosis factor-α Forward primer GTGACAAGCCTGTAGCCCAT8 Reverse primer CTGAGTCGGTCACCCTTCTC9 GAPDH Glyceraldehyde 3-phosphate dehydrogenase Forward primer ATTCCATGGCACCGTCAAGG10 Reverse primer TGATGGCATGGACTGTGGTC11

[0187]

[0188] Example 4. Design of an extracellular vesicle separation process from L. plantarum KBL20066 using tangential flow filtration (TFF).

[0189] The process for isolating extracellular vesicles (EVs) from L. plantarum KBL20066 using tangential flow filtration (TFF) was designed as follows (Fig. 3). L. plantarum KBL20066 was initially cultured in a bioreactor under anaerobic conditions, and the supernatant was recovered using a continuous centrifuge. Subsequently, the bacterial cells were removed through 0.2 μm tangential flow filtration (TFF), and then concentrated through tangential flow filtration (TFF) with a molecular weight of approximately 300 kDa. During the process, buffer replacement (diafiltration) was performed using 1X PBS.

[0190]

[0191] Example 5. Obtaining extracellular vesicles from L. plantarum KBL20066 using tangential flow filtration and confirming their purity.

[0192] L. plantarumKBL20066 was first cultured anaerobically at 28°C for 16 h in modified De Man-Rogosa-Sharpe (MRS) medium, and then anaerobically cultured at 28°C for 19 h in the same medium with nitrogen (N2) gas before and after strain inoculation. After reaching the stationary phase, the supernatant was obtained by continuous centrifugation at 7,000 ×g. To remove residual cells in the supernatant, a KrosFlo FS-500 TFF system and a 0.2 μm tangential flow filtration (TFF) device [polyethersulfone (PES)] (MiniKros, Repligen) were used. Before using TFF, the membrane was thoroughly washed with tertiary purified water equivalent to twice the volume of the membrane area at a flow rate of 3 L / min to remove the filled glycerin / sodium hydroxide, and then washed again with the same volume of 1X PBS to maintain osmotic pressure and neutral pH.

[0193] To minimize the physical impact on extracellular vesicles (EVs) during the cell removal process, the shear rate was set to 8000 s. -1 Hereinafter, the transmembrane pressure (TMP) was maintained below 0.4 bar. The filtration flow rate was adjusted to prevent sediment accumulation in the TFF, and the filtration pressure was converted to negative pressure to prevent the TMP from increasing. When starling flow occurred, it was controlled using a back pressure valve. After complete removal of the cells, the concentrate and filtrate were observed under a microscope to confirm that the cells were completely removed (Fig. 4a).

[0194] The filtrate was stored at 4°C in a 20 L container washed with ethanol, and within 24 hours, concentration and buffer replacement processes were performed using a tangential flow filtration device (TFF) [modified PES (mPES)] (MiniKros, Repligen) with a molecular weight cut-off (MWCO) of approximately 300 kDa (KrosFlo FS-500 TFF system). The TFF used for concentration and buffer replacement was also washed in the same manner, and then the shear rate was set to 4,000 s -1 Hereinafter, the transmembrane pressure was maintained below 0.4 bar. After concentrating to the target concentration multiple of 10 to 80 times (e.g., 40 times), the same volume of sterilized 1X PBS was added and the concentration process was repeated 10 times to complete buffer exchange.

[0195] The number of EV particles in the final sample was analyzed using a nano-particle tracking analyzer (NTA), and the EV concentration was 4.3 × 10 11 particles / mL, and the average diameter was confirmed to be 147.5 nm (Fig. 4b). Protein concentration was measured by bicinchoninic acid (BCA) analysis. In the 0.2 μm cell removal process, 85% of total proteins and 77% of EVs were filtered. In the concentration process, 28% of EVs were concentrated and 74% of proteins were removed. In the buffer replacement process, 32% of EVs were concentrated and 12% of proteins were removed. Ultimately, the EV purity was improved approximately 60-fold compared to the initial culture supernatant (Fig. 4c).

[0196]

[0197] Example 6. Evaluation of the anti-aging and anti-inflammatory activities of L. plantarum KBL20066 extracellular vesicles using tangential flow filtration.

[0198] Before evaluating the anti-aging and anti-inflammatory activity of L. plantarumKBL20066 extracellular vesicle (EV) samples, the samples were placed in a dialysis membrane with a pore size of 3 kDa to remove salt, and buffer exchange was performed at 4°C for more than 12 hours in 1X PBS corresponding to more than 300 times the sample volume.

[0199] HaCaT cells passaged more than 30 times were seeded at 2 × 10 in 6-well plates. 5 After dispensing cells / well, they were stabilized by culturing them in Dulbecco's Modified Eagle Medium containing 10% FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin at 5% CO₂ and 37°C for 24 h. Afterwards, 3 × 10 L. plantarumKBL20066 EV samples were added. 10 particles / well were treated. After 24 hours of treatment, total RNA was extracted and the expression of MMP-1, an aging indicator, TNF-α, an inflammation indicator, hyaluronan synthase 3 (HAS3), a skin barrier strengthening indicator, and filaggrin (FLG), a keratinocyte structural protein, was confirmed using real-time quantitative RT-PCR.

[0200] Primers corresponding to each gene (Table 7) and Power SYBR™ Green PCR Master Mix from Thermo Fisher Scientific were used. PCR conditions included a total of 25 μL of the reaction mixture, incubation at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. GAPDH was used as a control gene.

[0201] GeneNamePrimerSequence (5'→3')SEQ ID NO:MMP-1Matrix metallopeptidase-1Forward primerAAAATTACACGCCAGATTTGCC12Reverse primerGGTGTGACATTACTCCAGAGTTG13TNF- αTumor necrosis factor-alphaForward primerCCTCTCTCTAATCAGCCCTCTG14Reverse primerGAGGACCTGGGAGTAGATGAG15HAS3Hyaluronan synthase 3Forward primerCAGCCTATGTGACGGGCTAC16Reverse primerCCTCCTGGTATGCGGCAAT17FLGFilaggrinForward primerTGAAGCCTATGACACCACTGA18Reverse primerTCCCTACGCTTTCTTGTCCT19GAPDHGlyceraldehyde 3-phosphatedehydrogenaseForward primerGGAGCGAGATCCCTCCCAAAT20Reverse primerGGCTGTTGTCATACTTCTCATGG21

[0202]

[0203] As shown in Fig. 5, when L. plantarumKBL20066 EVs obtained using tangential flow filtration were treated, the expression of MMP-1 and TNF-α was statistically significantly decreased (p < 0.05), and the expression of HAS3 and FLG increased by more than two times on average. This result confirms that EVs separated using a tangential flow filtration-based mass process exhibit skin aging inhibition activity and anti-inflammatory activity at the same level as EVs separated using an ultra-high-speed centrifugation method.

[0204] [Accession number]

[0205] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0206] Accession number: KCTC15615BP

[0207] Date of acceptance: 20230914

[0208]

[0209] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0210] Accession number: KCTC16002BP

[0211] Date of acceptance: 20240808

[0212]

[0213] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0214] Accession number: KCTC16006BP

[0215] Date of acceptance: 20240820

[0216]

[0217] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0218] Accession number: KCTC16051BP

[0219] Date of acceptance: 20240912

[0220]

[0221] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0222] Accession number: KCTC16052BP

[0223] Date of acceptance: 20240912

[0224]

[0225]

[0226]

[0227]

[0228]

Claims

1. A composition for improving skin condition, comprising an extracellular vesicle derived from a microorganism and having the ability to inhibit collagen decomposition.

2. A composition according to claim 1, wherein the improvement in skin condition is at least one selected from the group consisting of improvement in skin wrinkles, improvement in skin elasticity, inhibition of skin aging, anti-inflammation, skin soothing, relief of skin irritation, skin moisturizing, and improvement of skin barrier.

3. A composition having at least one characteristic selected from the group consisting of (1) to (4) in the first paragraph: (1) Inhibition of expression of matrix metallopeptidase-1 (MMP-1); (2) Inhibition of expression of inflammatory cytokines; (3) Promotion of expression of hyaluronan synthase 3; and (4) Promotion of filaggrin expression.

4. A composition according to claim 1, wherein the microorganism is at least one selected from the group consisting of Lactiplantibacillus plantarum, Bifidobacterium breve, Enterococcus faecium, Latilactobacillus sakei, and Staphylococcus epidermidis.

5. In paragraph 4, the Lactobacillus plantarum is a Lactobacillus plantarum KBL20066 strain having accession number KCTC 15615BP; The above Bifidobacterium breve is a Bifidobacterium breve KBL3168 strain having the accession number KCTC 16006BP; The above Enterococcus faecium is the Enterococcus faecium KBL1538 strain having the accession number KCTC 16002BP; The above Lactobacillus sakei is a Lactobacillus sakei KBL4353 strain having the accession number KCTC 16051BP; or The composition wherein the above Staphylococcus epidermis is a Staphylococcus epidermis KBL4354 strain having the accession number KCTC 16052BP.

6. A composition according to claim 1, wherein the extracellular vesicles are separated from the microorganism using a method selected from the group consisting of centrifugation, ultracentrifugation, aqueous two-phase system phase separation, differential centrifugation, equilibrium density centrifugation, density gradient, ultrafiltration, microfiltration, tangential flow filtration, dialysis, and free-flow electrophoresis.

7. A composition according to claim 1, wherein the extracellular vesicles have a diameter of 30 nm to 200 nm.

8. A composition according to any one of claims 1 to 7, wherein the composition is a cosmetic composition.

9. In the 8th paragraph, the composition is at least one formulation selected from the group consisting of toner, emulsion, lotion, essence, cream, gel, pack, oil, makeup base, foundation, lipstick, patch, spray, cleanser, mouthwash, skin improver, cleansing foam, cleansing water, and powder.

10. Cosmetics containing the composition of Article 8.

11. An anti-inflammatory composition comprising an extracellular vesicle derived from a microorganism and having collagen decomposition inhibitory properties.

12. A food containing extracellular vesicles derived from microorganisms and having collagen decomposition inhibitory properties. 13.(a) A step of centrifuging a microbial culture solution to obtain a centrifugation supernatant containing extracellular vesicles; (b) a step of filtering the centrifuged supernatant to remove the bacterial cells; and (c) comprising a step of separating extracellular vesicles from the centrifuged supernatant from which the above-mentioned cells have been removed; A method for producing extracellular vesicles derived from microorganisms having collagen decomposition inhibitory properties.

14. A manufacturing method in claim 13, wherein in step (c), extracellular vesicles are separated using a method selected from the group consisting of centrifugation, ultracentrifugation, aqueous two-phase system phase separation, differential centrifugation, equilibrium density centrifugation, density gradient, ultrafiltration, microfiltration, tangential flow filtration, dialysis, and free-flow electrophoresis.

15. A composition according to claim 13, wherein the microorganism is at least one selected from the group consisting of Lactiplantibacillus plantarum, Bifidobacterium breve, Enterococcus faecium, Latilactobacillus sakei, and Staphylococcus epidermidis.

16. A manufacturing method in claim 13, wherein in step (b), filtration is performed using a filter including pores having a diameter of 0.1 μm to 1 μm.

17. A manufacturing method in which, in step (b), tangential flow filtration is used to remove the fungi.

18. In the 17th paragraph, in the step (b), the shear rate is 4,000 s -1 8,000 s -1 A manufacturing method for performing tangential flow filtration by maintaining the transmembrane pressure at 0.1 bar to 1 bar.

19. A manufacturing method in which, in step (c), extracellular vesicles are concentrated and separated using tangential flow filtration.

20. A manufacturing method in claim 19, wherein the molecular weight cut-off (MWCO) of the filter for tangential flow filtration in step (c) is 100 kDa to 500 kDa.

21. In the 19th paragraph, in the step (c), the shear rate is 1,000 s -1 Within 4,000 s -1 A manufacturing method for performing tangential flow filtration by maintaining the transmembrane pressure at 0.1 bar to 1 bar.

Images