Mixture of type ii collagen-mimetic amino acid composition and plant extract for promoting joint health, and use thereof

Abstract

A mixture of an amino acid composition and a plant extract, and the use thereof. The amino acid composition comprises the following amino acids or salts thereof in percentage by weight: 20.0%-28.0% of glycine, 13.0%-18.0% of proline, 6.0%-10.0% of alanine, 4.0%-7.0% of aspartic acid, 4.0%-7.0% of glutamine, 3.5%-6.0% of glutamic acid, 3.5%-5.0% of arginine, 3.0%-4.5% of lysine, 3.0%-4.5% of serine, 2.5%-4.0% of leucine, 2.0%-3.2% of threonine, 1.8%-2.8% of valine, 1.5%-2.5% of methionine, 1.5%-2.5% of isoleucine, 1.0%-2.0% of phenylalanine, 0.4%-0.8% of tyrosine, 0.3%-0.6% of histidine, 0.3%-0.6% of tryptophan, and optional additives. The plant extract is a berry extract or a Curcuma plant extract. The composition and / or mixture can increase bone hardness, prevent inflammatory responses, alleviate joint pain and / or increase joint mobility, thereby providing systemic support for bone and joint health.

Description

Mixtures of amino acid compositions and plant extracts mimicking collagen type ii for promoting joint health and uses thereof TECHNICAL FIELD

[0001] The present invention relates to mixtures of amino acid compositions and plant extracts and uses thereof, and to joint health mixtures comprising the same. BACKGROUND

[0002] Collagen is an important structural protein in human connective tissue, widely present in skin, cartilage, bone and joint tissues. Among them, collagen type II plays a key role in maintaining the structure and function of cartilage tissue, and can support the elasticity and stability of joints. With age, the natural synthesis of collagen in the human body gradually decreases, and the decrease of collagen in bone tissue can weaken the bone matrix, increasing the risk of bone loss and fracture. Therefore, supplementing or promoting collagen production has become an important means to delay skin aging and maintain bone health.

[0003] Currently, collagen supplements are mostly derived from animal tissues (such as cow, pig, fish skin or fish scales), and small molecule peptides are obtained by hydrolysis to improve bioavailability. However, such products have several limitations, including potential allergic reactions, risk of pathogen transmission, and some consumers cannot accept animal-derived raw materials due to religious, ethical or dietary habits. In addition, from the perspective of environment and sustainable development, there are certain limitations in excessive dependence on animal sources.

[0004] To solve the above problems, the concept of biomimetic collagen has been proposed in recent years. Biomimetic collagen refers to the simulation of human collagen amino acid composition through plant-based biomimetic technology, providing a pure plant source, sustainable, and non-allergic risk of collagen selection.

[0005] Skeletal and joint health is the basis for the normal functioning of the human movement system, and its maintenance depends on the balance of bone tissue metabolism, the integrity of cartilage, and the lubrication function of the joint cavity. However, with the increasing trend of nationwide fitness and population aging, joint problems have not been limited to the elderly population, but have gradually become younger and more athletic. Young people due to long-term desk work, lack of sunlight and insufficient calcium intake, leading to decreased bone density and decreased bone hardness in the knee joint, hip joint and spinal joint. Fitness groups are prone to induce cartilage microdamage in the knee joint, hip joint and ankle joint due to intense exercise, and under insufficient repair, are prone to early joint stiffness and joint pain. Elderly people are prone to bone loss due to imbalance of bone remodeling caused by decreased osteoblast activity and increased osteoclast activity, and are prone to joint stiffness, pain and limited mobility due to decreased synthesis of cartilage matrix and narrowing of the joint cavity.

[0006] Therefore, there is a great need to develop a joint health composition that can increase bone hardness, prevent inflammatory response, relieve joint pain and / or improve joint flexibility, thereby providing systematic support for bone and joint health. SUMMARY

[0007] In view of the above problems and needs in the art, the present application provides an amino acid composition that mimics human collagen type II. The mixture of the amino acid composition and a berry extract (e.g., elderberry extract) and / or a Curcuma plant extract (e.g., turmeric extract) can synergistically increase bone hardness, prevent inflammatory response, relieve joint pain and / or improve joint flexibility.

[0008] In a first aspect, the present application provides an amino acid composition, wherein the amino acid composition comprises the following amino acids or salts thereof, by weight percentage:

[0009] 20.0%-28.0% of Glycine, 13.0%-18.0% of Proline, 6.0%-10.0% of Alanine, 4.0%-7.0% of Aspartic acid, 4.0%-7.0% of Glutamine, 3.5%-6.0% of Glutamic acid, 3.5%-5.0% of Arginine, 3.0%-4.5% of Lysine, 3.0%-4.5% of Serine, 2.5%-4.0% of Leucine, 2.0%-3.2% of Threonine, 1.8%-2.8% of Valine, 1.5%-2.5% of Methionine, 1.5%-2.5% of Isoleucine, 1.0%-2.0% of Phenylalanine, 0.4%-0.8% of Tyrosine, 0.3%-0.6% of Histidine, 0.3%-0.6% of Tryptophan, and an optional additive.

[0010] In one embodiment, the additive comprises 1.5%-6.0% relative to the total weight of the amino acid composition, and the additive comprises 3.0%-5.0% of maltodextrin and / or 2.0%-4.0% of vitamin C.

[0011] In one embodiment, the amino acid composition comprises the following amino acids or salts thereof, in percentage by weight: 24.03% of glycine, 15.98% of proline, 7.93% of alanine, 5.56% of aspartic acid, 5.44% of glutamine, 4.68% of glutamic acid, 4.26% of arginine, 3.97% of isoleucine, 3.96% of serine, 3.31% of leucine, 2.60% of threonine, 2.25% of valine, 2.07% of methionine, 2.01% of isoleucine, 1.48% of phenylalanine, 0.59% of tyrosine, 0.47% of histidine, 0.41% of tryptophan, 2.25% of maltodextrin, and 3.00% of vitamin C.

[0012] In one embodiment, the amino acid composition comprises the following amino acids or salts thereof, in percentage by weight: 24.03% of glycine, 15.98% of proline, 7.93% of alanine, 5.56% of aspartic acid, 5.44% of glutamine, 4.68% of glutamic acid, 4.26% of arginine, 3.97% of isoleucine, 3.96% of serine, 3.31% of leucine, 2.60% of threonine, 2.25% of valine, 2.07% of methionine, 2.01% of isoleucine, 1.48% of phenylalanine, 0.59% of tyrosine, 0.47% of histidine, 0.41% of tryptophan, 3.25% of maltodextrin, and 3.00% of vitamin C.

[0013] In one embodiment, the amino acid composition comprises the following amino acids or salts thereof, in percentage by weight: 24.03% of glycine, 15.98% of proline, 7.93% of alanine, 5.56% of aspartic acid, 5.44% of glutamine, 4.68% of glutamic acid, 4.26% of arginine, 3.97% of isoleucine, 3.96% of serine, 3.31% of leucine, 2.60% of threonine, 2.25% of valine, 2.07% of methionine, 2.01% of isoleucine, 1.48% of phenylalanine, 0.59% of tyrosine, 0.47% of histidine, 0.41% of tryptophan, 5.00% of maltodextrin, and 3.00% of vitamin C.

[0014] In one embodiment, each of the amino acid components in the amino acid composition is of industrial origin, of renewable plant origin, or is prepared from glucose by fermentation.

[0015] In a second aspect, the present application provides the use of the amino acid composition according to the first aspect in combination with a berry extract for the preparation of a mixture for increasing bone stiffness.

[0016] In one embodiment, the berry extract is an elderberry extract.

[0017] In one embodiment, the mixture is used to increase bone mineral density.

[0018] In one embodiment, the mixture is used to promote osteoblast differentiation.

[0019] In one embodiment, the mixture is used to inhibit osteoclast differentiation.

[0020] In a third aspect, the present application provides use of the amino acid composition according to the first aspect in combination with a berry extract in the preparation of a mixture for preventing inflammatory response.

[0021] In one embodiment, the berry extract is a Sambucus nigra extract.

[0022] In one embodiment, the mixture is used to reduce inflammatory factor levels. In one embodiment, the composition is used to reduce TNF-a, IL-1 b, iNOS levels.

[0023] In one embodiment, the mixture is used to prevent chondrocyte inflammation.

[0024] In a fourth aspect, the present application provides use of the amino acid composition according to the first aspect in combination with a Curcuma plant extract in the preparation of a mixture for relieving joint pain.

[0025] In one embodiment, the Curcuma plant extract is a Curcuma longa extract.

[0026] In one embodiment, the mixture is used to prevent joint wear and tear.

[0027] In one embodiment, the mixture is used to promote secretion of cartilage collagen.

[0028] In one embodiment, the mixture is used to promote secretion of glucosaminoglycans.

[0029] In a fifth aspect, the present application provides use of the amino acid composition according to the first aspect in combination with a Curcuma plant extract in the preparation of a mixture for increasing joint flexibility.

[0030] In one embodiment, the Curcuma plant extract is a Curcuma longa extract.

[0031] In one embodiment, the mixture is used to improve joint stiffness.

[0032] In one embodiment, the mixture is used to promote secretion of cartilage collagen.

[0033] In one embodiment, the mixture is used to promote secretion of glucosaminoglycans (GAGs).

[0034] In one embodiment, the mixture comprises a berry extract at a weight percent content of 2.0-3.5%, based on 100% of the total weight of the amino acid composition and the berry extract.

[0035] In one embodiment, the mixture comprises a curcuma plant extract at a weight percent content of 0.5-3.0%, based on 100% of the total weight of the amino acid composition and the curcuma plant extract.

[0036] In one embodiment, the mixture comprises a berry extract and a curcuma plant extract at a weight percent content of 2.0-3.5% for the berry extract and at a weight percent content of 0.5-3.0% for the curcuma plant extract, based on 100% of the total weight of the amino acid composition, the berry extract and the curcuma plant extract.

[0037] In one embodiment, the berry extract is derived from the fruit of Sambucus nigra.

[0038] In one embodiment, the curcuma plant extract is derived from the rhizome of Curcuma longa.

[0039] In one embodiment, the composition or mixture comprises a food-acceptable excipient.

[0040] In one embodiment, the food-acceptable excipient includes, but is not limited to: carriers / diluents: such as maltodextrin, starch, lactose, glucose, fructose, mannitol, sorbitol, dietary fiber; binding agents: such as gum arabic, gelatin, pectin, hydroxypropyl methylcellulose (HPMC), guar gum; disintegrants (for tablets / capsules): such as croscarmellose sodium, starch derivatives, microcrystalline cellulose; lubricants / anti-caking agents: such as magnesium stearate, silicon dioxide, talc; coating agents (such as tablets or granules): such as hydroxypropyl methylcellulose, polyvinyl alcohol, shellac; sweeteners / flavorings: such as xylitol, erythritol, steviol glycosides, monk fruit extract, honey powder; spices / essences: such as lemon powder, orange juice powder, vanilla powder; colorants (of natural origin): such as beetroot red, chlorophyll, curcumin, carotenes; anti-caking agents: such as tricalcium phosphate, calcium carbonate, silicon dioxide; drink bases (such as instant powders, functional beverage types): such as whey protein, plant protein, juice powder, coconut powder, oat powder.

[0041] In one embodiment, the food-acceptable excipient is a food-grade carrier, binding agent, anti-caking agent and / or natural sweetener.

[0042] In one embodiment, the composition or mixture is a powder, a tablet, a capsule, a soft capsule, a granule, an oral solution, a pill or a suspension, preferably a powder.

[0043] The amino acid composition of the present application, the composition comprising the same has the following advantages:

[0044] The amino acid composition or mixture of the present application can increase bone hardness, prevent inflammatory response, relieve joint pain, and improve joint flexibility.

[0045] The amino acid composition or mixture of the present application can activate the expression of genes related to collagen synthesis in chondrocytes, and promote the secretion of collagen, chondroitin and hyaluronic acid in cartilage.

[0046] The amino acid composition or mixture of the present application can inhibit the production of nitric oxide (NO) by inflammatory macrophages, reduce the secretion of pro-inflammatory substances, and reduce the level of inflammatory factors, thereby alleviating joint discomfort and protecting joint tissue.

[0047] The amino acid composition or mixture of the present application can inhibit cartilage degradation, significantly reduce the inflammatory response of chondrocytes, and inhibit the degradation process of articular cartilage.

[0048] The amino acid composition or mixture of the present application can promote the differentiation of osteoblasts, enhance bone formation, and also inhibit the differentiation and maturation of osteoclasts, thereby preventing osteoporosis.

[0049] The amino acid composition or mixture of the present application can be used as a health product, a food product or a food additive for non-therapeutic purposes, for increasing bone hardness, preventing inflammatory response, relieving joint pain, and improving joint flexibility. In other words, it can also be used for the treatment and prevention of osteoporosis, the treatment of arthritis, the relief of joint pain, and the improvement of activity limitation caused by joint problems. BRIEF DESCRIPTION OF DRAWINGS

[0050] Figure 1 shows the effect of sample 1 on the expression level of collagen-related genes in chondrocytes.

[0051] Figure 2A shows the expression of glucosaminoglycan (including chondroitin and hyaluronic acid) in chondrocytes stained with Alcian blue.

[0052] Figure 2B shows the quantitative analysis of the expression of glucosaminoglycan in chondrocytes in Figure 2A.

[0053] Figure 3 shows the comparison of the amount of nitric oxide (NO) produced in different treatment groups in a LPS-induced macrophage model.

[0054] Figure 4 shows the results of qPCR experiments, i.e. the comparison of the gene expression levels of various inflammatory factors in chondrocytes in different treatment groups.

[0055] Figure 5A shows the results of the experiment of the effect of sample 1 on mesenchymal stem cell osteogenic differentiation, including the results of cell alizarin red S staining of the control group and the experimental group (sample 1).

[0056] Figure 5B shows the quantitative analysis of the osteoblast differentiation in Figure 5A.

[0057] Figure 6 shows the inhibitory effect of sample 1 on osteoclast differentiation and maturation, including the results of fluorescence microscope observation of the control group and the experimental group (sample 1).

[0058] Figure 7 shows the T value of the spine of the subject after taking sample 2 for 12 weeks.

[0059] Figure 8 shows the Z value of the spine of the subject after taking sample 2 for 12 weeks.

[0060] Figure 9 shows the serum TNF-α level of the subject after taking sample 2 for 12 weeks.

[0061] Figure 10 shows the WOMAC score of the subject after taking sample 3 for 12 weeks. DETAILED DESCRIPTION

[0062] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0063] In this document, the terms "comprise", "have", "include" and "contain" are to be construed in an open-ended way, i.e. meaning "including, but not limited to".

[0064] In the present application, the term "amino acid" includes its salt forms, such as sodium salt, potassium salt, magnesium salt, hydrochloride salt, sulfate salt, etc., unless otherwise specified.

[0065] The present application will be further described with reference to the following figures and examples. The following examples are intended to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods in the examples, for which specific conditions are not indicated, are performed according to the conventional conditions known in the art or according to the conditions recommended by the manufacturers.

[0066] Example 1: Preparation of a composition of collagen type II amino acids and plant extracts

[0067] Example 1: Preparation of a mixture of amino acids and plant extracts A mixture of 24.03% glycine, 15.98% L-proline, 7.93% L-alanine, 5.56% L- aspartic acid, 5.44% L-glutamine, 4.68% L-glutamic acid, 4.26% L-arginine, 3.97% L- isoleucine, 3.96% L-serine, 3.31% L-leucine, 2.60% L-threonine, 2.25% L-valine, 2.07% L-methionine, 2.01% L-isoleucine, 1.48% L-phenylalanine, 0.59% L-tyrosine, 0.47% L- histidine, 0.41% L-tryptophan, 2.75% elderberry extract (extracted from the fruit of Sambucus nigra, available from Huachengbio), 1.00% turmeric extract (extracted from the rhizome of Curcuma longa, available from ARJUNA NATURAL PRIVATE LTD), 2.25% maltodextrin, and 3.00% vitamin C were added into a mixer and mixed to obtain a primary mixture. The primary mixture was sieved through a screen (40 mesh) to obtain an intermediate mixture with uniform particle size. The intermediate mixture was homogenized (homogenizer: Breville, G560 (2-434437)) to obtain a homogeneous post-mixed product, which is the mixture of type II collagen amino acids and plant extracts of Example 1 (Sample 1).

[0068] Example 2: Promotion of collagen secretion by chondrocytes

[0069] Example 1 (Sample 1) was used in a chondrocyte cell line experiment to evaluate its effect on collagen gene expression.

[0070] Specifically, mouse chondrocyte precursor cell line ATDC5 (Sigma, 99072806) was seeded in a 24-well culture plate at a density of 1 x 10 5 cells / well, and cultured in DMEM / F12 medium (Gibco, 3086139) supplemented with 10% FBS (Gibco, M3009125RP) and 1% antibiotic AA (Simply, CC501-0100) in a 37°C, 5% CO2 incubator for 24 hours.

[0071] Subsequently, the test composition was added to the culture medium, and the groups were as follows:

[0072] Control group: blank culture medium.

[0073] Experimental group: 0.0625 mg / mL concentration of Sample 1.

[0074] After the cells were continuously cultured for 48 hours, the culture medium was discarded, the cells were washed with 1x DPBS, and 600 μL of RB Buffer (Geneaid, RB300) was added to each well to lyse the cells and extract total RNA. The obtained RNA was used for subsequent qPCR detection to evaluate the expression level of collagen-related genes. The experimental data was statistically analyzed using Student's t-test in Excel (** indicates P < 0.01 relative to the control group, and *** indicates P < 0.001 relative to the control group).

[0075] The primer sequences of each gene are as shown in Table 1:

[0076] Table 1

[0077] Target gene Forward sequence (5'-3') Reverse sequence (5'-3') Collagen II (Col II A2) GCTGGTGAAGAAGGCAAACGAG (SEQ ID NO: 1) CCATCTTGACCTGGGAATCCAC (SEQ ID NO: 2) Collagen IX A2 (Col IX A2) GGGATACAGAGCAGAGACCC (SEQ ID NO: 3) GGGGTACAGCAGAGAGATAG (SEQ ID NO: 4) Collagen IX A3 (Col IX A3) TTCGACTTCTCTCCAGCCGA (SEQ ID NO: 5) TCCACTGGCCTGATCCATGT (SEQ ID NO: 6) Collagen XI A2 (Col XI A2) TTGCTGCTGTACCTTTCG (SEQ ID NO: 7) TGCTTCTGCTGATCTCACTT (SEQ ID NO: 8)

[0078] Collagen, as an important structural component of articular cartilage, can enhance the toughness and elasticity of cartilage, reduce the friction on the surface of cartilage during movement, and slow down the vibration and impact caused by movement, thereby further improving the functional performance of the joint, significantly improving the flexibility of the joint, and preventing joint wear, thereby relieving joint pain.

[0079] As shown in FIG. 1, the experimental results show that sample 1 can up-regulate the expression levels of collagen II and other collagen-related genes (Collagen IX A2, Collagen IX A3, Collagen XI A2), wherein, taking the expression level of the control group as the benchmark (set as 100%), the relative expression amount of collagen II gene is significantly up-regulated by 49.8%, the relative expression amount of Collagen IX A2 gene is significantly up-regulated by 22.6%, the relative expression amount of Collagen IX A3 gene is significantly up-regulated by 33.8%, and the relative expression amount of Collagen XI A2 gene is significantly up-regulated by 79.7%. The results show that sample 1 can promote the secretion of collagen by chondrocytes, and has a significant effect on improving the synthesis of cartilage matrix, promoting joint repair and maintaining joint health.

[0080] Example 3: Promoting chondrocytes to secrete glucosaminoglycan

[0081] Sample 1 obtained in Example 1 was used for chondrocyte experiments to evaluate its effect on glucosaminoglycan (GAGs) secretion.

[0082] Specifically, human immortalized chondrocyte cell line C28 / I2 (Merck, SC043) was seeded in a 24-well culture plate at a density of 1 x 10 5 cells / well, using DMEM / F12 medium (Gibco, 3086139) added with 10% FBS (Gibco, M3009125RP) and 1% antibiotic AA (Simply, CC501-0100), and cultured in a 37°C, 5% CO2 incubator for 24 hours.

[0083] Subsequently, the test sample was added to the culture medium, and the groups were as follows:

[0084] Control group: blank culture medium.

[0085] Experimental group: sample 1 at a concentration of 0.0625%.

[0086] Continue to culture for 48 hours, remove the culture medium and rinse with 1 x PBS for 3 times, then add 0.5 mL of 10% paraformaldehyde to each well, and fix at room temperature for 30 minutes. After discarding the fixing solution, rinse with 1 x PBS again for 3 times. Subsequently, 0.5 mL of 1% Alcian blue solution (pH = 2.5; Sigma, A5268-10G) prepared with 0.1 M HCl was added to each well, and reacted overnight at room temperature.

[0087] After the staining was completed, the cells were washed 3 times with 1x PBS and observed under a microscope (ZEISS Axiovert, ATCID00055) for the blue signal of Alcian Blue binding to glycosaminoglycans. Further, 1 mL of 6 M Guanidine-HCl (Sigma, G4505-25G) was added to each well to elute the dye for 10 minutes at room temperature, and then 200 μL was transferred to a 96-well plate, and the absorbance at 620 nm was measured using a microplate reader (BIOTECH, Epoch 1703289). The experimental data were statistically analyzed using Student's t-test in Excel (* indicates P < 0.05 relative to the control group).

[0088] Glycosaminoglycans are important components of synovial fluid and cartilage matrix. The increase of glycosaminoglycans not only helps to strengthen the structure of cartilage matrix, but also improves the lubrication function of synovial fluid in the joint cavity, thereby effectively reducing the friction during joint movement, improving the smoothness of the joint, and thus improving the flexibility of the joint and preventing joint wear.

[0089] As shown in the experimental results of FIG. 2A, after the sample 1 treatment group was co-cultured with chondrocytes, the GAGs staining signal (light color) was significantly enhanced under a microscope, and the light color part of the experimental group was significantly increased, indicating that sample 1 can promote chondrocytes to secrete glycosaminoglycans. As shown in FIG. 2B, according to the data obtained by the microplate reader, the content of glycosaminoglycans secreted by chondrocytes was increased by 5.3% compared with the control group, indicating that sample 1 can promote chondrocytes to secrete glycosaminoglycans, thereby effectively preventing joint wear, relieving joint pain, and improving joint flexibility by increasing joint lubrication.

[0090] Example 4: Inhibition of Nitric Oxide (NO) produced by inflammatory macrophages

[0091] The sample 1 obtained in Example 1 was used for macrophage experiments to evaluate its regulatory effect on the production of inflammation-related nitric oxide (NO).

[0092] Specifically, the mouse macrophage strain RAW264.7 (ATCC, TIB-71) was selected and cultured in DMEM medium (Gibco, 3124477) supplemented with 10% FBS (Gibco, M3009125RP) and 1% antibiotic AA (Simply, CC501-0100). The cells were seeded in a 96-well culture plate at a density of 1 x 10 4 The cells were incubated in a 37°C, 5% CO2 incubator for 24 hours.

[0093] After the incubation was completed, the culture medium was discarded and replaced with FBS-free medium, and the following groups were set up:

[0094] Control group: 500 ng / mL of lipopolysaccharide (LPS; Sigma, SI-L2880-25MG) was added.

[0095] Experimental group: 500 ng / mL of LPS and sample 1 at a concentration of 2 mg / mL.

[0096] After 24 hours of continuous culture, 150 μL of culture supernatant was removed from each well and transferred to a new 96-well plate, which previously contained 130 μL of sterile distilled water per well. Subsequently, Griess reagent was prepared (reagent A and reagent B were mixed at a ratio of 1:1; Invitrogen, G7921), and 20 μL was added to each well, and the reaction was carried out in the dark for 30 minutes. Then, the absorbance (OD) was measured at 548 nm using a microplate reader (BIOTECH, Epoch 1703289). The higher the OD value, the higher the concentration of NO. The experimental data were statistically analyzed using Student's t-test in Excel (* indicates P < 0.05 compared with the control group).

[0097] In the inflammatory state, macrophages produce nitric oxide, which stimulates other immune cells to further participate in the inflammatory response, exacerbating the inflammatory process and leading to joint damage and degeneration.

[0098] As shown in Figure 3, the experimental results show that compared with the control group containing only LPS, the treatment group with sample 1 can effectively reduce the production of nitric oxide by macrophages by 30%, proving that the composition can effectively inhibit the release of nitric oxide by macrophages in the inflammatory state, thereby preventing the inflammatory response.

[0099] Example 5: Reducing the inflammatory response of chondrocytes

[0100] Sample 1 obtained in Example 1 was used in a chondrocyte inflammation model experiment to evaluate its regulatory effect on the expression of inflammation-related factors.

[0101] Specifically, the mouse chondrocyte cell line ATDC5 (Sigma, 99072806) was selected, and the cells were seeded in a 6-well culture plate at a density of 1 x 10 5 cells / well and cultured at 37°C, 5% CO2 for 24 hours. After the cells adhered, 200 μg / mL of monosodium urate (MSU; Sigma, U2875) was added to each well to induce an inflammatory response. Then, the experimental group sample was added, and the cells were cultured in a 37°C, 5% CO2 incubator for 48 hours, with the following groups:

[0102] Control group: 200 μg / mL of MSU.

[0103] Experimental group: 200 pg / mL concentration of MSU and 0.125 mg / mL concentration of sample 1.

[0104] After the end of the culture, the culture solution was discarded, washed with 1 x DPBS, and 600 pL of RB Buffer was added to each well to lyse the cells. Subsequently, total RNA was extracted, and reverse transcription and qPCR gene quantification analysis were performed. The experimental data were statistically analyzed using Student's t-test in Excel (*** indicates P < 0.001 relative to the control group).

[0105] The target genes for detection included inflammatory factors IL-1 b, TNF-a, and inducible nitric oxide synthase (iNOS), and the primer sequences were as shown in Table 2:

[0106] Table 2

[0107] Target gene Forward sequence (5'-3') Reverse sequence (5'-3') IL-1 b TTGGGCCTCAAAGGAAAGAA (SEQ ID NO: 9) TGTGAGGTGCTGATGTACCAGTT (SEQ ID NO: 10) TNF-a CCCAAGGCGCCACATCT (SEQ ID NO: 11) CACCCCGAAGTTCAGTAGACAGA (SEQ ID NO: 12) iNOS CTCAGTTCTGCGCCTTTG (SEQ ID NO: 13) TGAAGCGTTTCGGGATCTG (SEQ ID NO: 14)

[0108] When chondrocytes are damaged for various reasons (such as age, mechanical wear), the damaged cells release a large amount of pro-inflammatory factors such as IL-1 b, TNF-a, and nitric oxide (NO). These signaling molecules trigger an inflammatory response, and a persistent inflammatory environment further inhibits cartilage repair and accelerates cell apoptosis, leading to more extensive joint and cartilage degradation, and ultimately resulting in limited joint function.

[0109] As shown in FIG. 4, the experimental results showed that sample 1 could significantly reduce the expression levels of various inflammatory factors in chondrocytes, with the expression level of the control group as the benchmark (set to 100%), the relative expression of IL-1 b gene was significantly reduced by 80%, the relative expression of TNF-a gene was significantly reduced by 84%, and the relative expression of iNOS gene was significantly reduced by 83%. Therefore, sample 1 can effectively inhibit the inflammatory response of chondrocytes, reduce the expression of pro-inflammatory factors, thereby playing an anti-inflammatory protective role and effectively delaying the degradation process of joint cartilage.

[0110] Example 6: Promoting osteoblast differentiation

[0111] The sample 1 obtained from Example 1 was used for osteoblast differentiation experiment to evaluate its effect on bone health.

[0112] First, human adipose-derived mesenchymal stem cells AdMSC cells (ATCC, CRL-2749) were seeded in a 24-well culture plate at a seeding density of 8 x 10 4 cells / well, with a culture liquid volume of 500 μL / well, using an aMEM culture medium (Gibco, 12000-022) added with 5% fetal bovine serum FBS (Gibco, M3009125RP) and 1% antibiotic AA (Simply, CC501-0100), and placed in a CO2 incubator for 1 day. Subsequently, the culture liquid was replaced with MSCgo™ osteogenic differentiation medium (05-440-1B) for 7 days of differentiation, and the differentiation culture liquid was replaced every 2-3 days.

[0113] After 7 days, the test sample was added, and the groups were as follows:

[0114] Control group: blank culture medium.

[0115] Experimental group: sample 1 at a concentration of 0.5%.

[0116] After the sample was added, the culture was continued for 14 days, and the culture liquid was replaced every 2-3 days. After the culture ended, the culture liquid was removed, the cells were washed twice with PBS, and then fixed with 4% paraformaldehyde at 37°C for 10 minutes. The fixed cells were washed twice with ddH2O and stained with alizarin red S staining solution (2 g alizarin red S / 100 mL ddH2O; Sigma, A5533) for 1 minute. After the staining solution was removed, it was washed thoroughly with ddH2O to obtain the staining result. The cell calcification nodules were observed under a microscope (ZEISS Axiovert, ATCID00055).

[0117] Further, the stained sample was added to a CPC solution (350 mg CPC / 10 mL ddH2O; Sigma, C9002-25G) at 37°C for 2 hours to elute the alizarin red S dye. Subsequently, 50 μL of the solution was transferred from each well to a 96-well plate, and the OD405 value was detected using an enzyme labeler (BIOTECH, Epoch 1703289) to quantitatively evaluate the degree of cell calcification. The experimental data was statistically analyzed using Student’s t-test in Excel (* indicates P < 0.05 relative to the control group).

[0118] Calcium in the bone can be stained red by Alizarin Red S, as shown in FIG. 5A, in which the red color is shown as dark color, and under the microscope, the red color (dark color) of the experimental group is increased, indicating that sample 1 can promote the differentiation of osteoblasts. By quantitatively detecting the degree of calcification of the cells, the ability of sample 1 to promote the differentiation of osteoblasts was illustrated, and the results are shown in FIG. 5B. According to the data obtained by the enzyme marker, taking the control group as the benchmark (set as 100%), sample 1 can significantly increase the relative amount of osteoblast differentiation by 41.9%. Osteoblasts are the main functional cells of bone formation, responsible for the synthesis, secretion and mineralization of bone matrix. Human bone tissue is constantly being rebuilt, and the bone remodeling process includes bone resorption and new bone formation, and osteoblasts are responsible for new bone formation. Through new bone formation, the bone density of the body can be improved, the bone mass can be increased, and thus the bone hardness can be increased, promoting the health of the body's bones.

[0119] Example 7: Inhibition of differentiation and maturation of osteoclasts

[0120] Sample 1 obtained in Example 1 was used for in vitro experiments to evaluate its effect on the differentiation of peripheral blood mononuclear cells (PBMCs) into osteoclasts.

[0121] First, peripheral blood was collected from healthy volunteers, and 20 mL of blood was diluted with 15 mL of PBS. 15 mL of Ficoll (GE Healthcare) was added to a 50 mL centrifuge tube, and then 35 mL of diluted blood was slowly overlaid on the Ficoll layer, and centrifuged at 400 g for 40 minutes. After centrifugation, a thin layer can be observed between the Ficoll layer and the plasma layer, which is peripheral blood mononuclear cells (PBMCs). The PBMCs were carefully removed and washed twice with PBS (400 g, 15 minutes).

[0122] The obtained PBMCs were seeded at a density of 1 x 10 6 cells / mL to 2 x 10 6 cells / mL, and sample 1 was added for culture. The osteoclast differentiation medium was composed of a-MEM (Gibco, 12000-022) added with 10% FBS (Gibco, M3009125RP), 1 x P / S, human RANKL (40 ng / mL; Peprotech, 310-01-10UG), and human M-CSF (25 ng / mL; Peprotech, 300-25-10UG). The cells were continuously cultured in a 37°C, 5% CO2 incubator for 14 days, and the culture medium was replaced every 3 days.

[0123] The groups were as follows:

[0124] Control group: blank medium.

[0125] Experimental group: Sample 1 at 5 mg / mL concentration.

[0126] After 14 days of continuous culture, a large number of multinucleated osteoclasts were observed in the control group. Subsequently, a drop of Actin Green™ 488 ReadyProbes® Reagent (Invitrogen, A11008) and Hoechst 33342 (Thermo, 62249; 1:20000 dilution) was added to each well for 15 minutes at 37°C for fluorescent staining. The amount of osteoclasts in each group was observed using a fluorescence microscope (ZEISS Axiovert, ATCID00055).

[0127] In young bones, the activities of osteoblasts and osteoclasts are in a dynamic balance, maintaining the health and density of the bones. However, as age increases, the levels of cytokines in the body change, leading to excessive proliferation and abnormal activity of osteoclasts. The imbalance between osteogenesis and osteoclastogenesis causes the rate of bone decomposition to be much faster than the rate of synthesis, resulting in a large amount of calcium loss from the bone tissue, bone mass reduction, and fragile bones.

[0128] As shown in Figure 6, compared with the control group (mature multinucleated osteoclasts), the number of osteoclasts in the experimental group (undifferentiated mononuclear cells) was significantly reduced (by 70%), indicating that Sample 1 can significantly inhibit the differentiation and maturation of osteoclasts, effectively slow down bone loss, thereby increasing bone density, increasing bone hardness, and promoting bone health.

[0129] Example 8: Preparation of a mixture of collagen type II amino acids and plant extracts

[0130] A mixture of 24.03% glycine, 15.98% L-proline, 7.93% L-alanine, 5.56% L-aspartic acid, 5.44% L-glutamine, 4.68% L-glutamic acid, 4.26% L-arginine, 3.97% L-ornithine hydrochloride, 3.96% L-serine, 3.31% L-leucine, 2.60% L-threonine, 2.25% L-valine, 2.07% L-methionine, 2.01% L-isoleucine, 1.48% L-phenylalanine, 0.59% L-tyrosine, 0.47% L-histidine, 0.41% L-tryptophan, 3.25% maltodextrin, 2.75% elderberry extract (extracted from the fruit of Sambucus nigra, available from Huachengbio, Hunan, China), and 3.00% vitamin C, by weight, was mixed in a blender to obtain a premix. The premix was sieved through a screen having a mesh size of 40 mesh to obtain an intermediate mixture product having a uniform particle size. The intermediate mixture product was homogenized (homogenizer: Breville, G560 (2-434437)) to obtain a homogeneous post-mixed product, which is a type II collagen amino acid and plant extract mixture of Example 8 (Sample 2).

[0131] Example 9: Preparation of a Type II Collagen Amino Acid and Plant Extract Mixture

[0132] A mixture of 24.03% glycine, 15.98% L-proline, 7.93% L-alanine, 5.56% L-aspartic acid, 5.44% L-glutamine, 4.68% L-glutamic acid, 4.26% L-arginine, 3.97% L-ornithine hydrochloride, 3.96% L-serine, 3.31% L-leucine, 2.60% L-threonine, 2.25% L-valine, 2.07% L-methionine, 2.01% L-isoleucine, 1.48% L-phenylalanine, 0.59% L-tyrosine, 0.47% L-histidine, 0.41% L-tryptophan, 5.00% maltodextrin, 3.00% vitamin C, and 1.00% turmeric extract (extracted from the rhizome of Curcuma longa, available from ARJUNA NATURAL PRIVATE LTD), by weight, was mixed in a blender to obtain a premix. The premix was sieved through a screen having a mesh size of 40 mesh to obtain an intermediate mixture product having a uniform particle size. The intermediate mixture product was homogenized (homogenizer: Breville, G560 (2-434437)) to obtain a homogeneous post-mixed product, which is a type II collagen amino acid and plant extract mixture of Example 9 (Sample 3).

[0133] Example 10: Human efficacy trial

[0134] This example provides the efficacy of sample 2 obtained in Example 8 on bone and joint health.

[0135] Sample: Sample 2 (5 g / day) of Example 8.

[0136] Subjects: A total of 10 adults.

[0137] Inclusion criteria: Adults at high risk of fracture (low bone density, postmenopausal women, age > 65 years).

[0138] Method: Self-controlled trial. Subjects took 5 g of sample 2 before meals daily for 3 months. Bone density values were collected at month 0 and month 3, respectively. Experimental data were statistically analyzed using Student's t-test in Excel (** indicates P < 0.01 vs. week 0, *** indicates P < 0.001 vs. week 0).

[0139] Test items: Spinal bone density scan (dual-energy X-ray absorptiometry, DEXA): T value, Z value.

[0140] As shown in Table 3 below, the T value reflects the comparison of bone mineral density (BMD) with the average BMD of healthy adults of the same gender and age. The T value can be used to diagnose osteopenia and osteoporosis.

[0141] Table 3

[0142] T value explanation -1 or above Normal bone density Less than -1 to greater than -2.5 Osteopenia (lower than normal BMD) Less than -2.5 Osteoporosis (low BMD)

[0143] As shown in Table 4 below, the Z value compares the BMD of the subject with the average BMD of the same age group, taking into account gender and body mass index (BMI).

[0144] Table 4

[0145] Z value explanation More than -1.5 Typical BMD of the same age group Less than -1.5 Atypical BMD, need to investigate

[0146] Trial results

[0147] As shown in Figure 7, after taking sample 2 for 12 weeks, the T value of the subject's spine was significantly improved from -0.92 to -0.72, with a change rate of 21.7%, and 80% of the subjects showed effective improvement.

[0148] As shown in Figure 8, after taking sample 2 for 12 weeks, the subject's spine Z value was significantly improved from -0.140 to 0.270, with a change rate of 293%, and 90% of the subjects showed effective improvement.

[0149] The decrease in bone mineral density is the main cause of decreased bone hardness and increased risk of fracture. Sample 2 can significantly improve bone mineral density, thereby reducing the risk of fracture in postmenopausal women or older people, slowing bone loss, and improving bone strength, bone hardness, and bone support.

[0150] Example 11: Human efficacy test

[0151] This example provides the efficacy of sample 2 obtained in Example 8 on bone and joint health.

[0152] Sample: Sample 2 (5 g / day) of Example 8.

[0153] Subjects: A total of 10 adults.

[0154] Inclusion criteria: 20 years old or older.

[0155] Methods: Self-controlled trial was used. The subjects took 5 g of sample 2 before meals every day for 3 months. Blood samples were collected at 0 months and 3 months. The experimental data was statistically analyzed using Student's t-test in Excel (* indicates P < 0.05 relative to week 0).

[0156] Test items: Serum TNF-α level (inflammatory marker).

[0157] Detection method: After fasting blood collection, the test was entrusted to Rihua Testing Institute, and TNF-α was tested by ELISA KIT (Elabscience, E-EL-H0109).

[0158] Test results

[0159] TNF-α is one of the core inflammatory factors in the occurrence and development of arthritis. TNF-α not only directly destroys chondrocytes, but also stimulates synoviocyte fibroblasts and chondrocytes to produce inflammatory mediators including matrix metalloproteinase (MMP), accelerates the degradation of extracellular matrix, and leads to joint cartilage destruction and persistent inflammation.

[0160] As shown in Figure 9, after taking sample 2 for 12 weeks, the level of TNF-α decreased by 59.1%, and 90% of the subjects showed effective improvement. Therefore, sample 2 can reduce the level of inflammatory factors, thereby helping to prevent inflammatory reactions.

[0161] Example 12: Human efficacy test

[0162] This example provides the efficacy of sample 3 obtained in example 9 on bone and joint health.

[0163] Sample: sample 3 of example 9 (5 g / day).

[0164] Subjects: 10 adults in total.

[0165] Inclusion criteria: adults over 20 years old and with joint discomfort.

[0166] Method: self-controlled trial was used. The subjects took 5 g of sample before meals every day for 3 months. Self-assessment questionnaires were collected at weeks 0, 4 and 12. Detection method: self-assessment questionnaires were used to investigate the total score of WOMAC (The Western Ontario and McMaster Universities Osteoarthritis Index), joint pain score, stiffness score, and mobility score. The experimental data were statistically analyzed using Student's t-test in Excel (* indicates P < 0.05 relative to week 0, and ** indicates P < 0.01 relative to week 0).

[0167] Test results

[0168] As shown in Figure 10, after taking sample 3 for 12 weeks, the WOMAC score was significantly reduced by 58%, the joint pain score was reduced by 44%, the joint stiffness score was reduced by 66.7%, and the mobility score (physical function) was reduced by 60.5%, indicating that the sample 3 composition can effectively improve the joint stiffness of people with joint discomfort, thereby improving joint flexibility and effectively relieving joint pain to improve joint function and physical performance.

[0169] Although the present application has been illustrated and described with reference to certain preferred embodiments thereof, it should be understood by those skilled in the art that the foregoing is a further detailed description of the application and is not intended to limit the application to the specific embodiments described. Various changes in form and detail can be made thereto without departing from the spirit and scope of the application. Industrial applicability

[0170] The amino acid composition or mixture of the present application can be used as a health product, food product or food additive for non-therapeutic purposes to increase bone hardness, prevent inflammatory response, relieve joint pain, and improve joint flexibility, in other words, to treat and prevent osteoporosis, treat arthritis, relieve joint pain, and improve limited activity caused by joint problems.

Claims

1. An amino acid composition, wherein, The amino acid composition comprises the following amino acids or salts thereof in percentage by weight: 20.0-28.0% glycine, 13.0-18.0% proline, 6.0-10.0% alanine, 4.0-7.0% aspartic acid, 4.0-7.0% glutamic acid, 3.5-6.0% glutamic acid, 3.5-5.0% arginine, 3.0-4.5% isoleucine, 3.0-4.5% serine, 2.5-4.0% leucine, 2.0-3.2% threonine, 1.8-2.8% valine, 1.5-2.5% methionine, 1.5-2.5% isoleucine, 1.0-2.0% phenylalanine, 0.4-0.8% tyrosine, 0.3-0.6% histidine, and 0.3-0.6% tryptophan, and an additive.

2. The amino acid composition of claim 1, wherein, The additive comprises 1.5-6.0% relative to the total weight of the amino acid composition.

3. The amino acid composition of claim 2, wherein, The additive comprises 3.0-5.0% maltodextrin and / or 2.0-4.0% vitamin C.

4. Use of the amino acid composition according to any one of claims 1 to 3 and a berry extract for the preparation of a mixture for increasing bone stiffness.

5. The use of claim 4, wherein, The mixture is used for increasing bone mineral density.

6. The use of claim 4, wherein, The mixture is used for promoting osteoblast differentiation.

7. The use of claim 4, wherein, The mixture is used for inhibiting osteoclast differentiation.

8. Use of the amino acid composition according to any one of claims 1 to 3 and a berry extract for the preparation of a mixture for preventing inflammatory response.

9. The use of claim 8, wherein, The mixture is used for reducing inflammatory factor level.

10. The use of claim 9, wherein, The mixture is used for reducing TNF-a, IL-1β, iNOS level.

11. The use of claim 8, wherein, The mixture is used for preventing chondrocyte inflammation.

12. The use of any one of claims 4 to 11, wherein, The percentage by weight of the berry extract is 2.0-3.5% based on the total weight of the mixture.

13. The use of any one of claims 4 to 11, wherein, The berry extract is elderberry extract.

14. The use according to claim 13, wherein the elderberry extract is derived from the fruit of Sambucus nigra.

15. Use of the amino acid composition according to any one of claims 1 to 3 and a Curcuma plant extract for the preparation of a mixture for relieving joint pain.

16. The use of claim 15, wherein, The mixture is used for preventing joint wear.

17. The use of claim 16, wherein, The mixture is used for promoting secretion of cartilage collagen.

18. The use of claim 16, wherein, The mixture is used for promoting secretion of glucosaminoglycan.

19. Use of the amino acid composition according to any one of claims 1 to 3 and a Curcuma plant extract for the preparation of a mixture for increasing joint flexibility.

20. The use of claim 19, wherein, The mixture is used for improving joint stiffness.

21. The use of claim 19, wherein, The mixture is used for promoting secretion of cartilage collagen.

22. The use of claim 19, wherein, The mixture is used for promoting secretion of glucosaminoglycan.

23. The use of any one of claims 15 to 22, wherein, The percentage by weight of the Curcuma plant extract is 0.5-3.0% based on the total weight of the mixture.

24. The use of any one of claims 15 to 22, wherein, The Curcuma plant extract is turmeric extract.

25. The use according to claim 24, wherein the turmeric extract is derived from the rhizome of Curcuma longa.

Images