Methods for rejuvenating human cells with micro rnas
A cocktail of miRNAs and OSKMNL rejuvenates somatic cells by reducing epigenetic age without changing identity, addressing the limitations of existing OSKMNL-based methods and preventing pluripotency induction.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2026-04-09
AI Technical Summary
Existing methods for cellular rejuvenation, such as transient expression of OSKMNL factors, fail to significantly enhance epigenetic rejuvenation while maintaining cellular identity, and risk inducing pluripotency and teratoma formation.
Transient treatment of human somatic cells with a specific cocktail of miRNAs, including miR302a, miR302b, miR302c, miR302d, and miR367, combined with transient expression of OSKMNL, rejuvenates cells without changing their identity or inducing pluripotent stem cell formation.
The combination of miRNAs and OSKMNL effectively rejuvenates somatic cells by reducing epigenetic age by 5-20 years, maintaining cellular identity, and avoiding the formation of pluripotent stem cells.
Smart Images

Figure 00000022_0000 
Figure 00000023_0000 
Figure 00000024_0000
Abstract
Description
METHODS FOR REJUVENATING HUMAN CELLS WITH MICRO RNASCROSS-REFERENCE TO RELATED APPLICATION
[0001] Benefit is claimed to US Provisional Patent Application No. 63 / 702,159, filed October 2, 2024, the contents of which are incorporated by reference herein in their entirety.BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0002] The nucleotide sequences provided herewith are shown using standard letter abbreviations for nucleotide bases as defined in 37 CFR 1.831 through 37 CFR 1.835. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an XML file named 3231_4_2_seqlist, approximately 10,000 bytes, created September 29, 2025, the contents of which are incorporated by reference herein in their entirety.FIELD
[0003] Provided herein is a method using micro RNAs (miRNAs) alone, and in combination with factors to rejuvenate human cells.BACKGROUND
[0004] Aging is a universal biological phenomenon experienced by nearly all living organisms. It is characterized by a progressive decline in physiological functions, ultimately leading to various severe illnesses and mortality. This degenerative process fundamentally originates from the accumulation of molecular damage from the moment of birth, one key aspect of which is the dysregulation of DNA methylation, a type of epigenetic alteration.
[0005] During embryonic development, the epigenetic architecture of DNA plays a critical role in guiding cell fate and identity. However, as organisms age, this precisely regulated landscape undergoes significant changes across all cells, a process closely correlated with chronological age. This correlation has facilitated the development of so-called "epigenetic clocks." These tools can estimate the chronological age of any mammalian tissue sample with a considerable degree of accuracy based on its methylation landscape, as derived from methodologies such as Illumina methylation arrays.
[0006] Various in vitro and in vivo experiments involving mammalian subjects have demonstrated that recognized longevity treatments, including but not limited to calorie restriction, and treatment with Rapamycin or Metformin, can decelerate the progression of the epigenetic clock. Thisslowdown corresponds to an extension of both lifespan and health span. Strikingly, these epigenetic clocks were found to be more accurate predictors of mortality than chronological age itself.
[0007] As discussed in Puri et al (Bioessays 45 (2023)), prolonged induction of pluripotencyinducing transcription factors Oct4, Sox2, Klf4, c-Myc, NANOG, and Lin28a or "OSKMNL" will induce adult somatic cells to a pluripotent state. Although the epigenic clock in such cells is reset to 0, which is also accompanied by other cellular rejuvenation phenotypes, the cells lose their original somatic identity, and turn into pluripotent cells, and are therefore not relevant for therapeutic purposes where cell identity needs to be kept. Transient expression of OSKMNL does not lead to induction of pluripotency, and still allow clock reversal, yet reversal of the epigenetic clock was observed to be minor (-4.94 years in endothelial cells and -1.84 years in fibroblasts; see Sarkar et al., Nature Comm. 11:1545, 2020).
[0008] Therefore, if transient expression of OSKMNL factors is to be used for cellular rejuvenation, a continuing need exists to significantly enhance that potential. Moreover, it would be beneficial to develop additional rejuvenation methods that mitigate the risk of changing cellular identity even further, to reduce the risk of teratoma formation which can be the consequence of reaching pluripotency.SUMMARY
[0009] Described herein is the discovery that transient treatment of human somatic cells, such as but not limited to fibroblast or mesenchymal cells, with a specific cocktail of miRNAs can rejuvenate cells such as fibroblasts, without forming iPSCs or changing the identity of the original cells. Also described is the discovery that use of the noted miRNA cocktail in combination with transient expression of OSKMNL can enhance epigenetic rejuvenation in somatic cells significantly beyond that previously observed.
[0010] The methods described herein include a method for rejuvenating human somatic cells, such as but not limited to fibroblast, keratinocytes, prostate or mesenchymal cells, without changing cell identity or inducing formation of pluripotent stem cells, by transfecting human somatic cells with at least one micro RNA (miRNA), comprising miR302a, miR302b, miR302c, miR302d, and miR367, thereby rejuvenating the human somatic cells without changing cell identity or inducing formation of pluripotent stem cells.
[0011] Also described is a method for rejuvenating human somatic cells by transfecting human somatic cells with at least one micro RNA (miRNA), comprising miR302a, miR302b, miR302c, miR302d, and miR367; and transfecting the human somatic cells with nucleic acids encoding at least one of Oct4, Sox2, Klf4, c-Myc, NANOG, and Lin28a (OSKMNL); thereby rejuvenating the human somatic cells.
[0012] In particular embodiments of the described methods, the human somatic cells are transfected with miR302a, miR302b, miR302c, miR302d, and miR367.
[0013] In other particular embodiments, the human somatic cells are transfected at least once per day for at least 4-20 days, such as for at least 4 days or 7 days.
[0014] In some embodiments, the transfected human somatic cells are cultured in somatic cell culture media for at least 24 hours after the last transfection, such as 1-20 days.
[0015] In particular embodiments of the described methods, the transfected OSKMNL and / or miRNAs are provided as RNA.
[0016] In other embodiments, transfecting the human somatic cells includes transfecting the cells with a DNA expression vector encoding the OSKMNL and / or miRNAs, such as a plasmid or viral expression vector.
[0017] In certain embodiments, transfecting the human somatic cells is by electroporation.
[0018] In some particular embodiments, the human somatic cells that are transfected are isolated cells in vitro. In other particular embodiments, the human somatic cells are in a subject, and the OSKMNL and / or miRNAs are administered to the subject prior to their transfection into the human somatic cells.
[0019] In further particular embodiments, rejuvenating human somatic cells is indicated by a reduction in cellular epigenetic age or by cellular transcriptomic profiling.
[0020] In additional particular embodiments, the somatic cells are a cell type derived from multiple embryonic lineages, such as ectoderm, endoderm, or mesoderm.
[0021] The foregoing and other objects, features, and advantages will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.BRIEF DESCRIPTION OF THE FIGURES
[0022] Fig. 1 shows the epigenetic age of treated and non-treated NHDF 78F cells, and that OSKMNL alone cannot induce epigenetic rejuvenation. Epigenetic age was measured by the Horvath skin and blood method from DNA isolated from cells 6 and 23 days following final transfection with OSKMNL factors, but without miRNA. Determined epigenetic age is shown in the upper table and illustrated in the graph below. NHDF (normal human dermal fibroblast) was cultured in RPMI media (fibroblast support media) without any transfection (1); in RPMI + 4 daily transfections of OSKMNL followed by 6 days of RPMI (2). As another control, cells were cultured in NutriStem media (iPSC support media) without any transfection (3). Or in NutriStem media + 4 daily transfections of OSKMNLfollowed by 23 days of NutriStem (4) (numbering is according to chart in top panel). W.O. - Without; NT - Not Treated.
[0023] Fig 2 shows that miRNA addition to OSKMNL is critical for boosting rejuvenation. 7 Fibroblast cell lines (49M, 54F, 63F, 64F, 68F, 69F, 78F) were cultured in fibroblast media, transfected with OSKMNL factors two or three times for two or three days, together with the 5 miRNA cocktail as described. Following the final transfection, cells were cultured a further 4days as indicated in the graph). DNA was then isolated, and epigenetic age measured by the Horvath skin and blood method. Maximum rejuvenating effect is shown for each graph. The key to the conditions tested is shown in the figure.
[0024] Fig. 3 is a graph showing results of a CellNet analysis of cellular identity based on RNAseq profile of the cells treated in Fig. 2. 7 Fibroblast cell lines (49M, 54F, 63F, 64F, 68F, 69F, 78F) transfected with OSKMNL factors and 5 miRNA cocktail three times. Following the final transfection, cells were cultured for a further 4 days. As indicated in the graph the treated rejuvenated cells (horizontal lines in the graphs) kept their fibroblastic identity as the non-treated (NT) cells (dots in the graphs). Also shown are results for embryonic stem cells (ESC).
[0025] Fig. 4 shows the expression of the noted collagen genes in the seven Fibroblast cell lines (49M, 54F, 63F, 64F, 68F, 69F, 78F) transfected with OSKMNL factors and 5 miRNA cocktail three times, followed by a four-day recovery period prior to RNA isolation. Non-transfected (NT) and transfected samples are shown for each cell line and each collagen gene assayed.
[0026] Fig. 5 shows the epigenetic rejuvenation of NHDF 63F and NHDF 68F cells transfected with only five miRNAs at two different concentrations. Non-treated cells are also shown. Epigenetic age was determined by the Horvath skin and blood method.
[0027] Fig. 6 shows the results of a CellNet analysis of cellular identity of the cells from the experiment shown in Fig. 5based on RNAseq profile from RNA collected from the 63F and 68F cells transfected with the five noted miRNAs. Also shown are micrographs of transfected and nontreated (NT) NHDF 64F and 68F cultures. iPSC colony formation was determined visually. As indicated in the graph, the treated rejuvenated cells (horizontal lines in the graphs) kept their fibroblastic identity as the non-treated (NT) cells (dots in the graphs). Also shown are cellular identity results for other cells types. No iPSC colonies or other cell type identify were observed.
[0028] Fig, 7 shows the expression of the noted collagen genes in 63F and 68F cells transfected with the five noted miRNAs as described in Fig. 5. Non-transfected (NT) and transfected samples are shown for each cell line and each collagen gene assayed.
[0029] Fig. 8 shows the epigenetic rejuvenation of NHDF 68F and NHDF 78F cells transfected (5 or 16 times) with different identities of miRNAs as noted. Non-treated cells are also shown. Epigenetic age was determined by the Horvath skin and blood method.
[0030] Fig. 9 shows the results of a CellNet analysis of cellular identity based on RNAseq profile from RNA collected from the NHDF 68F and NHDF 78F cells transfected with miRNAs as noted and from the experiment described in Fig. 8. The graphs on the left display the scores across all cell types, while the graphs on the right display the scores specifically for fibroblasts.
[0031] Fig, 10 shows the expression of the noted collagen genes in the NHDF 68F and NHDF 78F cells transfected with miRNAs as noted and from the experiment described in Fig. 8.Nontransfected (NT) and transfected samples are shown for each cell line and each collagen gene assayed.
[0032] Fig. 11 shows epigenetic rejuvenation of NHDF 68F and NHDF 78F cells transfected with miRNAs and OSKMNL mRNA as noted. Non-treated cells are also shown. Epigenetic age was determined by the Horvath skin and blood method.
[0033] Fig. 12 shows micrographs of the transfected and nontreated (NT) NHDF 68F and 78F cultures from the experiment described in Fig. 11. As noted, transfected cells were treated with the five noted miRNAs and either the OSK factors or together with only Oct4. Representative micrographs were taken at the indicated days after the final transfection (XD).
[0034] Fig. 13 shows epigenetic rejuvenation of NHDF 68F and NHDF 78F cells transfected with miRNAs and Oct4 mRNA as noted. Non-treated cells are also shown. Epigenetic age was determined by the Horvath skin and blood method.
[0035] Fig. 14 shows the epigenetic rejuvenation of Prostate (39M) and Keratinocyte (80M) cells transfected with miRNAs and OSKMNL mRNA as noted. Non-treated cells are also shown.Number of transfections (XT) and culture days after final transfection (YD) are indicated. Epigenetic age was determined by the Horvath multitissue method.
[0036] Fig. 15 shows epigenetic rejuvenation of Mesenchymal stem cells (MSC) 57F and 63F transfected with miRNAs and Oct4 mRNA as noted. Non-treated cells are also shown. Epigenetic age was determined by the Horvath multitissue method.DETAILED DESCRIPTION
[0037] Terms
[0038] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms "a," "an," and "the" include plural referents unless context clearlyindicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. It is further to be understood that all molecular weight or molecular mass values are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The term "comprises" means "includes." The abbreviation, "e.g." is derived from the Latin exempli gratia, and is used herein to indicate a nonlimiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example."
[0039] Biological age: Health status of an organism or cell, as can be determined by relevant biomarkers. Correlates with the expected remaining lifespan of an organism, or division potential for mitotic cells in tissue culture. Biological age correlates with chronological age, but organisms with the same chronological age can have different biological ages.
[0040] Cell culture medium or media: synthetic set of culture conditions with the nutrients necessary to support the growth of a specific population of cells. Growth media generally include a carbon source, a nitrogen source and a buffer to maintain pH. In one embodiment, growth medium contains a minimal essential media, such as Dulbecco's Modified Eagle Medium (DMEM) or Roswell Park Memorial Institute (RPMI) medium. Other cell culture media, such as NutriStem culture medium (Sartorious) is tailored for stem cell growth.
[0041] Chronological age: The age of an organism as a function of time, for example weeks or years.
[0042] Contacting: Placement in direct physical association. Includes both in solid and liquid form. Contacting can occur in vitro with isolated cells or in vivo by administering to a subject.
[0043] Differentiation refers to the process whereby unspecialized cells (e.g., stem cells or pluripotent stem cells) acquire specialized structural and / or functional features characteristic of more mature cells. Similarly, "differentiate" refers to this process. Typically, during differentiation, cellular structure alters, and tissue-specific proteins appear.
[0044] Effective amount of a compound: A quantity of compound sufficient to achieve a desired effect.
[0045] Epigenetic age: An estimate of chronological and biological age as determined by an algorithm that takes into account methylation levels of specific genomic CpG sites, such as in the human genome. Multiple algorithms of measuring this "epigenetic clock" have been developed, which can be used to determine epigenetic rejuvenation of different cell and tissue types, depending on the method, following the subject methods. Particular methodology for measuring the epigenetic clock and its correlation to chronological and biological age have been described by Horvath (see Genome Biology. 14 (10): R115. doi:10.1186 / gb-2013-14-10-rll5, 2013).
[0046] Expand: refers to a process by which the number of cells in a cell culture is increased due to cell division.
[0047] Isolated: A biological component, such as a cell or tissue that has been substantially separated or purified away from other biological components in the organism in which the component naturally occurs, i.e., other cells and tissues.
[0048] MicroRNA (miRNA): RNA molecule of 18-24 nucleotides long. Endogenously produced in cells from longer precursor molecules of transcribed non-coding RNA. miRNAs can recognize target mRNAs through complementary or near-complementary hybridization leading to translational inhibition either via direct cleavage of the mRNAs or via potentiation of their degradation via hindering the mRNA circularization necessary for translation. miRNA is produced as a single-stranded stem-and- loop structure (pri-miRNA) that is first cleaved in the nucleus by DROSHA to release the stem-and-loop pre-miRNA. It is then exported to the cytosol where it is cleaved by DICER to produce a mature miRNA - a dsRNA 18-24 bp long with 3' overhangs generated by DICER.
[0049] Rejuvenation (of a cell): Decreasing the biological age of a cell. Cellular rejuvenation can be determined by, among other indications, decreased epigenetic age of a cell, as measured by epigenetic clock algorithms such as the Horvath epigenetic clock. Rejuvenation of cells can also be determined by transcriptomic profiling of the cells prior to and following the rejuvenation process. Other measures of cellular rejuvenation include telomere length, mitochondrial ROS levels, proteasome activity, and Autophagosome formation.
[0050] Stem cell, Pluripotent Stem cell: A stem cell refers to a cell that can differentiate into more than one given cell type. A pluripotent stem cell naturally exists in the blastocyst embryo state, and can differentiate into all of the cells of the human body. An induced pluripotent stem cell (iPSC) has the properties of a pluripotent stem cell, but has been induced ex vivo from a differentiated cell by a process of cellular reprogramming.
[0051] In case of conflict, the present specification, including explanations of terms, will control. In addition, all the materials, methods, and examples are illustrative and not intended to be limiting.
[0052] Methods for Rejuvenating Somatic Cells with miRNAs
[0053] Described herein is a method for rejuvenating isolated somatic cells in culture. In particular embodiments, the described method involves transiently transfecting or otherwise expressing one micro RNA (miRNA) including miR302a, miR302b, miR302c, miR302d, and miR367 while, in particular embodiments, also transfecting or otherwise expressing the OSKMNL factors, in a plurality of human somatic cells, such as isolated somatic cells. In other embodiments, which do not change cellidentity of the end-product cells or induce formation of pluripotent stem cells, the combination of miRNAs is provided to the cells, but without the OS KM NL factors. In particular embodiments of both methods more than one of the listed miRNAs are provided, such as 1, 2, 3, 4, or all 5 of the listed miRNAs, either alone or in combination with OSKMNL.
[0054] The described methods involve transfecting or otherwise expressing one or a combination of micro RNAs (miRNAs) with or without OSKMNL in a plurality of human somatic cells, such as isolated somatic cells that are cultured in vitro. In other embodiments, the cells are transiently transfected with OSKMNL and / or the combined miRNAs in vivo. In the described methods, cells are exposed (e.g., by transfection of the miRNAs or transcription factors, or by one or more expression vectors that encode the miRNAs or transcription factors) to a combination of OSKMNL and / or miR302a, miR302b, miR302c, miR302d, and miR367, which together induce epigenetic reprogramming and cellular rejuvenation. It will be appreciated that although this disclosure describes that the subject methods are using miR302a, miR302b, miR302c, miR302d, and miR367, functional analogs of these miRNAs, which target the same mRNAs, are also encompassed. Accordingly, in particular embodiments, one or more of the miR302a, miR302b, miR302c, miR302d, and miR367 can be substituted with a functionally analogous sequence.
[0055] miRNAs are small non-coding RNAs that bind to complementary messenger RNAs (mRNAs) and subsequently regulate protein expression. miRNAs are synthesized as long singlestranded RNAs (pri-miRNA) that fold into hairpin loop structures (pre-miRNA). These hairpins are processed by the enzymes drosha and dicer into double-stranded mature miRNAs. The guide strand complementary to target mRNA transcripts is loaded into argonaute (AGO) proteins while the passenger strand is removed. The guide strand / AGO complex then binds by sequence complementarity to targets that are typically located within 3'-untranslated regions (3'-UTR) of mRNAs.
[0056] In particular embodiments, somatic cells to be rejuvenated are transfected with miRNAs including but not limited to mature miR302a, miR302b, miR302c, miR302d, and miR367. The sequences of these mature miRNAs for use in the described methods are as follows: miR302a: UAAGUGCUUCCAUGUUUUGGUGA (SEQ ID NO: 1), miR302b:UAAGUGCUUCCAUGUUUUAGUAG (SEQ ID NO: 2), miR302c UAAGUGCUUCCAUGUUUCAGUGG (SEQ ID NO: 3), miR302d UAAGUGCUUCCAUGUUUGAGUGU (SEQ ID NO: 4), and miR367 AAUUGCACUUUAGCAAUGGUGA (SEQ ID NO: 5). In other embodiments, pri-miRNAs are transfected into the somatic cells to be rejuvenated. The sequences of the pri-miRNAs that can be transfected are as follows: miR302a: ccaccACUUAAACGUGGAUGUACUUGCUuugaaacuaaagaagUAAGUGCUUCCAUGUUUUGGUGAugg (SEQ ID NO: 6), miR302b: gcucccuucaACUUUAACAUGGAAGUGCUUUCugugacuuuaaaagUAAGUGCUUCCAUGUUUUAGUAGgagu(SEQ ID NO: 7), miR302c ccuuugcUUUAACAUGGGGGUACCUGCUGugugaaacaaaagUAAGUGCUUCCAUGUUUCAGUGGagg (SEQ ID NO: 8), miR302d ccucuACUUUAACAUGGAGGCACUUGCugugacaugacaaaaaUAAGUGCUUCCAUGUUUGAGUGUgg (SEQ ID NO: 9), and miR367 ccauuACUGUUGCUAAUAUGCAACUCUguugaauauaaauuggAAUUGCACUUUAGCAAUGGUGAugg (SEQ ID NO: 10). It will be appreciated that the sequences of the mature and pri-miRNAs for use in the described methods can be varied such that their function is unchanged. Therefore, 1, 2, 3 or more nucleotides in the described mature or pri-miRNAs can be changed from the indicated sequences, so long as the miRNA function is retained. Such variant sequences include variations of miR302a, miR302b, miR302c, miR302d, and miR367 that are less than 100% identical to miR302a, miR302b, miR302c, miR302d, and miR367, such as 99%, 98%, 95% or less identical but that can still target the same mRNAs.
[0057] In particular embodiments, the described miRNAs can be chemically modified to improve nuclease resistance and increase binding affinity. Illustrative sequence modifications to increase potency include 2' sugar modifications, such as 2'-O-Methyl (2'-0-Me), 2'-O-methoxyethyl (2'- MOE), or 2'-fluoro (2'-F). The nucleic acid structure of the miRNA can also be modified into a locked nucleic acid (LNA) with a methylene bridge between the 2' oxygen and the 4' carbon to lock the ribose in the 3'-endo conformation. This modification significantly increases both target specificity and hybridization properties of the molecules. Other modifications include 5'-(E)-Vinylphosphonate protection (5'-VP), backbone modifications (phosphorothioate (PS), Peptide Nucleic Acid (PNA), Phosphorodiamidate Morpholino Oligonucleotide (PMO), Ethylene-bridged Nucleic Acid (ENA), 5- Methylcytosine modification, introduction of a "pyrimidine cassette" and / or introduction of a "DNA gap". In particular embodiments, one or more of the described miRNA sequences contain no chemical modifications. In other embodiments, the miRNA sequences are partially modified, and in still other embodiments, the miRNA sequences are fully modified, such that every nucleotide or internucleotide bond is modified from the native sequence.
[0058] In certain embodiments, one or more of the described miRNA sequences is linked (covalently or non-covalently) to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the miRNA sequence. Such moieties include, without limitation, lipid moieties such as a cholesterol moiety, or a ligand to a cellular receptor.
[0059] Rejuvenation of somatic cells by the described combination of OSKMNL and / or miRNAs requires the presence of the OSKMNL factors and / or the miRNAs in the target cellular compartment (e.g., nucleus for OSKMNL; cytoplasm for miRNAs) for sufficient time to induce epigeneticreprogramming and cellular rejuvenation. In a particular embodiment, sufficient cellular dwell time and activity is achieved by multiple rounds of transfecting the subject somatic cells with the described combination of OSKMNL and / or miRNAs, with each round of transfection separated by a given amount of time, such as but not limited to 6, 12, 18, or 24 hours. In a particular embodiment, the target somatic cells are transfected once with the miRNA combination. In other embodiments, the target somatic cells are transfected multiple times with the miRNA combination, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more times.
[0060] In particular embodiments of the methods described herein, after the final transfection or round of expression of the noted transcription factors (with or without miRNAs), the subject cells are further cultured in suitable media for 1-20 days, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days or increments in between.
[0061] In a particular embodiment, miR302a, miR302b, miR302c, miR302d and miR367 with and without OSKMNL are provided to the cells by standard transfection methods known to the art such as, but not limited to electroporation and standard lipofectamine-mediated nucleic acid transfection. In an alternative embodiment, somatic cells to be rejuvenated are transfected with an inducible expression vector that encodes the miRNAs and OSKMNL. In still other embodiments, one or more of the miRNAs are transfected as RNA while the OSKMNL are transfected in the context of an expression vector. Similarly in still other embodiments, OSKMNL can be transfected in mRNA form while the miRNAs are provided by way of an expression vector. It will be appreciated that not all of the miRNAs must be provided to cells by the same method. Accordingly, while one or more miRNAs can be provided in RNA form, one or more miRNAs can be provided by one or more expression vectors. miRNAs encoded by such vectors can be in mature form, or alternatively in the pri-miRNA form that is then processed by the cell into the mature, functional miRNA.
[0062] Suitable expression vectors for delivery of and expressing OSKMNL-encoding and miRNA-encoding sequences include, without limitation, DNA plasmids, viral vectors or DNA minicircles. Generation of the vector construct can be accomplished using any suitable genetic engineering techniques well known in the art. It will be appreciated that through vector-borne induction systems, the presence of OSKMNL (when provided), miR302a, miR302b, miR302c, miR302d, and miR367 in the cytoplasm can be controlled by the presence of the inducing agent, and so multiple rounds of miRNA transfection are not required in such embodiments. In particular embodiments, one or more of OSKMNL, miR302a, miR302b, miR302c, miR302d, and miR367 are expressed from the same vector. In other embodiments, one or more of OSKMNL, miR302a, miR302b, miR302c, miR302d, and miR367 are expressed from 2, 3, 4, or 5 different vectors.
[0063] In addition to regulating the presence of OSKMNL, miR302a, miR302b, miR302c, miR302d, and miR367 in the cell by the number of times the transcription factors and miRNAs are transfected or by the length of time the transcription factors and miRNAs are expressed, the activity of the OSKMNL factors and the miRNAs for transfection into the cell can be improved by formulations known to the art that enhance delivery of the OSKMNL and miRNAs in the cell and / or extend their halflife. For example, in a particular embodiment the described miRNA combination and mRNA encoding the OSKMNL factors can be formulated into a lipid nanoparticle (LNP) formulation. In some embodiments, LNP delivery of oligonucleotides, such as miRNAs, involves encapsulation of the oligonucleotides inside a nanoparticle made of two or optionally three components: structural lipids that form the lipid bilayer and maintain its rigidity; a cationic lipid to promote the incorporation of the negatively charged oligonucleotides into the particle and to facilitate escape from the endosomal pathway after cell internalization; and optionally (in embodiments that the LNP is administered in vivo, a "shield", often polyethylene glycol, to increase circulation time and minimize plasma protein binding. In another embodiment, the miRNAs can be formulated in sustained release nanoparticle compositions, such as with biodegradable polymers (e.g., PGA, PLA, PGLA, and the like) which will slowly release active miRNA into the cytoplasm over a pre-set number of days. It will be appreciated that such formulations can in certain embodiments be used of in vivo, systemic delivery of the noted miRNAs with and without the OSKMNL factors to a subject.
[0064] Typically, the somatic cells that are transfected by the miRNAs with or without mRNA encoding OSKMNL, or expressing vectors thereof, are isolated and grown in culture by standard methods in the art. It will be understood that although cell culture media for use in the described methods is typically standard, in particular embodiments, such media is tailored according to the particular somatic cell type.
[0065] Particular embodiments of the described methods, in which cells are provided with OSKMNL and miRNAs rejuvenate the cells, such as measured by the epigenetic clock, more robustly than previously reported by use of transient expression of OSKMNL alone. In other embodiments that employ the miRNA combination but do not use OSKMNL, the described methods rejuvenate cells with reduced risk of changing cellular identity or inducing formation of pluripotent stem cells, such that by the completion of the described rejuvenation method, while the epigenetic clock of the cells has been decreased by several years (e.g., 5-20 years), cellular somatic identity is unchanged. Rejuvenation of cells and the retention of original cellular identity can be verified in several ways.
[0066] One method to determine cellular identity after processing the cells in the described methods is through observation of cellular morphology. For example, iPSC colonies possess a morphology that is distinct from that of normal human fibroblasts.
[0067] Similarly, somatic cells possess distinct biochemical identities which can be assayed to distinguish a somatic cell from an iPSC or from another type of somatic cell. In a particular embodiment, following the described method, a sample of the processed cells can be assayed for expressed mRNA. Subsets of expressed RNA or even the entire cellular transcriptome can be determined by methods known to the art, for example RNA-seq methodology to sequence the entire cellular transcriptome, and thereby distinguish one cell type from another by way of the expressed RNA. In another embodiment, cells can be assayed for expression of particular cell surface receptors that are specific to the particular somatic cell type, for example, by immunocytochemistry or immunofluorescence.
[0068] Any isolated human somatic cell, derived from any embryonic lineage (e.g., ectoderm, mesoderm, or endoderm), any tissue, and any organ, can be the object of the described method. Somatic cells are all cells of a multicellular organism except for gametes. Particular non-limiting sources of human somatic cells that can be the object of the described methods include cells that are isolated from bone marrow, peripheral blood, umbilical cord blood, muscle, connective tissue, cartilage, organs such as but not limited to pancreas, liver, kidney, prostate, and skin. In particular embodiments, the somatic cells are skin derived cells such as fibroblasts, are of hematological origin including cells of the immune system, including T cells, B cells, and macrophages, adipose cells, epithelial cells, endothelial cells, mesenchymal-derived cells, parenchymal cells (for example, hepatocytes), neurological cells, and connective tissue cells. Among the foregoing cells are multipotent stem cells (for example, but not limited to, hematopoietic stem cells, mesenchymal stem cells, chondroblasts, mammary stem cells, endothelial stem cells, intestinal stem cells, olfactory stem cells, neural stem cells, testicular cells, and neural crest stem cells) which while able to further differentiate into fully differentiated or unipotent cells, are not totipotent in the way of iPSCs.
[0069] The rejuvenation methods described herein reverse the epigenetic clock of somatic cells, whether in culture or in a subject following in vivo systemic delivery of the noted factors and / or miRNAs, such as by 5-20 years. In those embodiments that only provide the noted miRNAs, such epigenetic rejuvenation is without risk of induction of pluripotency. It will be appreciated that induction of pluripotency (i.e., changing the identity of a somatic cell to an induced pluripotent stem cell), results in a complete resetting of the epigenetic clock to at or near zero, but also changes the identity of the somatic cell into a pluripotent cell. In contrast, the methods described herein decrease cellular epigenetic age, while maintaining cellular identity and without inducing pluripotent stem cells. In particular embodiments, including those methods that combine OSKMNL and miRNAs, as well as those that provide only the combination or miRNAs, epigenetic age is reduced by about 5-20 years, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 years, or increments in between.
[0070] Somatic cells that have been rejuvenated by the described methods can be used in therapeutic and cosmetic autologous cell therapies. In particular applications of the described methods, somatic cells are isolated from a subject to be treated, rejuvenated according to the described methods, expanded, and then used as needed for the particular therapeutic or cosmetic application. It will be appreciated that the downstream applications of such embodiments of the currently described methods are not limited in any way other than the ability to isolate a particular cell type, rejuvenate the cells according to the described method, and then use of the rejuvenated cells in the particular application.
[0071] In other embodiments, the described miRNAs with or without the OSKMNL factors are provided to a subject in vivo by standard methods in the art of delivering nucleic acids for entry into a cell and expression. In such embodiments, the described methods of cellular rejuvenation can be used to treat diseases and conditions effected by cellular and tissue aging.
[0072] The following examples are provided to illustrate certain particular features and / or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.EXAMPLES
[0073] Example 1: Transient Treatment of fibroblasts with OSKMNL but without miRNAs cannot reduce epigenetic age or induce stem cell formation
[0074] This example demonstrates that short-term transient transfection with OSKMNL factors can reduce epigenetic age of fibroblasts in culture, but only when co-transfected a cocktail of five specific miRNAs. The rejuvenating effect of the OSKMNL and miRNAs combination is significantly greater than that shown by Sarkar et al., which only used OSKMNL and presented statistically borderline results.
[0075] Prior to treatment, fibroblast cell line NHDF 78F was cultured in RPMI media supplemented with 10% FBS. During the assay, cells were cultured in either fibroblast (supplemented RPMI) or iPSC culture media NutriStem® hPSC XF Medium cat#05-100-lA, SATORIUS).
[0076] Cells were transfected with OSKMNL mRNAs (OCT4 , SOX2, KLF4, MYC, NANOG, LIN28a), with and without mixture of five miRNAs (miR302a, miR302b, miR302c, miR302d, miR367). OSKMNL mRNA was produced in-house from a DNA vector suitable to IVT (In Vitro Transcription), particularly using the Invitrogen™ MEGAscript™ T7 Transcription Kit (cat# AMB13345) and the pSTl vector from VectorBuilder. The plasmid contains the following elements: T7 promoter, 5UTR, Kozak Sequence, Coding sequence, 3UTR and Poly A. The IVT process was performed according to the MEGAscript protocol, nucleotide ratio was optimized, ARCA (cat# N-7003-10) capping was used.The mRNA product was cleaned using the MegaClear Kit (cat#AM1908). dsRNA residual was removed using Cellulose cleaning. Coding sequences for the OSKMNL factors were isolated, optimized, and cloned into the pSTl vector according to standard procedures. Cloned sequences were verified and derived from the human gene sequences found in the public databases (e.g., ncbi.nlm.nih.gov) at the following accession numbers: 0CT4 (P0U5F1): NM_002701.6; S0X2: NM_003106.4; KLF4: NM_004235.6; MYC: NM_002467.6; NANOG: NM_024865.4; and LIN28a: NM_024674.6.
[0077] miRNAs were purchased from Life Technologies: (miR302a: Cat. # MC10936; miR302b: Cat. # MC10081; miR302c: Cat. # MC10571; miR302d: Cat. # MC10927; and miR367: Cat. # MC10832)
[0078] Transfections were carried out by the lipofection method (according to manufacturer protocol) once daily for four days with the addition of interferon Inhibitor. Medium was changed 12-18 hours after each transfection. Following the last transfection on day four, cells were cultured for a further 6 and 23 days in RPMI fibroblast support media. DNA was isolated and sent to Infinium Methylation EPIC array to evaluate the methylation change on the cells. Methylation data was processed according to the Horvath skin and blood clock protocol, an estimate of chronological and biological age as determined by an algorithm that takes into account methylation levels of specific CpG sites of the human genome. Multiple algorithms of measuring this "epigenetic clock" have been developed, all of which can be used to determine epigenetic rejuvenation of cells following the subject methods. Particular methodology for measuring the epigenetic clock and its correlation to chronological and biological age have been described by Horvath (see Genome Biology. 14 (10): R115. doi:10.1186 / gb-2013-14-10-rll5, 2013).
[0079] Fig. 1 shows that when cells were treated with OSKMNL factors alone (i.e., in the absence of miRNAs), epigenetic age was not reduced, regardless of culture medium and culturing time.
[0080] To confirm whether addition of miRNAs is necessary for OSKMNL epigenetic rejuvenation, co-transfection of OSKMNL mRNAs and five miRNAs was tested on seven fibroblast cell lines (49M, 54F, 63F, 64F, 68F, 69F, 78F), cultured in RPMI supplemented with 10% FBS. Transfection was carried as described above, except only two or three transfections were performed, followed by four days additional culturing in RPMI fibroblast support media. DNA was then isolated and sent to Infinium Methylation EPIC array to evaluate the methylation change on the cells. Methylation data was processed according to the Horvath skin and blood clock protocol.
[0081] As shown in Fig. 2, co-transfection of OSKMNL mRNAs with the noted five miRNAs results in a significant decrease in cellular epigenetic age in all cell lines tested. The degree of rejuvenation correlated with the number of rounds of transfections. Across all cell lines tested, the range in maximum rejuvenating effect was from 10 (in 49M) to 16 years (in 64F).
[0082] To determine if the treatment with OSKMNL and miRNAs affected cellular identity, the treated and non-treated cells were assessed by the CellNet method using the RNAseq profile of RNA isolated from the treated and non-treated cells lines (Cahan et al., Cell 158(4):903-915, 2014). CellNet is a network-biology-based, computational platform that assesses the fidelity of cellular engineered cells to different cell types through the construction and classification of gene regulatory networks (GRNs) based on RNA-Seq data. CellNet is a Random Forest Classifier model which is trained on various RNA- Seq samples from different tissue sources. Each tested sample is given a score (between 1 to 0) for its similarity to the GRNs of each cell or tissue type in the trained data.
[0083] As shown in Fig. 3, CellNet analysis verifies that following the described method, the transcriptome of the resultant cells are fibroblasts (horizontal lines in the graphs), similar to the transcriptome of non-treated cells (dots in the graphs).
[0084] The results shown in Figs. 1-3 show that significant epigenetic rejuvenation by OSKMNL requires miRNA addition, and that OSKMNL transfections without miRNA were not able to rejuvenate fibroblasts. The results shown herein also demonstrate that two or three transfections with OSKMNL mRNA and noted five miRNAs can rejuvenate fibroblasts by 10 to 16 years without changing cellular identity. In contrast, it was previously reported that transfection with OSKMNL mRNAs was sufficient to rejuvenate cells a maximum of 5 years (Sarkar et al., 2020). However, not only is Sarkar's result within the margin of error, but it is also significantly less robust than that observed when OSKMNL is combined with miRNAs.
[0085] One of the primary functions of dermal fibroblasts is collagen synthesis. Accordingly, the expression level of collagens was compared between the treated cells and untreated cells described above. 7 Fibroblast cell lines (49M, 54F, 63F, 64F, 68F, 69F, 78F) were transfected two or three times with OKSMNL and the noted five miRNAs as above, and then allowed to grow for an additional four days. The expression level of several collagen genes (COL4A1, COL4A2, COL1A1, COL5A1, COL5A2, COL7A1, COL11A1) was measured using the RNAseq profile of RNA isolated from the treated and untreated cells lines. The expression level of the noted collagen genes was determined by RNAseq analysis as follows: RNA from triplicate of each sample was extracted and library cDNA of all samples was created and sent for sequencing. The raw data analysed as follows: BCL files are processed into raw fastq files using Picard. Raw FASTQ. files are assessed for quality, adapter content with FastQC and filtered for quality and adapter content using TrimGalore. Reads are aligned to the Human genome (GRCh38) using the STAR aligner (v2.7.11a). Reads are deduplicated using UMI identifier with Picard MarkDuplicates. Number of reads per gene is quantified using HTseq-Count.
[0086] As shown in Fig. 4 the treated (rejuvenated) fibroblasts expressed collagen genes at a higher level than the non-treated cells.
[0087] Example 2: miRNA-mediated rejuvenation of fibroblasts
[0088] Example 1 demonstrated that efficient epigenetic rejuvenation of fibroblasts by OSKMNL factors requires co-transfection with miRNAs. Example 2 shows that miRNAs are sufficient to rejuvenate cells even in the absence of the OSKMNL factors, thereby further reducing possible risk of iPSC formation due to OSKMNL expression.
[0089] Fibroblast cell lines NHDF 63F and 68F were cultured in RPMI supplemented with 10% FBS, and transfected with the five-miRNA cocktail as in Example 1. Cells were transfected fourteen times, followed by an additional four days of culturing after the final transfection. DNA was isolated and sent to Infinium Methylation EPIC array to evaluate the methylation change on the cells. Methylation data was processed according to the Horvath skin and blood. To determine if the treatment with miRNAs affected cellular identity, cells were assessed by the CellNet method using the RNAseq profile of RNA isolated from the treated and untreated cells lines. Additionally, iPSC formation was monitored visually in transfected cells. Moreover, collagen synthesis was examined by measuring expression of collagen genes.
[0090] Fig. 5 shows that fourteen rounds of transfection with miRNAs have a rejuvenating effect on both 63F and 68F cells, and demonstrates that transfection with miRNAs alone has a rejuvenation potential. As shown by the CellNet analysis presented in Fig. 6, the rejuvenated cells show fibroblasts identity and not any other cell type meaning original cellular identity was maintained. Moreover, transfection with miRNAs does not result in iPSC colony formation in the 64F and 68F cells.
[0091] As described in Example 1, the expression level of several collagen genes (COL4A1, COL4A2, COL1A1, COL5A1, COL5A2, COL7A1, COL11A1) was measured using the RNAseq profile of RNA isolated from the treated and untreated 63F and 68F cells. As shown in Fig. 7, the treated (rejuvenated) fibroblasts expressed collagen genes at a higher level than the non-treated cells.
[0092] Taken together, Figs. 5-7 indicate that epigenetic rejuvenation of somatic cells can be achieved by transfection with miRNAs alone, and with reduced risk of developing iPSCs.
[0093] To determine whether epigenetic rejuvenation of somatic cells can be achieved by transfection with fewer than the noted five miRNAs, two Fibroblast cell lines (68F and 78F) were cultured in a suitable medium (RPMI supplemented with 10% FBS) regular incubation condition, and transfected with different combinations of the five miRNAs. The cells were either not treated, or transfected with (a) all five miRNAs (miR302a,b,c,d and miR367), (b) mir302a, (c) mir302b, (d) mir302c, (e) miR367, (f) miR302a+miR367, (g) miR302a+miR302b+miR302c, (h) miR302b+miR302c+miR367, (i) miR302a+miR302d+miR367, or (j) miR302a+ miR302c +miR302d+miR367. Cells were transfected five or sixteen times, and then allowed to grow in culture for an additional 9-10 days prior to DNA extractionand processing as above. As shown in Fig. 8 separate miRNAs are each sufficient to epigenetically rejuvenate the cells. Of the 5 miRNAs, miR302a showed the most robust ability to rejuvenate the cells. Fig. 8 also demonstrated that combination treatments did not provide a significant rejuvenating advantage over transfection with the separate miRNAs.
[0094] To determine if 68F and 78F treated with the noted combinations of miRNAs affected cellular identity, cells were assessed by the CellNet method using the RNAseq profile of RNA isolated from the treated and untreated cells lines. As shown in Fig. 9, the rejuvenated cells show fibroblasts identity and not any other cell type identity.
[0095] As described above, the expression level of several collagen genes (COL4A1, COL4A2, COL1A1, COL5A1, COL5A2, COL7A1, COL11A1) was measured using the RNAseq profile of RNA isolated from the treated and untreated 68F and 78F cells. RNA was isolated 7 or 8 days after the final transfection of miRNAs. As shown in Fig. 10 the treated (rejuvenated) fibroblasts expressed collagen genes at a higher level than the non-treated cells.
[0096] Example 3: Sufficiency of miRNAs and Transcription Factor combinations to induce cellular rejuvenation
[0097] Example 1 demonstrates that epigenetic rejuvenation can be induced by a combination of five specific miRNAs and the OSKMNL transcription factors. In this example, the ability to induce rejuvenation with the miRNAs and varying subsets of the OSKMNL factors was assayed.
[0098] Two Fibroblast cell lines (68F and 78F) were cultured as above under standard incubation condition. Cells were treated as above with 5 and 15 daily transfections of miRNAs (miR302a, miR302b, miR302c, miR302d, and miR367) in combination with mRNAs encoding the following: (a) OSKMNL (Oct4, Sox2, Klf4, Myc,Nanog and Lin28), (b) Oct4, (c) Sox2, (d) Klf4, (e) Nanog, (f) Lin28, (g) OSK (Oct4, Sox2 and Klf4), (h) Oct4+Sox2, or (i) NSL (Nanog, Sox2 and Lin28). After the last transfection (5 or 15), the cells continued to grow under the same culture conditions but without transfections and were taken for DNA extraction after 9-10 days. The DNA was sent to Infinium Methylation EPIC array to evaluate the methylation change on the cells. This data has been processed according to the Horvath skin and blood protocol. Morphology of treated and non-treated (NT) cells was also assessed microscopically at several days following the last transfection.
[0099] As shown in Fig. 11, the combination of the 5 miRNAs with the one or more OSKMNL genes provides a rejuvenating effect. Additionally, as shown in Fig. 12, rejuvenated cells demonstrated normal fibroblast morphology and did not display stem cell morphology. Accordingly, when cells were treated with the combination of the 5 miRNAs with only one of the OKSMNL mRNAs, there was no riskof stem cell formation. Of the conditions tested, the combination with Oct4 alone showed the greatest rejuvenating effect.
[0100] To further explore the sufficiency of Oct4 and miR302a to epigenetically rejuvenate fibroblasts, two Fibroblast cell lines (68F and 78F) were cultured as above under standard incubation condition. Cells were treated as above with 5 and 15 daily transfections of the following: (a) all five miRNAs (miR302a, miR302b, miR302c, miR302d, and miR367), (b) Oct4 + the 5 miRNAs, (c) Oct4, (d) mir302a, and (e) Oct4+miR302a. After the last transfection (5 or 15), the cells continued to grow under the same culture conditions but without transfections and were taken for DNA extraction after 7 days. The DNA was sent to Infinium Methylation EPIC array to evaluate the methylation change on the cells. This data has been processed according to the Horvath skin and blood protocol.
[0101] As shown in Fig. 13, when the cells were treated with only the combination of Oct4 and miR302a, a robust rejuvenation effect was observed, even after fewer (7) transfections than performed in the examples described above.
[0102] Example 4: Rejuvenation of prostate and keratinocyte cells
[0103] Previous examples demonstrated that it is possible to epigenetically rejuvenate fibroblasts with a combination of OSKMNL factors, or subset thereof, and five specific miRNAs, miR302a, miR302b, miR302c, miR302d, and miR367, or a subset thereof. This example shows that this ability of OKSMNL and miRNAs is not limited to fibroblasts but will also induce rejuvenation in multiple somatic cell types of different embryonic lineages than mesoderm, as prostate cells are derived from the endoderm and keratinocytes are derived from the ectoderm.
[0104] A prostate cell line (39M) and a Keratinocyte cell line (80M) were cultured in suitable media according to manufacturer instructions. Treated cells were transfected daily 4 or 8 times with mRNA of OSKMNL (OCT4, SOX2, KLF4, MYC, NANOG, LIN28a), combined with miR302a, miR302b, miR302c, miR302d, and miR367. After the last transfection, the cells were cultured for an additional 10- 14 days under the same culture conditions, following which DNA was extracted for analysis by the Infinium Methylation EPIC array to evaluate the methylation change on the cells. Collected methylation data was then processed according to Horvath multitissue clock algorithm.
[0105] As shown in Fig. 14, the combination of 5 miRNAs and OSKMNL epigenetically rejuvenated the treated prostate and keratinocyte cells.
[0106] Accordingly, using the described method, it is possible to rejuvenate multiple cell types from multiple embryonic lineages. This demonstrates the wide variety of somatic cells that can be epigenetically rejuvenated as described.
[0107] Example 5: Rejuvenation of mesenchymal stem cells
[0108] This example shows the ability to epigenetically rejuvenate mesenchymal stem cells using at least one of the noted miRNAs with and without the Oct4 transcription factor.
[0109] Two mesenchymal stem cell (MSc) cell lines (57F, 63F) were cultured in a suitable medium (M-ALPHA supplemented with 20% FBS) under standard incubation conditions. Treated cells were transfected daily 9 times with (a) miR302a, miR302b, miR302c, miR302d, and miR367, (b) miR302a, or (c) mir302a + mRNA of OCT4. After the last transfection, the cells were cultured for an additional 7 days under the same culture conditions, following which DNA was extracted for analysis by the Infinium Methylation EPIC array to evaluate the methylation change on the cells. Collected methylation data was then processed according to Horvath multitissue clock algorithm.
[0110] As shown in Fig. 15, treatment with the 5 miRNAs epigenetically reprogrammed the tested Msc cells. Moreover, treatment with miR302a alone and in combination with Oct4 provided a greater rejuvenating effect at number of transfections provided (9).
[0111] In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.
Claims
CLAIMS1. A method for rejuvenating human somatic cells, without changing cell identity or inducing formation of pluripotent stem cells, comprising: transfecting human somatic cells with at least one micro RNA (miRNA), comprising miR302a, miR302b, miR302c, miR302d, and miR367, thereby rejuvenating the human somatic cells without changing cell identity or inducing formation of pluripotent stem cells.
2. A method for rejuvenating human somatic cells, comprising: transfecting human somatic cells with at least one micro RNA (miRNA), comprising miR302a, miR302b, miR302c, miR302d, and miR367; and transfecting the human somatic cells with nucleic acids encoding at least one of Oct4, Sox2,Klf4, c-Myc, NANOG, and Lin28a (OSKMNL); thereby rejuvenating the human somatic cells.
3. The method of claim 1 or claim 2, wherein the human somatic cells are transfected with miR302a, miR302b, miR302c, miR302d, and miR367.
4. The method of claim 1 or claim 2, wherein the human somatic cells are transfected at least once per day for at least 4-20 days.
5. The method of claim 1 or claim 2, wherein the human somatic cells are transfected once per day for at least 4 days.
6. The method of claim 1 or claim 2, wherein the human somatic cells are transfected once per day for at least 7 days.
7. The method of claim 1 or claim 2, wherein the transfected human somatic cells are cultured in somatic cell culture media for at least 1-20 days after the last transfection.
8. The method of claim 1 or claim 2, wherein the transfected OSKMNL and / or miRNAs are provided as RNA.
9. The method of claim 1 or claim 2, wherein transfecting the human somatic cells comprises transfecting the cells with a DNA expression vector encoding the OSKMNL and / or miRNAs.
10. The method of claim 9, wherein the expression vector is a plasmid or viral expression vector.
11. The method of claim 1 or claim 2, wherein transfecting the human somatic cells is by electroporation.
12. The method of claim 1 or claim 2, wherein the human somatic cells are isolated cells in vitro.
13. The method of claim 1 or claim 2, wherein the human somatic cells are in a subject, and the OSKMNL and / or miRNAs are administered to the subject prior to their transfection into the human somatic cells.
14. The method of claim 1 or claim 2, wherein rejuvenating human somatic cells is indicated by a reduction in cellular epigenetic age or by cellular transcriptomic profiling.
15. The method of claim 1 or claim 2, wherein the human somatic cells are fibroblast, prostate, keratinocyte, or mesenchymal cells.
16. The method of claim 1 or claim 2, wherein the human somatic cells are mesodermal, endodermal or ectodermal.