Recombinant baculovirus with improved genetic stability
By reducing sequence identity between flanking ITRs in the B and C loop regions, the baculovirus expression system achieves improved genetic stability and high-yield rAAV production, addressing scalability issues in large-scale manufacturing.
Patent Information
- Application Number
- PCT/NL2025/050534
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-21
- Filing Date
- 2025-10-21
- Publication Date
- 2026-04-30
AI Technical Summary
Existing baculovirus expression systems for producing recombinant adeno-associated virus (rAAV) vectors face challenges in scalability and genetic stability due to homologous recombination between inverted terminal repeats (ITRs), leading to loss of gene inserts during repeated passaging, which is crucial for large-scale manufacturing.
Designing a DNA construct with reduced sequence identity between flanking parvovirus ITRs, particularly in the B and C loop regions, to stabilize baculovirus vectors, allowing for high-yield production and maintaining vector genome integrity during multiple passaging cycles.
The approach results in highly stable baculovirus vectors capable of producing functional rAAV with retained integrity, suitable for large-scale clinical manufacturing, enhancing genetic stability and yield.
Smart Images

Figure IMGF000024_0001_TABLE 
Figure IMGF000025_0001_TABLE 
Figure IMGF000025_0002_TABLE
Abstract
Description
RECOMBINANT BACULOVIRUS WITH IMPROVED GENETIC STABILITYINTRODUCTION
[0001] Recombinant adeno-associated virus (rAAV) vectors are widely used for gene delivery applications. These vectors typically include a recombinant transgene cassette, which is flanked by wild-type AAV inverted terminal repeats (ITRs). The ITRs are crucial for the replication and packaging of the recombinant genome during rAAV production and also have a role in the long-term maintenance of the transgene following delivery. To produce clinical-grade rAAV vectors, large-scale manufacturing methods are required for achieving high yield of rAAV vectors. A well-established rAAV production method involves plasmid transfection of human embryonic kidney 293 (HEK293) cells. Using this method, cells are co-transfected with a vector plasmid containing the ITR transgene DNA cassette and helper plasmids. Historically, it is known that when producing plasmids with vector genomes in E.coli, ITR sequences can mutate. This can be avoided by using recombination deficient E. coli strains. Such strains are presently commonly used and widely commercially available and allow for (large scale) manufacturing of plasmids containing inserts with highly structured sequences, and (inverted) repeat sequences as well, such as sequences encoding viral LTRs, shRNAs, AAV ITRs, and the like. Helper plasmids express essential genes, including Rep and Cap genes, driving genomic replication and encapsidation of rAAV. One of the challenges of this system remains the scalability for high-yield rAAV production. One well-known method for high-yield production of rAAV vectors is by using the baculovirus-based rAAV system, which is based on co-infection of insect cells with baculovirus expression vectors comprising the AAV Replicase (Rep) and Capsid (Cap) genes and the transgene cassette flanked by the 5’ and 3 ITRs. The transgene cassette typically comprises a (therapeutic) gene of interest and other regulatory components, such as enhancers or promoters for transgene expression in a target cell. As host for baculovirus expression vectors, insect cells derived from clone 9 of the species Spodoptera frugiperda (Sf9 cells) are commonly used due to their high susceptibility to baculovirus infection and favorable growth characteristics in suspension cultures.
[0002] Three main approaches have emerged in applying baculovirus expression vector systems for recombinant adeno-associated virus (rAAV) production. The first approach, known as the three-Bac system, involves delivering the Rep, Cap, and ITR-transgene cassette on three separate recombinant baculovirus expression vectors. This method was the first to demonstratethat AAV genes integrated within the baculovirus genome can undergo proper DNA and protein processing under the control of insect cell promoters. Further helper functions are provided by the baculoviral vectors themselves, eliminating the need for helper genes to be supplied through additional helper virus infections. The three-Bac system was later further optimized into the two-Bac system where a single recombinant baculovirus carries the Cap and Rep expression cassettes (Bac-CapRep), and a separate baculovirus contains the ITR-transgene cassette. Further refinement resulted in the mono-Bac system, where a single BEV carries the Rep, CAP, and transgene cassettes. All three systems are well known in the in the art and are used and have been used for clinical scale manufacturing.SUMMARY OF THE INVENTION
[0003] Despite the efficiency and scalability of baculovirus expression systems, challenges related to yield persist, in particular when developing baculovirus containing vector genomes with expression cassettes for genes of interest. Large-scale rAAV manufacturing requires significant quantities of baculovirus expression vectors, which in turn requires extensive repeated baculovirus passaging. The impact of the integrity of ITR sequences in the baculovirus / sf9 system has been studied for the manufacturing of AAV, and it was found that having fully wild-type ITR sequences flanking a gene cassette of interest, e.g. AAV-2 ITRs, or AAV-8 ITRs, or AAV-9 ITRs, resulted in optimal results from a quality perspective or recombinant AAV produced (Savy et al., Human Gene Therapy Methods, 2017, Vol. 28, Nr. 5, pp. 277-89). To achieve the high baculovirus yields necessary for large-scale rAAV production, baculovirus populations must undergo many replication cycles. In general, it is known that during serial passaging defective interfering (DI) baculoviruses that lack large portions of the genome can be produced, in what appears to be an intrinsic property of baculovirus infection. Repeated passaging can result in loss of inserts. Adaptive variants may quickly outgrowth the baculovirus population if they have a replication benefit. Hence, obtaining stable baculovirus clones that are stable at high passaging numbers is important for achieving the required baculovirus volumes and yields. If and what sequences of an rAAV vector genome insert may cause a loss of insert from a baculoviral vector encoding an rAAV genome is not known.
[0004] The present invention provides for a DNA construct comprising a gene of interest flanked by a first parvovirus inverted terminal repeat (first ITR) and a second parvovirus ITR(second ITR), wherein the sequence identity between the first ITR and the second ITR is reduced and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is reduced as well. The inventors hypothesized that the ITRs could be a destabilizing factor and / or proponent of homologous recombination, that could trigger the formation of mutants with (in part) deleted ITRs and / or loss of the gene of interest between the first and second ITR during passaging of the baculovirus. The present inventors, as depicted in the examples herein, advantageously show that by reducing the sequence identity between the first and second ITR, i.e. of the first ITR sequence to both the second ITR sequence, and the reverse complement of the second ITR sequence, highly stabilized baculovirus vectors with parvovirus vector genomes could be obtained. These highly stabilized baculovirus vectors allowed for large scale production of baculovirus vectors, and allow for high passage numbers, while substantially retaining parvoviral vector genome integrity. This is in particular advantageous for large scale clinical manufacturing.
[0005] By designing viral vector genomes in this way, vector capsids are packaged with full length vector genomes whilst also retaining the capacisty for repeated passaging of manufacturing constructs in large amounts while retaining both baculoviral and rAAV genome integrity. Baculoviral vectors comprising gene of interests flanked by a first parvovirus inverted terminal repeat (first ITR) and a second parvovirus ITR, wherein the sequence identity between the first ITR and the second ITR is reduced, and, the sequence identity between the first ITR and the reverse complement sequence of the second ITR is reduced in accordance with the invention allows for highly advantageous baculovirus manufacturing systems (such as MonoBac, DuoBac, or Triple Bac, or the like) suitable for large scale manufacturing e.g. for clinical use.
[0006] In one embodiment, the present invention provides for a DNA construct comprising a gene of interest flanked by a first parvovirus inverted terminal repeat and a second parvovirus ITR (second ITR), wherein the sequence identity between the first ITR and the second ITR is less than 80% and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is less than 90%.
[0007] In another embodiment, the present invention provides for a DNA construct comprising a gene of interest flanked by a first parvovirus inverted terminal repeat or an engineered or chimeric variant thereof (first ITR) and a second parvovirus ITR or a chimeric variant thereof (second ITR), wherein the sequence identity between the first ITR and the second ITR is less than 80% and the sequence identity between the first ITR and the reverse complement sequence of thesecond ITR is less than 90%.
[0008] In yet another embodiment, the present invention provides for a DNA construct comprising a gene of interest flanked by a first parvovirus inverted terminal repeat or a chimeric variant thereof (first ITR) and a second parvovirus ITR or a chimeric variant thereof (second ITR), wherein the sequence identity between the first ITR and the second ITR is less than 80% and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is less than 90%.
[0009] Parvovirus ITRs contains three palindromic sequences, referred to as (A-A’ (or RBE-RBE’), B-B’, and C-C’ regions) and forms a T-shaped structure (See i.a. Figure 8). It was observed that reducing sequence identity between the flanking ITRs, more preferably between the B and C loop regions of the ITRs, was highly advantageous for baculovirus vector manufacturing systems for producing AAV. It is understood that the ITRs of parvoviruses in accordance with the invention relate to sequences such as found in parvoviruses, including primate and / or human parvoviruses. The ITRs function i.a. in parvoviral vector genome replication, packaging (i.e. via interaction with parvovirus Rep proteins), and when delivered to a target cell, can provide for stable expression from the delivered genome and, e.g. may allow for concatemer formation of vector genomes. Hence, it is understood that the skilled person, when selecting parvovirus ITRs and / or engineering parvovirus ITRs (e.g. by creating chimeric parvovirus ITRs or other modifications, substitutions or the like (e.g. replacing two nucleic acids that base pair in the ITR structure with another pair, while retaining the (predicted) ITR structure)), is well capable of determining whether the first and second ITR sequences selected, are compliant with the reduced sequence identity requirements as outlined herein, but are also fully functional in the context of recombinant AAV production and subsequent use in gene transfer.
[0010] The DNA construct with reduced sequence homology between the first and second ITRs according to the invention was found to improve the genetic stability of baculovirus by retaining the intact ITR-transgene sequence integrity upon passaging of the baculovirus. Furthermore, it was demonstrated that functional rAAV can be produced using the DNA construct of the invention.
[0011] The DNA construct, according to the invention, can be provided in BAC plasmid, a baculovirus, or an isolated cell, for instance, by cloning of the DNA construct in the BAC plasmid for baculovirus production or by transecting or infecting cells with the BAC plasmid or a viruscomprising the DNA construct. The DNA construct according to the invention can also be provided in a method of preparing a baculovirus and in method of producing rAAV. The current invention thus also provides for a method of preparing baculoviruses and a method of producing rAAV wherein such method comprises the DNA construct of the invention.FIGURES
[0012] Figure 1. Homologous recombination between first and second ITRs causes genetic instability. (A) schematic design of the control ITR-transgene construct comprising a transgene insert flanked by wtAAV2 ITRs in the flip and flop orientation. (B) a more detailed overview of the constructs comprising the CBh promoter and a transgene flanked by the ITRs and the location of the primers for qPCR and endpoint PCR. (C) CBh / Bac ratio for P3-P6 baculovirus comprising construct 1. The ratios were calculated using the titers obtained with a qPCR amplifying the CBh and Bac region. (D) Gel electrophoresis of 5’Bac-3’Bac obtained by endpoint PCR, using 1 biological replicate on P2 - P6 baculoviruses comprises construct 1. The ~ 4.0 Kb band (higher arrow), represents the expected fragment, containing the entire ITR transgene DNA cassette. The ~1.8 Kb band (lower arrow) represents a ~2.0 Kb deletion. (E) Schematic representing the deletion model observed due to homologous recombination between the first and second ITR, based on sanger sequencing of the ~1.8 Kb bands extracted from the gel shown in Figure ID.
[0013] Figure 2. Schematic representation of ITR-transgene designs containing modified second (to which may also be referred to as“righf ’) ITR sequences and alignments. (A) Construct 1 (control) with the first (to which may also be referred to as “left”) ITR from wtAAV2 in the flip orientation and the second ITR from wtAAV2 in the flop orientation. (B) Construct 2 with the first ITR from wtAAV2 in the flip orientation and the second ITR from wtAAV2 in the flip orientation. (C) Construct 3 with the first ITR from wtAAV2 in the flip orientation and the second ITR from wtAAV6 in the flip orientation. (D) Construct 4 with the first ITR from wtAAV2 in the flip orientation and the second ITR comprising a chimeric AAV6 / 2 ITR sequence in the flip orientation. (E) Construct 5, similar to construct 2 but with AT linkers flanking the ITRs to reduce the GC content. (F) Alignments of the ITRs and their mismatches relative to the first ITR.
[0014] Figure 3. Graph showing the baculovirus rescue efficiency in PO. The percentage of P2 baculovirus plaque amplified clones comprising the intact ITR-transgene cassette determined by genetic screening using qPCR.
[0015] Figure 4. Transgene retention of P3 baculoviruses containing the ITR-transgene designs. Transgene retention of P3 baculoviruses comprising construct 1-5. Data is represents a bar graph showing mean CBh / Bac ratios. Error bars represent standard deviation from the mean. An one-way ANOVA was used for statistical analysis, P <0.0025. Dunnett’s multiple comparison test was used to compare BAC#B - E to control BAC#A, ** PO.01.
[0016] Figure 5. Genetic stability in P3 - P7 baculoviruses containing the ITR-transgene designs. Genetic stability was assessed by quantification of transgene retention based on CBh / Bac qPCR ratios. The data were generated with 4 baculovirus clones comprising the constructs 1-5 with two technical replicates. (A) CBh / Bac ratios for baculoviruses comprising construct 1-5. Mean normalized values were plotted with error bars representing the standard deviation. Connecting lines are used to represent the ratio trends over successive passages, represented by P3, P4, P5 and P7. (B) Bar graph representing mean change in normalized CBh / Bac ratios from P3 to P7 for baculoviruses comprising construct 1 -5, calculated by subtraction. Error bars represent the standard deviation. An ordinary one-way ANOVA was used for statistical analysis, P <0.0001. Dunnett’s multiple comparison test was used to compare constructs 2-5 to control construct 1, *** P0.0001, *P<0.01, ns = non-significant. (C) Bar graph representing mean CBh / Bac ratios at P3, P4, P5 and P7 for baculoviruses comprising construct 1-5. Error bars represent the standard deviation.
[0017] Figure 6. Transgene integrity of 5’Bac - 3’Bac PCR fragments of P3 and P7 baculoviruses with the ITR designs. Gel electrophoresis of 5’Bac - 3’Bac fragments were obtained by endpoint PCR, using 1 representative biological replicate for each construct at P3 and P7. The ~ 4.0 Kb band (higher arrow), represents the expected fragment, containing the entire ITR transgene DNA cassette. The ~1.8 Kb band (lower arrow) represents a -2 Kb deletion.
[0018] Figure 7. Genome copies and capsid particles of rAAV test production generated with P3, P5 and P7 baculoviruses (A) Bar graph representing mean genome copy number per mLmeasured by CBh qPCR of two biological replicates per baculovirus clone Statistical analysis was carried out using a two-way ANOVA, ns = non-significant (B) Bar graph representing mean capsid particle per mL measured by AAV5.2 ELISA of two biological replicates per baculovirus clone. Statistical analysis was carried out using a two-way ANOVA, ns = non-significant. (C) Isolated AAV DNA analyzed by alkaline DNA electrophoresis.
[0019] Figure 8. Schematic of an ITR (A). It was observed that in reducing sequence identity between first and second ITRS in general, and in particular in regions corresponding with the C / C’ and B / B / regions (i.e. B and C loop regions) of ITR structures as depicted in (A), was advantageous in improving (baculovirus) vector stability. This corresponds with the sequence between the boxed sequences as depicted in (B), i.e the sequence corresponding with nucleic acid positions 42 - 84 of SEQ ID NO.1 (a first ITR) aligned with the sequence of a second ITR and its reverse complement. It is noted that in the alignment, the D-sequence of the first ITR is not depicted.
[0020] Figure 9. Scheme outlining alignment of ITR sequences.DETAILED DESCRIPTION
[0021] The present invention provides for a DNA construct comprising a gene of interest flanked by a first parvovirus inverted terminal repeat or a chimeric variant thereof (first ITR) and a second parvovirus ITR or a chimeric variant thereof (second ITR), wherein the sequence identity between the first ITR and the second ITR is less than 80% and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is less than 90%.
[0022] AAV ITRs contain many GC rich repeat sequences and display high levels of homology, i.e. sequence identity, between the 5’and 3’ITR (left and right) ITR sequences. These sequences were shown by the inventors to be prone to recombination and excision of the transgene insert from the baculoviral vector, thereby making it difficult to obtain stable baculovirus clones. It was highly advantageously found that reducing the sequence identity between the first ITR and the second ITR, i.e. the 5’ and 3’ITR flanking the gene cassette, isuseful for obtaining baculovirus clones with improved genetic stability. While the left 5’ ITR of wtAAV2 was used as a first ITR in the examples herein, a skilled artisan would understand that the AAV ITR of different AAV serotype, or a chimeric ITRs can also be used. As long as sequence identity between the flanking ITRs is reduced (i.e. between the 5’ and 3’ITR, also referred to as first and second ITR), improved genetic stability of baculoviral vectors can be achieved.
[0023] wtAAV2 ITRs comprise the D-sequence, rep binding element (RBE), two hairpins (B and C)) and are flanked by additional ‘’extended ITR” sequences occurring in WT-AAV2. The orientation of the ITR can be in a “Flip” or in a “Flop” orientation. As used herein, “Flip” orientation means that the C hairpin within the ITR is closer to the D-sequence as depicted in Figure 1 A. As used herein “Flop” orientation means that the B hairpin within the ITR is closer to the D-sequence as depicted in Figure 1 A.
[0024] The sequence identity is determined by alignment of the left and right ITR (first and second ITR, i.e. the ITR sequences which flank a gene of interest). The alignment in accordance with the invention can be performed between the sequence of the first ITR and the sequence of the second ITR both in the same 5 ’-3’ direction and as present on the same DNA strand to determine sequence identity (“direct homology”), or, sequence identity is determined between the sequence of the first ITR in the 5 ’-3 direction and the reverse complement of said second ITR sequence (which said second ITR sequence is in the same 5 ’-3’ direction and is present on the same strand as the first ITR sequence). The latter may also be referred to as “inverted sequence identity” or “inverted homology. The double stranded DNA in which a vector genome sequence is incorporated is schematically depicted in Figure 9, as well as the orientation for alignment. Results of alignments are shown in Figure 8. Terms such as “inverted homology”, and “direct homology” are used in the examples herein.
[0025] Alignment of the first ITR is performed with a 124 nt sequence corresponding to a region starting 15 nucleotides upstream of the RBE sequence until 1 nucleotide upstream of the D sequence. Alignment of the right ITR is performed with a 124 nt sequence corresponding to a region starting 1 nucleotide downstream of the D sequence until 15 nucleotides downstream of the RBE sequence. Hence, it is understood that in accordance with the invention, alignment of an ITR sequence does not comprise the D sequence. Alignment is performed for the A region and the B and C loops.
[0026] As used herein “identity” or “sequence identity” refers to the degree of relatedness between two or more nucleic acid sequences (polynucleotide sequences), as determined by comparing the sequences. The comparison of sequences and determination of sequence identity may be accomplished using a mathematical algorithm; those skilled in the art will be aware of computer programs available to align two sequences and determine the percent identity between them. The skilled person will appreciate that different algorithms may yield slightly different results. Thus, the “percent identity” between a query nucleic acid sequence and a subject nucleic acid sequence is the “identities” value, expressed as a percentage, that is calculated by, for example, the BLASTN algorithm when a subject nucleic acid sequence has 100% query coverage with a query nucleic acid sequence after a pair- wise BLASTN alignment is performed. Such pair-wise BLASTN alignments between a query nucleic acid sequence and a subject nucleic acid sequence are performed by using the default settings of the BLASTN algorithm available on the National Center for Biotechnology Institute's website with the filter for low complexity regions turned off. Importantly, a query nucleic acid sequence may be described by a nucleic acid sequence identified in one or more claims herein. It is understood that sequence identity is to be determined over the entire length of the query sequence. Hence, in case the query sequence, i.e. a first sequence, is 150 nucleotides in length, sequence identity is determined relative to that length. When for example a second sequence of about 150 nucleotides, contains a portion of about 30 nucleotides which is 100% identical with the query sequence, i.e. the first sequence, and for the remainder, does not align, this means that the percentage identity is 20% relative to the first sequence ( 30 / 150).
[0027] A query sequence may be 100% identical to the subject sequence, or it may include up to a certain integer number of nucleotide alterations as compared to the subject sequence such that the % identity is less than 100%. For example, the query sequence can be at most 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical to the subject sequence. Such alterations include one or more of a deletion, substitution, and insertion, and said alterations may occur at the terminal positions of the query sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides in the query sequence or in one or more contiguous groups within the query sequence.
[0028] The percentage of sequence identity between the first ITR and the second ITR is preferably less than 90% determined with alignment of both sequences in the same direction(“direct homology”) and less than 90% determined with alignment of the first ITR in the 5-3’ direction and the second ITR in the reverse complement direction =(“ reverse homology”). In a preferred embodiment, the sequence identity between the first ITR and the second ITR is less than 80 percent determined with alignment of both sequences in the same direction, and less than 85 percent determined with alignment of the first ITR in the 5-3’ direction and the second ITR in the reverse complement direction. Without wishing to be bound by any theories, reducing the sequence identity between the first and the second ITR in both the 5’3 direction and in the reverse complement direction is useful to prevent genetic instability events due to homologous recombination.In another embodiment, the first ITR sequence is aligned with the second ITR sequence, and, the first ITR sequence is aligned with the reverse complementary sequence of the second ITR sequence, and first and second ITR sequences selected such that mismatches between the ITR sequences are preferably in the B and C loop encoding sequences, i.e. corresponding with nucleotides 42-84 of SEQ ID NO: 1. In one embodiment, the ITR sequences in the B and C loop encoding regions preferably have less than 80%, less than 78%, less than 76%, less than 74%, less than 72%, or less than 70%, sequence identity, when aligning the first ITR sequence and the second ITR sequence both in a direct sequence alignment and reverse complement alignment. In an further embodiment, in the B and C loop encoding regions, i.e. corresponding with nucleotides 42-84 of SEQ ID NO: 1, at most 12 consecutive nucleotides align between the first and second ITR in either alignment (i.e. of the direct and reverse complement alignment).
[0029] In a further embodiment, at least one of the ITRs comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.l. In another embodiment at least one of the ITRs comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.2. ITRS can be in either flop or flip sequence orientation.
[0030] In another further embodiment, the first ITR comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.1, or with SEQ ID NO. 2, and the second ITR comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.4. or SEQ ID NO. 5.
[0031] In a preferred embodiment, the first ITR consists of the sequence of SEQ ID NO.l, and the second ITR consists the sequence of SEQ ID NO.4. or SEQ ID NO. 5.
[0032] As shown in the examples herein, AAV genome integrity was preserved in rAAVs produced with baculoviruses in accordance with the invention. Hence, results show that surprisingly, homologous recombination between left and right ITRs apparently caused genetic instability in recombinant baculoviruses, in particular after repeated passaging of recombinant baculovirus vectors generated. Repeated passaging of baculoviral vectors is highly important for large scale manufacturing of recombinant baculovirus vectors. Moreover, in recombinant baculovirus generation, constructs could also aid in improving plaque purification. This way, the rAAV vector genome inserts advantageously provided for improved genetically stable baculovirus vectors, highly useful for large scale manufacturing, allowing to retain high rAAV yield and high product quality.
[0033] Hence, the present invention advantageously provides for a system with one or more baculoviruses for recombinant AAV production, wherein the system comprises a baculoviral vector with a DNA insert comprising a DNA construct comprising a gene of interest flanked by a first parvovirus inverted terminal repeat or a chimeric variant thereof (first ITR) and a second parvovirus ITR or a chimeric variant thereof (second ITR), wherein the sequence identity between the first ITR and the second ITR and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is less than 90%. Advantageously, this system allows for methods of production of rAAV wherein the number of passages of the baculoviral vector with the DNA insert with the first and the second ITR in accordance with the invention, that is used in the method of productions, is 2, 3, 4, 5, 6, 7, 8, 9 or more passages. Accordingly, in one embodiment, in the means and methods in accordance with the invention, the baculoviral vector comprises a DNA insert with the first and the second ITR in accordance with the invention, wherein the number of passages prior to the use in the step of infecting the insect cells in methods of production is 3 or more passages. In another embodiment, in the means and methods in accordance with the invention, the baculoviral vector comprises a DNA insert with the first and the second ITR in accordance with the invention, wherein the number of passages prior to the use in the step of infecting the insect cells in methods of production is 4 or more passages. In another embodiment, in the means and methods in accordance with the invention, the baculoviral vector comprises a DNA insert with the first and the second ITR in accordance with the invention, wherein the number of passages prior to the use in the step of infecting the insect cells in methods of production is 5 or more passages. In yet anotherembodiment, in the means and methods in accordance with the invention, the baculoviral vector comprises a DNA insert with the first and the second ITR in accordance with the invention, wherein the number of passages prior to the use in the step of infecting the insect cells in methods of production is 6 or more passages. In another embodiment, in the means and methods in accordance with the invention, the baculoviral vector comprises a DNA insert with the first and the second ITR in accordance with the invention, wherein the number of passages prior to the use in the step of infecting the insect cells in methods of production is 7 or more passages.
[0034] Accordingly, in further embodiments, the percentage of intact DNA insert observed after each of the 2, 3, 4, 5, 6, 7, 8, 9 or more passages of the baculoviral vector with the DNA insert with the first and the second ITR, prior to the step of infecting the insect cells, is increased and preferably shows genetic stability, as compared to the percentage of intact DNA insert obtained when performing the method with a transfer plasmid with a DNA insert comprising a first and a second ITR, wherein the sequence identity between the first ITR and the second ITR is 100% or the sequence identity between the first ITR and the reverse complement sequence of the second ITR is 100%. Hence, in further embodiments, the percentage of intact DNA insert observed after each of the 2 or more passages; 3 or more passages; 4 or more passages; 5 or more passages; 6 or more passages; or ; 7 or more passages, of the baculoviral vector with the DNA insert with the first and the second ITR in accordance with the invention, prior to the step of infecting the insect cells in methods of production, is increased and preferably shows genetic stability, as compared to the percentage of intact DNA insert obtained when performing the method with a transfer plasmid with a DNA insert comprising a first and a second ITR, wherein the sequence identity between the first ITR and the second ITR is 100% or the sequence identity between the first ITR and the reverse complement sequence of the second ITR is 100%.
[0035] In another embodiment, the first and second ITRs each comprise an intact terminal resolution sites (trs, referred to herein as TRS). In yet another or further embodiment, the first and second ITRs each comprise an intact terminal resolution sites in the sense that in the baculovirus rAAV manufacturing system, each of these sites are both nicked during rAAV production. Hence it is understood that preferably both TRS of the first and second ITR are compatible with manufacturing, likewise, the same applies to the ITRs selected and / or modified to comply with the meats and bounds as described herein to provide the advantage effects onstability during extensive passaging. In yet another embodiment, the rAAV vector genome has a size which is 2.5 kB or more, 2.6 kB or more, 2.7 kB or more, 2.8 kB or more, 2.9 kB or more, 3.0 kB or more, 3.5 kB or more, or, 4.0 kB or more. It is understood that the upper limit in terms of genome size may be selected to be appropriate with the packaging limitations of an rAAV capsid. In a further embodiment, the rAAV vector genome is not a self-complementary vector genome. Hence, it is understood that preferably in the methods of the invention, single stranded genomes are produced (+ or -) with the first ITR at one end, and the second ITR at the other end, with the sequence flanked by the ITRs being single stranded.
[0036] Embodiments1. A DNA construct comprising a gene of interest flanked by a first parvovirus inverted terminal repeat or a chimeric variant thereof (first ITR) and a second parvovirus ITR or a chimeric variant thereof (second ITR), wherein the sequence identity between the first ITR and the second ITR and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is less than 90%.2. A DNA construct comprising a gene of interest flanked by a first parvovirus ITR and a second parvovirus ITR, wherein the sequence identity between the B and C loop encoding regions of the respective first and second parvovirus ITR is less than 70%, and, wherein the sequence identity between the B and C loop encoding region of the first parvovirus ITR and the reverse complement sequence of the second parvovirus ITR is less than 70%,3. A DNA construct in accordance with embodiment 2, wherein the B and C loop encoding regions align with nucleotides 42-84 of SEQ ID NO: 1.4. The DNA construct in accordance with any of embodiments 1-3, wherein the sequence identity between the first ITR and the second ITR is less than 80 percent, and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is less than 85 percent.5. The DNA in accordance with embodiment 1-4, wherein one of the two ITRs comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.16. The DNA construct in accordance with any of embodiments 1-5, wherein the first ITR comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.l, and the second ITR comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.4. or SEQ ID NO. 5.7. The DNA construct in accordance with any of embodiments 1-6, wherein the first ITR consists of the sequence of SEQ ID NO.1, and the second ITR consists the sequence of SEQ ID NO.4. or SEQ ID NO. 5.8. A BAC plasmid or a baculovirus vector comprising a DNA construct according to any one of embodiments 1 -7.9. An isolated cell comprising a DNA construct according to any one of embodiments 1-8.10. The isolated cell in accordance with embodiment 8, wherein the cell is a mammalian cell or an insect cell.11. The BAC plasmid or baculovirus vector in accordance with embodiment 8, or the isolated cell in accordance with embodiments 9-10, wherein the genetic stability of the DNA construct upon passaging is improved as compared to a BAC plasmid, a baculovirus vector or an isolated cell that comprises a first ITR and a second ITR, wherein the sequence identity between the first ITR and the second ITR and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is 90% or more.12. The BAC plasmid or baculovirus vector in accordance embodiment 8, or the isolated cell in accordance to embodiments 9-10, wherein the genetic stability of the DNA construct upon passaging is improved as compared to a BAC plasmid, a baculovirus vector or an isolated cell that comprises a first ITR having a nucleic acid sequence with at least 95% sequence identitywith SEQ ID NO.l and a second ITR having a nucleic acid sequence with at least 95% sequence identity with SEQ ID NO.2.13. A method of preparing a recombinant baculovirus comprising;a. providing a bacmid;b. provide a compatible transfer plasmid with a DNA insert comprising a DNA construct as defined in any of embodiments 1-7;c. co-transfecting insect cells with the bacmid and the compatible transfer plasmid to facilitate recombination between the bacmid and the compatible transfer plasmid to provide for a recombinant baculovirus genome comprising the DNA insert;d. culturing the transfected insect cells to produce recombinant baculovirus;e. harvesting of the supernatant comprising the recombinant baculovirus produced by the insect cells;f. selecting recombinant baculoviral clones;g. identifying recombinant baculoviral clones comprising an intact DNA insert.14. The method in accordance with embodiment 13, wherein the percentage of identified baculovirus clones comprising the intact DNA is increased as compared to the percentage of intact DNA insert obtained when performing the method with a transfer plasmid with a DNA insert comprising a first and a second ITR, wherein the sequence identity between the first ITR and the second ITR is 80% or more and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is 90% or more.15. The method in accordance with embodiment 13-14, wherein the percentage of identified baculovirus clones comprising the intact DNA is increased as compared to the percentage of intact DNA insert obtained when performing the method with a transfer plasmid with a DNA insert comprising a first ITR having a nucleic acid sequence with at least 95% sequence identity with SEQ ID NO.l and a second ITR having a nucleic acid sequence with at least 95% sequence identity with SEQ ID NO.2.16. The method in accordance with any of embodiments 13-15, wherein the method further comprises passaging of the identified baculovirus clones comprising an intact DNA insert and wherein the number of passages is 2, 3, 4, 5, 6, 7, 8, 9 or more.17. The method in accordance with embodiment 16, wherein the percentage of intact DNA insert observed after passaging baculovirus clones comprising the DNA construct as defined in any of embodiments 1-5 is increased as compared to the percentage of intact DNA insert obtained when performing the method with a transfer plasmid with a DNA insert comprising a first and a second ITR, wherein the sequence identity between the first ITR and the second ITR is 80% or more and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is 90% or more.18. The method in accordance with embodiment 16, wherein the percentage of intact DNA insert observed after passaging baculovirus clones comprising the DNA construct as defined in any of embodiments 1-5 is increased as compared to the percentage of intact DNA insert obtained when performing the method with a transfer plasmid with a DNA insert comprising a first ITR having a nucleic acid sequence with at least 95% sequence identity with SEQ ID NO.1 and a second ITR having a nucleic acid sequence with at least 95% sequence identity with SEQ ID NO.2.19. A baculoviral vector, obtainable or obtained by from the method as defined by embodiments 13-18.20. A method of producing recombinant AAV, comprising the steps of:o providing a system with one or more baculoviruses for recombinant AAV production, wherein the system comprises a baculoviral vector with a DNA insert comprising a DNA construct as defined in embodiments 1-7;o providing insect cells;o infecting the insect cells with the one or more baculoviruses and allowing recombinant AAV to be produced by the insect cells;o harvesting the recombinant AAV.21. A method in accordance with embodiment 20, further comprising isolating the recombinant AAV.22. The method in accordance with embodiment 20 or 21, wherein the one or more baculovirus vectors comprises at least one baculoviral vector as defined in embodiment 19.23. The method in accordance with any of embodiments 20-22 wherein the system with one or more baculoviruses for recombinant AAV production is selected from a three-Bac, two-Bac and mono-Bac system.24. The method in accordance with any of embodiments 20-23, wherein the baculoviral vector with the DNA insert is derived from passage 2, passage 3, passage 4, passage 5, passage 6, passage 7, passage 8 or passage 9.25. A parvoviral vector, preferably a recombinant AAV vector obtainable or obtained by the method as defined by embodiments 20-23.26. A pharmaceutical composition comprising a recombinant AAV produced by a method as defined by embodiments 20-25.27. A recombinant AAV according to embodiment 25, or a pharmaceutical composition according to embodiment 26, for use in a medical treatment.28. A recombinant AAV or a pharmaceutical composition according to for use in a medical treatment in accordance with embodiment 27, wherein the medical treatment comprises a gene therapy.In yet further aspects, provided are:1. A baculovirus vector comprising a DNA construct comprising a gene of interest flanked by a first parvovirus inverted terminal repeat or a chimeric variant thereof (first ITR) and a second parvovirus ITR or a chimeric variant thereof (second ITR), wherein the sequence identity between the first ITR and the second ITR and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is less than 90%.2. A baculovirus vector comprising a DNA construct comprising a gene of interest flanked by a first parvovirus ITR and a second parvovirus ITR, wherein the sequence identity between the B and C loop encoding regions of the respective first and second parvovirus ITR is less than 70%, and, wherein the sequence identity between the B and C loop encoding region of the first parvovirus ITR and the reverse complement sequence of the second parvovirus ITR is less than 70%,3. The baculovirus vector comprising a DNA construct in accordance with aspect 2, wherein the B and C loop encoding regions align with nucleotides 42-84 of SEQ ID NO:1.4. The baculovirus vector comprising a DNA construct in accordance with any of aspects 1- 3, wherein the sequence identity between the first ITR and the second ITR is less than 80 percent, and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is less than 85 percent.5. The baculovirus vector comprising a DNA construct in accordance with aspect 1-4, wherein one of the two ITRs comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.16. The baculovirus vector comprising a DNA construct in accordance with any of aspects 1- 5, wherein the first ITR comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.l, and the second ITR comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.4. or SEQ ID NO. 5.7. The baculovirus vector comprising a DNA construct in accordance with any of aspects 1- 6, wherein the first ITR consists of the sequence of SEQ ID NO.l, and the second ITR consists the sequence of SEQ ID NO.4. or SEQ ID NO. 5.8. A method of preparing a recombinant baculovirus comprising;a. providing a bacmid;b. provide a compatible transfer plasmid with a DNA insert comprising a DNA construct as defined in any of aspects 1-7;c. co-transfecting insect cells with the bacmid and the compatible transfer plasmid to facilitate recombination between the bacmid and the compatible transfer plasmid to provide for a recombinant baculovirus genome comprising the DNA insert; d. culturing the transfected insect cells to produce recombinant baculovirus;e. harvesting of the supernatant comprising the recombinant baculovirus produced by the insect cells;f. selecting recombinant baculoviral clones;g. identifying recombinant baculoviral clones comprising an intact DNA insert.9. A baculoviral vector, obtainable or obtained by the method as defined by aspect 8.10. A method of producing recombinant AAV, comprising the steps of:o providing a system with one or more baculoviruses for recombinant AAV production, wherein the system comprises a baculoviral vector with a DNA insert comprising a DNA construct as defined in any of aspects 1-9;o providing insect cells;o infecting the insect cells with the one or more baculoviruses and allowing recombinant AAV to be produced by the insect cells;o harvesting the recombinant AAV.11. A method in accordance with aspect 10, further comprising isolating the recombinant AAV.12. A parvoviral vector, preferably a recombinant AAV vector obtainable or obtained by from the method as defined by any of aspects 10-11.13. A pharmaceutical composition comprising a recombinant AAV produced by a method as defined by any of aspects 10-11.14. A recombinant AAV according to aspect 12, or a pharmaceutical composition according to aspect 13, for use in a medical treatment.15. A recombinant AAV or a pharmaceutical composition according to for use in a medical treatment in accordance with aspect 14, wherein the medical treatment comprises a gene therapy.* * *EXAMPLESExample 1 : Genetic instability due to homologous recombination between left and right ITRs in recombinant baculovirus genomes
[0037] To determine whether ITR homology, i.e. sequence identity, is responsible for genetic instability and transgene loss in a baculoviral vector, transfer plasmid containing the ITR-transgene DNA cassette were designed which a CBh promoter, a transgene, a poly A tail and the left and right ITR from wildtype (wt) AAV2 (DNA construct 1). Gene synthesis and subcloning were outsourced to GENEWIZ from Azenta Life Sciences.
[0038] The wtAAV2 ITRs comprises the D-sequence, rep binding element (RBE), two hairpins (B and C)) and flanked by additional ‘ ’extended ITR’ ’ sequences occurring in WT-AAV2. The left 5 ’ITR in DNA construct 1 was oriented in a Flip orientation, which means that C hairpin is facing the D-sequence. The right 3 ’ITR in construct 1 was oriented in the Flop orientation which means that B hairpin is facing the D-sequence (Figure 1 A). A standard baculovirus vector AAV manufacturing system was used in the experiments here described (Chen, 2008; Grieger et al., 2016; Kohlbrenner et al., 2005; Ruffing et al., 1992; Smith et al., 2009; Urabe et al., 2002). Baculovirus clones comprising DNA construct 1 were generated by co-transfection of the transfer plasmid and a Bacmid into insect cells (P0), followed by plaque purification (Pl) and amplification (P2), clonal selection and further amplification of the baculovirus clones by passaging until P6.
[0039] To assess genetic stability, two qPCR assays were used to detect the baculovirus backbone region outside the ITR cassette (qPCR Bac) and a region within the ITR cassette on the CBh promoter (qPCR promoter) as depicted in Figure IB. The baculovirus titers were determined with both qPCR methods and the ratio of CBh promoter to baculovirus backbone (CBh / Bac) was calculated to assess the transgene retention. Figure 1C shows a decrease in the CBh / Bac ratio over baculovirus passages. This suggests an accumulation of baculoviruses that comprises only the baculovirus backbone region and loss of baculoviruses comprising the CBh promoter region which is within the ITR-transgene cassette. Thus, indicating that the ITR-transgene cassette was lost with passaging the baculovirus due to genetic instability.
[0040] Next, to determine transgene integrity, a PCR assay was used to detect deletions in the ITR transgene cassette across multiple baculovirus passages. A fragment spanning the full ITR-transgene, was amplified by PCR using a forward (Bac FW) and reverse (Bac RV) primer on the baculovirus backbone (Figure IB). The PCR products revealed an amplicon of ~4.0 Kb which corresponded to the full ITR transgene cassette in passage 2 and 3 but this amplicon was lost in higher baculovirus passages (Figure ID). A second ~1.8Kb band was observed, indicating that a deletion occurred in the ITR transgene cassette. Sequencing results revealed that the ~1.8 Kb amplicon contained the baculovirus backbone sequences flanking the RBE region of a single ITR while completely missing the D-sequence(s) and transgene (Figure 1 E).
[0041] Taken together, these results indicate the presence of a baculovirus sub-population with a deletion in the ITR-transgene cassette. Without being bound to any theories, this deletion could be a result of homologous recombination between the left and the right ITR which indicates that homologous recombination is one of the factors responsible for genetic instability in the baculovirus vector.Example 2: generation of ITR-transgene constructs with reduced ITR sequence homology
[0042] After establishing of homologous recombination between the left and right ITRs as a driver of baculovirus genetic instability, four additional ITR-transgene DNA constructs were designed with reduced homology between the left and the right ITRs. DNA construct 1 with the wtAAV2 ITRs in a flip and flop orientation (described in example 1) was used as an internal control. Based on the sequence, this design exhibits 100% direct homology between the two ITRs, which means that the sequences of the left and right ITR are 100% homologous to each other when aligned in the same reading direction (Table 1 and Figure 2A).
[0043] To reduce direct homology between ITRs, a second construct (construct 2) was designed with the wtAAV2 5’ITR and 3’ITR sequences in a flip and flip orientation (both ITRs with the C hairpin facing the D-sequence. In this sequence, the direct homology was reduced to 63%, but the inverted homology was 100%, which means that the sequences of the left and right ITR are 100% homologous to each other when one of the ITRs is in the opposite reading (reverse complement) (Table 1 and Figure 2B).
[0044] A third construct (construct 3) was designed with the left ITR from wtAAV2 in the flip orientation and the right ITR from wtAAV6 in the flip orientation to reduce both direct and inverted homology (Table 1 and Figure 2C).
[0045] A fourth construct (construct 4) was designed with the left ITR from wtAAV2 in the flip orientation and a chimeric AAV6 right ITR, both in the flip orientation (Table 1 and Figure 2D). The chimeric AAV6 ITR was designed by incorporating the (terminal resolution site) TRS and D-sequence from AAV2, due to their established roles in replication and packaging (Brister & Muzyczka, 2000; King, 2001).
[0046] A fifth construct (construct 5) was designed with the left and right ITRs of wtAAV2 in the flip-flip orientation, similar to construct 2 but with optimized linkers to reduce the GC content in the 15bp site flanking the left and ITR by replacing GC nucleotides with AT nucleotides (Table 1 and Figure 2E). The rationale behind this design was to further reduce genetic instability by lowering GC content surrounding the ITR transgene DNA cassette, without altering the rAAV genome.
[0047] All five constructs were obtained by gene synthesis and subcloning and all other other components of the transgene such as promoter, transgene and poly A tail were identical between in all constructs. Transfer plasmids containing the ITR-transgene cassettes suitable for recombination into Bacmids for baculovirus generation were generated and baculoviruses were produced as described in example 1. and presence of correct ITR sequences confirmed by sequencing. Table 1 shows an overview of the DNA constructs and the percentage of direct homology and inverted homology between the left and the right ITRs (excluding the D sequence). Table 2 shows the sequences of the ITRs. Figure 2F shows the mismatches of the ITRs relative to the first ITR based on the alignment of the ITR sequences (excluding the D sequence).Construct # Left ITR Right ITR Description % Direct % Inverted Homology Homology 1 SEQ ID NO. 1 SEQ ID NO. 2 Control 100 862 SEQ ID NO. 1 SEQ ID NO. 3 Inverted right 86 100ITRBB' andCO sequence3 SEQ ID NO. 1 SEQ ID NO. 4 Left and right 77 81ITR fromdifferentserotypes4 SEQ ID NO. 1 SEQ ID NO. 5 Left and right 78 82ITR fromdifferentserotypes.(Chimeric rightITR)5 SEQ ID NO. 1 SEQ ID NO. 3 Inverted Right 86 100BB' and COsequence +optimized ATlinkersTable 1. Overview of the ITR-transgene constructsSEQ ITR 5’ to 3;ID NO. _1 wtAAV2 TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGG left ITR CffiSSIBAAAB^^^XS CG^CCCGSGSG®Cli7?i^JG^CCC^ Flip GGC 38GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGT GGCCA4C7CC4 n ACTAGG( r( Y1TCCT2 wtAAV2 AGGAACCWnAGTGATGGAG'I^GGCCkC^CCC^C^CTGC&CG right ITR CTCGCTCGCTCACTGAGGClllf AAAflop AB CGRCgCS^CGGrfGrfCdlTiTiTJWGCitCrfCtfGtfGrfGrfCKdGCCTCAGTGAGCGAGCG AGCGCGCAGAGAGGGAGTGGCCAAwtAAV2 AGGAACC XXGAGTGA 7 '( i( rA G7 TCGCC ACTCCCTCTCTGCGCG right ITR CTCGCTCGCTCACTGAGGCf CrfGrfCrfCtfCrfGrfGrfGrfCjlAAA GCCCGGGC flipT^sh^^^TTT^^^t^^^CTCAGTGAGCGAGCG AGCGCGCAGAGAGGGAGTGGCCAAwtAAV6 ATACX X X TAGTGA1G( 1A( / 7TGCCC ACTCCCTCTATGCGCGCTC right ITR GCTCGCTCGGTGGGGCtf CG rfGtfCiKAGdARGIBClAGAB G^CdTl CT WGCtMCdllg flip IM jniWflWG^ ccGAGCGAGCGAGC GCGCATAGAGGGAGTGGGCAA _Chimeric AC iGAAC X X X TAGTGA 7 '( 7( C i 7 TCGCC ACTCCCTCTATGCGCG AAV5 / 6 CTCGCTCGCTCGGTGGGGCB CGSG^CEAGSAGSCAGA GCTCTGCC right ITR T#^A^.^>ik^TTT^.^l^.>A^.GCCCCACCGAGCGAGCGflip AGCGCGCATAGAGGGAGTGGCCAAD-SequenceRep-binding element■iTable 2. Sequences of the ITRsSEQ ID NO: 1 was used in all construct designs positioned on the “left” as first ITR. SEQ ID Nos: 2-5 were used on the “right” as second ITR, i.e. a gene construct was flanked at one side by SEQ ID NO: 1 and on the other side by one of SEQ ID NO: 2-5.Example 3 : Baculovirus rescue
[0048] To generate recombinant baculoviruses for each design, the transfer plasmids for each construct were co-transfected with a Bacmid in insect cells to produce of PO baculovirus populations. Plaque purification (Pl) was performed to obtain clonally derived baculovirus populations. The Pl baculovirus populations were subsequently propagated to P2. Clonal screening by qPCR and PCR was used on P2 to identify transgene positive populations.
[0049] Based on the number of clones obtained with each construct, the percentage of clones that comprises the intact ITR-transgene insert was determined for each baculovirus (rescue efficiency). Figure 3 shows a rescue efficiency between 3.8% and 16.7%. The best rescue efficiency was obtained with baculovirus clones comprising construct 4.Example 4: Improved transgene retention
[0050] Recombinant P2 baculovirus clones comprising the ITR-transgene constructs were further amplified to P3 by infection of insect cells with the P2 cultures. The transgene retention, was assessed by qPCR to determine the CBh / Bac ratio as previously described. Baculovirus clones comprising the ITR transgene DNA constructs 2-4 showed a significantly higher (P<0.0025) CMV / Bac ratio compared to baculovirus clones comprising construct 1 (Figure 4), indicating improved genetic stability as a result of the reduced direct and inverted homology between the ITRs.Example 5: Sustained genetic stability over multiple passages
[0051] To further investigate the genetic stability of the ITR transgene DNA cassettes, the P3 baculoviruses comprising the constructs 1-5 were passaged until P7. For each passage the transgene retention was quantified by qPCR and the CBh / Bac ratios were determined for each passage as described in example 1. Surprisingly, baculoviruses comprising construct 3 and 4 resulted in a consistent transgene retention in all passages, demonstrating sustained genetic stability upon passaging (Figure 5).
[0052] To further assess transgene integrity, PCR assay was used to detect deletions in the ITR transgene cassette in baculovirus passage 3 and passage 7 as described in example 1. Similar to Figure 1 and as described in example 1, a ~4Kb amplicon representing the full ITR-transgene insert is expected, and a the presence of a second ~1.8Kb deletion band represents full transgene deletion. Figure 6 further confirmed that the presence of the full ITR transgene was low in baculovirus clones comprising construct 1, 2 and 5 due to the lower intensity of the ~4Kb band while the presence of baculoviruses comprising the deletion was higher in both Passage 3 and Passage 7. Surprisingly, for baculoviruses comprising construct 3 and construct 4, a strong amplicon band representing the intact ITR-transgene cassette was observed at both P3 and P7, while the band representing the deletion was less strong. Taken together, the present data demonstrates that reduction in both inverted and direct homology between the ITRs flanking the transgene (left and right / first and second ITRs) improves genetic stability of the ITR transgene DNA cassette in baculovirus.Example 6: Baculoviruses incorporating the ITR designs are suitable for rAAV production.
[0053] ITRs are functionally active components of the AAV genome and play an essential role in replication and encapsidation processes. Therefore, modification of ITRs may negatively impact rAAV production. To assess whether the ITR-trangene designs are suitable for rAAV production, a small scale rAAV production using P3, P5 and P7 baculoviruses comprising constructs 1-4 was caried out by co-infection insect cells with the rAAV2 Rep and AAV5 Cap genes. The cells were then lysed, clarified lysate comprising the rAAVs were collected and viral genome copy number was determined on the unpurified clarified lysates comprising the rAAVsby transgene qPCR. To quantify the viral particle copy number, the AAV5 ELISA kit (PROGEN) was used according to manufacturer’s instructions.
[0054] Figure 7A-B shows successful small scale rAAV production using baculoviruses comprising construct 1-5 with titers and AAV5 capsid particles in the expected range. AAV was further purified, AAV genomes isolated and analyzed by Alkaline DNA electrophoresis. Figure 7C shows that AAV genome integrity is preserved in rAAVs produced with baculoviruses comprising the constructs represented by the presence of the expected genome size and absence alternative genome sizes..
[0055] Taken together, the present results demonstrate that homologous recombination between left and right ITRs result in genetic instability in recombinant baculoviruses. Reducing direct and inverted homology between the ITRs in the ITR-transgene cassette mitigated this genetic instability and provided for an efficient recombinant baculovirus generation process with high rescue efficiency during plaque purification and high genetic transgene stability whilst retaining high AAV production yields and product quality which are essential for manufacturing scale up.Example 7
[0056] rAAV viral vector constructs as described above encoding GFP were used to transduce human iPS derived motorneurons. As determined by assessing fluorescence, all 5 constructs performed equally well. This indicates that modifying ITR sequences as outlined herein allows for improving baculovirus vectors for rAAV manufacturing, while transduction and transgene expression properties of rAAV produced are maintained.REFERENCESBrister, J. R., & Muzyczka, N. (2000). Mechanism of Rep-Mediated Adeno- Associated Virus Origin Nicking. Journal of Virology, 74(17), 7762-7771. https: / / doi.org / 10.1128 / JVI.74.17.7762-7771.2000Chen, H. (2008). Intron Splicing-mediated Expression of AAV Rep and Cap Genes and Production of AAV Vectors in Insect Cells. Molecular Therapy, 16(5), 924-930. https: / / doi.org / 10.1038 / mt.2008.35Grieger, J. C., Soltys, S. M., & Samulski, R. J. (2016). Production of Recombinant Adeno-associated Virus Vectors Using Suspension HEK293 Cells and Continuous Harvest of Vector From the Culture Media for GMP FIX and FLT1 Clinical Vector. Molecular Therapy, 24(2), 287-297. https: / / doi.org / 10.1038 / mt.2015.187King, J. A. (2001). DNA helicase-mediated packaging of adeno-associated virus type 2 genomes into preformed capsids. The EMBO Journal, 20(12), 3282-3291. https: / / doi.org / 10.1093 / emboj / 20.12.3282Kohlbrenner, E., Aslanidi, G, Nash, K., Shklyaev, S., Campbell-Thompson, M., Byrne, B. J., Snyder, R. O., Muzyczka, N., Warrington, K. H., & Zolotukhin, S. (2005). Successful Production of Pseudotyped rAAV Vectors Using a Modified Baculovirus Expression System. Molecular Therapy, 12(6), 1217-1225. https: / / doi.Org / 10.1016 / j.ymthe.2005.08.018 Ruffing, M., Zentgraf, H., & Kleinschmidt, J. A. (1992). Assembly of viruslike particles by recombinant structural proteins of adeno-associated virus type 2 in insect cells. Journal of Virology, 66(12), 6922-6930. https: / / doi.org / 10.1128 / jvi.66.12.6922-6930.1992 Rumachik, N. G., Malaker, S. A., Poweleit, N., Maynard, L. H., Adams, C. M., Leib, R. D., Cirolia, G., Thomas, D., Stamnes, S., Holt, K., Sinn, P., May, A. P., & Paulk, N. K. (2020). Methods Matter: Standard Production Platforms for Recombinant AAV Produce Chemically and Functionally Distinct Vectors. Molecular Therapy - Methods & Clinical Development, 18, 98-118. https : / / do i . org / 10.1016 / j . omtm.2020.05.018Smith, R. H., Levy, J. R., & Kotin, R. M. (2009). A Simplified Baculovirus-AAV Expression Vector System Coupled With One-step Affinity Purification Yields High-titer rAAV Stocks From Insect Cells. Molecular Therapy, 17(11), 1888-1896. https: / / doi.org / 10.1038 / mt.2009.128 Urabe, M., Ding, C., & Kotin, R. M. (2002). Insect Cells as a Factory to Produce Adeno-Associated Virus Type 2 Vectors. Human Gene Therapy, 13(16), 1935-1943.https : / / doi. org / 10.1089 / 10430340260355347
Claims
CLAIMS1. A method of producing recombinant AAV, comprising the steps of:o providing a system with one or more baculoviruses for recombinant AAV production, wherein the system comprises a baculoviral vector with a DNA insert comprising:a DNA construct comprising a gene of interest flanked by a first parvovirus inverted terminal repeat or a chimeric variant thereof (first ITR) and a second parvovirus ITR or a chimeric variant thereof (second ITR), wherein the sequence identity between the first ITR and the second ITR and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is less than 90%;o providing insect cells;o infecting the insect cells with the one or more baculoviruses and allowing recombinant AAV to be produced by the insect cells;o harvesting the recombinant AAV2. The method in accordance with claim 1, wherein the baculoviral vector with the DNA insert with the first and the second ITR, is a baculoviral vector of which the number of passages prior to the use in the step of infecting the insect cells is 2, 3, 4, 5, 6, 7, 8, 9 or more passages.
3. The method in accordance with claim 2, wherein the percentage of intact DNA insert observed after each of the 2, 3, 4, 5, 6, 7, 8, 9 or more passages of the baculoviral vector with the DNA insert, with the first and the second ITR, prior to the step of infecting the insect cells, is increased and preferably shows genetic stability, as compared to the percentage of intact DNA insert obtained when performing the method with a baculovirus vector with a DNA insert comprising a first and a second ITR, wherein the sequence identity between the first ITR and the second ITR is 100% or the sequence identity between the first ITR and the reverse complement sequence of the second ITR is 100%.
4. The method in accordance with claim 2, wherein the percentage of intact DNA insert observed after each of the 2, 3, 4, 5, 6, 7, 8, 9 or more passages of the baculoviral vectorwith the DNA insert with the first and the second ITR, prior to the step of infecting the insect cells, is increased and preferably shows genetic stability, as compared to the percentage of intact DNA insert obtained when performing the method with a baculovirus vector with a DNA insert comprising a first and a second ITR wherein the sequence identity between the first ITR and the second ITR is 80% or more and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is 90% or more.
5. The method in accordance with any of claims 1-4, further comprising isolating the harvested recombinant AAV.
6. The method in accordance with any of claims 1-5 wherein the system with one or more baculoviruses for recombinant AAV production is selected from a three-Bac, two-Bac and mono-Bac system.
7. The method in accordance with claim any of claims 1 -6, wherein the B and C loop encoding regions align with nucleotides 42-84 of SEQ ID NO: 1.
8. The method in accordance with any of claims 1-7, wherein the sequence identity between the first ITR and the second ITR is less than 80 percent, and the sequence identity between the first ITR and the reverse complement sequence of the second ITR is less than 85 percent.
9. The method in accordance with any of claims 1-8, wherein one of the two ITRs comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.
110. The method in accordance with any of claims 1-9, wherein the first ITR comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.1, and the second ITR comprises or consists of a sequence that has at least 95% sequence identity with SEQ ID NO.
4. or SEQ ID NO. 5.
11. The method in accordance with any of claims 1-9, wherein the first ITR consists of the sequence of SEQ ID NO.1, and the second ITR consists the sequence of SEQ ID NO.
4. or SEQ ID NO. 5.
12. A parvoviral vector, preferably a recombinant AAV vector obtainable or obtained by any of the methods of claims 1-11.
13. A pharmaceutical composition comprising the parvoviral vector or the recombinant AAV, in accordance with claim 12.
14. A parvoviral vector, recombinant AAV or a pharmaceutical composition according to any of claims 11 and 12, for use in a medical treatment.
15. A system with one or more baculoviruses for recombinant AAV production, comprising the baculoviral vector with the DNA insert with the first and the second ITR as defined by any of claims 1-11, wherein the system preferably is a three-Bac, two-Bac or mono- Bac system.
Citation Information
Patent Citations
Virus-derived construct plasmid library and construction of same
EP4520832A1
Self-complementary parvoviral vectors, and methods for making and using the same
US20070253936A1
AAV expression cassette and AAV vectors comprising the same
WO2020142714A1
Methods and systems for producing AAV particles
WO2021154923A2
Virus-derived construct plasmid library and construction of same
WO2023214578A1