Pharmaceutical compositions for treating arthritis comprising gynostemma pentaphyllum extract with increased contents of damulin a and damulin b or fractions thereof

Abstract

A Gynostemma pentaphyllum extract, having increased contents of damulin A, damulin B, or damulin A and damulin B, and a fractionated extract thereof exhibit superior anti-inflammatory effects and joint-health-improving effects, including cartilage-forming effects, compared to existing Gynostemma pentaphyllum extracts. Accordingly, the extract having increased contents of damulin A, damulin B, or damulin A and damulin B provides a novel pharmaceutical composition and health functional food for treating osteoarthritis, rheumatoid arthritis, gout, and psoriatic arthritis, the pharmaceutical composition and health functional food having excellent cartilage-forming and arthritis-treating effects.

Description

Pharmaceutical composition for treating arthritis comprising a Gynostemma pentaphyllum extract or a fraction thereof having increased content of damulin A and damulin B

[0001] The present invention relates to a composition for the prevention or treatment of arthritis comprising, as an active ingredient, an extract of Gynostemma pentaphyllum (Actiponin) in which the content of damulin A and damulin B is increased by treating the extract of Gynostemma pentaphyllum (GPE) at high temperature and high pressure.

[0002] The present invention relates to a composition for the prevention or treatment of arthritis comprising, as active ingredients, a Gynostemma pentaphyllum extract (Actiponin) in which the content of damulin A and damulin B is increased by treating the Gynostemma pentaphyllum extract (GPE) at high temperature and high pressure to further fractionate the extract (Actiponin), thereby enhancing the content of damulin A, damulin B, gypenoside L, and gypenoside LI (Actiponin-F, Actiponin-F), and a Gynostemma pentaphyllum extract fraction (TGBA-2) in which the content of the four major components is further enhanced.

[0003] The present invention relates to a composition for the prevention or treatment of arthritis comprising damulin A or damulin B isolated from Gynostemma pentaphyllum extract as an active ingredient.

[0004] The human body is composed of approximately 200 joints. A joint is the area where bones meet. Joints are composed of cartilage, joint capsules, synovial membranes, ligaments, tendons, and muscles to allow for smooth movement between bones, and they serve to absorb shock generated during movement.

[0005] Arthritis is a disease caused by inflammation in the joints of the human body. Types include osteoarthritis, rheumatoid arthritis, gout, and psoriatic arthritis, with 95% of arthritis patients suffering from osteoarthritis. Osteoarthritis is a disease characterized by localized degenerative changes as joint cartilage wears away, and it is also known as degenerative arthritis. Osteoarthritis is a representative degenerative disease closely associated with aging; approximately 10–15% of the total population suffers from this disease, and notably, about 60–80% of the elderly population aged 65 or older suffer from osteoarthritis.

[0006] Osteoarthritis is a degenerative arthritis characterized by degenerative changes in the cartilage and surrounding bone of synovial joints. It is a disease marked by the gradual loss of articular cartilage, hypertrophy of the bone located beneath the cartilage, bone formation at the joint margins, and non-specific synovial inflammation. Osteoarthritis progresses through five stages: the chondrosis stage (Stage 1), where increased water content within the cartilage causes edema; the fibrillation stage (Stage 2), where cartilage is destroyed, causing the surface to crack and tear, exposing the bone and narrowing the joint cavity; the stage (Stage 3), where cartilage cells begin to regenerate to repair the cartilage, but destruction occurs faster than regeneration, leading to an overall reduction in cartilage; the bone change stage (Stage 4), where bone deformation results in joint deformity and dysfunction; and the joint soft tissue change stage (Stage 5), where soft tissue thickens.

[0007] The causes of osteoarthritis are closely related to aging and excessive body weight, and it occurs more frequently in women as age increases. The mechanism by which osteoarthritis is induced is known to involve increased production of pro-inflammatory cytokines and increased secretion of MMPs (Matrix Metalloproteinases), such as collagenase and stromelysin, which cause damage to the articular cartilage matrix.

[0008] Drugs currently used to treat osteoarthritis include analgesics, steroids, and non-steroidal anti-inflammatory drugs, as well as methods using chondroprotective agents such as hyaluronic acid, glucosamine, and chondroitin, and surgical treatment methods such as arthroscopic surgery, proximal tibial osteotomy, partial joint replacement, and total knee replacement.

[0009] However, drug treatments only have the effect of non-specifically alleviating pain or inflammatory responses, and chondroprotectors merely protect the joints by supplying nutrients to cartilage cells or cushioning impact, failing to serve as a fundamental treatment method. Furthermore, existing arthritis medications are known to have disadvantages depending on the type, including various systemic side effects such as gastrointestinal disorders (including stomach ulcers and bleeding), weight gain, diabetes, hypertension, osteoporosis, and cataracts; increased risk of infection, thrombosis, and cardiovascular risks observed when using biological agents; and inconvenience of treatment, delayed onset of action, and cost burden when using injectable formulations. Therefore, there is a need to develop new, safer treatments that can treat osteoarthritis more effectively without side effects.

[0010] Gynostemma pentaphyllum is a perennial vine belonging to the Cucurbitaceae family. It grows wild in forests in mountains and fields, and its rhizomes spread sideways with white hairs at the nodes and grow in an tangled manner, but it also climbs up using tendrils.

[0011] Tea made from dried leaves of the *Gynostemma pentaphyllum* is also known as *vine tea* and is said to eliminate alopecia areata, restore the function of various organs, maintain healthy skin, have anti-stress effects, suppress relaxant and spastic constipation, and have antidiarrheal effects. It is also known to be effective for bronchial asthma and senile chronic bronchitis, and has antitussive, expectorant, and stress-induced ulcer effects, as well as preventing arthritis, hepatitis, and arteriosclerosis, and providing pain relief.

[0012] Prior art related to the arthritis effects of Gynostemma pentaphyllum includes the research report “Development of Obesity-Suppressing Functional Food Using TG1022F” reported by the inventors in 2010, which describes that Gynostemma pentaphyllum extract (TG1022F) exhibits an alleviating effect on arthritis in animal models of CIA (rheumatoid arthritis) and AIA (chronic arthritis). Chinese Published Patent No. 115666540 A discloses that Gynostemma pentaphyllum leaves (tea) are effective in preventing arthritis, and Zhi-Hong Wan et al. (2017) discloses that Gypenoside (GP), known as a major component of Gynostemma pentaphyllum, has an anti-inflammatory effect in human osteoarthritis chondrocytes induced by interleukin-1β. Chinese Published Patent No. 115368425 A describes a therapeutic composition for rheumatoid arthritis, osteoarthritis, juvenile arthritis, and gouty arthritis using a compound obtained by acid hydrolysis of Gynostemma pentaphyllum extract. Korean Patent No. 10-0930580 describes that Damulin A and Damulin B are produced by high-temperature and high-pressure treatment of Gynostemma pentaphyllum, and that these components are active ingredients useful for treating metabolic diseases through AMPK activation. Hee-Geun Jo et al. (2024) discloses the inhibitory effects of Gynostemma pentaphyllum leaf ethanol extract on pain, inflammation, and cartilage destruction through the inhibition of metalloproteinases (MMP), Cyclooxygenase-2, and Prostaglandin E receptors.

[0013] However, the prior art does not disclose that Damulin A or Damulin B isolated from Gynostemma pentaphyllum extract, or Gynostemma pentaphyllum extract enhanced with these Damulin A or Damulin B components, have excellent effects in directly preventing or treating arthritis.

[0014] Accordingly, while developing a new therapeutic agent capable of effectively treating arthritis without side effects using natural herbal medicines, the inventors confirmed that inflammation, a major cause of arthritis, was improved in cell experiments and animal experiments on arthritis using Damulin A, Damulin B, and Gynostemma pentaphyllum extracts containing them. Furthermore, they established optimal conditions for producing an extract with excellent therapeutic effects on arthritis, including superior chondrocyte proliferation and increased cartilage thickness in animal experiments using the said extracts. By confirming that the Gynostemma pentaphyllum extract produced by the above method can effectively improve and treat arthritis without side effects, the inventors completed the present invention.

[0015] The present invention provides a composition for the prevention or treatment of arthritis comprising, as active ingredients, a Gynostemma pentaphyllum extract (Actiponin) in which the content of damulin A and damulin B is increased by treating the Gynostemma pentaphyllum extract (GPE) at high temperature and high pressure, and a Gynostemma pentaphyllum extract fraction (Actiponin-F and TGBA-2) in which the content of damulin A, damulin B, gypenoside L, and gypenoside LI is enhanced.

[0016] The present invention provides a composition for the prevention or treatment of arthritis comprising damulin A or damulin B isolated from Gynostemma pentaphyllum extract as an active ingredient.

[0017] Another objective of the present invention is to provide a pharmaceutical or health functional food comprising a Gynostemma extract, a fraction thereof, or Damulin A or Damulin B, which exhibits increased preventive, improving, and therapeutic effects of arthritis with Damulin A, Damulin B, Zipenoside L, Zipenoside LI, Zipenoside LVI, and Zipenoside XLVI.

[0018] The present invention will be described in detail below.

[0019] The present invention relates to a Gynostemma pentaphyllum extract in which the content of damulin A and damulin B is increased by treating the extract of Gynostemma pentaphyllum, fresh Gynostemma pentaphyllum leaves, or dried Gynostemma pentaphyllum leaves with water, C1 to C4 lower alcohols, or a mixture of solvents thereof, with high temperature, high pressure, or an organic acid.

[0020] The high-temperature and high-pressure treatment reaction of the above-mentioned Gynostemma pentaphyllum leaf or Gynostemma pentaphyllum leaf extract can be prepared by selecting from the method described in Korean Registered Patent No. 930580.

[0021] The organic acid treatment reaction of the above-mentioned Gynostemma pentaphyllum leaf or Gynostemma pentaphyllum leaf extract can be prepared by selecting from the method described in Korean Registered Patent No. 2507569.

[0022] It can be prepared by selecting a combination of a high-temperature and high-pressure treatment reaction and an organic acid treatment reaction of the above-mentioned Gynostemma pentaphyllum leaf or Gynostemma pentaphyllum leaf extract.

[0023] The fractions of Gynostemma pentaphyllum extract exhibiting increased preventive, improving, and therapeutic effects for arthritis with the above-mentioned damulin A, damulin B, gypenoside L, gypenoside LI, gypenoside LVI, and gypenoside XLVI can be prepared by using fractionation methods using column chromatography and liquid-liquid separation, as well as by using high temperature and high pressure treatment, organic acid treatment, and enzyme treatment alone or by combining the above methods.

[0024] The chemical structures of zipenoside LVI, zipenoside XLVI, zipenoside L, and zipenoside LI, which are the main components of Actiponin-F and TGBA-2 confirmed to have an arthritis treatment effect in the present invention, and 2α,3β,12β-trihydroxydammar-20(22)-E,24-diene-3-O-[β-D-glucopyranosyl-(1→)-β-D-glucopyranoside] named Damulin A, which is the active ingredient for arthritis treatment, and 2α,3β,12β-trihydroxydammara-20,24-diene-3-O-[β-D-glucopyranosyl-(1→)-β-D-glucopyranoside] named Damulin B, which is the active ingredient for arthritis treatment, are as shown in the following chemical structural formulas.

[0025] [Chemical Structure Formula]

[0026]

[0027] In the present invention, Damulin A is used interchangeably with Damulin A, DA, and Damulin B is used interchangeably with Damulin B, DB.

[0028] In the present invention, gypenoside L, gypenoside L, gypenoside 50, GPL, and GP50 are used interchangeably, and gypenoside LI is used interchangeably with gypenoside LI, gypenoside 51, GPLI, and GP51.

[0029] In the present invention, gypenoside LVI, gypenoside LVI, gypenoside 56, gPLVI, and GP56 are used interchangeably, and gypenoside XLVI is used interchangeably with gypenoside XLVI, gypenoside 46, GPXLVI, and GP46.

[0030] The Gynostemma pentaphyllum leaf extract prepared by high temperature and high pressure treatment, organic acid treatment, or a combination thereof in the Gynostemma pentaphyllum leaf extract of the present invention has increased damulin A and damulin B, and the therapeutic effect for arthritis is significantly improved. For such therapeutic, improvement, or preventive effects on arthritis, the content of damulin A and damulin B is, respectively, in the dry solid content of the Gynostemma pentaphyllum leaf extract of the present invention, the content of damulin A, which is an effective indicator component, is in the range of 0.5% to 10% and preferably 0.7% to 7%, and the content of damulin B is in the range of 0.3% to 8% and preferably 0.5% to 6%.

[0031] The Gynostemma pentaphyllum leaf extract of the present invention may be prepared by a method comprising the steps of: preparing a Gynostemma pentaphyllum leaf extract by extracting Gynostemma pentaphyllum leaves or dried Gynostemma pentaphyllum leaves with water, a C1 to C4 lower alcohol, or a mixed solvent thereof (Step 1); preparing an extract of the Gynostemma pentaphyllum leaf extract residue by extracting the residue remaining after extracting the Gynostemma pentaphyllum leaves with water, a C1 to C4 lower alcohol, or a mixed solvent thereof (Step 2); mixing the extract of Step (1) and the extract of Step (2) (Step 3); mixing the extract of Step 3 (Step 4); and treating the extract of Step 4 at high temperature and high pressure (Step 5).

[0032] The Gynostemma pentaphyllum leaf extract of the present invention may be prepared by a method comprising the steps of: preparing a Gynostemma pentaphyllum leaf extract by extracting Gynostemma pentaphyllum leaves or dried Gynostemma pentaphyllum leaves with water, a C1 to C4 lower alcohol, or a mixed solvent thereof (Step 1); preparing an extract of the Gynostemma pentaphyllum leaf extract residue by extracting the residue remaining after extracting the Gynostemma pentaphyllum leaves with water, a C1 to C4 lower alcohol, or a mixed solvent thereof (Step 2); mixing the extract of Step (1) and the extract of Step (2) (Step 3); mixing the extract of Step 3 (Step 4); and adding an organic acid to the extract of Step 4 and then heating it to 50 to 100 ℃ (Step 5).

[0033] The Gynostemma pentaphyllum leaf extract of the present invention can be prepared by a method comprising the step of placing Gynostemma pentaphyllum leaves or dried Gynostemma pentaphyllum leaves in water and subjecting them to high temperature and high pressure treatment, followed by extracting them with a C1 to C4 lower alcohol or a mixed solvent thereof.

[0034] The dried Gynostemma pentaphyllum leaf in step (1) above refers to a dried Gynostemma pentaphyllum leaf, and includes naturally dried Gynostemma pentaphyllum leaf, semi-dried Gynostemma pentaphyllum leaf, Gynostemma pentaphyllum leaf dried after roasting or steaming, etc. The Gynostemma pentaphyllum leaf may be a fresh Gynostemma pentaphyllum leaf that has been roasted or steamed at 90 to 300 ℃ for 5 minutes to 120 hours and then dried.

[0035] In order to obtain a Gynostemma extract with a high content of Damulin A and B, it is necessary to maintain high temperature and high pressure. For this purpose, a commercially available general high temperature and high pressure or a fermentation tank and extractor equipped with a high temperature and high pressure sterilization device can be used.

[0036] The above Gynostemma extract can be produced even under ultra-high pressure conditions where the temperature is not high, and commercially available ultra-high pressure reactors may be used to maintain the ultra-high pressure conditions. For example, the DFS-2L from Toyo Koko Co., Ltd. of Japan may be used. The preferred temperature for producing the above novel Gynostemma extract is 40 to 180 ℃, and the preferred pressure is 1.2 to 1,100 atmospheres. The reaction time is preferably 0.1 to 24 hours. In addition, as a method to increase the content of Damulin A and Damulin B in the Gynostemma extract, it is also possible to use an ultra-high frequency range or an oven in addition to high pressure and high temperature conditions.

[0037] The Gynostemma extract of the present invention, to which high temperature and high pressure are applied, has increased damulin A and damulin B, and the therapeutic effect for arthritis is significantly improved. For such therapeutic, improvement, or preventive effects for arthritis, the content of damulin A, which is an effective indicator component in the dry solid content of the Gynostemma extract of the present invention, is in the range of 0.5% to 10%, preferably in the range of 0.7% to 7%, and the content of damulin B is in the range of 0.3% to 8%, preferably in the range of 0.5% to 6%.

[0038] The fractions of Gynostemma pentaphyllum extract exhibiting increased arthritis improvement and therapeutic effects with the above-mentioned damulin A, damulin B, gypenoside L, gypenoside LI, gypenoside LVI, and gypenoside XLVI can be prepared by using methods such as column chromatography fractionation and liquid-liquid separation fractionation, as well as high temperature and high pressure treatment, organic acid treatment, and enzyme treatment, either individually or in combination with the above methods.

[0039] In the present invention, the arthritis is osteoarthritis, rheumatoid arthritis, gout, and psoriatic arthritis, preferably osteoarthritis called degenerative arthritis, but is not limited thereto.

[0040] In the present invention, the osteoarthritis is a disease also known as degenerative arthritis, characterized by irreversible loss of cartilage tissue, the formation of abnormal bone tissue, and an increase in the thickness of the subchondral bone due to degenerative changes caused by obesity, aging, or traumatic inflammation, resulting in pain and loss of mobility. Accordingly, in the present invention, the osteoarthritis encompasses both degenerative arthritis caused by degenerative changes in cartilage cells due to aging and degenerative arthritis that occurs after trauma.

[0041] The daily dosage of the solid extract, extract, fraction of extract, or liquid form prior to powdering of the present invention may be administered appropriately in an amount of 1 mg to 100 g based on the solid content, along with other additives and excipients.

[0042] The formulation of the present invention may be composed of a Gynostemma extract containing damulin A or damulin B as an active ingredient in a range of 0.01% to 100% of the total composition.

[0043] In addition, food containing the composition of the present invention may be used with any type of carrier within a composition range in which the effect of improving arthritis is not impaired. The composition of the present invention may be added to hot spring water, filtered water, distilled water, carbonated water, juice, yogurt, milk, edible oil, food additives, ice cream, hamburgers, cereals, cookies, bread, biscuits, processed meat, soy milk, health food, nutritional supplements, processed fruits and fruit juices, etc., and food containing this composition may include fillers, preservatives, sweeteners, coloring agents, humidifying emulsifiers, etc.

[0044] Depending on the clinical state of the disease, various recognized routes of administration may be selected. Examples include oral or parenteral administration methods. Parenteral administration methods include intravenous injection, intramuscular injection, subcutaneous injection, and nasal administration, and the formulations may be solid, semi-solid, or liquid. Additionally, all forms capable of administering a precise amount are included, such as suppositories, creams, gels, patches, vaginal suppositories, and aerosols. Pharmacological compositions include traditional mediators and adjuvants. Any pharmacologically recognized mediator may serve as the mediator of the present invention, and excipients or stabilizers include those that exhibit non-toxicity upon exposure to cells and mammals. Pharmacologically recognized mediators include pH buffer aqueous solutions, phosphoric acid and citric acid, and may include ascorbic acid. Water-soluble polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine, or lysine, and carbohydrates such as glucose, mannose, and dextrin may also serve as mediators. Chelating agents such as EDTA, mannitol, sorbitol, and non-polar surfactants such as Tween, PEG (Polyethylene Glycol), and Pluronics may also be included as mediators. Pharmacologically recognized mediators and diluents include all types of solutions, dispersants, antibacterial and antifungal agents, anti-adhesives, and absorption retardants. The use of these preparations for the pharmacologically active substance is as described in the general description. All preparations are included, excluding those incompatible with the pharmacologically active substance. Complementary components may also be added to this composition. In addition, the composition of the present invention may include chromium, manganese, zinc, niacin, vitamin B6, vitamin B12, etc., and may also include HCA (Hydroxycitric acid) and CLA (Conjugated linoleic acid), which are currently known to be effective against obesity.

[0045] Even when administered orally, it may be formulated with pharmacologically recognized non-toxic excipients. Excipients include mannitol, polydextrose, maltodextrose, starch, lactose, magnesium stearate, saccharin, talc, cellulose, glucose, gelatin, sugar, magnesium carbonate, etc. This composition may be in the form of a solution, suspension, tablet, pill, capsule, or powder and may be formulated with pharmacologically recognized non-toxic excipients.

[0046] Tablets, pills, and capsules may contain the following formulations. Adhesives such as tragacanth gum, acacia, corn starch, and gelatin; excipients such as calcium phosphate; decomposers such as corn starch, potato starch, and alginate; lubricants such as magnesium stearate; sweeteners such as sugar and lactose; and flavorings extracted from peppermint, wind green, and cherry may also be added. If the unit dose is in capsule form, a liquid medium may be included in addition to the formulations presented above. In the case of syrups and elixirs, along with the active ingredient, sweeteners such as sugar and methyl or propyl parabens as preservatives may be included, and cherry and orange flavorings may be added as coloring agents and flavorings. All formulations used when preparing the unit dose must be pure and non-toxic. In such formulations, diluents such as lactose, sugar, and calcium phosphate, lubricants such as magnesium stearate, and binders such as starch, polyvinylpyrrolidone, acacia gum, gelatin, and cellulose may also be included.

[0047] Gynostemma extract with increased content of damulin A and damulin B, and Gynostemma extract fractions with increased content of damulin A, damulin B, gypenoside L, gypenoside LI, gypenoside LVI, and gypenoside XLVI, have superior anti-inflammatory and cartilage-promoting effects in animal experiments compared to Gynostemma extract that has not undergone high temperature and high pressure treatment.

[0048] As a result, Gynostemma extract with increased damulin A and damulin B content and Gynostemma extract fractions with increased damulin A, damulin B, gypenoside L, gypenoside LI, gypenoside LVI, and gypenoside XLVI content provide a new arthritis treatment with excellent cartilage proliferation effects.

[0049] Figure 1 shows the results of confirming cytotoxicity using CCK8 solution by treating mouse macrophages RAW264.7 with Gynostemma pentaphyllum extract (1A), Actiponin (1B), Damulin A (1C), Damulin B (1D), wsAN (1E), Actiponin-F (1F), and TGBA-2 (1G) at different concentrations.

[0050] Figure 2 shows the results of confirming the effects of Gynostemma pentaphyllum extract (2A), Actiponin (2B), Damulin A (2C), Damulin B (2D), wsAN (2E), Actiponin-F (2F), and TGBA-2 (2G) on inhibiting LPS-induced NO production in mouse macrophages RAW264.7, and a comparison of NO production-inducing activities (2H) by treating Gynostemma pentaphyllum extract, Actiponin, wsAN, Actiponin-F, and TGBA-2 alone.

[0051] Figure 3 is a figure showing the results confirming that PGE2 production is reduced in a concentration-dependent manner in mouse macrophages RAW264.7 upon treatment with Actiponin (3A), Damulin A (3B), Damulin B (3C), Actiponin-F (3D), and TGBA-2 (3E).

[0052] Figure 4 is a figure showing the results of confirming the inhibitory effect of LPS-induced inflammatory response protein production by Gynostemma pentaphyllum extract (4A), Actiponin (4B), Damulin A (4C), Damulin B (4D), wsAN (4E), Actiponin-F (4F), and TGBA-2 (4G) on mouse macrophages RAW264.7, showing that treatment with Actiponin, Damulin A, Damulin B, Actiponin-F, and TGBA-2 inhibited the production of inflammatory enzymes iNOS and COX2, and inflammatory cytokines TNF-α and IL-6 in a concentration-dependent manner.

[0053] Figure 5 shows the results of treatment with actiponin (5A), damulin A (5B), damulin B (5C) and TGBA-2 (5D) in mouse macrophages RAW264.7 inhibiting the phosphorylation of IκBα and NFκB induced by LPS in a concentration-dependent manner.

[0054] Figure 6 is a figure showing the results of treatment with actiponin (6A), damulin A (6B), damulin B (6C) and TGBA-2 (6D) in mouse macrophages RAW264.7 inhibiting the phosphorylation of MAPKs (JNK, ERK, and p38) in a concentration-dependent manner.

[0055] Figure 7 shows the results of confirming cytotoxicity using CCK8 solution by treating human chondrocyte SW1353 with Gynostemma pentaphyllum extract (7A), Actiponin (7B), Damulin A (7C), Damulin B (7D), wsAN (7E), Actiponin-F (7F), TGBA-2 (7G), Zipenoside LVI (7H), Zipenoside XLVI (7I), Zipenoside L (7J) and Zipenoside LI (7K) at different concentrations.

[0056] Figure 8 is a figure showing the effects of Gynostemma pentaphyllum extract (8A), Actiponin (8B), Damulin A (8C), Damulin B (8D), wsAN (8E), Actiponin-F (8F), and TGBA-2 (8G) on inhibiting the production of cartilage matrix degrading enzymes MMP-2 and MMP-9, which are increased by an inflammatory response induced by IL-1β treatment, in human chondrocyte SW1353 using gelatin zymography.

[0057] Figure 9 is a figure showing the effects of Gynostemma extract (9A), Actiponin (9B), Damulin A (9C), and Damulin B (9D), wsAN (9E), Actiponin-F (9F), TGBA-2 (9G), Zipenoside LVI (9H), Zipenoside XLVI (9I), Zipenoside L (9J) and Zipenoside LI (9K) on the improvement of cartilage matrix component Aggrecan and Collagen type II expression inhibited by IL-1β treatment in human chondrocyte SW1353 using RT-qPCR.

[0058] Figure 10 shows the carrageenan-induced left hind paw edema (10A) and inhibitory effect (10B) of Actiponin on rats.

[0059] Figure 11 briefly illustrates the experimental method regarding the cartilage improvement effects of Actiponin, Actiponin-F, and TGBA-2 administration in a DMM (destabilization of the medial meniscus) model.

[0060] Figure 12 shows the results of confirming the inhibitory effect of Actiponin on cartilage destruction by administering it to rats that underwent DMM surgery or Sham surgery, including Safranin O staining image (12A); OsteoArthritis Research Society International (OARSI) grading result graph (12B); MMP13 protein expression staining image in cartilage tissue (12C); results of measuring articular cartilage thickness (12D); and graphs of measuring the number of cartilage cells (12E).

[0061] Figure 13 shows the results of confirming the cartilage destruction inhibitory effect by administering Actiponin-F to rats that underwent DMM surgery or Sham surgery.

[0062] Figure 14 shows the results of confirming the cartilage destruction inhibitory effect by administering TGBA-2 to rats that underwent DMM surgery or Sham surgery.

[0063] [Correction pursuant to Rule 91 06.11.2025] Figure 15 shows the results of confirming the cartilage regeneration effect by Safranin O staining in rats with acute osteoarthritis induced by administering 3 mg / kg Monosodium iodoacetate (MIA) into the joint cavity and administering Actiponin. Figure 16 is a comparative HPLC figure of Gynostemma pentaphyllum extract (GPE), Actiponin, non-saponin water-soluble fraction (wsAN), Actiponin-F, and TGBA-2.

[0064] The present invention will be explained in detail below by way of examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.

[0065] <Comparative Example. Preparation of Gynostemma extract (GPE)>

[0066] Gynostemma pentaphyllum extract (GPE) that was not subjected to high temperature and high pressure treatment was prepared by extracting Gynostemma pentaphyllum leaves twice with 50% ethanol at 65–85°C for 3–8 hours each, filtering the supernatant, and centrifuging at 1,000 g to remove suspended solids. The obtained extract was concentrated and freeze-dried to obtain a dried powder, which was used in each experiment.

[0067] <Example 1. Isolation of arthritis therapeutic substances Damulin A and B from Gynostemma pentaphyllum extract>

[0068] 5 kg of dried Gynostemma pentaphyllum leaves were immersed in 50 L of 50% ethanol and extracted at 90°C for 6 hours, after which the first supernatant was collected. 50 L of 50% ethanol was added to the remaining immersion of Gynostemma pentaphyllum leaves, and the mixture was extracted at 90°C for 6 hours to obtain the second supernatant. The first and second supernatants were combined and filtered through gauze. The resulting liquid was then centrifuged at 1,000 × g to remove suspended solids. The obtained extract was concentrated under reduced pressure to 50 Brix and used for the isolation of the active substance, damulin. The high temperature and high pressure treatment of the concentrate, the pure isolation of damulin A and B, and their identification were carried out by referring to the contents disclosed in Korean Registered Patent No. 930580.

[0069] <Example 2. Preparation of Gynostemma extract with increased damulin content by high temperature and high pressure treatment>

[0070] A concentrated ethanol extract of *Gynostemma pentaphyllum* with increased damulin content due to high temperature and high pressure treatment (hereinafter referred to as “Actiponin”) was prepared by applying a high temperature and high pressure reaction or an ultra-high pressure reaction to a simple heated and atmospheric pressure *Gynostemma pentaphyllum* ethanol extract (hereinafter referred to as “heated and atmospheric pressure *Gynostemma pentaphyllum* extract”). For the high temperature and high pressure reaction, a standard high temperature and high pressure sterilizer (Autoclave) or an ultra-high pressure reactor (DFS-2L, Toyo Koko, Japan) was used to maintain high temperature and high pressure conditions for the concentrated simple extract of *Gynostemma pentaphyllum*. The content of damulin A and damulin B in the dried material obtained by drying the concentrated extract of *Gynostemma pentaphyllum* was analyzed using HPLC. The content of damulin A and damulin B increased in proportion to temperature, pressure, and time, respectively.

[0071] Accordingly, in the present invention, a new concentrated extract of Gynostemma pentaphyllum (Actiponin) with increased content of damulin A and damulin B is prepared by treating the concentrated extract of Gynostemma pentaphyllum with high temperature and high pressure. Actiponin can be prepared by including 0.7~7% (w / w) of damulin A, 0.5~6% (w / w) of damulin B, 0.03~9% (w / w) of gypenoside L, and 0.03~8% (w / w) of gypenoside LI. Table 1 is a graph showing the increase in the content of damulin A and B contained in the Gynostemma pentaphyllum extract under high temperature and high pressure conditions.

[0072] Reaction Conditions Damulin Content % (w / w) Temperature (°C) Time (Hour) Pressure (Atm) Damulin A Damulin B Control Group (TG1022) 0.37±0.03 0.28±0.02 1210.5±0.20.70±0.04 0.56±0.04 10.89±0.07 0.68±0.04 21.53±0.06 1.16±0.07 32.01±0.08 1.47±0.08 42.49±0.09 1.91±0.108 3.21±0.03 2.42±0.03 124.51±0.03 12±0.02246.82±0.065.54±0.0545122970.62±0.030.52±0.029610.83±0.070.74±0.0710871.21±0.061.13±0.06242970.82±0.020.71±0.059611.22±0.040.97±0.0310871.81±0.061.33±0.02

[0073] <Example 3. Preparation of Actiponin Fraction>

[0074] The inventors confirmed the arthritis-improving and therapeutic effects of Actiponin, including Damulin A and Damulin B, and in particular confirmed that the non-saponin water-soluble fraction (wsAN), which corresponds to the polar fraction containing a large amount of water-soluble substances obtained from the Actiponin fraction, exhibits strong inflammation-inducing activity.

[0075] The above wsAN (non-saponin water-soluble fraction) is a fraction that elutes within a retention time of 10 minutes when separated under the conditions of Shimadzu (CBM-40) System, ELSD detector, HYPERSIL C18 (4.6×250 mm, Thermo BDS), flow rate 0.9 mL / min, solvent: A - H2O / B - CH3CN, solvent concentration gradient [B 5% (0-5 min) / 5-73% (5-45 min) / 73-100% (45-55 min) / 100% (55-60 min) / 100-5% (60-60.1 min) / 5% (60.1-75 min)], and corresponds to a fraction having a total sugar content of 15±2% when analyzed by the phenol sulfuric acid method and a total protein content of 16±3% when analyzed by the BCA method.

[0076] Accordingly, a method for preparing Actiponin-F, an Actiponin fraction with enhanced content of damulin A, damulin B, gypenoside L, gypenoside LI, gypenoside LVI, and gypenoside XLVI, was established by removing the wsAN fraction through additional fractionation of the Gynostemma pentaphyllum extract (Actiponin) with increased damulin content by high temperature and high pressure treatment of Example 2.

[0077] In addition, a method for producing the Actiponin fraction TGBA-2 was established through additional fractionation of Actiponin, which does not contain wsAN fraction, gypenoside LVI, and gypenoside XLVI, but has damulin A, damulin B, gypenoside L, and gypenoside LI as main components and has an even higher content of the four components.

[0078] Methods for obtaining Actiponin-F and TGBA-2 may include fractionation methods using column chromatography, fractionation methods using liquid-liquid separation, as well as high temperature and high pressure treatment and organic acid treatment, either individually or in combination with the above methods.

[0079] As a specific example of fractionation using the above column chromatography, a Gynostemma pentaphyllum leaf extract containing one or more major components is adsorbed onto a stationary phase such as a normal-phase silica resin, a benzene-ethylene resin, more preferably Diaion HP20, or a reverse-phase resin, and eluted using a mixture of water, methanol, ethanol, acetonitrile, etc. as the mobile phase, thereby selectively fractionating a fraction containing major substances.

[0080] As a specific example of the fractionation method using the above liquid-liquid separation, a Gynostemma pentaphyllum leaf extract containing one or more major components can be prepared by homogenizing it using a lower alcohol having 1 to 4 carbon atoms, an organic solvent having 1 to 6 carbon atoms, dioxane, triple distilled water, and a mixed solvent thereof, and then allowing it to stand to separate the resulting solution layer, which is then fractionated. In addition, the solvent used for fractionation may include NaCl, KCl, citrate, other organic acids, and salts of organic acids.

[0081] The above high-temperature and high-pressure treatment may utilize an extractor equipped with a general commercially available high-temperature and high-pressure sterilization device, subcritical extraction equipment, etc. Preferred conditions for producing Actiponin-F and TGBA-2 involve treating a Gynostemma pentaphyllum leaf extract containing one or more major components at 40 to 300°C for 5 minutes to 120 hours at 1.02 to 1,100 atmospheres. More preferably, the treatment is performed at 90 to 200°C for 0.5 to 48 hours at 1.1 to 100 atmospheres. Additionally, various organic acids and their salts may be added during the high-temperature and high-pressure treatment to obtain fractions with different compositional ratios and contents of major substances.

[0082] If necessary to obtain a fraction with a specific composition ratio and content of the main substance, additional steps of filtration, concentration, and drying may be included in accordance with known methods in conjunction with the above-described chromatography, liquid-liquid separation, and high-temperature, high-pressure treatment methods, and the above methods may be used in sequential combination. It is also possible to use fractions obtained from each step by appropriately mixing them.

[0083] Another method for obtaining TGBA-2 is to treat purified gypenoside LVI or gypenoside XLVI, respectively, at high temperature and high pressure, or to treat a purified product containing gypenoside LVI and gypenoside XLVI at high temperature and high pressure. As a specific example of the above method, a single substance of purified gypenoside LVI or gypenoside XLVI, or a mixture of purified gypenoside LVI and gypenoside XLVI, can be treated at 40 to 300°C for 5 minutes to 120 hours at 1.02 to 1,100 atmospheres. More preferably, a single substance of purified gypenoside LVI or gypenoside XLVI, or a mixture of purified gypenoside LVI and gypenoside XLVI, can be treated at 90 to 200°C for 0.5 to 48 hours at 1.1 to 100 atmospheres.

[0084] [Correction pursuant to Rule 91 06.11.2025] The present invention relates to a Gynostemma extract characterized by the sum of the contents of Damulin A, Damulin B, Zipenoside L, and Zipenoside LI being 2.8~99.0% (w / w) through additional purification of the Gynostemma extract prepared by treating the Gynostemma extract at high temperature and high pressure, and a composition for improving or treating arthritis containing the same. The chromatograms of the above-mentioned Gynostemma extract (GPE), Actiponin, wsAN fraction (non-saponin water-soluble fraction), Actiponin-F, and TGBA-2 are as shown in the HPLC comparative figure of FIG. 16.

[0085] HPLC analysis was performed under the conditions of a Shimadzu (CBM-40) System, ELSD detector, HYPERSIL C18 (4.6×250 mm, Thermo BDS), flow rate 0.9 mL / min, solvent: A - H2O / B - CH3CN, and solvent concentration gradient [B 5% (0-5 min) / 5-73% (5-45 min) / 73-100% (45-55 min) / 100% (55-60 min) / 100-5% (60-60.1 min) / 5% (60.1-75 min)].

[0086] [Correction pursuant to Rule 91 06.11.2025]<Deleted>

[0087] [Correction pursuant to Rule 91 06.11.2025]<Deleted>

[0088] Table 2 below is a graph showing the content of gypenoside LVI (GP56), gypenoside XLVI (GP46), gypenoside L (GP50), gypenoside LI (GP51), damulin A (DA), and damulin B (DB) contained in Actiponin, obtained through several experiments using independent lots of Gypsum leaf extracts from different origins and production times, and in Actiponin-F and TGBA-2, which are fractions prepared from the above Actiponin.

[0089] Classification Unit: mg / gws ANGP56GP46GP50GP51DBDA Total Actiponin Experiment 152460.058.18.45.06.16.1143.5 Experiment 243655.856.514.011.37.69.8155.0 Experiment 349333.639.217.013.911.313.3128.3 Experiment 456026.433.219.412.312.915.9120.1 Experiment 547033.841.521.115.116.919.3147.6 Experiment 651524.722.926.319.720.022.0135.6 Actiponin-F Experiment 70146.4168.829.025.023.424.0416.7 Experiment 80142.3154.134.718.128.425.5403.0 Experiment 90144.7165.948.639.832.236.0467.2 Experiment 100128.7133.652.044.036.939.0434.2 Experiment 110103.0114.860.354.048.352.0432.4 Experiment 12099.9110.877.164.057.161.0469.8 Experiment 13097.3118.184.065.078.079.0521.4TGBA-2 Experiment 14000106.079.097.0109.0391.0 Experiment 15000162.0113.0119.0179.0573.0 Experiment 16000189.4135.6147.0174.8646.8 Experiment 17000212.7152.4169.5192.8727.4 Experiment 18000171.8131.2220.2251.5774.7 Experiment 19000177.2137.0235.5286.2835.9

[0090] From the experimental results in Table 2 above, Actiponin consists of gypenoside LVI (2.5~6.0 %w / w), gypenoside XLVI (2.3~5.8 %w / w), gypenoside L (0.8~2.6 %w / w), gypenoside LI (0.5~2.2 %w / w), damulin B (0.6~2.0 %w / w), and damulin A (0.6~2.2 %w / w), and the total weight of gypenoside LVI, gypenoside XLVI, gypenoside L, gypenoside LI, damulin B and damulin A combined is 7.3~20.6 %w / w. Actiponin-F is a fraction from which the non-saponin water-soluble fraction (wsAN) has been removed, and consists of gypenoside LVI (9.7~14.6 %w / w), gypenoside XLVI (11.1~16.9 %w / w), gypenoside L (2.9~8.4 %w / w), gypenoside LI (1.8~6.5 %w / w), damulin B (2.4~7.9 %w / w), and damulin A (2.3~7.8 %w / w), with the total weight of gypenoside LVI, gypenoside XLVI, gypenoside L, gypenoside LI, damulin B and damulin A combined being 30~62 %w / w.

[0091] TGBA-2 is a fraction from which the non-saponin water-soluble fraction (wsAN) has been removed, and consists of zipenoside L (10.6~21.3 %w / w), zipenoside LI (7.9~15.2 %w / w), damulin B (9.7~23.6 %w / w), and damulin A (10.9~28.6 %w / w). The total weight of zipenoside L, zipenoside LI, damulin B, and damulin A combined is 39.1~88.7 %w / w, confirming that the content of each substance varies depending on the origin and harvesting time of the Gynostemma pentaphyllum leaves.

[0092] Furthermore, the inventors confirmed the arthritis-improving and therapeutic effects of Actiponin, which includes Damulin A and Damulin B, and specifically confirmed that the wsAN fraction, which corresponds to the polar fraction obtained from Actiponin, exhibits strong inflammation-inducing activity. By preparing an Actiponin fraction ('Actiponin-F') from which the wsAN fraction has been removed, they produced a new Gynostemma extract with superior arthritis-improving and therapeutic effects without side effects.

[0093] To compare the anti-inflammatory effects of Gynostemma pentaphyllum extract (GPE) not subjected to high temperature and high pressure treatment, Actiponin, its fraction wsAN, Actiponin-F, TGBA-2, and Damulin A and Damulin B, the amount of NO produced by LPS treatment was measured after treating RAW264.7 cells with each substance. Actiponin, Actiponin-F, TGBA-2, and Damulin A and Damulin B showed excellent NO production inhibitory ability, whereas wsAN did not inhibit NO production induced by LPS treatment and induced NO production in a dose-dependent manner. Meanwhile, the Gynostemma pentaphyllum extract not subjected to heat treatment showed weak NO production inhibitory ability (Figs. 2A–2G).

[0094] When comparing the amount of NO produced by treating RAW264.7 cells with the actiponin fractions wsAN, actiponin-F, and TGBA-2 alone under conditions without LPS treatment, wsAN alone showed strong NO production-inducing activity, whereas actiponin-F and TGBA-2 did not induce NO production (Fig. 2H).

[0095] Actiponin, Actiponin-F (from which the wsAN fraction was removed), and TGBA-2 showed excellent NO production inhibition effects compared to the unheat-treated Gynostemma pentaphyllum extract GPE, and Actiponin-F (from which the wsAN fraction was removed) and TGBA-2 showed even better NO production inhibition effects than Actiponin.

[0096] From the above results, it is expected that the wsAN fraction will have strong inflammation-inducing activity, and it was determined that Actiponin-F and TGBA-2, from which the wsAN fraction was removed from Actiponin, would have superior anti-inflammatory activity and arthritis-improving effects compared to Actiponin.

[0097] Statistical Analysis Methods

[0098] In this invention, all results except for animal testing were obtained from at least three independent experiments. Each result was expressed as mean ± standard deviation. Statistical analysis was performed using IBM SPSS Statistics 27 (IBM Corporation, Armonk, NY, USA), and post-hoc testing was conducted using Duncan's multiple range test after analysis with one-way ANOVA. The statistical significance level was set at p < 0.05.

[0099] <Experimental Example 1. Cytotoxicity Test of Actiponin, etc.>

[0100] In this experiment, mouse macrophages RAW264.7 were placed in a 48-well cell culture plate at a volume of 1.5 × 10⁶ 5 By cell / well, human-derived chondrocyte SW1353 was 1.5 × 10⁶ in a 96-well plate 4 Cultured in a cell / well for 24 hours.

[0101] After 24 hours of culture, RAW264.7 was treated with Gynostemma pentaphyllum extract (GPE) (Fig. 1A), Actiponin (Fig. 1B), Damulin A (Fig. 1C), and Damulin B (Fig. 1D), wsAN (Fig. 1E), Actiponin-F (Fig. 1F), and TGBA-2 (Fig. 1G), and SW1353 was treated with Gynostemma pentaphyllum extract (GPE) (Fig. 7A), Actiponin (7B), Damulin A (7C), and Damulin B (7D), wsAN (7E), Actiponin-F (7F), TGBA-2 (7G), Zipenoside LVI (7H), Zipenoside XLVI (7I), Zipenoside L (7J), and Zipenoside LI (7K), respectively, at the concentrations shown in Table 3 below.

[0102] Sample Cytotoxicity Test Treatment Concentration RAW 2 6 4.7 SW 13 5 3 Gynostemma pentaphyllum extract (GPE) (μg / ml) 0, 40, 80, 16 00, 20, 40, 80, 120, 160, 200 Actiponin (Actiponin) (μg / ml) 0, 40, 80, 120, 160, 20 00, 40, 80, 120, 160, 200 Actiponin-F (Actiponin-F) (μg / ml) 0, 10, 20, 40, 80, 12 00, 10, 20, 40, 60, 80, 120 TGBA-2 (μg / ml) 0, 5, 10, 200, 4, 8, 12, 16, 20, 24wsAN (μg / ml)0, 60, 120, 2400, 20, 40, 60, 80, 120, 160, 240Damulin A (μM)0, 4, 8, 12, 16, 200, 4, 8, 12, 16Damulin B (μM)0, 4, 8, 12, 16, 200, 4, 8, 12, 16Gypenoside L (μM)-0, 5, 10, 20, 40Gypenoside LI (μM)-0, 5, 10, 20, 40Gypenoside LVI (μM)-0, 8, 16, 32, 64Gypenoside XLVI (μM)-0, 8, 16, 32, 64

[0103] After treating each substance and culturing for 24 hours, the cytotoxicity of each substance was confirmed using CCK8 solution. As a result, the concentration that did not inhibit cell growth and the concentration for evaluating cell efficacy were determined as shown in the following table, and subsequent experiments using RAW264.7 and SW1353 were conducted at the concentrations shown in Table 4 below.

[0104] Sample Cell Efficacy Evaluation Treatment Concentrations RAW 26 4.7 SW 13 5 3 Gynostemma pentaphyllum extract (GPE) (μg / ml) 0, 40, 80, 160, 40, 80, 160 Actiponin (Actiponin) (μg / ml) 0, 40, 80, 1600, 40, 80, 160 Actiponin-F (Actiponin-F) (μg / ml) 0, 20, 40, 800, 10, 20, 40 TGBA-2 (μg / ml) 0, 5, 10, 200, 4, 8, 16 wsAN (μg / ml) 0, 60, 120, 2400, 60, 120, 240 Damulin A (μM) 0, 4, 8, 160, 3, 6, 12Damulin B (μM)0, 4, 8, 160, 3, 6, 12Gypenoside L (μM)-0, 5, 10, 20Gypenoside LI (μM)-0, 5, 10, 20Gypenoside LVI (μM)-0, 8, 16, 32Gypenoside XLVI (μM)-0, 8, 16, 32

[0105] <Experimental Example 2. Experiment to Confirm the Effect of Actiponin, etc. on NO Production>

[0106] In this experiment, mouse macrophages RAW264.7 were placed in a 100 mm culture dish at a rate of 2×10⁻⁶ 6 After culturing in a cell / plate for 24 hours, the reduction in NO production was confirmed by treating with Gynostemma pentaphyllum extract (GPE) (2A), Actiponin (2B), Damulin A (2C), and Damulin B (2D), wsAN (2E), Actiponin-F (2F), and TGBA-2 (2G) at the concentrations presented in Table 4.

[0107] After pre-treating each substance for 4 hours, 500 ng / ml of LPS was added to each plate and incubated for an additional 20 hours. For NO production, the supernatant was collected, reacted with Griess reagent at room temperature for 10 minutes, and the absorbance was measured at 540 nm.

[0108] It was confirmed that NO production decreased in a concentration-dependent manner when mouse macrophages RAW264.7 were treated with Actiponin (2B), Damulin A (2C), and Damulin B (2D). This confirms that Actiponin, Damulin A, and Damulin B inhibited NO production, which increases during inflammatory responses in macrophages, thereby demonstrating their ability to suppress inflammatory responses. (Figs. 2B, 2C, 2D)

[0109] To compare the anti-inflammatory effects of Gynostemma pentaphyllum extract (GPE), Actiponin, wsAN, Actiponin-F (2F), and TGBA-2 (2G), the amount of NO produced induced by treating RAW264.7 cells with the above substances and LPS was measured.

[0110] As a result, Actiponin, Actiponin-F, and TGBA-2 showed excellent NO production inhibitory activity, and Gynostemma pentaphyllum extract showed very weak NO production inhibitory activity, but wsAN could not inhibit LPS-induced NO production, and NO production increased in a dose-dependent manner (Figs. 2A, 2B, 2E, 2F, 2G).

[0111] From the above experimental results, the dose of each substance that inhibits NO production induced by LPS treatment in RAW264.7 cells by 50% is shown in Table 5 below.

[0112] Sample IC 50 (μg / ml) Gynostemma pentaphyllum extract (GPE) 745.14±157.13 Actiponin 141.70±1.33 Actiponin-F 75.29±3.47 TGBA-217.98±0.61 Damulin A 2.65±1.17 (3.39±1.49 μM) Damulin B 1.92±0.23 (2.45±0.29 μM)

[0113] From the above results, it was confirmed that Actiponin-F and TGBA-2, with the wsAN fraction removed, have no inflammation-inducing activity and possess superior inflammation-controlling activity compared to Actiponin, while being safer. To confirm this, the amount of NO produced was compared by treating RAW264.7 cells with Gynostemma pentaphyllum extract GPE, Actiponin, Actiponin-F, TGBA-2, and wsAN alone without LPS treatment. As a result, Gynostemma pentaphyllum extract GPE and wsAN showed strong NO production-inducing activity, while Actiponin showed weak NO production. Since the amount of NO produced by the administration of Actiponin-F and TGBA-2 was not statistically different from that of the untreated group, it was determined that they do not induce NO production (Fig. 2H).

[0114] From the above results, the degree of NO production when each substance is treated alone is calculated as a percentage compared to the LPS treatment group, and the results are as shown in Table 6 below.

[0115] Sample NO production rate (%) Untreated control group 2.6±0.57 e LPS (500 ng / mL) 100.0±4.00 a Gynostemma pentaphyllum extract (GPE, 40 μg / ml) 47.0±3.00 c Actiponin (40 μg / ml) 7.6±0.05 d Actiponin-F (40 μg / ml) 6.1±0.59 de TGBA-2 (5 μg / ml) 4.6±0.02 de wsAN (40 ug / ml)57.9±3.89 b

[0116] From the above results, since the wsAN fraction has strong inflammation-inducing activity, it was determined that Actiponin-F and TGBA-2, fractions from which this was removed from Actiponin, would have superior anti-inflammatory effects and effects for improving and treating arthritis compared to Actiponin.

[0117] <Experimental Example 3. PGE2 Inhibition Experiment with Actiponin, etc.>

[0118] In this experiment, mouse RAW264.7 macrophages were placed in 100 mm culture dishes at a rate of 2 × 10⁶ 6 After culturing in a cell / plate for 24 hours, Actiponin, Damulin A, Damulin B, Actiponin-F, and TGBA-2 were treated at various concentrations. Four hours later, 500 ng / ml of LPS was added to each plate, and the cells were cultured for an additional 20 hours. Prostaglandin E2 (PGE2) production was measured by collecting the supernatant and using a PGE2 ELISA assay kit according to the product instructions. It was confirmed that Actiponin, Damulin A, and Damulin B reduced PGE2 production in mouse RAW264.7 macrophages in a concentration-dependent manner. Additionally, Actiponin-F and TGBA-2 also reduced PGE2 production in a concentration-dependent manner. From these results, it was confirmed that Actiponin, Damulin A, Damulin B, Actiponin-F, and TGBA-2 can inhibit PGE2 production, which is associated with inflammatory responses, in macrophages. (Fig. 3)

[0119] <Experimental Example 4. Experiment on Inhibition of Inflammatory Enzymes and Cytokines with Actiponin, etc.>

[0120] In this experiment, mouse RAW264.7 macrophages were placed in 100 mm culture dishes at a rate of 2 × 10⁶ 6After culturing in a cell / plate for 24 hours, Gynostemma pentaphyllum extract (GPE), Actiponin, Damulin A, Damulin B, wsAN, Actiponin-F, and TGBA-2 were treated at various concentrations. After 4 hours, 500 ng / ml of LPS was added to each plate, and the cells were cultured for an additional 20 hours. Cells were then lysed using a protein extraction reagent kit according to the product instructions. The protein concentration of the extracts was quantified using a BCA protein assay kit. Western blot analysis was performed to investigate whether Actiponin, Damulin A, and Damulin B could inhibit the inflammatory enzymes iNOS and COX2, and the inflammatory cytokines TNF-α and IL-6 in mouse RAW264.7 macrophages. GAPDH was used as a control for cytoplasmic proteins. All result images were quantitatively analyzed using ImageJ software. As a result of confirming expression, Actiponin, Damulin A, Damulin B, Actiponin-F, and TGBA-2 each inhibited the protein expression of LPS-induced inflammatory markers iNOS, COX2, TNF-α, and IL-6 in mouse RAW264.7 macrophages in a concentration-dependent manner. (Fig. 4)

[0121] <Experimental Example 5. NFκB Inhibition Experiment of Actiponin, Damulin A, Damulin B, and TGBA-2>

[0122] In this experiment, mouse RAW264.7 macrophages were placed in 100 mm culture dishes at a rate of 2 × 10⁶ 6After culturing in a cell / plate for 24 hours, Actiponin, Damulin A, Damulin B, and TGBA-2 were treated at various concentrations. After 1 hour, 500 ng / ml of LPS was added, and the cells were cultured for an additional 30 minutes. Cells were lysed using a protein extraction reagent kit according to the product instructions. The protein concentration of the extracts was quantified using a BCA protein assay kit. Western blot analysis was performed to investigate whether Actiponin, Damulin A, Damulin B, and TGBA-2 could inhibit the NFκB pathway, known as an inflammation-related cellular mechanism, in mouse RAW264.7 macrophages. The purpose was to confirm the inhibitory effects of Actiponin on the cytoplasmic phosphorylation of IκBα and NFκB. GAPDH was used as a control for cytoplasmic proteins. All result images were quantitatively analyzed using ImageJ software. Actiponin, damulin A, damulin B, and TGBA-2 each inhibited LPS-induced phosphorylation of IκBα and NFκB in mouse RAW264.7 macrophages in a concentration-dependent manner. (Fig. 5)

[0123] <Experimental Example 6. Inhibition of MAPKs (JNK, ERK, and p38) by Actiponin, Damulin A, Damulin B, and TGBA-2>

[0124] In this experiment, mouse RAW264.7 macrophages were placed in 100 mm culture dishes at a rate of 2 × 10⁶ 6After culturing in a cell / plate for 24 hours, Actiponin, Damulin A, Damulin B, and TGBA-2 were treated at various concentrations. After 1 hour, 500 ng / ml of LPS was added, and the cells were cultured for an additional 30 minutes. Cells were then lysed using a protein extraction reagent kit according to the product instructions. The protein concentration of the extracts was quantified using a BCA protein assay kit. To investigate whether Actiponin, Damulin A, Damulin B, and TGBA-2 could inhibit MAPKs (JNK, ERK, and p38), which are known to be involved in inflammation-related cellular mechanisms, western blot analysis was performed to confirm the inhibitory effect on the phosphorylation of MAPKs (JNK, ERK, and p38) that were increased by inducing an inflammatory response with LPS. HDAC1 was used as a control for cytoplasmic proteins. All result images were quantitatively analyzed using ImageJ software. As a result of the above experiment, Actiponin, Damulin A, Damulin B, and TGBA-2 each inhibited the phosphorylation of LPS-induced MAPKs (JNK, ERK, and p38) in mouse RAW264.7 macrophages in a concentration-dependent manner. (Fig. 6)

[0125] <Experimental Example 7. Experiment on Inhibition of Cartilage Matrix Degrading Enzyme Production by Actiponin, etc.>

[0126] To confirm the inhibitory effects of Gynostemma pentaphyllum extract (GPE), Actiponin, Damulin A, Damulin B, wsAN, Actiponin-F, and TGBA-2 on the production of cartilage matrix degrading enzymes MMP-2 and MMP-9, the cytotoxicity of each substance on human chondrocyte SW1353 was confirmed using a CCK-8 reagent to determine the concentration that does not inhibit growth (Fig. 7).

[0127] 4×10⁴ human chondrocytes SW1353 in a 6-well cell culture plate 5Cells were cultured in wells for 24 hours. Conditioning media obtained by pre-treating each substance at the concentrations in Table 4 for 2 hours and then treating with IL-1β (10 ng / mL) for 24 hours were subjected to electrophoresis on SDS-PAGE containing 0.1% gelatin. After washing twice with renaturation buffer (2.5% Triton X-100) for 30 minutes, the gelatinase was incubated with gelatinase incubation buffer (50 mM Tris-HCl (pH 7.5), 200 mM NaCl, 2.5 mM CaCl2) at 37°C for 24 hours. After the reaction was complete, the gel was stained with 0.25% Coomassie brilliant blue solution for 2 hours, then destained to observe the degree of gelatin degradation.

[0128] Since gelatin, one of the major components of the cartilage matrix, is degraded by MMP-2 and MMP-9, the regions corresponding to MMP-2 and MMP-9 enzymatic activity are identified as white bands in zymography using gelatin as a substrate.

[0129] In SW1353 cells, treatment with IL-1β increased the expression of MMP-2 and MMP-9, which degrade the cartilage matrix, and treatment with each of the substances—Actiponin (Fig. 8B), Damulin A (Fig. 8C), Damulin B (Fig. 8D), Actiponin-F (Fig. 8F), and TGBA-2 (Fig. 8G)—inhibited gelatin degradation in a concentration-dependent manner.

[0130] <Experimental Example 8. Experiment on the Improvement of Aggrecan and Collagen Type II mRNA Expression with Actiponin, etc.>

[0131] 3×10⁴ human chondrocytes SW1353 in a 16-well cell culture plate 5Cells were cultured in wells for 24 hours. After pre-treating each substance at the concentrations in Table 4 for 2 hours, the cells were stimulated for 24 hours with IL-1β (10 ng / mL). Cells were collected, total RNA was isolated using Trizol reagent, quantified using a nano-drop spectrophotometer, and A 260 / A 280 RNA with a value of 1.8 or higher was used in the experiment.

[0132] ReverTra Ace from 1 μg of total RNA TM cDNA was synthesized using qPCR RT Master Mix, real-time PCR was performed using Luna Universal qPCR Master Mix, and the expression levels of each gene were analyzed using the CFX Maestro program. The primers used in the experiment are shown in Table 7 below.

[0133] Primer Name Base Sequence (5'→3')GAPDH-FATCTCTGCCCCCTCTGCTGAGAPDH-RGCTAAGCAGTGTTGGTGCAggrecan-FACTTCCGCTGGTCAGATGGAAggrecan-RTCTCGTGCCAGATCATCACCCOL2A1-FCAACACTGCCAACGTCCAGATCOL2A1-RCTGCTTCGTCCAGATAGGCAAT

[0134] The expression of Aggrecan and Collagen type II, components of the cartilage matrix, was inhibited by treatment with IL-1β, known as an inflammation-inducing factor, compared to the untreated group. In the wsAN-treated group, the expression of Aggrecan and Collagen type II, which was inhibited by IL-1β treatment, was further inhibited; however, in the Actiponin (Fig. 9B), Actiponin-F (Fig. 9F), and TGBA-2 (Fig. 9G) treated groups, it was confirmed that the expression of Aggrecan and Collagen type II, which was inhibited by IL-1β treatment, increased. In the Damulin A (Fig. 9C) and Damulin B (Fig. 9D) administration groups, it was confirmed that the expression of Aggrecan and Collagen type II, which was inhibited by IL-1β treatment, increased statistically significantly starting from 3 μM.

[0135] In the groups administered zipenoside LVI (Fig. 9H) and zipenoside LI (Fig. 9K), an increase in the expression of Aggrecan and Collagen type II, which were suppressed by IL-1β treatment, was observed, but in the groups administered zipenoside XLVI (Fig. 9I) and zipenoside L (Fig. 9J), the expression of Aggrecan, which was suppressed by IL-1β treatment, was not restored, and only an increase in Collagen type II expression was observed.

[0136] The increase rates of Aggrecan and Collagen type II gene expression in the damulin A, damulin B, gypenoside L, gypenoside LI, gypenoside LVI, and gypenoside XLVI treatment groups compared to the IL-1β treatment group in SW1353 cells are shown in Table 8 below.

[0137] The lowest concentration at which a statistically significant increase in Aggrecan and Collagen type II gene expression was observed from the above experimental results is as shown in Table 9 below, and from this, it was confirmed that the activity of each substance was best in Damulin A and Damulin B.

[0138] 시라세이 가산 (μM)Aggrecan (%)Collagen type II (%)Damulin A+IL-1β0100.00±5.58100.00±8.973123.05±11.53125.99±3.93 *6145.11±9.36 ***146.93±10.18 ***12157.30±9.36 ***195.41±5.42 ***Damulin B+IL-1β0100.00±7.35100.00±7.053165.00±9.73 ***136.83±7.68 *6185.86±2.99 ***145.65±8.67 **12241.93±7.72 ***173.49±16.07 ***Gypenoside LVI+IL-1β0100.00±5.33100.00±5.628115.58±9.9979.219±5.3316121.72±7.24115.15±15.2632127.56±9.56 *114.92±7.66 Gypenoside XLVI+IL-1β0100.00±5.33100.00±5.62895.077±6.0294.460±7.081699.291±4.88132.19±12.32 *32100.01±10.31144.72±9.02 **Gypenoside L+IL-1β0100.00±5.33100.00±5.625103.42±0.8391.602±12.041097.402±1.35110.95±6.172095.407±2.11121.08±5.04 Gypenoside LI+IL-1β0100.00±5.33100.00±5.625104.69±4.40106.89±10.2210120.76±2.68 **130.27±10.3720130.91±0.52 ***154.98±13.39 **p< 0.05, **p< 0.01, ***p< 0.001 compared with IL-1β-treated group.

[0139] CompoundsAggrecanCollagen type IIDamulin A6 μM3 μMDamulin B3 μM3 μMGypenoside LVI32 μM-Gypenoside XLVI-16 μMGypenoside L--Gypenoside LI10 μM20 μM

[0140] <Experimental Example 9. Experiment on the Inhibition of Carrageenan-Induced Edema in the Left Hind Leg of Rats by Actiponin>

[0141] Male Sprague-Dawley rats were used in this experiment. The experimental animals were acclimatized to the laboratory environment for one week after introduction. The rearing room environment was controlled with a temperature of 20–24 ℃, humidity of 40–60%, and a 12-hour light-dark cycle, while food and water were provided for free intake.

[0142] To confirm the anti-inflammatory effect of Actiponin, it was orally administered to experimental animals at doses of 30, 50, 100, and 200 mg / kg, and the thickness of the left hind paw prior to inflammation induction was measured using a digital caliper 1 hour later. To induce inflammation, 1% carrageenan was injected subcutaneously into the left hind paw, and the paw thickness was measured using a digital caliper every hour until 4 hours thereafter. Diclofenac was administered as a positive control for anti-inflammatory effects, and the edema inhibition rate at each time point was calculated using the following formula.

[0143]

[0144] As a result of confirming the effect of Actiponin on the degree of paw edema induced by carrageenan in rats, statistically significant inhibition of paw edema was observed in the Actiponin group starting 1 hour after inflammation induction compared to the group injected with only carrageenan. When comparing the degree of paw edema 4 hours after inflammation induction with the group injected with only carrageenan, a significant inhibitory effect on paw edema was observed in all Actiponin groups. (Figs. 10A, 10B)

[0145] <Experimental Example 10. Experiment on the cartilage improvement effects of Actiponin, Actiponin-F, and TGBA-2 in a DMM model>

[0146] Figure 11 briefly illustrates the experimental method regarding the cartilage improvement effect of administered substances such as Actiponin in a DMM (destabilization of the medial meniscus) model.

[0147] In this experiment, 6-week-old male Sprague-Dawley rats were used. The experimental animals were acclimatized to the laboratory environment for one week after introduction. The rearing room environment was controlled with a temperature of 20–24 ℃, humidity of 40–60%, and a 12-hour light-dark cycle, while food and water were provided for free intake.

[0148] To verify the cartilage-improving effect of Actiponin, degenerative arthritis was induced by performing DMM surgery according to known techniques, and sham-operated rats were used as a control group. Each sample was prepared by suspending it in drinking water daily and administered orally for 8 weeks starting the day after DMM surgery, and a group administered physiological saline was used as a comparison group. Actiponin was administered at doses of 50, 100, and 200 mg / kg, Actiponin-F at 30, 60, and 120 mg / kg, and TGBA-2 at 6, 12, and 24 mg / kg.

[0149] Cartilage samples obtained from rats were fixed in 4% paraformaldehyde and dehydrated in 0.5 M EDTA to remove calcification. After decalcification was completed, the cartilage samples were embedded in paraffin, and sections approximately 5 μm thick were prepared and fixed on glass slides. The average articular cartilage (AC) thickness was measured by Safranin O staining, and the degree of arthritis was scored using the OARSI grading system. The OARSI scores are shown in Table 10 below. The average number of chondrocytes in the cartilage was analyzed on Hematoxylin-Eosin (HE) stained slides.

[0150] The OARSI evaluation method, proposed by the OARSI (Osteoarthritis Research Society International), is a histopathological assessment of the severity of arthritis lesions. It involves staining tissue sections prepared by excising joint tissue to evaluate the state of joint surface wear and the presence of osteophytes, and provides a numerical assessment based on the degree of cartilage damage and the size of the lesions.

[0151] Grade (Key Features) Secondary Grade (Selective) Relevant Criteria (Tissue Response) Grade 0 Intact surface and cartilage No secondary grade Intact and undamaged cartilage Grade 1 Intact surface 1.0 Cellular integrity 1.5 Apoptotic matrix: Intact surface layer, edema and / or fibrillation Cells: Proliferation (clustering), hypertrophy Grade 2 Discontinuous surface 2.0 Fibrillation of the surface layer 2.5 Surface abrasion accompanied by reduction of the surface layer matrix Including the above, + Discontinuous surface layer ± Reduced staining of the upper 1 / 3 (middle layer) of the cartilage (Safranin O or Toluidine Blue) ± Irregularity of the orientation of the cartilage columns Grade 3 Vertical fissures / fissures 3.0 Simple fissures / fissures 3.5 Cracked / complex fissures Including the above, ± Reduced staining of the lower 2 / 3 (deep layer) of the cartilage (Safranin O or Toluidine Blue) ± New collagen formation (polarized light microscope, Picrosirus Red) Staining) Grade 4 Erosion 4.0 Separation of surface layer 4.5 Depression of middle layer Loss of cartilage matrix, formation of cysts within cartilage matrix Grade 5 Descaling 5.0 Intact bone surface 5.5 Presence of repaired or healing tissue Sclerosing bone or repaired tissue including fibrocartilage on the articular surface Grade 6 Deformity 6.0 Presence of periarticular osteophytes 6.5 Presence of periarticular and central osteophytes Bone remodeling, articular surface contour deformation including microfractures and repairs

[0152] Figures 12, 13, and 14 show the results of experiments conducted by administering Actiponin (Figure 12), Actiponin-F (Figure 13), and TGBA-2 (Figure 14). Compared to normal rats (Sham group), arthritis rats (comparison group, DMM) showed significant articular cartilage surface damage and a decrease in Safranin O staining (Figures 12A, 13A, 14A), and a statistically significant increase in OARSI scores (Figures 12B, 13B, 14B). However, the administration of Actiponin, Actiponin-F, and TGBA-2 of the present invention resulted in improvements in the cartilage surface, an increase in Safranin O staining (Figures 12A, 13A, 14A), and a dose-dependent decrease in OARSI scores for each sample (Figures 12B, 13B, 14B). In addition, the expression level of MMP13, a cartilage matrix degrading enzyme, was investigated using an immunohistochemical staining method on articular cartilage tissue. As a result, it was confirmed that the expression of MMP13 was increased in the cartilage of arthritis rats compared to normal rats, but the expression level of MMP13 decreased in a dose-dependent manner in the groups administered Actiponin, Actiponin-F, and TGBA-2 (Figs. 12C, 13C, 14C).

[0153] Meanwhile, analysis of tissue slides stained with Safranin O, which selectively binds to proteoglycans constituting cartilage tissue, confirmed that in the groups administered Actiponin, Actiponin-F, and TGBA-2, there was a dose-dependent increase in articular cartilage thickness (Figs. 12D, 13D, 14D) and an increase in the number of cartilage cells (Figs. 12E, 13E, 14E).

[0154] Therefore, in the present invention, the administration of Actiponin, Actiponin-F, and TGBA-2 in a rat osteoarthritis model with damaged cartilage was confirmed to have excellent effects in inhibiting the expression of MMP13 protein, a cartilage matrix degrading enzyme that is an indicator of osteoarthritis, improving articular cartilage surface damage, and increasing cartilage thickness.

[0155] <Experimental Example 11. Experiment on the cartilage regeneration effect of Actiponin in an MIA model>

[0156] Figure 15 shows the results of confirming the cartilage destruction inhibition / cartilage regeneration effect by Safranin O staining in rats that had acute osteoarthritis induced by administering monosodium iodoacetate (MIA), known to damage joints by inducing acute inflammation, into the joint cavity and administering Actiponin.

[0157] In this experiment, 6-week-old male Sprague-Dawley rats were used. The experimental animals were acclimatized to the laboratory environment for one week after introduction. The rearing room environment was controlled with a temperature of 20–24 ℃, humidity of 40–60%, and a 12-hour light-dark cycle, while food and water were provided for free intake.

[0158] To verify the cartilage regenerative effect of Actiponin, acute osteoarthritis was induced by injecting 3 mg / kg MIA into the joint cavity, and Actiponin at doses of 50, 100, and 200 mg / kg was prepared by suspending it in drinking water daily and administered orally for 2 weeks starting from the day after the MIA injection, and a group administered physiological saline was used as a control group.

[0159] Cartilage samples obtained from rats were fixed in 4% paraformaldehyde and dehydrated in 0.5 M EDTA to remove calcification. After the calcification was completed, the cartilage samples were embedded in paraffin, sections approximately 5 μm thick were prepared and fixed on glass slides, and the regeneration of the cartilage matrix was confirmed by Safranin O staining, which primarily stains proteoglycans.

[0160] Figure 15 shows the results of examining the articular cartilage area by Safranin O staining and H&E staining after orally administering Actiponin at each dose for 2 weeks following the injection of 3 mg / kg MIA.

[0161] Compared to normal rats (Sham group), arthritis rats (0.9% normal saline) showed significant articular cartilage surface damage and decreased Safranin O staining, but administration of Actiponin of the present invention showed dose-dependent improvement of the cartilage surface and increased Safranin O staining (Fig. 15).

[0162] Therefore, in the present invention, the excellent effect of administering Actiponin to regenerate the cartilage matrix in a rat osteoarthritis model in which cartilage was damaged by inducing acute inflammation by administering MIA was confirmed.

[0163] <Preparation Example>

[0164] Preparation Example 1: Preparation of Tablets

[0165] 20 g of the Actiponin of the present invention was mixed with 175.9 g of lactose, 180 g of potato starch, and 32 g of colloidal silica, respectively. A 10% gelatin solution was added to this mixture, and the mixture was ground and passed through a 14-mesh sieve. This was dried, and 160 g of potato starch, 50 g of talc, and 5 g of magnesium stearate were added to it to obtain a mixture, which was then made into tablets.

[0166] Preparation Example 2: Preparation of soft capsules

[0167] 100 g of the Actiponin of the present invention, 100 g of corn starch, 100 g of lactose, and 2 g of magnesium stearate were mixed, and then the above ingredients were mixed according to a conventional method for manufacturing capsules and filled into a gelatin capsule to produce a capsule.

[0168] Preparation Example 3: Preparation of pills

[0169] The Actiponin of the present invention was ground to obtain a powder that passed through a 200 mesh. 5 mg of Actiponin was appropriately mixed with honey, dextrin, starch, microcrystalline cellulose, CMC calcium, etc., and then a pill was prepared.

[0170] Preparation Example 4: Preparation of health functional food

[0171] The present invention was prepared into granules by mixing 20 g of Actiponin, an appropriate amount of a vitamin mixture, 70 µg of vitamin A acetate, 1.0 mg of vitamin E, 0.13 mg of vitamin B1, 0.15 mg of vitamin B2, 0.5 mg of vitamin B6, 0.2 µg of vitamin B12, 10 mg of vitamin C, 10 µg of biotin, 1.7 mg of nicotinamide, 50 µg of folic acid, 0.5 mg of calcium pantothenate, an appropriate amount of a mineral mixture, 1.75 mg of ferrous sulfate, 0.82 mg of zinc oxide, 25.3 mg of magnesium carbonate, 15 mg of monopotassium phosphate, 55 mg of disaccharide phosphate, 90 mg of potassium citrate, 100 mg of calcium carbonate, and 24.8 mg of magnesium chloride, but it can be prepared by modifying the composition into various formulations depending on the application. In addition, the composition ratio of the above vitamin and mineral mixture may be arbitrarily modified, and the above ingredients may be mixed and manufactured according to a conventional method for manufacturing health functional foods.

[0172] Preparation Example: Preparation of a Beverage

[0173] 1 g of the Actiponin of the present invention, 0.1 g of citric acid, 100 g of fructooligosaccharide, and 900 g of purified water were mixed and stirred, heated, filtered, sterilized, and refrigerated according to a conventional beverage manufacturing method to produce a beverage.

Claims

1. A pharmaceutical composition for improving or treating arthritis characterized by containing a compound of damulin A or damulin B of the following chemical structural formula, or damulin A and damulin B as active ingredients.

2. In Paragraph 1, The above pharmaceutical composition is a pharmaceutical composition for improving and treating arthritis characterized by promoting the proliferation of cartilage cells.

3. In Paragraph 1, A pharmaceutical composition for improving and treating arthritis, characterized in that the above arthritis is osteoarthritis.

4. A health functional food for preventing or improving arthritis, characterized by containing a compound of Damulin A or Damulin B, or Damulin A and Damulin B as active ingredients.

5. In Paragraph 4, The above-mentioned health functional food is a health functional food for preventing or improving arthritis characterized by promoting the proliferation of cartilage cells.

6. In Paragraph 5, A health functional food for the prevention or improvement of arthritis, characterized in that the above arthritis is osteoarthritis.

7. A Gynostemma pentaphyllum fraction prepared by treating a Gynostemma pentaphyllum extract at high temperature and high pressure, A fraction of *Gynostemma pentaphyllum* characterized by containing a total content of 2.8 to 99.0% (w / w) of damulin A, damulin B, gypenoside L, and gypenoside LI.

8. In Paragraph 7, The above Gynostemma fraction is characterized by comprising 0.6~2.2% (w / w) of damulin A, 0.6~2.0% (w / w) of damulin B, 0.8~2.6% (w / w) of gypenoside L, and 0.5~2.2% (w / w) of gypenoside LI.

9. In Paragraph 7, The above Gynostemma fraction is a fraction from which the non-saponin water-soluble fraction (wsAN) has been removed, characterized by comprising 2.3~7.8% (w / w) of damulin A, 2.4~7.9% (w / w) of damulin B, 2.9~8.4% (w / w) of gypenoside L, and 1.8~6.5% (w / w) of gypenoside LI.

10. In Paragraph 7, The above Gynostemma fraction is a fraction from which the non-saponin water-soluble fraction (wsAN) has been removed, characterized by comprising 10.9~28.6% (w / w) of damulin A, 9.7~23.6% (w / w) of damulin B, 10.6~21.3% (w / w) of gypenoside L, and 7.9~15.2% (w / w) of gypenoside LI.

11. A Gynostemma fraction according to any one of paragraphs 7 through 10, used for the improvement or treatment of arthritis.

12. A pharmaceutical composition for improving and treating arthritis characterized by comprising the Gynostemma pentaphyllum fraction of claim 11.

13. In Paragraph 12, A pharmaceutical composition for improving and treating arthritis, characterized in that the above arthritis is osteoarthritis.

14. In Paragraph 13, The above pharmaceutical composition is a pharmaceutical composition for improving and treating arthritis characterized by promoting the proliferation of cartilage cells.

15. In Paragraph 13, The above pharmaceutical composition is a pharmaceutical composition for improving and treating arthritis characterized by inhibiting inflammation.

16. A health functional food for preventing or improving arthritis, characterized by comprising a fraction of *Gynostemma pentaphyllum* according to any one of claims 7 to 10 as an active ingredient.

17. In Paragraph 16, A health functional food for the prevention or improvement of arthritis, characterized in that the above arthritis is osteoarthritis.

18. In Paragraph 16, The above-mentioned health functional food is a health functional food for preventing or improving arthritis characterized by promoting the proliferation of cartilage cells.

19. In Paragraph 16, The above health functional food is a health functional food for preventing or improving arthritis characterized by inhibiting inflammation.

20. A method for preparing a composition comprising damulin A, damulin B, damulin L, and damulin LI by treating purified gypenoside LVI, gypenoside XLVI, or a mixture thereof at high temperature and high pressure.

Images