Methods and systems for immobilizing biomolecules and uses of same

A hydrogel-based system for continuous biopolymer production addresses scalability and cost issues in nucleic acid synthesis by immobilizing biomolecules on a permeable support, facilitating indefinite and efficient production of nucleic acids and proteins.

WO2026096465A1PCT designated stage Publication Date: 2026-05-07CORNELL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
CORNELL UNIVERSITY
Filing Date
2025-10-28
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Existing methods for nucleic acid synthesis, such as chemical synthesis and enzymatic amplification, are limited by length constraints and high costs, particularly due to the need for expensive transcription enzymes, and lack scalability and efficiency.

Method used

A system utilizing a hydrogel with coupler reactive groups disposed on a permeable support, allowing continuous production of biopolymers by immobilizing biomolecules and enabling the flow of biopolymer building components, which includes a hydrogel with sufficient permeability and porosity to facilitate continuous biopolymer assembly without clogging.

Benefits of technology

Enables indefinite and tunable production of nucleic acids and proteins, overcoming length and cost limitations of conventional methods, with extended reaction times and efficient enzyme retention.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025052844_07052026_PF_FP_ABST
    Figure US2025052844_07052026_PF_FP_ABST
Patent Text Reader

Abstract

A system includes one or more support(s) having a permeability of 2000 L m-2 h-1 bar-1 or more; and a hydrogel that includes one or more coupler reactive group(s) that connect with one or more linker reactive group(s) of one or more biomolecule(s). The hydrogel is disposed on the one or more support(s), and wherein the hydrogel has a permeability of 100 L m-2 h-1 bar-1 or more.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS AND SYSTEMS FOR IMMOBILIZING BIOMOLECULES AND USES OF SAMECROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit to and priority to Provisional Application No.63 / 712,897, filed on October 28, 2024, which is incorporated herein by reference in its entirety.FIELD

[0002] This application discloses a device useful for immobilizing biomolecules on a hydrogel for forming biopolymers in a continuous technique.BACKGROUND

[0003] There is a continued interest in high throughput and / or high-capacity methods of producing nucleotides. In addition to the heavy demand caused by the growing interest and notable successes in nucleic acid drugs, other industrial fields including diagnostics, various laboratory kits and reagents for biology / biotechnology, etc. also long for automatic and / or scalable production of nucleic acids.

[0004] Conventionally, the main production methods for nucleic acids (including RNA oligos) include: 1) chemical synthesis, based on solid phase phosphoramidite chemistry. This chemical approach has notable limitations, generating only small chains of less than 200 bases. 2) enzymatic amplifications including in vitro transcription (IVT), isothermal amplification, etc. While IVT as a cell-free approach is capable of producing RNA of various lengths, including those over 200 bases, it has limitations. For example, IVT is costly, primarily due to the need for, and rapid consumption of, expensive transcription enzyme(s). Additionally, conventional IVT is based on batch mode, which typically cannot last longer than 4 hours.

[0005] Nucleic acid-based therapies are emerging as powerful tools for disease prevention and treatment, with the rapid success of mRNA vaccines highlighting their potential. Beyond medicine, nucleic acids are essential for genetic engineering, molecular diagnostics, and synthetic biology. As demand grows across healthcare and biotechnology, there is an urgent need for scalable, efficient, and tunable production methods to support both therapeutic development and industrial applications.

[0006] For conventional RNA synthesis, there are two main methods. 1. Chemical synthesis is dependent on solid phase phosphoramidite chemistry. The chemical approach has notable limitations, generating only small chains of less than 200 bases. 2. Solution-base IVT utilizes RNA polymerase such as T7, T3, and SP6 to transcribe RNA from DNA template in a batch way. The reaction efficiency gradually descends with byproduct generation (pyropho sphatate). The costliest part of this method is the transcription enzymes.

[0007] For conventional DNA synthesis, three main methods are used. 1. The solid phase phosphoramidite chemistry also works for DNA synthesis, likewise there is a length limitation, which can only produce small chains of less than 200 bases. 2. Enzyme methods includes PCR, isothermal amplification, etc. They are mainly methods to provide long length DNA. But those methods usually only produce double-stranded DNA. 3. Fermentation methods is another way to use bacteria to produce DNA, such as plasmid. This method needs more steps to prepare for target product, for instance, plasmid construction, bacteria screen and cultivation, and plasmid extraction and purification.

[0008] What is needed are techniques to synthesize biopolymers in a continuous fashion.SUMMARY

[0009] In some examples, disclosed herein is a system that includes one or more support(s) having a permeability of 2000 L-m ^h ^bar1or more; and a hydrogel that includes one or more coupler reactive group(s) that connect with one or more linker reactive group(s) of one or more biomolecule(s). The hydrogel is disposed on the one or more support(s). and wherein the hydrogel has a permeability of 100 L-m"2-h_1-bar_1or more.

[0010] The one or more support(s) and the hydrogel may in combination have a permeability of 1000 L-m ^h ^bar1or more. The one or more support(s) may have a porosity of about 5 percent to about 95 percent, based on the total volume of the one or more support(s). The one or more support(s) may include a plurality of pores having a pore size of about 100 nm to about 1 cm. The plurality of pores of the one or more support(s) may have a D50 pore size of about 50 nm to about 1 mm. The plurality of pores of the one or more support(s) may have a D90 pore size of about 1 micro to about 5 mm. The hydrogel may have a porosity of about 5 percent to about 95 percent, based on the total volume of the hydrogel. The hydrogel may include a plurality of pores having a pore size of about 10 nm to about 700 microns. The plurality of pores of the hydrogelmay have a D50 pore size of about 50 nm to about 1 mm. The plurality of pores of the hydrogel may have a D90 pore size of about 50 nm to about 500 microns. Each of the one or more supports may have an individual thickness of about 100 microns to about 5 mm. The one or more support(s) may have a total thickness of about 100 microns to about 5 m, wherein the total thickness is a sum of all of the one or more support(s) measured from an inlet to an outlet of the system. The hydrogel may have an average coating thickness along surfaces of the one or more support(s) of about 10 nm to about 5 mm. The hydrogel may have a crosslinking density of 0. 1 mol / L or more. The hydrogel may have a degree of swelling of 20% or more. The hydrogel may have a pH of about 7 to about 8. The hydrogel may include one or more backbone chain(s) comprised of residues of one or more monomer(s); and one or more crosslinker(s) that connect the one or more backbone chain(s) together, wherein either or both of the one or more crosslinker(s) or the one or more backbone chain(s) comprise the one or coupler reactive group(s). The system may include one or more inlet(s) configured to input one or more solvent(s), one or more buffer(s), and / or one or more biopolymer building component(s): and one or more outlet(s) configured to output the one or more solvent(s), one or more buffer(s), one or more biopolymer byproduct(s), one or more biopolymer building component(s) that are unreacted, and / or one or more biopolymer(s) from the system. The one or more support(s) comprises surfaces capable of being coated or covered by a hydrogel and forming pores between surfaces of the hydrogel. The one or more support(s) may include one or more of a foam, a fiber arrangement, a particle, sponge, wood, paper, porous silica, or any combination thereof. The fiber arrangement may include random fiber networks, aligned fiber arrays, woven fiber structures, knitted or braider fiber networks, hierarchical or gradient fiber structures, porous fiber architecture, or any combination thereof.

[0011] In another example, disclosed herein is a system that includes one or more support(s) having a permeability of 2000 L·m-2·h-1·bar-1or more and a hydrogel that includes one or more coupler reactive group(s). The hydrogel is disposed on the one or more support(s) has a permeability of 100 L-m2-h '-bar1or more. The system includes one or more biomolecules comprising one or more linker reactive group(s) connected with the hydrogel at the one or more coupler reactive group(s).

[0012] The hydrogel may be disposed on essentially all of the one or more support(s) such that pores exist between surfaces of the hydrogel. Most of the one or more biomolecules may be connected with the hydrogel at the surfaces of the hydrogel that form the pores. The pores mayexist between the surface of the hydrogel and may have a size of about 10 nm to about 700 microns. The one or more biomolecule(s) may include one or more of an oligonucleotide, a DNA oligonucleotide, an RNA oligonucleotide, a double- stranded DNA oligonucleotide, a protein, an antigen, a protein receptor, a polysaccharide, a viral protein, or the like, or any combination thereof. The one or more linker reactive group(s) and the one or more coupler reactive group(s) may in combination include a pair of reactive groups comprising amine reactive conjugations, thiol-reactive conjugations, carbonyl-reactive conjugations, carboxyl-reactive conjugations, biorthogonal pairs or systems, photo reactive conjugations, or any combination thereof. The amine reactive conjugations may include an amine and a carboxylic acid, an amine and an activated ester, an amine and an isothiocyanate, an amine and an aldehyde or ketone, or any combination thereof. The thiol-reactive conjugations may include a thiol and a maleimide. a thiol and an acylate or vinyl sulfone, a thiol and a haloacetyl, a thiol and a disulfide, or any combination thereof. The carbonylreactive conjugations may include an aldehyde or ketone and a hydrazide, a aldehyde or ketone and an aminooxy, or any combination thereof. The carboxyl-reactive conjugations may include carboxylic acid and an amine, a carboxylic acid and an alcohol, or any combination thereof. The biorthogonal pairs or systems may include azide and alkyne, an azide and a strained alkyne, tetrazine and a trans-cyclooctene, a cyclopropane and a tetrazine, an aldehyde and a hydrazine or aminooxy, a thiol and a gold nanoparticle surface, a boronic acid and a diol, a haloalkane and a haloalkane dehalogenase-tag, or any combination thereof.

[0013] In another example, a system includes one or more support(s) having a permeability of 2000 L-m ^h ^ bar1or more; and one or more monomer(s) and one or more crosslinker(s) dispersed within and / or on the one or more support(s) and configured to polymerize and form a hydrogel that is disposed on most or all of the one or more support(s). The one or more monomer(s) and / or the one or more crosslinker(s) include or are configured to form, after polymerization, one or more coupler reactive group(s) that are configured to connect with one or more linker reactive group(s) of one or more biomolecule(s). The one or more monomer(s) may include one or more of polyethylene glycol- acrylate monomer(s), multi-arm PEG-Acrylate, Acrylate-PEG-NHS, methyl acrylate, 2-Hydroxyethyl acrylate, 2-Carboxyethyl acrylate, 2-Hydroxy-3-phenoxypropyl acrylate, 2-(Dimethylamino)ethyl acrylate, (2-Boc-amino)ethyl methacrylate, Methacrylic acid N-hydroxysuccinimide ester, N-[Tris(hydroxymethyl)methyl]acrylamide, N-(3-Aminopropyljmethacrylamide hydrochloride, N-Hydroxyethyl acrylamide, N-Isopropylacrylamide, Glycerol 1,3-diglycerolate diacrylate, 2- Aminoethyl methacrylate hydrochloride, Glycidyl acrylate, 2-Isocyanatoethyl methacrylate, or any combination thereof. The one or more crosslinker(s) may include two or more functional group(s) configured to bind two or more polymer chains together. The two or more functional group(s) may include an acrylate, methyl acrylate, ethylene, amide, acrylamides, or any combination thereof. The one or more coupler and linker reactive group(s) may be able to connect and immobilize the one or more biomolecule(s) on the hydrogel during formation of one or more biopolymer(s). The system may include an additive configured to be incorporated within the hydrogel, wherein the additive comprises one or more of catalysts, photo-initiators, nano cellulose, carbon nanotubes, graphene, gold nanoparticles, silica particles, polymer fibers, polysaccharides, proteins, nucleic acids, or any combination thereof.

[0014] In another example, a method includes contacting one or more support(s), one or more monomer(s), and one or more crosslinker(s); and applying conditions sufficient to polymerize the one or more monomer(s) and the one or more crosslinker(s) together such that a hydrogel is formed and becomes disposed on the one or more support(s). The hydrogel has one or more coupler reactive group(s) that connect with one or more linker reactive group(s) of one or more biomolecule(s).

[0015] The one or more support(s) that has the hydrogel disposed thereon may have a permeability of 1000 L-m i '-bar1or more. The method may include contacting the one or more support(s) that has the hydrogel disposed thereon and the one or more biomolecule(s) comprising the one or more linker reactive group(s) to connect the hydrogel and the one or more biomolecule(s) at the one or more coupler and linker reactive group(s). The one or more monomer(s) and the one or more crosslinker(s) may be polymerized by heat, ultraviolet light, magnetic field, surface grafting, or any combination thereof while in contact with the one or more support(s). The method may include contacting one or more solvent(s) with the one or more support(s) that is / are coated with the hydrogel such that byproducts and the one or more crosslinker(s) and monomer(s) are removed from the one or more support(s) that is / are coated with the hydrogel.

[0016] In another example, a method includes contacting one or more biopolymer building components and the one or more support(s) having a hydrogel disposed thereon and connectedwith one or more biomolecule(s) at the hydrogel to form a product stream comprising one or more biopolymer(s).

[0017] The one or more support(s) that has the hydrogel may have a permeability of 1000 L-m^-h^-bar1or more. The one or more biopolymer building components(s) may include one or more of enzyme(s), building block(s), molecular chaperones, or any combination thereof. The one or more building block(s) comprises one or more of amino acids, ribonucleoside trisphosphates, primers, oligonucleotides, long-chain nucleic acids, or any combination thereof. The one or more biopolymer building components and the one or more support(s) may be contacted at a temperature sufficient to form the one or more biopolymer(s) and without deforming or distorting the hydrogel. The one or more biopolymer building components and the one or more support(s) may be contacted at a temperature of about 4°C to about 80°C. The one or more biopolymer building components and the one or more support(s) may be contacted and moved through the one or more support(s) at a pressure sufficient to form the one or more biopolymer(s) and to move one or more biopolymer byproduct(s) out of the one or more support(s). The one or more biopolymer building components and the one or more support(s) may be contacted at a pressure of about 50 KPa to about 200 KPa. The method may include before formation of the one or more biopolymer(s), contacting the one or more support(s) that has the hydrogel with the one or more biomolecule(s) to connect the one or more biomolecule(s) and the hydrogel. They may include separating the one or more biopolymer(s). one or more biopolymer byproduct(s), and one or more biopolymer building component(s) into one or more separate stream(s). The method may include recycling the one or more biopolymer building component(s) that are unreacted by moving the one or more biopolymer building component(s) from an outlet that is downstream of the one or more support(s) to an inlet that is upstream of the one or more support(s). The method may include monitoring and / or identifying formation of the one or more biopolymers while within the hydrogel and / or downstream of the one or more support(s).BRIEF DESCRIPTION OF THE DRAWING

[0018] The disclosure is best understood from the following detailed description when read in conjunction with the accompanying drawings. It is emphasized that, according to common practice, the various features of the drawings are not to-scale. On the contrary, the dimensions of the various features are arbitrarily expanded or reduced for clarity.

[0019] Figure 1 shows a perspective view of a system for making biopolymers.

[0020] Figure 2 shows a perspective view of a system for making biopolymers.

[0021] Figure 3 shows Hybrid materials: DNA-decorated mesh fabric, a) the process of gel coating and DNA modification on a mesh fabric, b) the molecular mechanism of gel preparation and RNA transcription.

[0022] Figure 4 shows DNA-decorated mesh fabrics and the continuous flow device, a) polyester mesh fabric, b) hydrogel-coated mesh fabric, c) food dye-stained hydrogel-coated mesh fabric, d) a photography of DNA-decorated mesh fabric under UV light, the DNA was stained with SYBR Green I. e, f) the images of the continuous flow device.

[0023] Figure 5 shows ae plot of RNA product concentration versus time. The Greenish area, yellowish area, and blueish area represent the working solution contained 1VT buffer and T7, IVT buffer without T7, and IVT buffer with T7, respectively. The reddish area represents the device operation was paused with IVT buffer.

[0024] Figure 6 shows gel electrophoresis analysis of RNA products. 1 and 2 are two RNA products. 3, 4, and 5 indicate that the RNA product gradually decreased with suspending T7 infusion. 6 and 7 indicate that the RNA product restored with infusing T7 again. The yellow dotted rectangular indicates RNA products.

[0025] Figure 7 shows an sample workflow of continuous nucleic acid production.

[0026] Figure 8 illustrates a scheme to continuously make biopolymers, such as RNA, with enzyme self regeneration and / or recycling by purification and / or separation from the RNA product.

[0027] Figure 9A illustrates a preparation of DNA hybrid hydrogel and device assembly for in-vitro nucleic acid and protein and a DNA-polymer hybrid gel preparation on mesh fabric.

[0028] Figures 9B-C illustrate a system fabricated by DNA hybrid hydrogels and schematic of in-vitro DNA amplification, RNA transcription, and protein translation in a system or device.

[0029] Figure 10A illustrates a mesh fabric.

[0030] Figure 10B illustrates a food dye stained polymer organogel-coated fabric.

[0031] Figure 10C illustrates a fluorescent image of SYBR green I-stained DHHMF.

[0032] Figure 10D illustrates results of RNA in-vitro transcription concentration as a function of total concentration of monomers used in polymer organogel.

[0033] Figure 10E illustrates results of the concentration of RNA compared to usage of template DNA per milligram of acrylate PEG NHS monomer.

[0034] Figure 10F illustrates results of an Example system showing the concentration of RNA compared to the molar ratio of monomer to crosslinker.

[0035] Figure 11 illustrates use of different devices (i.e., systems) for continuously forming RFP mRNA and gel electrophoresis to analyze quality of product.

[0036] Figure 12 illustrates use of different devices (i.e., systems) for continuously forming GFP mRNA and gel electrophoresis to analyze quality of product.

[0037] Figure 13 illustrates use of different devices (i.e., systems) for continuously forming FLAP (Fluorescent light-up aptamers) Aptamer (Mango III) and gel electrophoresis to analyze quality of product.

[0038] Figure 14 illustrates use of different devices (i.e., systems) for continuously forming siRNA and gel electrophoresis to analyze quality of product.

[0039] Figure 15 illustrates use of different devices (i.e., systems) for continuously forming Ribozyme and gel electrophoresis to analyze quality of product.

[0040] Figure 16 illustrates use of different devices (i.e., systems) for continuously forming miRNA and gel electrophoresis to analyze quality of product.

[0041] Figure 17 illustrates long term operation of a device (i.e., system) to continuously form RFP mRNA and gel electrophoresis to analyze quality of product.

[0042] Figure 18 illustrates devices (i.e., systems) configured to operate on a perpetual production platform to form ssDNA.

[0043] Figure 19 illustrates a batch based technique to form ssDNA.

[0044] Figure 20 illustrates gel electrophoresis of the quality of ssDNA of Figure 18.

[0045] Figure 21 shows a design of / ram-cleaving hammerhead ribozyme and split spinach FLAP and monitoring ribozyme cleavage process by gel electrophoresis.

[0046] Figure 22 illustrates FET-like three- state logic computing device and workflow where 0 is off, 1 is semi-ON. and 2 is ON for use with the design of figure 21.

[0047] Figures 23A-B illustrates signal readouts of the FET-like three state logic computing device and a truth table of the logic gate of figures 21 and 22.DESCRIPTION

[0048] Although subject matter of the present disclosure is described in terms of certain embodiments and examples, other embodiments and examples, including embodiments and examples that do not provide all of the benefits and features set forth herein, are also within the scope of this disclosure. For example, various structural, logical, and process step changes may be made without departing from the scope of the disclosure.

[0049] The claimed subject matter is described in terms of certain examples. But, other examples, including examples that do not provide all of the benefits and features set forth herein, are also within the scope of this disclosure. Various structural, logical, and process step changes may be made without departing from the scope of the disclosure. It is understood that other examples of the present disclosure may be made without departing from the scope of the present disclosure.

[0050] Unless stated otherwise, technical and scientific terms used in this specification carry the same meaning as generally understood by those having ordinary skill in the art. Methods and materials that are equivalent or comparable to those described herein may also be employed in practicing or testing the present disclosure.

[0051] In the figures, certain features are illustrated in certain sizes and dimensions for illustrative purposes only. The figures are meant to show an example of the teaching described herein and are not meant to be limiting. The scope of the disclosure includes different and varying sizes and dimensions of features illustrated in the figures envisioned by the skilled artisan.

[0052] As used herein, unless otherwise indicated, “about”, “substantially”, or “the like”, when used in connection with a measurable variable (such as, for example, a parameter, an amount, a temporal duration, or the like) or a list of alternatives, is meant to encompass variations of and from the specified value including, but not limited to, those within experimental error (which can be determined by, e.g., a given data set, an art accepted standard, etc. and / or with, e.g., a given confidence interval (e.g., 90%. 95%, or more confidence interval from the mean), such as, for example, variations of + / -10% or less, + / -5% or less, + / -!% or less, and + / -0.1% or less of and from the specified value), insofar such variations in a variable and / or variations in the alternativesare appropriate to perform in the instant disclosure. As used herein, the term “about” may mean that the amount or value in question is the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, compositions, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error, or the like, or other factors known to those of skill in the art such that equivalent results or effects are obtained. In general, an amount, size, composition, parameter, or other quantity or characteristic, or alternative is “about” or “the like,” whether or not expressly stated to be such. It is understood that where “about,” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.

[0053] Ranges of values are disclosed herein. The ranges set out a lower limit value and an upper limit value. Unless otherwise stated, the ranges include the lower limit value, the upper limit value, and all values between the lower limit value and the upper limit value, including, but not limited to, all values to the magnitude of the smallest value (either the lower limit value or the upper limit value) of a range. It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a numerical range of “0.1 % to 5%” should be interpreted to include not only the explicitly recited values of 0.1% to 5%, but also, unless otherwise stated, include individual values (e.g., 1%, 2%, 3%, and 4%) and the sub-ranges (e.g., 0.5% to 1.1%; 0.5% to 2.4%; 0.5% to 3.2%, and 0.5% to 4.4%, and other possible sub-ranges) within the indicated range. It is also understood (as presented above) that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,, it will be understood that the particular value forms a further disclosure. For example, if the value “about 10” is disclosed, then “10” is also disclosed.

[0054] As used herein, unless otherwise stated, the term “group” refers to a chemical entity that is monovalent (i.e., has one terminus that can be (is) covalently bonded to other chemical species), divalent, or polyvalent (i.e.. has two or more termini that can be (are) covalently bonded to other chemical species). The term “group” also includes radicals (e.g., monovalent radicals and multivalent radicals, such as, for example, divalent radicals, trivalent radicals, and the like). Illustrative examples of groups include:....the like.

[0055] As used herein, unless otherwise stated, the term “structural analog” refers to any monomer, crosslinker, biological component, or group that can be envisioned to arise from an original monomer, crosslinker, biological component, or group, respectively, if one atom or group of atoms, functional groups, or substructures is replaced with another atom or group of atoms, functional groups, substructures, or the like. In various examples, the term “structural analog” refers to any monomer, crosslinker, biological component, or group that is derived from an original monomer, crosslinker, biological component, or group, respectively, by a chemical reaction, where an original monomer, crosslinker, biological component, or group is modified or partially substituted such that at least one or more structural features(s) of the original monomer, crosslinker, biological component, or group is retained. Examples of structural analogs include, but are not limited to isomers (e.g., geometric isomers, structural isomers, or the like), homologs, derivatives, and the like. In various examples, a structural analog is a functional analog (e.g., exhibits similar or substantially the same physical, chemical, biochemical, or pharmacological propert(ies), or any combination thereof of the original monomer, crosslinker, biological component, or group). In various examples, a structural analog is not a functional analog (e.g., exhibits one or more significantly different physical, chemical, biochemical, or pharmacological propert(ies), or any combination thereof from the original polymer, compound, or group).

[0056] The disclosed techniques herein are useful for building biopolymers in a continuous fashion or process. A hydrogel can be disposed on a support that is permeable, which serves as a basis for immobilizing biomolecules. The biomolecules immobilized on the hydrogel can be contacted with a solution containing biopolymer building components (e.g., enzymes, primers, amino acids, etc.) that can be used to build biopolymers (e.g., DNA, RNA, proteins, etc.) on theimmobilized biomolecule. The solution is moved across and through the hydrogel and support, which provides fresh biopolymer building components and moves byproducts from the biomolecules. By moving the solution across and through the hydrogel and support, continuous formation of the biopolymers can be achieved while byproducts (which may have a negative impact on reaction conditions, such as pH) are moved away from the biomolecules that are forming the biopolymers.

[0057] Nucleic acid-based prophylactics and therapeutics have emerged as a promising new category of medicine for the prevention and treatment of various diseases. Nucleic acid drags operate at the gene level, enabling precise modulation of gene expression. Compared to conventional drags like small molecules and proteins, nucleic acid drags offer broader medical applications and disease targets, due to their unique physicochemical and physiological properties. Notably, the power of RNA drugs was impressively demonstrated by the rapid development and successful deployment of the COVID-19 mRNA vaccine. Besides medicine, nucleic acids are essential molecules in biology, biotechnology, and biotech industry, playing indispensable part in genetic engineering, molecular diagnostics, gene silencing and expression regulation, synthetic biology, etc. For both fundamental research and applied development, nucleic acid products are also widely used for non-coding RNA, cell-free protein production, various kits, etc.

[0058] To meet the demand for nucleic acid-based drags and reagents, effective scalable manufacture methods with tunable production capability are essential. Here, a novel platform capable of continuous, indefinite RNA and DNA production is disclosed. A hybrid material is disclosed herein by coating polymer gels onto mesh polymer fabrics to act as a porous and soft hydrated layer where not only the nucleic acid templates (DNA or RNA) were anchored but also the enzymatic reaction was sustained for a longer period due to a potential retention effect of enzymes on hydrogel layer. The disclosed techniques also include a unique flow device to host our hybrid materials and to carry out the reactions continuously. Current nucleic acid preparation methods such as PCR, in vitro transcription (IVT), provide nucleic acid products in a batch way, which cannot produce nucleic acids in a continuous way. In contrast, the present disclosure offers a simple device that can produce nucleic acids indefinitely.

[0059] In an example of RNA production, mRNA can be transcribed successfully in continuous flow device (or system) loading laminated DNA-decorated hydrogels for at least three months. The production period can be extended longer with months-level being expected. Thetranscript can be regulated by controlling the attachment direction of template DNA on hydrogel layer. This disclosure is a significant milestone in the field of nucleic acid artificial synthesis.

[0060] This system and methods disclosed here include a number of aspects, including but not limited to, polymer organogel, DNA and / or RNA hybrid hydrogel, hydrogel-based continuous production platform, RNA continuous production, DNA continuous production, recycling of enzymes, and the like, and any combination thereof. The systems and methods may be configured to produce proteins using a gene-coded DNA template with enzymatically ligation with an intrachain photo-crosslinked DNA cap so as to protect DNA template from degradation.

[0061] Other applications include continuous RNA and DNA production, DNA and RNA adsorption, separation, and detection.

[0062] The systems described herein to make biopolymers includes a hydrogel disposed on a support with free coupler reactive groups on the hydrogel or support configured to immobilize biomolecules. Once biomolecules are added to the system and immobilized on the hydrogel or the support, the biopolymer building components can be added via a solution that is moved through or across the hydrogel and support, since both the hydrogel and support are permeable. So long as the hydrogel and / or support have sufficient permeability to allow flow of the solution containing the biopolymer building components, the biopolymer can be assembled on the biomolecule without clogging of the system and without long resonance times of the byproducts during assembly.

[0063] The system may include one or more support(s) assembled together and in contact with adjacent support(s). The system may include one or more support(s) assembled separately from each other and / or in series so that different biopolymers on downstream support(s) can be built upon biopolymers from upstream support(s). The system may include any number of the one or more support(s) such that desirable biopolymers can be made in a continuous manner. The system may include one or more, two or more, three or more, four or more, or a plurality of support(s) that are connected or separated from each other.

[0064] The one or more support(s) of the system may have any configuration sufficient to have the hydrogel disposed thereon and to allow solutions containing biopolymer building components to move or flow through or across the one or more support(s) and hydrogel. The one or more support(s) may have any configuration with sufficient permeability. The one or more support(s) may have sufficient rigidity to allow the hydrogel to be disposed thereon andtherebetween the one or more support(s). The one or more support(s) may have a permeability sufficient to allow molecules and / or compounds (e.g., biopolymer building components) of a desired size move through the device. For example, the one or more support(s) may have a permeability of about 500 L-m ^h ^bar1or more, about 1000 L-m ^fr'-bar1or more, about 2000 L-m^-h^-bar1or more, or about 5000 L-nr^h ^-bar1or more. For example, the permeability may be between about 50 L-m ^h ^bar1and about 5000 L-m ^h ^bar1. including all 0.1 L-m ^fr'-bar1values and ranges therebetween.

[0065] The one or more support(s) may have a porosity sufficient to allow fluids and / or biopolymer building blocks to flow through the one or more support(s), for example from an inlet to an outlet. The porosity may have be about 5 percent or more, about 15 percent or more, or about 30 percent or more. The porosity may be above about 95 percent or less, about 75 percent or less, or about 50 percent or less. The porosity may be between about 5 and about 95 percent, including all 0.1 percent values and ranges therebetween. Porosity can be measured by methods known in the art. In various examples, porosity may be measured by Scanning Electron Microscopy (SEM). The support may have an amount of pores sufficient to support the hydrogel and allow the solution containing the biopolymer building components to flow through the pores. The pores may be evenly distributed throughout each of the one or more support(s). The pores may be spaced from each other by a distance that is similar (e.g., within about 1 to about 20 percent of the average distance between pores) through the one or more support(s). The pores may be spaced by a distance of about 0.01 microns to about 10 mm, including all 0.005 micron values and ranges therebetween. The pores of the one or more support(s) may have any size sufficient to allow biopolymer building components and / or biopolymers to flow therebetween with minimal or no clogging of the pores. The one or more support(s) may have pores of varying sizes or may have pores of essentially the same size. The one or more support(s) may have a D50 or D90 pore size of about 0.1 microns or more, about 1 micron or more, about 50 microns or more, or about 100 microns or more. The hydrogel may have a D50 or D90 pore size of about 5 mm or less, about 1 mm or less, or about 500 microns or less. The D50 or D90 pore size may be between 50 microns and 5 mm, including all 0.1 micron values and ranges therebetween.

[0066] The one or more support(s) may have a configuration, shape of, or comprise a foam, a fiber arrangement, a particle, a sponge, wood, paper, porous silica, or any other medium having surfaces sufficient to have the hydrogel disposed or coated thereof. The one or more support(s)may be comprised of a material that is sufficiently rigid to allow polymerization and formation of the hydrogel. The one or more support(s) may be comprised of wood, paper, porous silica, nickel, plastics, nanoclay, cellulose fibers, graphene-based materials, carbon nanotube-based materials, nanoparticles, ID, 2D, and 3D nanomaterials, or any combination thereof. Examples of plastics or polymers may include one or more of polyesters, polycarbonate, polyurethane, ABS, polyamides, polysaccharides, microporous polymer, or any combination thereof. The one or more support(s) may be connected and / or agglomerated together using fasteners (e.g., staples, adhesive, wire, etc.) or by the hydrogel after polymerization of the one or more monomer(s), crosslinker(s), or both. The one or more support(s) comprises surfaces capable of being coated or covered by a hydrogel and forming pores between surfaces of the hydrogel. The one or more support(s) may include one or more of a foam, a fiber arrangement, a particle, sponge, wood, paper, porous silica, or any combination thereof. The fiber arrangement may include random fiber networks, aligned fiber arrays, woven fiber structures, knitted or braider fiber networks, hierarchical or gradient fiber structures, porous fiber architecture, or any combination thereof.

[0067] The one or more support(s) may have a thickness sufficient to provide enough surface area for the hydrogel to be disposed herein. The one or more support(s) may have a thickness sufficient to provide desirable reaction or production rates of the biomolecules. The thickness of the one or more support(s) may be in part adjusted based on the pore size or porosity of the hydrogel and / or one or more support(s) such that desirable permeability of the system is achieved. The thickness of the one or more support(s) may be measured along the flow of fluids between the inlet and the outlet. Where only one pathway for fluids flow in and out of the system, the thickness of the one or more support(s) may be measured any two opposing external surfaces of the one or more support(s). The thickness of the one or more support(s) may be measured for each support or for the sum of all of the one or more support(s). The thickness of each of the one or more support(s) may be about 100 microns to about 5 cm, including all 0.1 micron values and ranges therebetween. The one or more support(s) may have a total thickness of about 100 microns to about 5 cm, including all 0.1 micron values and ranges therebetween.

[0068] The hydrogel may be formed from one or more monomer(s) that are crosslinked such that the formed hydrogel has one or more coupler reactive groups. The hydrogel may be comprised of residues of one or more monomer(s), one or more crosslinker(s), or both. The one or more coupler reactive groups may be present on one or both of the one or more monomer(s) and / or theone or more crosslinker(s). The one or more coupler reactive groups may be formed from the reaction of two or more of the one or more monomer(s) and / or the one or more crosslinker(s).

[0069] One or more monomer(s) as used herein unless otherwise stated comprises a compound that reactable with another monomer to form a polymer chain that is crosslink-able. The monomer or polymer chains may be able to crosslink with other monomers or polymer chains with or without one or more crosslinker(s). For example, the monomers or polymer chains may include functional groups that can react with adjacent polymer chains such that the crosslinked polymer has free coupler reactive groups that are configured to immobilize one or more biomolecule(s). For example, the monomers or polymer chains may include functional groups that are configured to react with one or more crosslinker(s) that have at least two functional groups such that two of the monomers and / or polymer chains may be connected and form a crosslinked polymer that has free coupler reactive groups that are configured to immobilize one or more biomolecule(s).

[0070] The one or more monomer(s) may have a functionality of at least two or more such that a polymer chain is formable. The one or more monomer(s) may have any functionality sufficient to form a crosslinked polymer with desirable permeability and having free coupler reactive groups. For example, the one or more monomer(s) may have at least two functional groups that allow for the one or more monomer(s) connect and form a linear polymer chain. In some examples, the one or more monomer(s) may include three or more functional groups such that three or more monomers or polymer chains can be connected and form a branched polymer. The one or more monomer / s) may include different functional groups for different purposes. For example, the one or more monomer(s) may have some functional groups that are configured to connect with other monomers and / or polymer chains and include different functional groups that are configured to react with crosslinkers such that polymer chains can be formed and subsequently or simultaneously crosslinked.

[0071] The one or more monomer(s) may be any compound sufficient to form a desired crosslinked polymer. The one or more monomer(s) may include acrylates, amides, methacrylates, methylmethacrylates, acrylamides, amines, carboxylic acids, aromatic nucleophilic substitution monomers, or any combination thereof. The one or more monomers may include a polyethylene glycol-acrylate monomer or polyethylene glycol-acrylate monomers, a multi-arm PEG-Acrylate or multi-arm PEG-Acrylates. Acrylate-PEG-NHS, methyl acrylate, 2-Hydroxyethyl acrylate, 2-Carboxyethyl acrylate, 2-Hydroxy-3-phenoxypropyl acrylate, 2-(Dimethylamino)ethyl acrylate,(2-Boc-amino)ethyl methacrylate, Methacrylic acid N-hydroxysuccinimide ester, N-[Tris(hydroxymethyl)methyl]acrylamide, N-(3-Aminopropyl)methacrylamide hydrochloride, N-Hydroxyethyl acrylamide, N-Isopropylacrylamide, Glycerol 1,3-diglycerolate diacrylate, 2-Aminoethyl methacrylate hydrochloride, Glycidyl acrylate, 2-Isocyanatoethyl methacrylate, structural analogs thereof, or any combination thereof. In some examples, the one or more monomer(s) and / or crosslinker(s) may include one or more amino acid(s). nucleotide(s), peptide(s), other biological compounds, structural analogs thereof, or any combination thereof such that a hydrogel is formed that is crosslinked and includes coupler reactive groups. Hydrogels made of one or more of amino acids, nucleotides, peptides, other biological compounds, or any combination thereof may be referred to as biological hydrogels.

[0072] A one or more crosslinker(s) as used herein unless otherwise stated means a compound that is capable of connecting two or more monomers, other crosslinkers, and / or polymer chains such that a crosslinked polymer is formed with free coupler reactive groups. The one or more crosslinker(s) may be the same or different than the one or more monomer(s). The one or more crosslinker(s) may have a functionality of at least two such that the crosslinker can react with at least two monomers, crosslinkers, and / or polymer chains and form the crosslinked polymer. In some examples, the crosslinker may include two or more functional groups configured to connect with separate functional groups of either or both of other crosslinkers or monomers. Besides free radical polymerization, condensation polymerization can be also be used to construct the gel materials. There are several examples, such as polyamides and polymers of intrinsic microporosity (PIMs), and other porous polymers.

[0073] The functional groups used herein unless otherwise stated mean reactive groups that are configured to polymerize the one or more monomer(s) and / or crosslinker(s) together to form a crosslinked polymer (e.g., hydrogel). The functional groups of the one or more crosslinker(s) may be referred to as crosslinker functional groups. The functional groups of the one or more monomer(s) may be referred to a monomer functional groups. The functional groups of the one or more crosslinker(s) and / or monomer(s) may be the same or different. The functional groups may be different than coupler reactive groups. After reacting two or more functional groups of the one or more monomer(s) and / or one or more crosslinker / s), a coupler reactive group may form from the reaction. The one or more monomer(s) and / or one or more crosslinker(s) may include any number of functional groups sufficient to form a desired polymer structure. The one or moremonomer(s) and / or one or more crosslinker(s) may each independently include two or more, three or more, four or more, five or more, or a plurality of functional groups such that a linear polymer, branched polymer, or network polymer may be formed that may be optionally further crosslinked to achieve a desirable hydrogel. The functional groups may include any compound including a vinyl group sufficient for polymerization and formation of the hydrogel. The functional groups may include one or more of acrylate, methyl acrylate, ethylene, amide, acrylamides, amines, carboxylic acids, aromatic nucleophilic substitution reactors, or any combination thereof.

[0074] The coupler reactive groups of the hydrogel may be configured to immobilize a biomolecule on the hydrogel by connecting with one or more linker reactive groups of the biomolecule. Any number of coupler reactive groups may be included on the one or more monomer(s) and / or one or more crosslinker(s) before polymerization and formation of the hydrogel. Any number of coupler reactive groups may be included on the hydrogel after polymerization. The coupler reactive groups may be present on the hydrogel in an amount sufficient to immobilize a desirable number of biomolecules. The coupler reactive groups may be present in the hydrogel in an amount of about 0.004 mM to about 1 mM, including all 0.0005 mM values and ranges therebetween.

[0075] The coupler reactive groups of the hydrogel and the linker reactive groups of the one or more biomolecule(s) may be a pair of functional groups that are reactable and can immobilize the one or more biomolecule(s) on the hydrogel. The coupler and / or linker reactive groups may be a reactable pair of functional groups that do not inhibit formation of the one or more biopolymer(s) on the biomolecule and / or hydrogel once the biomolecule and the hydrogel are connected. The coupler and linker reactive groups may be the same or different so long as they are reactable to immobilize the biomolecule on the hydrogel. In an example device or system, the hydrogel may include a combination of different coupler reactive groups so that different biomolecules may be immobilized on the device or system. The coupler and linker reactive groups may in combination include one or more a pair of reactive groups comprising amine reactive conjugations, thiolreactive conjugations, carbonyl-reactive conjugations, carboxyl-reactive conjugations, biorthogonal pairs or systems, photo-reactive conjugations, or any combination thereof. The amine reactive conjugations may include one or more of an amine and a carboxylic acid, an amine and an activated ester, an amine and an isothiocyanate, an amine and an aldehyde or ketone, or any combination thereof. The thiol-reactive conjugations may include one or more of a thiol and amaleimide, a thiol and an acylate or vinyl sulfone, a thiol and a haloacetyl, a thiol and a disulfide, or any combination thereof. The carbonyl-reactive conjugations may include one or more of an aldehyde or ketone and a hydrazide, a aldehyde or ketone and an aminooxy, or any combination thereof. The carboxyl-reactive conjugations may include one or more of carboxylic acid and an amine, a carboxylic acid and an alcohol, or any combination thereof. The biorthogonal pairs or systems may include one or more of azide and alkyne, an azide and a strained alkyne, tetrazine and a trans-cyclooctene, a cyclopropane and a tetrazine, an aldehyde and a hydrazine or aminooxy, a thiol and a gold nanoparticle surface, a boronic acid and a diol, a haloalkane and a haloalkane dehalogenase-tag, or any combination thereof. The photo-reactive conjugations may include one or more of aryl azides, benzophenones, diazirines, psoralen, or any combination thereof.

[0076] The coupler and / or linker reactive groups may be connected by enzymatic or catalytic conjugation. The coupler and / or linker reactive groups may be connected by one or more catalysts or enzymes configured to connect the biomolecules and the hydrogel together. The catalysts or enzymes used to link the biomolecules and the hydrogel together may be configured to facilitate enzymatic or catalytic conjugation between the pair.

[0077] The hydrogel may cover all, most, or essentially all of the surfaces of the one or more support(s) in a contiguous or semi-contiguous layer. The hydrogel may have a thickness on the one or more support(s) sufficient to immobilize one or more biomolecules for biopolymer production. The hydrogel may have a thickness sufficient to achieve desirable permeability of the system in combination with the one or more support(s). The hydrogel may have a thickness sufficient to avoid clogging of the system by the biopolymers, byproducts, or biopolymer building components. The hydrogel may have an average coating thickness along surfaces of the one or more support(s) of about 10 nm to about 5 mm.

[0078] The hydrogel may have a permeability sufficient to allow molecules and / or compounds (e.g., biopolymer building components) of a desired size move through the system. The hydrogel may have a permeability sufficient to mitigate clogging by unreacted biopolymer building components, biopolymers, and byproducts. The hydrogel and the one or more support(s) may have a permeability that is essentially the same (e.g.., within about 5 to 20 percent as permeable) as each other. The hydrogel and the one or more support(s) have a permeability that is different relative to each other. The hydrogel may have a permeability of about 50 L-m2-hLbar1or more, about 100 L-m ^fr'-bar1or more, about 500 L-m"2-h_1-bar_1or more, or about 1000 L-m2-h ^bar1or more.The permeability may be about 50 L-m ^h ^bar1to about 2000 L-m ^h ^bar1, including all 0.1 L-m ^fr'-bar1values and ranges therebetween.

[0079] The hydrogel may have a porosity sufficient to facilitate fluid flow of reactants and move biopolymers and byproducts through the system. The porosity may have be about 5 percent or more, about 15 percent or more, or about 30 percent or more. The porosity may be above about 95 percent or less, about 75 percent or less, or about 50 percent or less. The porosity may be between about 5 percent and about 95 percent, including all 0.1 percent values and ranges therebetween. Porosity may be measured by any technique known in the art, such as SEM. The hydrogels may have pores of varying sizes or may have pores of essentially the same size. The hydrogels may have a D50 or D90 pore size of about 0.1 microns or more, 1 micron or more, about 50 microns or more, or about 100 microns or more. The hydrogel may have a D50 or D90 pore size of about 5 mm or less, about 1 mm or less, or about 500 microns or less. The hydrogels may have a D50 or D90 pore size of about 0.1 microns to about 500 microns, including all 0.5 micron values and ranges therebetween.

[0080] In combination, the one or more support(s) and the hydrogel may have a permeability sufficient to allow molecules and / or compounds (e.g., biopolymer building components) and biopolymers of a desired size move through the system at a desired rate. The combination of the one or more support(s) and the hydrogel may have a permeability sufficient to allow fluids to flow through the system at a rate that removes or pushes out byproducts before the byproducts impact formation of the biopolymers.

[0081] The hydrogel may have a degree of crosslinking sufficient to form the hydrogel and allow for molecules and / or compounds to move through the hydrogel. The degree of crosslinking may be sufficient to allow for biomolecules to be immobilized on the hydrogel. The permeability of the hydrogel may be related to the degree of crosslinking. The degree of crosslinking may be impacted by the ratio of monomer to crosslinker. The degree of crosslinking may be about 0.1% to about 90%, including all 0.1 % values and ranges therebetween. Crosslinking may be determined by any method known in the art, such as by swelling test and spectroscopic (FTIR / NMR) methods.

[0082] The hydrogel may swell when contacted with one or more solvent(s) (e.g., water) that are configured to move the biopolymer building components through the device. The hydrogel may swell without any permanent distortion of the hydrogel and / or without disconnecting thehydrogel and / or the one or more supports. The hydrogel may be swell such that the permeability of the hydrogel remains at an amount sufficient to allow for movement of the biopolymer building components through the device. Swelling of the hydrogel may be measured as an increase in in total volume of the hydrogel before and after contact with one or more solvents. The hydrogel may have a degree of swelling of about 5 percent or more, about 10 percent or more, about 20 percent or more, or about 40 percent or more. The hydrogel may have a degree of swelling of about 300 percent or less, about 100 percent or less, about 80 percent or less, or about 60 percent or less. The degree of swelling may be about 5 percent to about 300 percent, including all 0.1 percent values and ranges therebetween. Swelling of the hydrogel may be measured known techniques in the art such as changes in initial volume and post solvent contact volume or by ASTM D570, ASTM F2900 technique.

[0083] The hydrogel may have a pH sufficient to achieve desirable permeability and / or swelling such that the biopolymer can be formed and / or biopolymer building components can move within the hydrogel. The pH may be adjusted by the monomers, crosslinkers, functional groups of the monomers or crosslinkers, and / or coupler and / or linker functional groups of the hydrogel. The pH may of the hydrogel may be adjusted or stabilized by the biopolymer building components used in the system or methods. The pH of the hydrogel may be at or between about 7 to about 8. The pH of the hydrogel may be measured by standard techniques in the art to determine the pH of hydrogels or other polymers.

[0084] A biomolecule may be configured to connect with a hydrogel and to facilitate formation of one or more biopolymer(s). The biomolecule may be immobilized on the hydrogel so that biopolymers can be built on the individual biomolecules. The biomolecule may include one or more linker reactive groups that are configured to connect and / or react with coupler reactive groups of the hydrogel such that the biomolecule is immobilized on the hydrogel. The biomolecule may include any number of separate linker reactive groups such that the biomolecule can be immobilized on the hydrogel through connection with one or more of the coupler reactive group(s). The biomolecule may form the bases for formation of any biopolymer. Once immobilized, biomolecules may form biopolymers by introduction of biopolymer building blocks to the system. The biomolecules use the biopolymer building blocks to synthesize biopolymers in a continuous fashion or organization. In some examples, separate biomolecules form separate biopolymers at different times, and the continuous flow of biopolymer building blocks facilitates formation of thebiopolymers, movement of the byproducts from the biomolecules and hydrogel, and moves the formed biopolymers out of the system. Biomolecules may be any compound that can be used in combination with biopolymer building blocks to form a biopolymer. Examples of biomolecules may include one or more of one or more of an oligonucleotide, a DNA oligonucleotide, an RNA oligonucleotide, a double-stranded DNA oligonucleotide, a protein, an antigen, a protein receptor, a polysaccharide, a viral protein, or the like, or any combination thereof.

[0085] The biomolecule may be positioned, disposed, or immobilized anywhere on the hydrogel sufficient to facilitate formation of the biopolymer. The biomolecule may only be positioned, disposed, or immobilized on outer surfaces of the hydrogel and build the biopolymers at the outer surfaces of the hydrogel, within the hydrogel and build the biopolymers within the hydrogel, or both. The biomolecule may be connected coupler reactive groups of the hydrogel and / or other functional groups of the support such that the biomolecule is immobilized and capable of forming the biopolymers.

[0086] A biopolymer is produced from a biomolecule and is any compound that is comprised of one or more monomer units (e.g., biopolymer building blocks). The biopolymers discussed herein may be built on the biomolecule, which is positioned, disposed, or immobilized on the hydrogel and / or support. The biopolymer may have any molecule weight (e.g., number, weight average, Mz, Mz+1 as measured by polystyrene or poly (butyl methacrylate) standards) desired using the targeted biomolecules to form the biopolymer. The biopolymer may have a molecular weight that is larger than the biomolecule. The biopolymer may include one or more of a protein or proteins, a protein derivative or protein derivatives, a polypeptide or polypeptides, a nucleic acid or nucleic acids (e.g. DNA, RNA, or the like), a polysaccharide or polysaccharides, or any combination thereof. Examples of RNA may include one or more of mRNA, miRNA, siRNA, aptamers, saRNA, gRNA. Examples of DNA may include one or more of plasmid, circleDNA, oligos, single-stranded and double-stranded DNA, viral DNA, specific gene-coded DNA fragments, branched DNA nanostructures, DNA origami, or any combination thereof. Examples of polysaccharides may include alginate, cellulose, chitin, Hyaluronic acid, chondroitin sulfate, heparin, Dextran, xanthan gum, or any combination thereof.

[0087] Proteins or protein derivatives as used herein unless otherwise stated may be comprised of canonical or non-canonical amino acids. The canonical or non-canonical amino acids may be referred to or included as biopolymer building components or blocks. The proteins describedherein may be made from the hydrogel and / or one or more support(s) as described herein through cell-free protein synthesis (CFPS). CFPS may utilize purified or semi-purified biopolymer building components, including, but not limited to. ribosomes and enzymes (natural or engineered), to produce target proteins from a template without the need for intact, living cells. CFPS can be performed from an mRNA template or can alternatively commence with a DNA template (or equivalent nucleic acid), from which the requisite mRNA is transcribed in a coupled system incorporating an appropriate RNA polymerase (e.g., T7 RNA polymerase or equivalents) and ribonucleotide triphosphates (NTPs). Biopolymer building components for protein production may generally include: ribosomes (e.g., prokaryotic 70S or eukaryotic 80S); aminoacyl-tRNA synthetases (aaRS), which charge transfer RNAs with their cognate amino acids; a complete set of tRNAs; translation initiation factors (e.g., IF1, IF2, IF3 for prokaryotic systems or eIFl-eIF5 for eukaryotic systems); elongation factors (e.g., EF-Tu, EF-Ts, EF-G for prokaryotic systems or eEFlA, eEFIB, eEF2 for eukaryotic systems); release factors (e.g., RF1, RF2, RF3 for prokaryotic systems or eRFl, eRF3 for eukaryotic systems); and ribosome recycling factors. Additional biopolymer building components may encompass cofactors such as magnesium ions, potassium ions, and polyamines; a pool of amino acids, which typically may include the twenty canonical amino acids; and energy sources and regeneration systems, including but not limited to ATP, GTP, phosphoenolpyruvate with pyruvate kinase, or creatine phosphate with creatine kinase. Importantly, the amino acid pool may be expanded to include non-natural amino acids (nnAAs) (e.g., p-azidophenylalanine, p-acetylphenylalanine, selenocysteine, pyrrolysine, or other chemically modified amino acids) incorporated via engineered orthogonal aminoacyl-tRNA synthetase / tRNA pairs, chemical aminoacylation methods, or other techniques, thereby enabling the production of proteins with expanded chemical diversity and novel functionalities.

[0088] To build the biopolymer, biopolymer building components are used in conjunction with the biomolecule to facility proper building and sequence of the biopolymer. Biopolymer building blocks may include any compounds used to form, catalyze, sequence, or otherwise build the biopolymer. Examples of biopolymer building components may include one or more of enzymes, primers, building blocks (e.g., amino acids, NTPs), or any combination thereof. Biopolymer building components are moved into the system through a solution (e.g., buffer solution). Examples of enzymes may include one or more of DNA and RNA polymerase, ribosome, any other enzyme used to make a biopolymer, or any combination thereof. Examples of polymerbuilding blocks may include one or more of amino acids, dNTPs, rNTPs,, or any combination thereof. Examples of primers may include one or more of isotherm amplification primers, other primers, or any combination thereof. Each of the individual biopolymer building components may be present in any concentration sufficient to facilitate formation of the biopolymer at each of the biomolecule sites. The biopolymer building components may be present in excess of a molar ratio used to form the biopolymers. For example, a solution including excess of each of the biopolymer building components that is continuously moved across or through the hydrogel may be configured to continuously feed the biomolecules as biopolymers and other byproducts are produced. Optionally, after the solution containing an excess of biopolymer building components is moved across or through the hydrogel, the solution may be purified or otherwise separated and then recycled such that the unreacted biopolymer building components can be recycled and moved across or through the hydrogel again. This configuration reuses unreacted components and helps facilitate continuous formation of the biopolymers and movement of the biopolymers and byproducts across and out of the system. Each of the biopolymer building components are configured to either be built onto the biomolecule or used to facilitate or catalyze building on the biomolecule such that the biopolymer is sequenced and formed in the system. Individual biomolecules on the same hydrogel may be configured to build different biopolymers either on the same hydrogel and support or on a separate hydrogel and support in the system.

[0089] Byproducts of biopolymers (i.e., biopolymer byproducts) are compounds formed during sequencing and formation of the biopolymers and are different and separate from the biopolymers. Byproducts may be benign compounds formed in the process of forming the biopolymers. Byproducts may be undesirable in the system because of negative impacts on reaction conditions, such as changes in pH or concentration of other reactants. Desirably, the solution containing biopolymer building components may move through or across the hydrogel to flush the products from the hydrogel and corresponding reaction sites of the biomolecule such that the biomolecule can continue to facilitate growth of the biopolymers without undesirable interference from the byproducts. Byproducts may include any compound formed during formation of the biopolymers and a separate component from the said biopolymers. Examples of byproducts may include one or more of pyrophosphate, other byproducts, or any combination thereof.

[0090] The systems described herein may be formed by any techniques sufficient to dispose the hydrogel on the one or more support(s) and / or immobilize the biomolecule on one or both of the one or more support(s) and the hydrogel.

[0091] The one or more support(s) may be contacted with one or more monomer(s), one or more crosslinker(s), or both and subjected to conditions such that the one or more monomer(s) and / or one or more crosslinker(s) polymerize to form the hydrogel thereon the one or more support(s). Before polymerization, the one or more monomer(s) and / or one or more crosslinker(s) may be spread, moved, distributed, or disseminated to essentially of the externally exposed surfaces of the one or more support(s). The one or more monomer(s) and / or one or more crosslinker(s) may be contacted or mixed with one or more monomer solvents (either before or after contact with the one or more support(s)) configured to spread, moved, distributed, or disseminated between surfaces of the one or more support(s). In some examples, the one or more monomer(s) and one or more crosslinker(s) may be contacted and form a precursor solution or a solution may be formed in situ with the one or more support(s). The monomer solvent may be any solvent configured to dissolve the one or more monomer(s) and / or one or more crosslinker(s) at desirable concentrations. The monomer solvent may polar or non-polar. The monomer solvent may be protic or aprotic. Any number of monomer solvents may be used in combination to separately or in combination dissolve the one or more monomer(s) and / or one or more crosslinker(s). The one or more monomer solvent(s) may be one or more of acetone, DMSO, acetonitrile, DMF, dichloromethane, THF, ethyl acetate, formamide, NMP, pyridine, ionic liquids, or any combination thereof.

[0092] After contacting the one or more monomer(s), one or more crosslinker(s). and one or more monomer solvent(s), conditions may be applied to the one or more monomer(s), one or more crosslinker(s), and one or more monomer solvent(s) sufficient to form the hydrogel. Conditions may include application of UV light, elevated temperatures, moisture curing, magnetic field, surface grafting, or any combination thereof. Conditions may be applied for any period of time sufficient to form the hydrogel, such as between 15 seconds and 24 hours or more. In some examples, the hydrogel may be fully or partially formed separately from the one or more support(s) and disposed on or contacted with the support(s) such that the combination of the one or more support(s) and the hydrogel are capable of immobilizing the biomolecule and to facilitate growth of biopolymers.

[0093] After forming the hydrogel that has free coupler reactive groups, a biomolecule may be contacted with the hydrogel and the one or more support(s) such that the biomolecule is immobilized on the hydrogel and / or one or more support(s). Before contact with the hydrogel and / or one or more support(s), the biomolecule may be contacted with one or more solvents (e.g., water), solutions, or buffers (e.g.., phosphate buffers) sufficient to facilitate connection between the coupler reactive group(s) and the linker reactive group(s) such that a biomolecule precursor solution is formed. The biomolecule may be present in the biomolecule precursor solution in any desirable concentration sufficient to be immobilized on the hydrogel and / or one or more support(s). In some examples, the biomolecule may be present in excess to connect with most, essentially all, or all of the coupler reactive group(s) of the hydrogel. The biomolecule may be present in the solution a concentration of about 1 pg / microliter to about 100 micrograms per liter, including all 0.1 picogram per liter values or rangers therebetween, based on the total volume of the solution. Once immobilized, the biomolecule may be present within and / or on the hydrogel and / or one or more support(s) in any concentration sufficient to facilitate formation of a desirable number of biopolymers. For example, the biomolecule may be present within and / or on the hydrogel and / or one or more support(s) in an amount of about 1 pg / microliter to about 100 micrograms per liter, including an 50 nanogram per liter values or rangers therebetween based on the individual or combination total volume of the hydrogel and / or one or more support(s).

[0094] The biomolecule and the combination of the hydrogel and the one or more support(s) may be contacted under any conditions (e.g., time, temperature, pressure, pH, etc.) sufficient to immobilize the biomolecule onto the hydrogel and / or one or more support(s) in desirable amounts. The biomolecule and the combination of the hydrogel and the one or more support(s) may be contacted at any desirable temperature that does not negatively impact the properties of the hydrogel and / or the biomolecule before, during, or after immobilization thereon. For example, the biomolecule and the combination of the hydrogel and the one or more support(s) may be contacted at a temperature of about 0 degrees Celsius to about 80 degrees Celsius, or any range therebetween. The biomolecule and the combination of the hydrogel and the one or more support(s) may be contacted at a pressure sufficient to disperse or permeate the biomolecule to desirable reaction sites across and / or within the hydrogel and / or one or more supports. For example, the biomolecule and the combination of the hydrogel and the one or more support(s) may be contacted at a pressure of about 50 KPa to about 150 Kpa, including all 0.1 Kpa values or range therebetween.

[0095] The biomolecule and the combination of the hydrogel and the one or more support(s) may be contacted for any period of time that allows for sufficient reaction time between the linker reactive group of the biomolecule and the coupler reactive group of the hydrogel and / or one or more support(s). The biomolecule and the combination of the hydrogel and the one or more support(s) may be contacted for a period of time sufficient to allow the biomolecule to disperse and / or permeate between the pores of the hydrogel and / or the one or more support(s). The biomolecule and the combination of the hydrogel and the one or more support(s) may be contacted for between about 1 h (h = hour(s) and about 24 h, including all integer minute values and ranges therebetween.

[0096] The biomolecule and the combination of the hydrogel and the one or more support(s) may be contacted at a desirable pH that is controlled by utilization of a buffer. The pH of the system may be controlled through batch application of a buffer while the biomolecule is connecting with coupler reactive groups of the hydrogel. In some examples, fresh buffer and / or biomolecules are continuously applied to the hydrogel and / or the one or more support(s) for a period of time sufficient to permeate the hydrogel and / or the one or more support(s) and immobilize the biomolecule at most, essentially all, or all of the coupler reactive groups of the hydrogel and / or the one or more support(s). Continuous application of buffer and / or biomolecules may additionally push byproducts produced from reaction of the linker and coupler reactive groups from the system and facilitate more efficient immobilization of the biomolecules throughout the system. A desirable pH may be maintained such that the biomolecules can have sufficient reaction conditions to immobilize on the hydrogel and / or the one or more support(s). For example, while attaching the biomolecule, a neutral or acidic pH may be maintained, such as a pH at or between about 7 to about 9 or any value or range therebetween. After sufficient biomolecules are immobilized on the hydrogel and / or one or more support(s), the system may be washed with a solution and / or buffer to remove unreacted biomolecules from the system.

[0097] Once the biomolecule is immobilized on the system on the hydrogel and / or one or more support(s), the system may be utilized to form one or more biopolymers. The biopolymers are built at the immobilized biomolecules by using an input of biopolymer building components that individually or in combination facilitate, catalyze, and / or are incorporated within the biopolymer. In some examples, the biopolymer building components are added in excess moved across the hydrogel and / or the one or more support(s) at a pressure sufficient to form the biopolymer andflush byproducts from the system. The pressure may be sufficient to avoid distortion of the hydrogel and / or the one or more support(s) while maintaining formation of the biopolymers. The pressure may be about 50 KPa to about 150 Kpa, including all 0.1 Kpa values or ranges therebetween.

[0098] The biopolymer building components may be contacted with the system in a single solution or in multiple solutions simultaneously or in sequence. For example, a first biopolymer building component stream containing an enzyme (or other component) and a second biopolymer building component stream containing a biopolymer building block (or other component) may each be added to the system in a mixed or separate streams so that the amount of biopolymer building components may be modulated, individually added by recycling, or changed to make different biopolymers.

[0099] During formation of the biopolymers, a solution containing the biopolymer building components is moved across the hydrogel and / or one or more support(s) at a concentration sufficient to form the biopolymers. The amount and / or combination of biopolymer building components may be adjusted or tailored based on the predicted rates of reactions, rate of fluid flow of the solution, or the progress of the reaction as identified during monitoring of the system. For example, the combination of biopolymer building components may be present in the solution at a concentration of about 0.1 mM to about 1 mM, including all 0.05 mM values and ranges therebetween.

[0100] After or during formation of the biopolymer in the system, a solution containing the products, unreacted or reusable biopolymer building components, and / or byproducts of the process may be separated from the system by the movement or flow of fluids through the hydrogel and / or one or more support(s). The flow of fluids may be sufficient to move byproducts out of the system before the byproducts negatively impact properties of the system, such as pH. In some examples, the solution moves through a pathway (e.g., an outlet) connected with a module that is configured to analyze, separate, identify, and / or utilize the biopolymers, byproducts, and / or unreacted or reuseable biopolymer building components. After entering the module, the biopolymers, byproducts, and / or unreacted or reusable biopolymer building components may be moved through another pathway for further treatment or may be separated and moved through separate pathways. For example, some of the unreacted or reused biopolymer building components can be moved through a recycle stream back to a location of the hydrogel and / or one or more support(s) tofacilitate formation of additional biopolymer. This is advantageous to reuse flushed components, such as enzymes that have formed biopolymer or did not connect with reactive sites of biomolecules, so that the system and methods can operate in a continuous manner. Example separation techniques for the biopolymers, byproducts, and / or unreacted or reusable biopolymer building components may include one or more of filtration, adsorption, electrophoresis, centrifugation, precipitation, or any combination thereof.

[0101] Analysis of the components during or after reaction may be conducted by any techniques known in the art. Analysis may include identification of the presence of or concentration of a particular biopolymer or compound. For example, some of the products may be identified by known techniques in the art configured to determine if and / or when biopolymers or bioproducts are formed. Identification techniques may include one of more of electrophoresis, adsorption, size exclusion chromatography, sequencing, mass spectroscopy, or any combination thereof.

[0102] Analysis of the components may be completed with computing techniques (using a processor or similar hardware) to modulate incoming reactants and outgoing products and byproducts. The computing process may use the analysis techniques described herein to determine reaction rates of the biopolymer and to manage formation of the biopolymer through adjusting the amount or concentration of reactants, adjusting reaction conditions (e.g., pressure, temperature, resonance time of reactants), molar ratio, or combination thereof. The computing techniques may be configured to automatically adjust when one biopolymer building component (e.g., enzymes), buffer, and / or another biopolymer building component (e.g., biopolymer building blocks) are moved into the system or the concentration of one is changed in the system, which may be advantageous to maintain an excess for reactions or to increase fluid flows to wash the system of byproducts.

[0103] The system and / or methods disclosed herein to make biopolymers may be run in a continuous fashion or manner for any period of time to make desirable amounts of biopolymers. Continuous time as used herein unless otherwise stated means that the systems disclosed will continuously facilitate formation of biopolymers without interruption so long as biomolecules are attached to the hydrogel and the biopolymer building components are flowing or moving through or across the system. To begin formation of the biopolymers, the systems and / or methods may be operated for about 5 min to about 24 h, which can be identified by the initial presence of thebiopolymer in the product stream (as conducted by analysis and / or identification techniques described herein). Once some amount of biopolymers form, the systems and / or methods may be operated for any continuous period of time desired, such as between about 30 minutes and six months or years.

[0104] During formation of the biopolymers, the solution entering the system or the system itself may be held or moved to any temperature sufficient to form the biopolymers without distorting the hydrogel, biomolecules, and / or biopolymers. In some examples, the system and / or the solution may be allowed remain at ambient temperature (e.g., about 25 degrees Celsius). The temperature of the solution (containing biopolymer building components) may be cooled or heated before being moved into the inlet of the system. The temperature of the hydrogel and / or the one or more support(s) may be cooled or heated before entry of the solution. The temperature of the hydrogel and / or the one or more support(s) and the solution may be the same or different before contacting of each other and formation of the biopolymers. The temperature may be above 0 degrees Celsius and below about 80 degrees Celsius, including all 0.1 degree values and ranges therebetween.

[0105] After formation of a desirable amount of biopolymers or if an undesired reaction rate or fluid flow occurs, the system may be flushed or cleaned with a relevant cleaning solution or technique. For example, over prolonged use of the continuous system, build up of biopolymer building components, byproducts, and / or biopolymers may occur upstream or downstream of the inlet. To mitigate this issue, a cleaning solution that does not negatively impact the hydrogel may be applied to the system so that the system can be reused. In some examples, the cleaning solution may be used to remove the immobilized biomolecules from the hydrogel so that new and / or different biomolecules may be added to the system for producing more biopolymers. In some examples, the solution containing buffer and / or biopolymer building components may function to The cleaning solution may include any compound sufficient to unclog the hydrogel and / or one or more support(s) or any compound sufficient to dislodge or otherwise remove the biomolecule from the hydrogel. The cleaning solution may include compounds such as one or more of buffer salts, solvents, or any combination thereof.

[0106] Buffers used herein unless otherwise stated may be for maintaining pH (e.g., between about 7 and about 9) during formation of the hydrogel, immobilization of the biomolecule, or formation of the biopolymer on the biomolecule. The buffers used herein may be configured forstoring biopolymers or analyzing or identifying biopolymers. The buffers may be added to the system for facilitating production of the biopolymer or the module for downstream use, analysis, or identification. The buffers disclosed herein may be configured to maintain or stabilize a desirable pH such that desirable products (e.g., biopolymers, hydrogel, and / or biomolecules connection to the hydrogel) are formed. The buffer may be any combination of compounds sufficient to maintain or stabilize desirable pH. For example, the buffer may include one or more of phosphate, tris-EDTA, tris-acetate-EDTA, tris-borate-EDTA, sodium chloride, or any combination thereof. The concentration of the buffer within the solution of the system may be any amount sufficient to achieve desirable pH. For example, the concentration may be about 10 mM to about 300 mM, including all 0.1 mM values and ranges therebetween.

[0107] FIG. 1 is a cross-sectional view of system 100 configured to form a biopolymer. A solution is moved through an inlet 102 of the system 100 and to a housing 104 that is configured to hold fluids. The housing 104 includes one or more support(s) 106a, 106b, 106c that have a hydrogels 108a, 108b, 108c individually disposed on each of the one or more support(s) 106a, 106b, 106c. The one or more support(s) 106a, 106b, 106c are positioned within housing 104 and separated from each other and the inlet 102 and an outlet 110 by channels 112a, 112b, 112c, 112d. The channels 112a, 112b, 112c, 112d may be connected directly through passages around the one or more support(s) 106a, 106b, 106c or the channels 112a, 112b, 112c, 112d may be fluidly connected through the one or more support(s) 106a. 106b, 106c and the hydrogels 108a, 108b, 108c that have permeability.

[0108] The solution that moves through the inlet 102 contains biopolymer building components configured to be used for building a biopolymer. The inlet 102 as used herein unless otherwise stated means any pathway that moves compounds into the system before, during, or after formation of the biopolymer. Any number of inlets 102 may be included in the system, such as one or more, two or more, three or more, four or more, or a plurality of inlets 102. The one or more support(s) 106a, 106b, 106c and / or the hydrogels 108a, 108b, 108c includes one or more biomolecule(s) that are immobilized on the one or more support(s) 106a, 106b, 106c and / or the hydrogels 108a, 108b, 108c. As the solution flows across and / or through the one or more support(s) 106a, 106b, 106c and the hydrogels 108a, 108b, 108c the biopolymer building components connect with the biomolecules and build and / or sequence the one or more biopolymer(s). Since the one or more support(s) 106a, 106b, 106c and the hydrogels 108a, 108b, 108c are set up in sequence, oneof the biopolymer(s) may be built and / or sequenced at the first of the one or more support(s), and a different of the biopolymer(s) may be built and / or sequenced at the other support(s) 106b, 106c and the hydrogels 108b. 108c. In some examples, the same biopolymers are built at all of the one or more support(s) 106a, 106b, 106c and the hydrogels 108a, 108b, 108c. In some examples, different portions of the same biopolymer are built at all three of the one or more support(s) 106a, 106b. 106c and the hydrogels 108a, 108b, 108c such that the biopolymer is built up at each of the one or more support(s) 106a, 106b, 106c and the hydrogels 108a, 108b, 108c while flowing towards the outlet 110. After the biopolymers are formed, the biopolymers, unreacted biopolymer building components, and biopolymer byproducts flow to the outlet 110 for further use, recycling, identification, purification, and / or analysis. In other examples, more or less than three of the one or more support(s) 106a, 106b, 106c and the hydrogels 108a. 108b, 108c are included in the system.

[0109] The inlet 102 and the outlet 110 may be the same in some examples meaning that fluids enter and exit through the same pathway. The inlet 102 and outlet 110 may in combination be connected with sources of biopolymer building components and / or buffer. For example, the outlet 110 may move unreacted or reused biopolymer building components to a source of unreacted or reused biopolymer building components or back into the housing 104 (e.g., through a recycle loop or pathway (not shown)).

[0110] The housing 104 may have any form sufficient to contain the one or more support(s) 106a, 106b, 106c and the hydrogels 108a, 108b, 108c and solutions running therethrough. The one or more support(s) 106a, 106b, 106c and the hydrogels 108a, 108b, 108c may be formed first and the housing 104 may enclose the one or more support(s) 106a, 106b. 106c and the hydrogels 108a, 108b, 108c so that the solution may be flowed therethrough.

[0111] FIG. 2 is a cross-sectional view of system 200 configured to form a biopolymer. The system 200 may be similar to the system 100 of FIG. 1. A solution is moved through an inlet 202 of the system 200 and to a housing 204 that is configured to hold fluids. The housing 204 includes one or more support(s) 206 that have a hydrogels 208 individually disposed on each of the one or more support(s) 206. The one or more support(s) 206 are positioned within housing 204 and separated from each other and the inlet 202 and an outlet 210 by channels 212a, 212b. The channels 212a, 212b may be connected directly through passages around the one or more support(s) 106 orthe channels 212a, 212b may be fluidly connected through the one or more support(s) 206 and the hydrogels 208 that have permeability.

[0112] The solution that moves through the inlet 202 contains biopolymer building components configured to be used for building a biopolymer. The one or more support(s) 206 and / or the hydrogels 208 includes one or more biomolecule(s) that are immobilized on the one or more support(s) 206 and / or the hydrogels 208. As the solution flows across and / or through the one or more support(s) 206 and the hydrogels 208 the biopolymer building components connect with the biomolecules and build and / or sequence the one or more biopolymer(s). After the biopolymers are formed, the biopolymers, unreacted biopolymer building components, and biopolymer byproducts flow to the outlet 210 for further use, recycling, identification, purification, and / or analysis. In other examples, more or less than one of the one or more support(s) 206 and the hydrogels 208 are included in the system.

[0113] After moving to the outlet 210, the biopolymers, unreacted biopolymer building components, and biopolymer byproducts can flow to a module 214 that is configured to use, recycle, identify, purify, analyze, treat, or any other techniques that utilizes the biopolymers, unreacted biopolymer building components, and biopolymers. The module 214 as used herein, unless otherwise stated, means any chamber separate from or attached with the housing 204 and configured to perform separation or analysis of the compounds moving through or removed from the housing 204. Once completed, unreacted biopolymer byproducts may be separated from other components, optionally mixed with additional solvent, buffer, or other reaction components, and returned to the housing 204 via a recycle stream 216 (or recycle loop). The recycle stream 216 may be moved directly back to the housing 204 or may be moved through another module (not shown) that is configured to additionally treat the solution or mix with additional components before entry back into the housing 204. The biopolymers may be moved through an exit pathway 218 so that the biopolymers may be further treated or used in downstream applications. The bioproducts may be moved through the exit pathway 218 or a different pathway (not shown) and disposed of. The exit pathway 218 means any pathway that removes components from the module and one or more exit pathways 218 may be included in the presently disclosed design.

[0114] The system 100, 200 can further comprise equipment utilized to operate the system. Nonlimiting examples of equipment utilized but otherwise not shown may be one or more of other modules, pumps, additional pathways (e.g., inlets, outlets, recycle loops), precursor reactors orchambers (e.g., for premixing biopolymer building components), monitoring equipment, analysis equipment, filtration apparatuses and equipment, computing equipment, temperature control equipment, or any combination thereof.ILLUSTRATIVE STATEMENTS SETS A TO D

[0115] Statement sets A through D are illustrative of all concepts disclosed in this application. Elements or portions of statement sets A through D may be used interchangeably with other of statement sets A through D.AL A system for immobilizing a biomolecule comprising:a mesh scaffold;a hydrogel composition coating the mesh scaffold; anda biomolecule covalently cross-linked to the hydrogel composition.A2. The system of statement Al, wherein the mesh scaffold comprises a mesh fabric.A3. The system of statement A2, wherein the mesh fabric comprises a pore size of about 0.1-5 mm, including all 0.05 mm values and ranges therebetween.A4. The system of statement A2 or A3, wherein the mesh fabric comprises a pore size of about 1-3 mm, including all 0.1 mm values and ranges therebetween.A5. The system of any one of statements A1-A4, wherein the hydrogel composition comprises a polymer organogel or the like.A6. The system of any one of statements A1-A4, wherein the hydrogel composition comprises polydimethylsiloxane or the like.A7. The system of any one of statements A1-A6, wherein the biomolecule comprises an oligonucleotide, a DNA oligonucleotide, an RNA oligonucleotide, a double- stranded DNA oligonucleotide, a protein, an antigen, a protein receptor, a polysaccharide, a viral protein, or the like, or any combination thereof.BL A system for immobilizing a biomolecule comprising:a mesh scaffold; anda hydrogel composition coating the mesh scaffold,wherein the hydrogel composition comprises a group capable of and / or configured to forming a chemical cross-linking (e.g., forming two or more cross-linking bonds) with a biomolecule or the like.B2. The system of statement B 1, wherein the mesh scaffold comprises a mesh fabric.B3. The system of statement B2, wherein the mesh fabric comprises a pore size of about 0.1 - 5 mm, including all 0.05 mm values and ranges therebetween.B4. The system of statements B2 or B3, wherein the mesh fabric comprises a pore size of about 1-3 mm, including all 0.1 mm values and ranges therebetween.B5. The system of any one of statements B1-B4, wherein the hydrogel composition comprises a polymer organogel or the like.B6. The system of any one of statements B1-B4, wherein the hydrogel composition comprises polydimethylsiloxane or the like.Cl. A method for producing an oligonucleotide, the method comprising:obtaining a system of any one of claims A1-A7, wherein the biomolecule comprises a nucleotide template;flowing a solution comprising a polymerase or the like and dNTPs or the like through the hydrogel embedded mesh of the system to permit an oligonucleotide formation reaction or the like; andcollecting a product oligonucleotide produced by the oligonucleotide formation reaction or the like.C2. The method of statement Cl, wherein the solution comprises a buffer.C3. The method of statements Cl or C2, wherein the nucleotide template comprises a doublestranded DNA template or the like.C4. The method of any one of statement C1-C3, wherein the polymerase comprises an RNA polymerase or the like.C5. The method of statement C4, wherein RNA polymerase is selected from a T7 polymerase, a T3 polymerase, a SP6 polymerase, and the like, and any combination thereof.C6. The method of any one of statements C1-C5, wherein the product oligonucleotide comprises an RNA oligonucleotide.C7. The method of any one of statements C1-C6, wherein more than one system is employed in parallel.C8. The method of any one of statements C1-C6, wherein more than one system is employed in series.C9. The method of any one of statements Cl-C, wherein the solution is cooled to about 4°C.CIO. The method of any one of statements Cl-C, wherein the system is maintained at a temperature of about 15°C to about 70°C.Cl 1. The method of statement CIO, wherein the system is maintained at a temperature of about 30°C.Cll. The method of any one of statements Cl -CIO, wherein the method is performed in a continuous operation.Draft Claims for PCT FilingDI. A system, comprising:a. one or more support(s) having a permeability of 2000 L-m ^h ^bar1or more; andb. a hydrogel that comprises one or more coupler reactive group(s) configured to connect with one or more linker reactive group(s) of one or more biomolecule(s), wherein the hydrogel is disposed on the one or more support(s), and wherein the hydrogel has a permeability of 100 L m ^h ^bar1or more.D2. The system of statement DI, wherein the one or more support(s) and the hydrogel in combination have a permeability of 1000 L-m^-h^-bar1or more.D3. The system of statements DI or D2, wherein the one or more support(s) has a porosity of about 5 percent to about 95 percent, based on the total volume of the one or more support(s). D4. The system of any one of statements D1-D3, wherein the one or more support(s) comprise a plurality of pores having a pore size of about 100 nm to about 1 cm.D5. The system of any one of statements D1-D4, wherein the plurality of pores of the one or more support(s) have a D50 pore size of about 50 nm to about 1 mm.D6. The system of any one of statements D1-D5, wherein the plurality of pores of the one or more support(s) have a D90 pore size of about 1 pm to about 5 mm.D7. The system of any one of statements D1-D6, wherein the hydrogel has a porosity of about 5 percent to about 95 percent, based on the total volume of the hydrogel.D8. The system of any one of statements D1-D7, wherein the hydrogel comprises a plurality of pores having a pore size of about 10 nm to about 700 pm.D9. The system of any one of statements D1-D8, wherein the plurality of pores of the hydrogel have a D50 pore size of about 50 nm to about 1 mm.DIO. The system of any one of statements D1 -D9, wherein the plurality of pores of the hydrogel have a D90 pore size of about 50 nm to about 500 pm.Dll. The system of any one of statements DI -DIO, wherein each of the one or more supports has an individual thickness of about 100 pm to about 5 mm.DI 2. The system of any one of statements DI -DI 1, wherein the one or more support(s) has a total thickness of about 100 pm to about 5 m, wherein the total thickness is a sum of all of the one or more support(s) measured from an inlet to an outlet of the system.D13. The system of any one of statements D1-D12, wherein the hydrogel has an average coating thickness along surfaces of the one or more support(s) of about 10 nm to about 5 mm. D14. The system of any one of statements D1-D13. wherein the hydrogel has a crosslinking density of 0. 1 mol / L or more.D15. The system of any one of statements D1-D14, wherein the hydrogel has a degree of swelling of 20% or more.D16. The system of any one of statements D1-D15, wherein the hydrogel has a pH of about 7 to about 8.D17. The system of any one of statements D1-D16, wherein the hydrogel comprises:a. one or more backbone chain(s) comprised of residues of one or more monomer(s); andb. one or more crosslinker(s) that connect the one or more backbone chain(s) together, wherein either or both of the one or more crosslinker(s) or the one or more backbone chain(s) comprise the one or coupler reactive group(s).DI 8. The system of any one of statements D1-D17, further comprising:a. one or more inlet(s) configured to input one or more solvent(s), one or more buffer(s), and / or one or more biopolymer building component(s); andb. one or more outlet(s) configured to output the one or more solvent(s), one or more buffer(s). one or more biopolymer byproduct(s), one or more biopolymer building component(s) that are unreacted, and / or one or more biopolymer(s) from the system. D19. The system of any one of statements D1-D18, wherein the one or more support(s) comprises surfaces capable of being coated or covered by a hydrogel and forming pores between surfaces of the hydrogel.D20. The system of any one of statements DI -DI 9, wherein the one or more support(s) comprises one or more of a foam, a fiber arrangement, a particle, sponge, wood, paper, porous silica, or any combination thereof.D21. The system of any one of statements D1-D20, wherein the fiber arrangement comprises random fiber networks, aligned fiber arrays, woven fiber structures, knitted or braider fiber networks, hierarchical or gradient fiber structures, porous fiber architecture, or any combination thereof.D22. A system, comprising:a. one or more support(s) having a permeability of 2000 L-m ^h ^bar1or more; andb. a hydrogel that comprises one or more coupler reactive group(s), wherein the hydrogel is disposed on the one or more support(s) has a permeability of 100L·m-2·h-1·bar-1or more; andc. one or more biomolecules comprising one or more linker reactive group(s) connected with the hydrogel at the one or more coupler reactive group(s).D23. The system of statement D22, wherein the hydrogel is disposed on essentially all of the one or more support(s) such that pores exist between surfaces of the hydrogel.D24. The system of any one of statements D22 to D23, wherein most of the one or more biomolecules are connected with the hydrogel at the surfaces of the hydrogel that form the pores. D25. The system of any one of statements D22 to D24, wherein the pores that exist between the surface of the hydrogel have a size of about 10 nm to about 700 m.D26. The system of any one of statements D22 to D25, wherein the one or more biomolecule(s) comprises one or more of an oligonucleotide, a DNA oligonucleotide, an RNA oligonucleotide, a double-stranded DNA oligonucleotide, a protein, an antigen, a protein receptor, a polysaccharide, a viral protein, or the like, or any combination thereof.D27. The system of any one of statements D22 to D26, wherein the one or more linker reactive group(s) and the one or more coupler reactive group(s) in combination comprise a pair of reactive groups comprising amine reactive conjugations, thiol-reactive conjugations, carbonylreactive conjugations, carboxyl-reactive conjugations, biorthogonal pairs or systems, photo reactive conjugations, or any combination thereof.D28. The system of statement D27, wherein the amine reactive conjugations comprise an amine and a carboxylic acid, an amine and an activated ester, an amine and an isothiocyanate, an amine and an aldehyde or ketone, or any combination thereof.D29. The system of statement D27, wherein the thiol-reactive conjugations comprise a thiol and a maleimide, a thiol and an acylate or vinyl sulfone, a thiol and a haloacetyl, a thiol and a disulfide, or any combination thereof.D30. The system of statement D27, wherein the carbonyl-reactive conjugations comprise an aldehyde or ketone and a hydrazide, a aldehyde or ketone and an aminooxy, or any combination thereof.D31. The system of statement D27, wherein the carboxyl-reactive conjugations comprise carboxylic acid and an amine, a carboxylic acid and an alcohol, or any combination thereof. D32. The system of statement D27, wherein the biorthogonal pairs or systems comprise azide and alkyne, an azide and a strained alkyne, tetrazine and a trans-cyclooctene, a cyclopropane and a tetrazine, an aldehyde and a hydrazine or aminooxy, a thiol and a gold nanoparticle surface, a boronic acid and a diol, a haloalkane and a haloalkane dehalogenase-tag, or any combination thereof.D33. A system, comprising:a. one or more support(s) having a permeability of 2000 L·m-2·h-1·bar-1or more; andb. one or more monomer(s) and one or more crosslinker(s) dispersed within and / or on the one or more support(s) and configured to polymerize and form a hydrogel that is disposed on most or all of the one or more support(s),wherein the one or more monomer(s) and / or the one or more crosslinker(s) comprise or are configured to form, after polymerization, one or more coupler reactive group(s) that are configured to connect with one or more linker reactive group(s) of one or more biomolecule(s).D34. The system of statement D33, wherein the one or more monomer(s) comprise one or more of polyethylene glycol-acrylate monomer(s), multi-arm PEG-Acrylate, Acrylate-PEG-NHS, methyl acrylate, 2-Hydroxyethyl acrylate, 2-Carboxyethyl acrylate, 2-Hydroxy-3-phenoxypropyl acrylate. 2-(Dimethylamino)ethyl acrylate, (2-Boc-amino)ethyl methacrylate, Methacrylic acid N-hydroxysuccinimide ester, N-[Tris(hydroxymethyl)methyl]acrylamide, N-(3-Aminopropyl)methacrylamide hydrochloride, N-Hydroxyethyl acrylamide, N-Isopropylacrylamide, Glycerol 1,3-diglycerolate diacrylate, 2-Aminoethyl methacrylate hydrochloride, Glycidyl acrylate. 2-Isocyanatoethyl methacrylate, or any combination thereof. D35. The system of statements D33 or D34, wherein the one or more crosslinker(s) comprise two or more functional group(s) configured to bind two or more polymer chains together.D36. The system of any one of the previous statements D33 to D35, wherein the two or more functional group(s) comprise an acrylate, methyl acrylate, ethylene, amide, acrylamides, or any combination thereof.D37. The system of any one of the previous statements D33 to D36, wherein the one or more coupler and linker reactive group(s) are configured to connect and immobilize the one or more biomolecule(s) on the hydrogel during formation of one or more biopolymer(s).D38. The system of any one of the previous statements D33 to D37, further comprising:a. an additive configured to be incorporated within the hydrogel, wherein the additive comprises one or more of catalysts, photo-initiators, nano cellulose, carbon nanotubes, graphene, gold nanoparticles, silica particles, polymer fibers, polysaccharides, proteins, nucleic acids, or any combination thereof.D39. A method, comprising:a. contacting one or more support(s), one or more monomer(s), and one or more crosslinker(s); andb. applying conditions sufficient to polymerize the one or more monomer(s) and the one or more crosslinker(s) together such that a hydrogel is formed and becomes disposed on the one or more support(s), wherein the hydrogel has one or more coupler reactive group(s) configured to connect with one or more linker reactive group(s) of one or more biomolecule(s).D40. The method of statement D40, wherein the one or more support(s) that has the hydrogel disposed thereon has a permeability of 1000 L-m2-h ^bar1or more.D41. The method of claim 39, further comprising:a. contacting the one or more support(s) that has the hydrogel disposed thereon and the one or more biomolecule(s) comprising the one or more linker reactive group(s) to connect the hydrogel and the one or more biomolecule(s) at the one or more coupler and linker reactive group(s).D42. The method of claim 39, wherein the one or more monomer(s) and the one or more crosslinker(s) are polymerized by heat, ultraviolet light, magnetic field, surface grafting, or any combination thereof while in contact with the one or more support(s).D43. The method of claim 39, further comprising:a. contacting one or more solvent(s) with the one or more support(s) that has the hydrogel such that byproducts and the one or more crosslinker(s) and monomer(s) are removed from the one or more support(s) that has the hydrogel.D44. A method, comprising:a. contacting one or more biopolymer building components and the one or more support(s) having a hydrogel disposed thereon and connected with one or more biomolecule(s) at the hydrogel to form a product stream comprising one or more biopolymer(s).D45. The method of claim 44, wherein the one or more support(s) that has the hydrogel has a permeability of 1000 L·m-2·h-1·bar-1or more.D46. The method of claim 44, wherein the one or more biopolymer building components(s) comprises one or more of enzyme(s), building block(s), molecular chaperones, or any combination thereof.D47. The method of claim 46, wherein the one or more building block(s) comprises one or more of amino acids, ribonucleoside trisphosphates, primers, oligonucleotides, long-chain nucleic acids, or any combination thereof.D48. The method of claim 44, wherein the one or more biopolymer building components and the one or more support(s) are contacted at a temperature sufficient to form the one or more biopolymer(s) and without deforming or distorting the hydrogel.D49. The method of claim 44, wherein the one or more biopolymer building components and the one or more support(s) are contacted at a temperature of about 4°C to about 80°C.D50. The method of claim 44, wherein the one or more biopolymer building components and the one or more support(s) are contacted and moved through the one or more support(s) at a pressure sufficient to form the one or more biopolymer(s) and to move one or more biopolymer byproduct(s) out of the one or more support(s).D51. The method of claim 44, wherein the one or more biopolymer building components and the one or more support(s) are contacted at a pressure of about 50 KPa to about 200 KPa.D52. The method of claim 44, further comprising:a. before formation of the one or more biopolymer(s), contacting the one or more support(s) has the hydrogel with the one or more biomolecule(s) to connect the one or more biomolecule(s) and the hydrogel.D53. The method of claim 44, further comprising:a. separating the one or more biopolymer(s). one or more biopolymer byproduct(s), and one or more biopolymer building component(s) into one or more separate stream(s). D54. The method of claim 53, further comprising:a. recycling the one or more biopolymer building component(s) that are unreacted by moving the one or more biopolymer building component(s) from an outlet that is downstream of the one or more support(s) to an inlet that is upstream of the one or more support(s).D55. The method of claim 44, further comprising:a. monitoring and / or identifying formation of the one or more biopolymers while within the hydrogel and / or downstream of the one or more support(s).EXAMPLESExample 1

[0116] Fabricating novel hybrid materials, part 1: polymer organogel on mesh fabrics.

[0117] Typically, 42 pL of 35% acrylate-PEG3500-NHS solution in DMSO (w / v), 9 pL of polyethylene glycol) methyl ether acrylate, 3 pL of 8.9% PEGDA solution in DMSO (v / v), and 6 pL of 3% Irgacure 2959 solution in DMSO (w / v) were mixed thoroughly to prepare a precursor solution. 60 pl of precursor solution was pipetted onto three pieces of 1.0 cm x 1.0 cm polyester mesh fabrics with 2.0 mm pore, then the mesh fabrics were sandwiched by two glass slides after nitrogen gas purging, followed by UV cross-linking (365 nm, 40 min) under nitrogen protection. After UV cross-linking, the organogel coated mesh fabrics were put in 1 mL of acetone for 5 min to wash away the unreacted precursor and DMSO, then gel-coated mesh fabrics were obtained by evaporating acetone under nitrogen atmosphere (Figure 3).

[0118] Fabricating novel hybrid materials, part 2: DNA modification on mesh fabrics.

[0119] For RNA IVT, EGFP-coded DNA template was prepared by PCR with 5' amino modified primers. Plasmid pET-28a(+)-6xHis-EGFP was purchased from VectorBuilder and used as the template for PCR amplification. The amplified EGFP-coded DNA template was purified with QIAquick PCR purification kit and stored at -20 °C before use. 20 pl of EGFP-coded or RFP-coded DNA template (850 ng / pl) was used to modify one gel-coated polyester mesh fabric (1.0 cm2) by putting them in 200 pl of 0.1 M phosphate buffer (pH 8.0) at room temperature for 12 h. The DNA template modified mesh fabrics were washed with 0.1 M phosphate buffer (pH 8.0) until the nanodrop reading of the eluted solution was less than 1 ng / pL to ensure there was no free DNA in the hydrogel layer on mesh fabrics, followed by soaking the DNA template-decorated mesh fabrics in the IVT buffer before use (Figure 5 and 6).

[0120] For DNA enzymatic amplification, above-mentioned DNA template-decorated mesh fabrics were treated by either alkali or heat to denature the double- stranded DNA template, followed by washing away the unwound single- stranded DNA that is untagged to hydrogel layer on mesh fabrics. Then primers and DNA polymerase for isothermal amplification were introduced to produce single- stranded DNA.

[0121] The fabrication and operation of continuous flow device.

[0122] The DNA template-decorated mesh fabrics were clamped with 1.5 cm x 1.5 cm mesh (large pore, 3 mm in diameter) embedded PDMS. Typically, three pieces of DNA templatedecorated mesh fabrics were laminated and assembled into a continuous flow device (Figure 2). The buffered T7 was infused into the continuous flow device by a syringe pump at flow rate of 1000-3000 nL / min. The buffered T7 was cooled at 4 °C with a cooling water circulator. The continuous flow device was kept at 30 °C in an oven. The nucleic acid products were collected at outside of oven. The concentration of nucleic acid products was measured by Qubit Flex Fluorometer at predetermined time (Figure 5). The quality of nucleic acid product was analyzed with gel electrophoresis (Figure 6). The nucleic acids continuous production platform was composed of three modules (Figure 7):

[0123] 1) The gel module: the covalent conjugates of DNA with non-DNA moieties including gold nanoparticles, PEG monomers, and other small molecules, serve as new hydrogel building blocks. The physically and / or chemically cross-linking of the building blocks form DNA hydrogels.

[0124] 2) The continuous module: by combining 3D printing with fluidic designs along with associate engineering components, the continuous flow device allows for the timely collection of nucleic acids products as well as the rapid and efficient removal of undesirable by-products, such as pyrophosphate. Continuous nucleic acids production is monitored by Qubit Flex Fluorometer and gel electrophoresis.

[0125] 3) The indefinite module: by engineering a separate add-on module, the enzymes synchronizing to the continuous module are recycled and re-produced.Example 2

[0126] Figure 8 illustrates a scheme to continuously make biopolymers, such as RNA, with enzyme self regeneration and / or recycling by purification and / or separation from the RNA product.

[0127] Figure 9A illustrates the preparation of DNA hybrid hydrogel and device assembly for in-vitro nucleic acid and protein and a DNA-polymer hybrid gel preparation on mesh fabric.

[0128] Figures 9B-C illustrate the system fabricated by DNA hybrid hydrogels and schematic of in-vitro DNA amplification, RNA transcription, and protein translation in a system or device.

[0129] Figure 10A illustrates a mesh fabric.

[0130] Figure 10B illustrates a food dye stained polymer organogel-coated fabric.

[0131] Figure 10C illustrates a fluorescent image of SYBR green I-stained DHHMF.

[0132] Figure 10D illustrates the results of RNA in-vitro transcription concentration as a function of total concentration of monomers used in polymer organogel.

[0133] Figure 10E illustrates the results of the concentration of RNA compared to usage of template DNA per milligram of acrylate PEG NHS monomer.

[0134] Figure 10F illustrates the results of an Example system showing the concentration of RNA compared to the molar ratio of monomer to crosslinker.

[0135] Figure 11 illustrates use of different devices (i.e., systems) for continuously forming RFP mRNA and gel electrophoresis to analyze quality of product.

[0136] Figure 12 illustrates use of different devices (i.e., systems) for continuously forming GFP mRNA and gel electrophoresis to analyze quality of product.

[0137] Figure 13 illustrates use of different devices (i.e., systems) for continuously forming FLAP Aptamer (Mango III) and gel electrophoresis to analyze quality of product.

[0138] Figure 14 illustrates use of different devices (i.e., systems) for continuously forming siRNA and gel electrophoresis to analyze quality of product.

[0139] Figure 15 illustrates use of different devices (i.e., systems) for continuously forming Ribozyme and gel electrophoresis to analyze quality of product.

[0140] Figure 16 illustrates use of different devices (i.e., systems) for continuously forming miRNA and gel electrophoresis to analyze quality of product.

[0141] Figure 17 illustrates long term operation of a device (i.e., system) to continuously form RFP mRNA and gel electrophoresis to analyze quality of product.

[0142] Figure 18 illustrates devices (i.e., systems) configured to operate on a perpetual production platform to form ssDNA.

[0143] Figure 19 illustrates a batch based technique to form ssDNA.

[0144] Figure 20 illustrates gel electrophoresis of the quality of ssDNA of figure 18.

[0145] Figure 21 shows a design of trans-cleaving hammerhead ribozyme and split spinach FLAP and monitoring ribozyme cleavage process by gel electrophoresis.

[0146] Figure 22 illustrates FET-like three-state logic computing device and workflow where 0 is off, 1 is semi-ON, and 2 is ON for use with the design of figure 21.

[0147] Figures 23A-B illustrates signal readouts of the FET-like three state logic computing device and a truth table of the logic gate of figures 21 and 22.

[0148] Unless otherwise stated, procedures for each of the above figures 8 through 23B are described below.

[0149] 1. Materials

[0150] Plasmids pET-28a(+)-6xHis-EGFP and pUC18-T7-RFP3-3 were constructed by VectorBuilder and GenScript, respectively. 5' amino modified DNA templates with T7 promotor for short RNA IVT and primers with and without 5' amino modification were synthesized by Integrated DNA Technology.

[0151] 2. Fabrication of polymer organogel on mesh fabrics

[0152] For RNA-producing gel, typically, 30 pl of 50% acrylate-PEG3500-NHS (Sigma-Aldrich) solution in DMSO (m / v), 9 pl of polyethylene glycol) methyl ether acrylate(Mn 480, Sigma-Aldrich), 3 pl of 10% polyethylene glycol) diacrylate (Mn 575, Sigma-Aldrich) solutionin DMSO (m / v), 6 pl of 3% 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylpropiophenone (Irgacure 2959) (Sigma-Aldrich) solution in DMSO (m / v), and 12 pl of DMSO were mixed thoroughly to prepare a precursor solution. 60 pl of precursor solution was pipetted onto three pieces of 1.0 cm x 1.0 cm polyester mesh fabrics with 2.0 mm pore, then the mesh fabrics were sandwiched by two glass slides after nitrogen gas purging, followed by UV cross-linking (365 nm, 40 min) under nitrogen protection. After UV cross-linking, the organogel-coated mesh fabrics were put in 1 ml of acetone for 5 min to wash away the unreacted precursor and DMSO, then gel-coated mesh fabrics were obtained by evaporating acetone under a nitrogen atmosphere. For long-term running device, 6 pl of 10% polyethylene glycol) diacrylate solution in DMSO (m / v) was used.

[0153] For DNA-producing gel, typically, 10 pl of 50% acrylate-PEG3500-NHS solution in DMSO (m / v), 3 pl of polyethylene glycol) methyl ether acrylate, 1 pl of 10% poly(ethylene glycol) diacrylate solution in DMSO (m / v), 2 pl of 3% Irgacure 2959 solution in DMSO (m / v), and 4 pl of DMSO were mixed thoroughly to prepare a precursor solution. 10 pl of precursor solution was pipetted onto one piece of 0.28 cm2polyester mesh fabric with 2 mm pore. The remaining procedures followed the same protocol as that for the RNA-producing gel preparation.

[0154] 3. DNA modification on gel-coated polyester mesh fabrics

[0155] In the case of mRNA, EGFP-coded and RFP-coded DNA templates was prepared by PCR (OneTaq Hot Start 2X Master Mix, New England Biolabs) with 5' amino modified primers. The amplified EGFP-coded and RFP-coded DNA templates were purified with QIAquick PCR purification kit (Qiagen) and stored at -20 °C before use. Typically, 20 pl of EGFP-coded or RFP-coded DNA template (850 ng / pl) was pipetted onto the one gel-coated polyester mesh fabric (1.0 cm2), followed by immersing them in 200 pl of 0.1 M phosphate buffer (pH 8.0) at room temperature for 12 h. The DNA hybrid hydrogel-coated mesh fabrics (DHHMF) were washed with 0.1 M phosphate buffer (pH 8.0) until Nanodrop reading of the effluent was less than 1 ng / pl to ensure that there was no free DNA in the hydrogel layer on polyester mesh fabrics.

[0156] In the case of short RNA, 20 pl of 5' amino modified DNA template (50 ng / pl) was used to modify one gel-coated polyester mesh fabric (1.0 cm2) by putting them in 200 pl of 0.1 M phosphate buffer (pH 8.0) at room temperature for 12 h. The DHHMFs were washed with 0.1 M phosphate buffer (pH 8.0) until Nanodrop reading of the effluent was less than 1 ng / pl to ensure that there was no free DNA in the hydrogel layer on polyester mesh fabrics.

[0157] In the case of DNA, 7 l of RFP-coded DNA template (141 ng / pl) was used to modify one gel-coated polyester mesh fabric (0.28 cm2) by putting them in 70 pl of 0.1 M phosphate buffer (pH 8.0) at room temperature for 12 h. The DHHMFs were washed with 0.1 M phosphate buffer (pH 8.0) until Nanodrop reading of the effluent was less than 1 ng / pl to ensure that there was no free DNA in the hydrogel layer on polyester mesh fabrics.

[0158] 4. Fabrication of continuous flow device

[0159] All the components of devices were cleaned by sonication in ethanol for 15 min. For RNA production device, typically, three DHHMFs (1.0 cm2) were alternately laminated with two 1.5 cm x 1.5 cm nylon mesh separators (large pore. 3.0 mm in diameter) embedded PDMS (thickness, 3.0 mm) and then clamped by two clear acrylic sheets (6.5 cm x 6.5 cm x 3.0 mm) preconnected with Tygon ND-100-80 tubing (OD 1.8 mm, ID 1.0 mm) to assemble into a continuous flow device.

[0160] For DNA production device, typically, one DHHMF (0.28 cm2) was laminated with a PDMS spacer (thickness, 1.5 mm) with a hole of 0.40 cm2and then clamped by two clear acrylic sheets (6.5 cm x 6.5 cm x 3.0 mm) pre-connected with Tygon ND-100-80 tubing (OD 1.8 mm, ID 1.0 mm) to assemble into a continuous flow device.

[0161] 5. Construction of perpetual nucleic acid production platform

[0162] The nucleic acids continuous production platform was composed of three modules: continuous flow device, temperature-controlled chamber, syringe pump. The syringes with buffered enzymes and building blocks such as rNTP or dNTP and primers were connected to the continuous flow devices placed in a temperature-controlled chamber with. The syringe pumps were used to inject the reaction solution and products were collected with sealed tubes outside of the chamber. In control experiment, the temperature of flow-in syringe with buffered enzymes was kept at 4 °C by cooling system.

[0163] 6. Operation and parameters optimization of perpetual nucleic acid production platform

[0164] To further ensure no free DNA left in the hydrogel layer on mesh fabric, all continuous flow devices were infused by lx IVT buffer (for RNA production) or 0.12 M Tris-HCl buffer (pH8.0) (for DNA production) over 12 h before nucleic acid production. The effluent was measured with Qubit Flex Fluorometer to be less than the effective reading range. For RNA production, syringes with buffered T7 RNAP were infused into the continuous flow devices by syringe pumps at flow rate of 2000-8000 nl / min. The continuous flow devices were kept at 37 °C in a temperature-controlled chamber. RNA products were collected at outside of the chamber. The syringes with buffered T7 RNAP were replaced every 12 or 24 h with new buffered T7 RNAP and the concentrations of products were measured every 12 or 24 h. For DNA production, syringes with primers and DNA polymerase for isothermal amplification were infused into the continuous flow devices by syringe pumps at flow rate of 1000-4000 nl / min. The continuous flow devices were kept at 37 °C in a temperature-controlled chamber. DNA products were collected at outside of the chamber. The syringes with primers and DNA polymerase for isothermal amplification were replaced at 3, 6, 12, and 24 h with new isothermal amplification reaction solution and the concentrations of products were measured at 3, 6, 12, and 24 h. The operation parameters of continuous flow device were optimized by only adjusting one of the seven parameters including T7 RNAP usage, Mg2+concentration, rNTP concentration, NaCl concentration, DTT concentration, temperature, and pump rate at a time. The optimized operation parameters for RNAs were summarized in Table 1. For DNA production, the operation parameters were optimized by only adjusting one of the five parameters including primer concentration, Mg2+concentration, dNTP concentration, RPA enzymes usage, and pump rate at a time. The optimized operation conditions for DNA were summarized in Table 2. Three individual devices were assembled for each kind of nucleic acid and operated for seven days. For long-term RNA production, one device was operated for three months.

[0165] 7. Concentration measurement and gel electrophoresis analysis of nucleic acid products

[0166] The concentrations of nucleic acid products during the process of devices operation were monitored by Qubit Flex Fluorometer with corresponding assay kits at predetermined time. Three replicate measurements were made on each sample. The quality of nucleic acid product was analyzed with gel electrophoresis. 1% agarose gel with GelRed was used to run DNA samples at 90 V for 60 min. For RNA samples, 0.5 g agarose in 50 ml of lx TAE buffer was heated until dissolved, then cooled to 60 °C. 5 pl of 10,000 x SYBR Green II were added to make gel. 1 volumeunpurified RNA sample was added to 2 volumes of RNA sample loading buffer (Santa Cruz Biotechnology) and mixed well. Immediately prior to loading, sample was heated to 65 °C for 10 minutes, then chilled on ice. RNA samples were loaded on the agarose gel and run at 90 V for 60 min.

[0167] 8. Quantitation of template DNA on gel-coated polyester mesh fabrics

[0168] Given that there are specific restriction enzyme sites on RFP-coded DNA template, a restriction enzyme, Pstl-HF (New England Biolabs), was used to cut the template DNA from the DHHMF because there is only one restriction site with an appropriate cutting length on RFP-coded DNA template. The digested DNA fragments were collected, then the concentrations of the DNA fragments were measured to calculate the amounts of template DNA modified on the DHHMFs with the collected volume because one template DNA generates one digested DNA fragment.

[0169] For quantitating the amount of template DNA modified on RNA-producing DHHMF, the DHHMFs (1.0 cm2) optimized for device operation were washed with 0.1 M phosphate buffer (pH 8.0) until Nanodrop reading of the effluent was less than 1 ng / pl. To further ensure no free DNA left in the hydrogel layer, one DHHMF was soaked in 1.5 ml of lOx TE buffer (8.0) buffer over 12 h before restriction enzyme digestion. The supernatant was measured with Qubit Flex Fluorometer to be less than the effective reading range. One DHHMF was washed three times with 1 ml of 0.12 M Tris-HCl and soaked in lx digestion buffer for 5 min. Then, the DHHMF was digested in a solution (10 pl of Pstl-HF, 50 pl of lOx rCutSmart buffer, and 440 pl of nuclease-free water) at 37 °C for 30 min. After digestion, the solution was collected and the DHHMF was rinsed approximate seven times with 400 pl of 0.1 M phosphate buffer (pH 8.0) until the DNA concentration of the effluent were measured with Qubit Flex Fluorometer to be less than the effective reading range. The digestion solution and all effluents were combined and concentrated using 10 KDa centrifugal filter. The concentration of DNA in final solution was measured with Qubit Flex Fluorometer to calculate the DNA amount with solution volume. The experiment was independently repeated three times.

[0170] For quantitating the amount of template DNA modified on DNA-producing DHHMF, the DHHMFs (0.28 cm2) optimized for device operation were used to quantitate the amounts of template DNA on DHHMFs. The DHHMF was digested in a solution (2 pl of Pstl-HF, 15 pl of lOx rCutSmart buffer, and 133 pl of nuclease-free water) at 37 °C for 30 min. The remainingprocedures followed the same protocol as that for the RNA-producing DHHMF. The experiment was independently repeated three times.

[0171] 9. Protein expression from mRNA

[0172] To verify the integrity and functionality of the EGFP mRNA and RFP mRNA produced by our nucleic acid production platform, PURExpress in vitro protein synthesis kit (New England Biolabs) was used for mRNAs translation. First, the EGFP mRNA and RFP mRNA samples were concentrated with 10 KDa centrifugal filter and purified with Monarch Spin RNA Cleanup Kit (New England Biolabs). Then, 1.5 pl of RFP mRNA (432 ng / pl) and 2 pl of EGFP mRNA (292 ng / pl) were used for the protein expression with PURExpress in vitro protein synthesis kit in a total volume of 25 pl, respectively. Fluorescence images were acquired after a 4-hour expression period at 37 °C. Green fluorescence images were taken using 485 nm excitation and a 528 nm emission filter, and red fluorescence images were taken using 485 nm excitation and a 620 nm emission filter.

[0173] 10. Fluorescence measurement and imaging of Mongo III and Spinach aptamers

[0174] For Mango III aptamer, reactions were prepared by aliquoting 200 pl of lx FLAP buffer containing Mango-III RNA aptamer (-500 nM), then adding 4 pl of 1 M MgCl21 pl of 2 M NaCl, and 1 pl of 100 pM TOl-3PEG-Biotin (Molecular Biology Products) (final ligand -0.5 pM). Samples were gently mixed and incubated 15 min at room temperature, protected from light. Fluorescence was quantified in black 96-well plates on a BioTek Synergy H4 plate reader using top optics (Ex 485 nm, Em 528 nm) and 8 mm read height at ambient temperature. Representative photographs were taken in a dark room using an excitation filter (485 nm) on the light source and an emission filter (590 nm) on the camera. For Spinach aptamer, 1 pl of 20 pM DFHBI-1T (Cayman Chemical) was added to 100 pl of sample and incubated at room temperature for 10 min in black 96-well plates, protected from light. Fluorescence was measured by a BioTek Synergy H4 plate reader using 485 nm excitation and 528 nm emission and 4.5 mm read height at ambient temperature.

[0175] 11. HHR ribozyme design and cleavage assessment and optimization

[0176] A hammerhead ribozyme (HHR) comprises a conserved catalytic core and three helices (I. II, and III). Trans-cleaving HHR was designed by modifying recognition arms to precisely match the target RNA, while the catalytic core and stem-loop II were kept unchanged, enabling stable folding and optimal function at physiological conditions, such as low Mg2+concentrations. The cleavage site was ensured to follow the NUX| rule (N = any base, X G) to maximize activity and selectivity. The target arm was designed according to split Spinach aptamer to match the recognition arm.

[0177] The target arm RNA and recognition arm RNA were produced by two devices separately. Equal amount of them was mixed and incubated at 37 °C for 2 h. The cleavage was assessed by gel electrophoresis. Incubation time was adjusted for optimizing the cleavage.

[0178] 12. Computing device design, fabrication, and operation of FET-like three state logic gates

[0179] This bench-scale mixing channel system was 3D-printed on a Formlabs Form 2. The printed parts were rinsed, post-cured under UV 365 nm for 20 min, and heat treated at 80 °C overnight. For replica molding, the part was fixed to a Petri dish with double-sided tape, PDMS precursor was degassed and poured over the pattern, and cured at 80 °C for 30-60 min. The PDMS slab was trimmed to a microscope slide size, the channel surface and a glass slide were oxygenplasma treated and bonded to form enclosed channels, and inlet and outlet ports were drilled. The system comprises two plates connected via tubing. The first plate provides about 2 h of residence time. The second plate provides about 15 min of residence time and is heated to 55 °C using a resistive tape controlled by a temperature controller with a contact sensor during fluid passage.

[0180] Substrate strand, catalytic strand, and Spinach split B were produced by three devices separately. After one day running, when the concentrations of the strands reached to stable, the production devices were connected to computing device, computing device consists of two parts: cleavage module and annealing module. Substrate strand and catalytic strand were introduced into cleavage module at 37 °C for cutting the substrate strand into Spinach split A, running time was controlled by the channel length and pump rate; total running time was kept at approximate 2 h. Then the Spinach split A and 1 M KC1 were infused into annealing module at 50 °C, the runningtime was kept at 15 min. The final solution containing Spinach aptamer with two splits (A + B) was collected. 1 pl of 20 pM DFHBI-1T (Cayman Chemical) was added to 100 pl of the final solution and incubated at room temperature for 10 min in a black 96-well plate for fluorescence measurement. The input signals to the logic gate were modulated by using T-valves to alternate the infusion of RNA strands and buffers into the computing device. The pump rates of three production devices were kept at 2000 nl / min, and the pump rate of KC1 solution was kept at 600 nl / min.

[0181] DNA and RNA sequences used in this work (the sequences used here are just examples)

[0182] PCR-amplified GFP-coded template (5'^3'):

[0183] TAGAGGATCGAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGG GAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAG GAGATATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGC CGCGCGGCAGCCATATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCC ATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGA GGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCG GCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGT GCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGC CCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAG ACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAA GGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACT ACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTG AACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTA CCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACC TGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTC CTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAA GTAACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAA AGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGG GCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGA

[0184] PCR-amplified RFP-coded template (5'—3'):

[0185] GTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACC GAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGC CTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGGATCTCGATCCCGCGAAATTAAT ACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACT TTAAGAAGGAGATATACATATGCGGGGTTCTATATACATATGGTCTCTAAAGGCGAG GAAGACAACATGGCAATCATCAAAGAGTTCATGCGTTTCAAAGTGCACATGGAGGG TAGCGTCAACGGTCACGAATTTGAAATCGAAGGTGAGGGTGAAGGTCGCCCGTACG AAGGTACCCAAACCGCTAAACTGAAAGTGACGAAAGGTGGTCCGCTGCCATTCGCA TGGGATATCCTGTCTCCACAGTTCATGTACGGTTCTAAAGCGTACGTGAAACACCCG GCTGACATTCCTGACTACCTGAAACTGTCCTTCCCGGAAGGTTTCAAATGGGAACGT GTGATGAACTTCGAGGACGGTGGCGTAGTTACTGTTACCCAGGACTCTTCCCTGCAG GATGGTGAGTTTATCTACAAGGTTAAACTGCGTGGCACTAACTTTCCGTCCGACGGC CCGGTTATGCAGAAGAAGACTATGGGCTGGGAAGCATCTAGCGAACGTATGTATCC GGAAGATGGTGCTCTGAAAGGCGAAATCAAACAGCGTCTGAAACTGAAAGACGGCG GCCATTATGATGCGGAAGTTAAGACGACCTACAAAGCCAAGAAACCGGTTCAGCTG CCGGGCGCCTATAATGTAAACATCAAACTGGATATcACCTCCCACAACGAAGATTAC ACCATTGTAGAACAATATGAACGCGCGGAAGGCCGCCATAGCACCGGCGGCATGGA CGAACTGTACAAATAAGAATTCGAAGCTTGATCCGGCTGCTAACAAAGCCCGAAAG GAAGC-3

[0186] 5'-amino-modified DNA templates with T7 promotor for short RNA IVT (5'— >3'):

[0187] Mango III aptamer template:

[0188] Sense: CATTAATACGACTCACTATAGGGCTACGAAGGAAGGATTGGTATGTG GTATATTCGTAGC

[0189] Antisence: / AmMC6 / GCTACGAATATACCACATACCAATCCTTCCTTCGTAGCC CTATAGTGAGTCGTATTAATG

[0190] siRNA template:

[0191] Sense: GCTAATACGACTCACTATAGGGAAGCTGTCACTGTAGAGCTGACTC TACAGTGACAGCTTA

[0192] Antisense: / AmMC6 / TAAGCTGTCACTGTAGAGTCAGCTCTACAGTGACAGCT TCCCTATAGTGAGTCGTATTAGC

[0193] miRNA template:

[0194] Sense: CGTCAGATCACGAGCGACAGCTAATACGACTCACTATAGT GCAATG CAACTACAATGCAC

[0195] Antisense: / AmMC6 / GTGCATTGTAGTTGCATTGCACTATAGTGAGTCGTATT AGCTGTCGCTCGTGATCTGACG

[0196] HHR ribozyme catalytic strand template:

[0197] Sense: GCTAATACGACTCACTATAGGAATTCCCCGCTGATGAGTCCCAAAT AGGACGAAACGCACCGAATC

[0198] Antisense: / AmMC6 / GATTCGGTGCGTTTCGTCCTATTTGGGACTCATCAGCG GGGAATTCCTATAGTGAGTCGTATTAGC

[0199] HHR ribozyme substrate strand template:

[0200] Sense: GCTAATACGACTCACTATAGGATTCGGTGCGTCCGGGGAGAAGGAC GGGTCCAGTGCGT

[0201] Antisense: / AmMC6 / ACGCACTGGACCCGTCCTTCTCCCCGGACGCACCGAAT CCTATAGTGAGTCGTATTAGC

[0202] Spinach split B template:

[0203] Sense: GCTGACAGCTAATACGACTCACTATAGGCGCACTGTTGAGTAGAGT GTGAGCTCCCTCG

[0204] Antisense: / AmMC6 / CGAGGGAGCTCACACTCTACTCAACAGTGCGCCTATAG TGAGTCGTATTAGCTGTCAGC

[0205] RPA-amplified ssDNA (5'^3'):

[0206] CTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTT TCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGCGGGGTTCTATATACATATGGTCTCTAAAGGCGAGGAAGACAACATGGCAATCATCAAAGAGTT CATGCGTTTCAAAGTGCACATGGAGGGTAGCGTCAACGGTCACGAATTTGAAATCG AAGGTGAGGGTGAAGGTCGCCCGTACGAAGGTACCCAAACCGCTAAACTGAAAGTG ACGAAAGGTGGTCCGCTGCCATTCGCATGGGATATCCTGTCTCCACAGTTCATGTAC GGTTCTAAAGCGTACGTGAAACACCCGGCTGACATTCCTGACTACCTGAAACTGTCC TTCCCGGAAGGTTTCAAATGGGAACGTGTGATGAACTTCGAGGACGGTGGCGTAGTT ACTGTTACCCAGGACTCTTCCCTGCAGGATGGTGAGTTTATCTACAAGGTTAAACTG CGTGGCACTAACTTTCCGTCCGACGGCCCGGTTATGCAGAAGAAGACTATGGGCTGG GAAGCATCTAGCGAACGTATGTATCCGGAAGATGGTGCTCTGAAAGGCGAAATCAA ACAGCGTCTGAAACTGAAAGACGGCGGCCATTATGATGCGGAAGTTAAGACGACCT ACAAAGCCAAGAAACCGGTTCAGCTGCCGGGCGCCTATAATGTAAACATCAAACTG GATATcACCTCCCACAACGAAGATTACACCATTGTAGAACAATATGAACGCGCGGAA GGCCGCCATAGCACCGGCGGCATGGACGAACTGTACAAATAAGAATTCGAAGCTTG ATCCGGCTGCTAACAAAGCCCGAAAGGAAGC

[0207] Primers with 5' amino modification for GFP-coded template amplification (5'— >3'):

[0208] Forward primer: TAGAGGATCGAGATCTCGATCCC

[0209] Reverse primer: / AmMC6 / TCCGGATATAGTTCCTCCTTTCAG

[0210] Primers with 5' amino modification for RFP-coded template amplification (5'— >3'):

[0211] Forward primer: GTATTACCGCCTTTGAGTGAGC

[0212] Reverse primer: / AmMC6 / GCTTCCTTTCGGGCTTTGTTAG

[0213] Primers without 5' amino modification for RPA amplification (5'— >3'):

[0214] Forward primer: CTCGATCCCGCGAAATTAATACGACTCACTAT

[0215] Reverse primer: GCAGCCGGATCAAGCTTCGAATTCTTATTTGT

[0216] RNA sequences:

[0217] mRNA (EGFP):

[0218] GGGGAAUUGUGAGCGGAUAACAAUUCCCCUCUAGAAAUAAUUUUGUUU AACUUUAAGAAGGAGAUAUACCAUGGGCAGCAGCCAUCAUCAUCAUCAUCACAGCAGCGGCCUGGUGCCGCGCGGCAGCCAUAUGGUGAGCAAGGGCGAGGAGCUGUUCA CCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUU CAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAG UUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCU GACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGAC UUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCA AGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCU GGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUG GGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACA AGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGG CAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCC GUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACC CCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAU CACUCUCGGCAUGGACGAGCUGUACAAGUAACUCGAGCACCACCACCACCACCAC UGAGAUCCGGCUGCUAACAAAGCCCGAAAGGAAGCUGAGUUGGCUGCUGCCACCG CUGAGCAAUAACUAGCAUAACCCCUUGGGGCCUCUAAACGGGUCUUGAGGGGUU UUUUG

[0219] mRNA (RFP):

[0220] GGGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGUUUAACUUUAA GAAGGAGAUAUACAUAUGCGGGGUUCUAUAUACAUAUGGUCUCUAAAGGCGAGG AAGACAACAUGGCAAUCAUCAAAGAGUUCAUGCGUUUCAAAGUGCACAUGGAGG GUAGCGUCAACGGUCACGAAUUUGAAAUCGAAGGUGAGGGUGAAGGUCGCCCGU ACGAAGGUACCCAAACCGCUAAACUGAAAGUGACGAAAGGUGGUCCGCUGCCAUU CGCAUGGGAUAUCCUGUCUCCACAGUUCAUGUACGGUUCUAAAGCGUACGUGAA ACACCCGGCUGACAUUCCUGACUACCUGAAACUGUCCUUCCCGGAAGGUUUCAAA UGGGAACGUGUGAUGAACUUCGAGGACGGUGGCGUAGUUACUGUUACCCAGGAC UCUUCCCUGCAGGAUGGUGAGUUUAUCUACAAGGUUAAACUGCGUGGCACUAAC UUUCCGUCCGACGGCCCGGUUAUGCAGAAGAAGACUAUGGGCUGGGAAGCAUCU AGCGAACGUAUGUAUCCGGAAGAUGGUGCUCUGAAAGGCGAAAUCAAACAGCGU CUGAAACUGAAAGACGGCGGCCAUUAUGAUGCGGAAGUUAAGACGACCUACAAAGCCAAGAAACCGGUUCAGCUGCCGGGCGCCUAUAAUGUAAACAUCAAACUGGAUA UcACCUCCCACAACGAAGAUUACACCAUUGUAGAACAAUAUGAACGCGCGGAAGG CCGCCAUAGCACCGGCGGCAUGGACGAACUGUACAAAUAAGAAUUCGAAGCUUGA UCCGGCUGCUAACAAAGCCCGAAAGGAAGCUGAGUUGGCUGCUGCCACCGCUGAG CAAUAACUAGCAUAACCCCUUGGGGCCUCUAAACGGGUCUUGAGGGGUUUUUUG

[0221] Mango III aptamer: GGGCUACGAAGGAAGGAUUGGUAUGUGGUAUAUUCG UAGC

[0222] siRNA: GGGAAGCUGUCACUGUAGAGCUGACUCUACAGUGACAGCUUA

[0223] miRNA: GUGCAAUGCAACUACAAUGCAC

[0224] HHR ribozyme catalytic strand: GGAAUUCCCCGCUGAUGAGUCCCAAAUAGG ACGAAACGCACCGAAUC

[0225] HHR ribozyme substrate strand: GGAUUCGGUGCGUCCGGGGAGAAGGACGGG UCCAGUGCGU

[0226] Spinach split B: GGCGCACUGUUGAGUAGAGUGUGAGCUCCCUCG

[0227] Table 1. Optimized operation parameters for RNAs production

[0228] According to different type of RNA, two optimized IVT buffer were developed. Optimized IVT buffer A for mRNAs, Mango III aptamer, and siRNA production: 4 ml of ultrapure IM Tris-HCl (pH 8.0) (Thermo Fisher Scientific), 0.2 ml of IM MgCh (Thermo Fisher Scientific), 1 ml of 5M NaCl (Thermo Fisher Scientific), 12 pl of spermidine (Sigma- Aldrich), and 14.8 ml of nuclease-free water (Thermo Fisher Scientific), in total 20 ml. Optimized IVT buffer B for miRNA, HHR ribozyme, and Spinach aptamer production: 4 ml of ultrapure IM Tris-HCl (pH 8.0), 0.6 ml of IM MgCh, 0.2 ml of 5M NaCl, 31.4 pl of spermidine, and 15.2 ml of nuclease-free water, in total 20 ml.MangoIII0.16 0.33 2000 miRNA 0.6 ml 20 p.1 1.872 ml IS ill 3 ml 37 “Cml ml nl / min HHRribozyme0.16 0.5 2000 and 0.6 ml 20 pl 1.699 ml 21 pi 3 ml 37 “Cml mi ’ nl / min Spinachaptamer

[0229] T7 RNA polymerase (80U / pl), rNTP (2.5 mM for each NTP), and DTT (0.1M) (Promega), Rnase Inhibitor. Murine (40U / p 1) (Empirical Bioscience and APExBIO).

[0230] Table 2. Optimized operation parameters for DNA production

[0231] RPA 2x buffer, dNTP, enzymes (X, Y, 32, Bst), MgCh are from Lyo-ready RPA combo kits (Thermo Fisher Scientific).

Claims

CLAIMS1. A system, comprising:a. one or more support(s) having a permeability of 2000 L-m ^h '-bar1or more: andb. a hydrogel that comprises one or more coupler reactive group(s) configured to connect with one or more linker reactive group(s) of one or more biomolecule(s), wherein the hydrogel is disposed on the one or more support(s), and wherein the hydrogel has a permeability of 100 L·m⁻²·h⁻¹·bar⁻¹ or more.

2. The system of claim 1, wherein the one or more support(s) and the hydrogel in combination have a permeability of 1000 L-m ^h^-bar1or more.

3. The system of claim 1, wherein the one or more support(s) has a porosity of about 5 percent to about 95 percent, based on the total volume of the one or more support(s).

4. The system of claim 1, wherein the one or more support(s) comprise a plurality of pores having a pore size of about 100 nm to about 1 cm.

5. The system of claim 4, wherein the plurality of pores of the one or more support(s) have a D50 pore size of about 50 nm to about 1 mm.

6. The system of claim 4, wherein the plurality of pores of the one or more support(s) have a D90 pore size of about 1 pm to about 5 mm.

7. The system of claim 4, wherein the hydrogel has a porosity of about 5 percent to about 95 percent, based on the total volume of the hydrogel.

8. The system of claim 1, wherein the hydrogel comprises a plurality of pores having a pore size of about 10 nm to about 700 pm.

9. The system of claim 8, wherein the plurality of pores of the hydrogel have a D50 pore size of about 50 nm to about 1 mm.

10. The system of claim 8, wherein the plurality of pores of the hydrogel have a D90 pore size of about 50 nm to about 500 pm.

11. The system of claim 1, wherein each of the one or more supports has an individual thickness of about 100 pm to about 5 mm.

12. The system of claim 1, wherein the one or more support(s) has a total thickness of about 100 pm to about 5 m, wherein the total thickness is a sum of all of the one or more support(s) measured from an inlet to an outlet of the system.

13. The system of claim 1, wherein the hydrogel has an average coating thickness along surfaces of the one or more support(s) of about 10 nm to about 5 mm.

14. The system of claim 1, wherein the hydrogel has a crosslinking density of 0. 1 mol / L or more.

15. The system of claim 1, wherein the hydrogel has a degree of swelling of 20% or more.

16. The system of claim 1, wherein the hydrogel has a pH of about 7 to about 8.

17. The system of claim 1, wherein the hydrogel comprises:a. one or more backbone chain(s) comprised of residues of one or more monomer(s);andb. one or more crosslinker(s) that connect the one or more backbone chain(s) together, wherein either or both of the one or more crosslinker(s) or the one or more backbone chain(s) comprise the one or coupler reactive group(s).

18. The system of claim 1, further comprising:a. one or more inlet(s) configured to input one or more solvent(s), one or more buffer(s), and / or one or more biopolymer building component(s); and b. one or more outlet(s) configured to output the one or more solvent(s), one or more buffer(s), one or more biopolymer byproduct(s), one or more biopolymer building component(s) that are unreacted, and / or one or more biopolymer(s) from the system.

19. The system of claim 1, wherein the one or more support(s) comprises surfaces capable of being coated or covered by a hydrogel and forming pores between surfaces of the hydrogel.

20. The system of claim 1, wherein the one or more support(s) comprises one or more of a foam, a fiber arrangement, a particle, sponge, wood, paper, porous silica, or any combination thereof.

21. The system of claim 20, wherein the fiber arrangement comprises random fiber networks, aligned fiber arrays, woven fiber structures, knitted or braider fiber networks, hierarchical or gradient fiber structures, porous fiber architecture, or any combination thereof.

22. A system, comprising:a. one or more support(s) having a permeability of 2000 L-m2-h '-bar1or more:andb. a hydrogel that comprises one or more coupler reactive group(s), wherein the hydrogel is disposed on the one or more support(s) has a permeability of 100 L- nr2- Ir1- bar1or more; andc. one or more biomolecules comprising one or more linker reactive group(s) connected with the hydrogel at the one or more coupler reactive group(s).

23. The system of claim 22, wherein the hydrogel is disposed on essentially all of the one or more support(s) such that pores exist between surfaces of the hydrogel.

24. The system of claim 23, wherein most of the one or more biomolecules are connected with the hydrogel at the surfaces of the hydrogel that form the pores.

25. The system of claim 24, wherein the pores that exist between the surface of the hydrogel have a size of about 10 nm to about 700 pm.

26. The system of claim 22, wherein the one or more biomolecule(s) comprises one or more of an oligonucleotide, a DNA oligonucleotide, an RNA oligonucleotide, a doublestranded DNA oligonucleotide, a protein, an antigen, a protein receptor, a polysaccharide, a viral protein, or the like, or any combination thereof.

27. The system of claim 22, wherein the one or more linker reactive group(s) and the one or more coupler reactive group(s) in combination comprise a pair of reactive groups comprising amine reactive conjugations, thiol-reactive conjugations, carbonyl-reactive conjugations, carboxyl-reactive conjugations, biorthogonal pairs or systems, photo reactive conjugations, or any combination thereof.

28. The system of claim 27, wherein the amine reactive conjugations comprise an amine and a carboxylic acid, an amine and an activated ester, an amine and an isothiocyanate, an amine and an aldehyde or ketone, or any combination thereof.

29. The system of claim 27. wherein the thiol-reactive conjugations comprise a thiol and a maleimide, a thiol and an acylate or vinyl sulfone, a thiol and a haloacetyl, a thiol and a disulfide, or any combination thereof.

30. The system of claim 27. wherein the carbonyl-reactive conjugations comprise an aldehyde or ketone and a hydrazide, a aldehyde or ketone and an aminooxy, or any combination thereof.

31. The system of claim 27. wherein the carboxyl-reactive conjugations comprise carboxylic acid and an amine, a carboxylic acid and an alcohol, or any combination thereof.

32. The system of claim 27, wherein the biorthogonal pairs or systems comprise azide and alkyne, an azide and a strained alkyne, tetrazine and a trans-cyclooctene, a cyclopropane and a tetrazine, an aldehyde and a hydrazine or aminooxy, a thiol and a gold nanoparticle surface, a boronic acid and a diol, a haloalkane and a haloalkane dehalogenase-tag, or any combination thereof.

33. A system, comprising:a. one or more support(s) having a permeability of 2000 L·m-2·h-1·bar-1or more; andb. one or more monomer(s) and one or more crosslinker(s) dispersed within and / or on the one or more support(s) and configured to polymerize and form a hydrogel that is disposed on most or all of the one or more support(s),wherein the one or more monomer(s) and / or the one or more crosslinker(s) comprise or are configured to form, after polymerization, one or more coupler reactive group(s) that are configured to connect with one or more linker reactive group(s) of one or more biomolecule(s).

34. The system of claim 33, wherein the one or more monomer(s) comprise one or more of polyethylene glycol-acrylate monomer(s), multi-arm PEG- Acrylate, Acrylate-PEG-NHS, methyl acrylate, 2-Hydroxyethyl acrylate, 2-Carboxyethyl acrylate, 2-Hydroxy-3- phenoxypropyl acrylate, 2-(Dimethylamino)ethyl acrylate, (2-Boc-amino)ethyl methacrylate, Methacrylic acid N-hydroxysuccinimide ester, N- [Tris(hydroxymethyl)methyl]acrylamide, N-(3-Aminopropyl)methacrylamide hydrochloride, N-Hydroxyethyl acrylamide. N-Isopropylacrylamide, Glycerol E3- diglycerolate diacrylate, 2-Aminoethyl methacrylate hydrochloride, Glycidyl acrylate, 2- Isocyanatoethyl methacrylate, or any combination thereof.

35. The system of claim 33. wherein the one or more crosslinker(s) comprise two or more functional group(s) configured to bind two or more polymer chains together.

36. The system of claim 35. wherein the two or more functional group(s) comprise an acrylate, methyl acrylate, ethylene, amide, acrylamides, or any combination thereof.

37. The system of claim 33, wherein the one or more coupler and linker reactive group(s) are configured to connect and immobilize the one or more biomolecule(s) on the hydrogel during formation of one or more biopolymer(s).

38. The system of claim 33, further comprising:a. an additive configured to be incorporated within the hydrogel, wherein the additive comprises one or more of catalysts, photo-initiators, nano cellulose, carbon nanotubes, graphene, gold nanoparticles, silica particles, polymer fibers, polysaccharides, proteins, nucleic acids, or any combination thereof.

39. A method, comprising:a. contacting one or more support(s), one or more monomer(s), and one or more crosslinker(s); andb. applying conditions sufficient to polymerize the one or more monomer(s) and the one or more crosslinker(s) together such that a hydrogel is formed and becomes disposed on the one or more support(s), wherein the hydrogel has one or more coupler reactive group(s) configured to connect with one or more linker reactive group(s) of one or more biomolecule(s).

40. The method of claim 39, wherein the one or more support(s) that has the hydrogel disposed thereon has a permeability of 1000 L-nr2h_1bar_1or more.

41. The method of claim 39, further comprisinga. contacting the one or more support(s) that has the hydrogel disposed thereon and the one or more biomolecule(s) comprising the one or more linker reactive group(s) to connect the hydrogel and the one or more biomolecule(s) at the one or more coupler and linker reactive group(s).

42. The method of claim 39, wherein the one or more monomer(s) and the one or more crosslinker(s) are polymerized by heat, ultraviolet light, magnetic field, surface grafting, or any combination thereof while in contact with the one or more support(s).

43. The method of claim 39, further comprising:a. contacting one or more solvent(s) with the one or more support(s) that has the hydrogel such that byproducts and the one or more crosslinker(s) and monomer(s) are removed from the one or more support(s) that has the hydrogel.

44. A method, comprising:a. contacting one or more biopolymer building components and the one or more support(s) that has a hydrogel disposed thereon and connected with one or morebiomolecule(s) at the hydrogel to form a product stream comprising one or more biopolymer(s).

45. The method of claim 44, wherein the one or more support(s) that has the hydrogel has a permeability of 1000 L-m^-h^-bar1or more.

46. The method of claim 44, wherein the one or more biopolymer building components(s) comprises one or more of enzyme(s), building block(s), molecular chaperones, or any combination thereof.

47. The method of claim 46, wherein the one or more building block(s) comprises one or more of amino acids, ribonucleoside trisphosphates, primers, oligonucleotides, long-chain nucleic acids, or any combination thereof.

48. The method of claim 44, wherein the one or more biopolymer building components and the one or more support(s) are contacted at a temperature sufficient to form the one or more biopolymer(s) and without deforming or distorting the hydrogel.

49. The method of claim 44, wherein the one or more biopolymer building components and the one or more support(s) are contacted at a temperature of about 4°C to about 80°C.

50. The method of claim 44, wherein the one or more biopolymer building components and the one or more support(s) are contacted and moved through the one or more support(s) at a pressure sufficient to form the one or more biopolymer(s) and to move one or more biopolymer byproduct(s) out of the one or more support(s).

51. The method of claim 44, wherein the one or more biopolymer building components and the one or more support(s) are contacted at a pressure of about 50 KPa to about 200 KPa.

52. The method of claim 44, further comprising:a. before formation of the one or more biopolymer(s), contacting the one or more support(s) that has the hydrogel with the one or more biomolecule(s) to connect the one or more biomolecule(s) and the hydrogel.

53. The method of claim 44, further comprising:a. separating the one or more biopolymer(s), one or more biopolymer byproduct(s), and one or more biopolymer building component(s) into one or more separate stream(s).

54. The method of claim 53, further comprising:a. recycling the one or more biopolymer building component(s) that are unreacted by moving the one or more biopolymer building component(s) from an outlet that is downstream of the one or more support(s) to an inlet that is upstream of the one or more support(s).

55. The method of claim 44, further comprising:a. monitoring and / or identifying formation of the one or more biopolymers while within the hydrogel and / or downstream of the one or more support(s).