Rabies mRNA vaccine and use thereof
By designing a rabies mRNA vaccine and using liposomes to deliver mRNA encoding the G protein, the problems of high cost and complex purification of inactivated vaccines have been solved, achieving a highly efficient and convenient immune response and significant immune effect.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-07-09
AI Technical Summary
Existing inactivated rabies vaccines have high virus culture costs and complex purification processes. The inactivation process greatly reduces immunogenicity, resulting in complicated injection procedures and numerous adverse reactions.
A rabies mRNA vaccine was designed that delivers mRNA encoding a G protein into recipient cells via liposomes, where it is translated into the native active conformation of the G protein, stimulating the immune system to produce high levels of neutralizing antibodies. The production process is cell-independent, simplifying the process, reducing impurities, and improving the efficiency of the immune response.
It achieves a highly efficient and simple immune response, produces high levels of neutralizing antibodies, reduces the probability of adverse reactions, has a simple production process, and its immunization effect is significantly better than that of traditional inactivated vaccines.
Smart Images

Figure CN2025147938_09072026_PF_FP_ABST
Abstract
Description
A rabies mRNA vaccine and its application
[0001] This application claims priority to Chinese patent application 2024119991635, filed on 2024 / 12 / 31. The entire contents of the aforementioned Chinese patent application are incorporated herein by reference. Technical Field
[0002] This invention belongs to the field of biomedicine, specifically relating to a rabies mRNA vaccine and its application. Background Technology
[0003] Rabies is a zoonotic disease caused by the rabies virus (RABV). It is widely distributed, found on every continent except Antarctica. Neurotropism is a key characteristic of rabies virus infection; the virus replicates within neurons and enters nerve-distributed tissues and organs via peripheral nerves. Clinical manifestations often include specific symptoms such as aerophobia, hydrophobia, pharyngeal muscle spasms, and progressive paralysis. Once rabies infection presents with clinical symptoms, it is almost 100% fatal. There is no specific treatment. It is estimated that approximately 60,000 people die from rabies each year, the vast majority of whom are infected through dog bites. Therefore, rabies prevention, especially post-exposure prophylaxis (PEP), is crucial to avoiding the harm rabies causes to people's lives and property.
[0004] The natural host of the rabies virus is primarily bats, and it can infect almost all terrestrial mammals. Except for bats, almost all hosts will develop rabies, eventually leading to illness and death. Rabies is mainly transmitted through the saliva of infected animals. Besides cats and dogs, livestock such as pigs, cattle, sheep, and horses, as well as wild animals such as bats, raccoons, skunks, wolves, and foxes, can carry and be infected with the rabies virus, transmitting it to humans through scratches or bites. Due to the neurotropic nature of the rabies virus, it primarily proliferates in nerve cells. After entering the host through a wound, the virus first ascends along neurons to invade the spinal cord and central nervous system, damaging the central nervous system and producing clinical symptoms. It then descends through the nervous system to other non-nervous tissues, mainly affecting the acinar cells of the salivary glands, and is released into saliva through the salivary glands. It is then transmitted to the next victim through bite wounds or mucous membranes contaminated with rabies-laden saliva.
[0005] Rabies virus belongs to the genus Lyssavirus in the family Rhabdoviridae. Molecularly, it consists of an envelope and a core. The envelope is composed of a phospholipid bilayer embedded with a glycoprotein (G) and an inner matrix protein (M). The core is a nucleocapsid composed of a nucleoprotein (N), which encloses the genome, phosphorylated protein (P), and RNA-directed RNA polymerase (L). The rabies virus genome is a single-stranded RNA containing five genes encoding the aforementioned N, P, M, G, and L proteins. The G protein, embedded in the outer membrane, is the primary mediator of viral invasion of cells. Therefore, the mechanism of action of rabies vaccines mainly involves stimulating the immune system to produce antibodies against the G protein, thereby blocking rabies virus infection of cells and clearing the virus, protecting exposed individuals from rabies.
[0006] The rabies virus G protein is the only protein exposed on the viral envelope and is a key protein mediating viral infection of target cells. Therefore, current subunit vaccines or other viral vector vaccines against rabies use the G protein as the sole immunogen. Only antibodies produced by stimulating the immune system with the G protein as an antigen can effectively block rabies virus infection of cells. Other studies have also shown that antibodies against other rabies virus proteins do not have the ability to block viral infection. Furthermore, the G protein is relatively conserved; the G proteins of various vaccine strains used in current inactivated rabies vaccines have very high homology, and different vaccine strains have good cross-protective efficacy against different rabies virus strains. This means that neutralizing antibodies produced by immunization against different strains of G protein provide broad protection against rabies virus.
[0007] Currently, there are three main types of rabies vaccines: the first type is inactivated vaccines; the second type is subunit vaccines using G protein as an antigen; and the third type is viral vector vaccines, also using G protein as an antigen. Human rabies vaccines are currently all inactivated vaccines; all human and veterinary rabies vaccines marketed in China are inactivated vaccines.
[0008] Inactivated vaccines, as the oldest form of vaccine, have the best safety profile from a pathogen perspective because the virus is fully inactivated. However, residual culture medium is inevitable during the purification process, and these impurities are one of the main causes of adverse reactions to rabies vaccines. Therefore, the development and improvement of inactivated rabies vaccines mainly focus on the culture medium for the rabies virus, progressing through various methods including neural tissue (sheep and mouse brains, etc.), duck embryos, primary cells (chicken embryo primary cells), human diploid cells, and Vero cells. Improvements in virus culture media, from tissues and embryos to primary cell lines and diploid cell lines, primarily aim to reduce the complexity of the virus culture system, simplify the culture process, better eliminate other impurities that may be mixed into the inactivated vaccine, reduce unnecessary immune responses, and lower vaccine side effects. For human rabies vaccines, vaccines produced using human diploid cells can produce a faster and better immune response.
[0009] However, inactivated vaccines have two drawbacks: first, the cost of virus cultivation is high and the purification process is complex; second, the inactivation process significantly reduces immunogenicity. The inactivation process destroys the natural structure of the virus and its proteins, resulting in inactivated vaccines having the lowest proportion of antigens that can stimulate the immune system to produce effective neutralizing antibodies compared to other vaccine forms. This is also why the rabies inactivated vaccine injection procedure is complex, generally requiring 4 to 5 doses.
[0010] In view of the main shortcomings of current inactivated rabies vaccines, there is an urgent need to design and develop rabies vaccines with high immunogenicity, high levels of neutralizing antibodies, and simple injection procedures. Summary of the Invention
[0011] To address the problems of high virus culture costs, complex purification processes, and complicated injection procedures caused by the significant reduction in immunogenicity during virus inactivation in existing rabies inactivated vaccines, this invention provides a rabies mRNA vaccine and its application. The mRNA vaccine provided by this invention has several advantages over inactivated vaccines. First, the mechanism of action of the mRNA vaccine involves liposomes delivering mRNA encoding a G protein into the cytoplasm of the recipient cell, where it is translated into rabies G protein and localized on the cell membrane. This process is consistent with the expression of the G protein after rabies virus infects cells. Therefore, the G protein expressed by mRNA delivery has its native active conformation, which can better stimulate the immune system to produce neutralizing antibodies. Second, the production process of the mRNA vaccine is completely cell-independent. Compared with inactivated or subunit vaccines, the production process is more convenient, the final product contains fewer impurities, and the probability of adverse reactions caused by impurities is lower. The mRNA vaccine provided by this invention can generate higher levels of neutralizing antibodies in the subject, achieving a faster and more significant immune response compared to inactivated vaccines.
[0012] To solve the above-mentioned technical problems, the present invention provides the following technical solution:
[0013] Based on the structure of rabies virus and its molecular mechanism of cell infection, this invention designs an mRNA molecule capable of efficiently expressing the rabies virus G protein in mammalian cells, using the rabies virus G protein as an immunogen. This mRNA molecule, from the 5' end to the 3' end, comprises the following components: a 5' cap, a 5' UTR, a coding sequence for the G protein, a stop codon, a 3' UTR, and a polyadenylated nucleotide sequence. The isolated mRNA provided by this invention is prepared into cationic lipid nanoparticles, which are the main components of the rabies vaccine. Specifically:
[0014] A first aspect of the present invention provides an isolated mRNA containing a coding sequence for the G protein of rabies virus, said coding sequence being selected from any of the following:
[0015] (1) The G protein comprises the amino acid sequence shown in SEQ ID NO:1; the coding sequence comprises a nucleic acid sequence selected from any of the sequences shown in SEQ ID NO:10-14 and 17;
[0016] (2) The G protein contains an amino acid sequence as shown in SEQ ID NO:8.
[0017] In some embodiments of the present invention, (2) the coding sequence of the G protein comprises a nucleic acid sequence as shown in SEQ ID NO:15.
[0018] In some embodiments of the present invention, the mRNA further comprises one or more of a 5'-cap structure, a 5'UTR, a 3'UTR, and poly(A).
[0019] In some preferred embodiments of the present invention, the poly(A) comprises 80-120 adenosine residues, for example, 80, 85, 90, 95, 100, 105, 110 or 120 adenosine residues.
[0020] In some preferred embodiments of the present invention, the 5'UTR comprises a nucleotide sequence as shown in SEQ ID NO:31.
[0021] In some preferred embodiments of the present invention, the 3'UTR comprises a nucleotide sequence as shown in SEQ ID NO:32.
[0022] In some embodiments of the present invention, the mRNA further comprises polynucleotide modifications.
[0023] In some preferred embodiments of the present invention, the polynucleotide modification is selected from one or more of the following: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification, and 5-methylcytidine modification.
[0024] In some specific embodiments of the present invention, the polynucleotide modification is pseudouridine modification or N1-methyl-pseudouridine modification.
[0025] A second aspect of the present invention provides an isolated DNA encoding the G protein of rabies virus, wherein the DNA satisfies any one of the following:
[0026] (1) The DNA is single-stranded DNA, and the DNA is a template strand for transcribing the mRNA as described in the first aspect; or, the DNA is a coding strand that is inversely complementary to the template strand for transcribing the mRNA as described in the first aspect.
[0027] (2) The DNA is double-stranded DNA, which includes the template strand and the coding strand described in (1), wherein the template strand and the coding strand are inversely complementary.
[0028] In some embodiments of the present invention, the sequence of the coding chain includes any of the sequences shown in SEQ ID NO:21-26 or 28.
[0029] In some embodiments of the present invention, the DNA further comprises a 5'UTR and / or a 3'UTR.
[0030] In some optional embodiments of the present invention, the DNA further comprises a protein-encoding tag.
[0031] In some specific embodiments of the present invention, the protein tag is, for example, an HA tag and / or a HiBiT tag.
[0032] A third aspect of the present invention provides a G protein of rabies virus, said G protein comprising the sequence shown in SEQ ID NO:8.
[0033] A fourth aspect of the present invention provides a recombinant expression vector comprising mRNA as described in the first aspect or DNA as described in the second aspect.
[0034] In some embodiments of the present invention, the backbone vector of the recombinant expression vector is pcDNA3.1.
[0035] In some embodiments of the present invention, the promoter of the recombinant expression vector is the T7 promoter.
[0036] A fifth aspect of the present invention provides a transformant comprising mRNA as described in the first aspect, DNA as described in the second aspect, or a recombinant expression vector as described in the fourth aspect.
[0037] In some embodiments of the present invention, the host cell of the transformant is a eukaryotic cell.
[0038] In some preferred embodiments of the present invention, the host cell is selected from yeast cells or mammalian cells.
[0039] In some specific embodiments of the present invention, the mammalian cell is a 293T cell.
[0040] The sixth aspect of the present invention provides a method for preparing the G protein of rabies virus, the method comprising culturing a transformant as described in the fifth aspect under conditions suitable for the expression of the G protein.
[0041] A seventh aspect of the present invention provides a composition comprising (1) mRNA as described in the first aspect, and (2) a delivery vector.
[0042] In some embodiments of the present invention, the delivery carrier is a lipid nanoparticle.
[0043] In some preferred embodiments of the present invention, the lipid nanoparticles are composed of cationic lipids, cholesterol, phospholipids and lipid conjugates.
[0044] In some preferred embodiments of the present invention, the N / P ratio of the ionizable lipids of the lipid nanoparticles to the mRNA is (2-20):1.
[0045] In some preferred embodiments of the present invention, the N / P ratio of the ionizable lipids of the lipid nanoparticles to the mRNA is (3-15):1, for example, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1 or 15:1.
[0046] In some preferred embodiments of the present invention, the lipid nanoparticles are composed of compound 6, cholesterol, DSPC, and DMG-PEG2000, wherein the molar ratio of compound 6:cholesterol:DSPC:DMG-PEG2000 is (45-50):(38.5-40):(10-12):(1.5-4), and the structural formula of compound 6 is shown below:
[0047] In some specific embodiments of the present invention, the molar ratio of compound 6: cholesterol: DSPC: DMG-PEG2000 is 50:38.5:10:1.5.
[0048] The eighth aspect of the present invention provides a pharmaceutical composition comprising mRNA as described in the first aspect, or a composition as described in the seventh aspect, and a pharmaceutically acceptable carrier and / or excipients.
[0049] The ninth aspect of the present invention provides a vaccine comprising the mRNA described in the first aspect, a composition as described in the seventh aspect or a pharmaceutical composition as described in the eighth aspect, and an adjuvant.
[0050] The tenth aspect of the present invention provides a method for preparing a composition for alleviating, preventing and / or treating diseases caused by rabies virus, the method comprising the step of mixing an aqueous phase containing mRNA with a lipid phase containing a delivery carrier, wherein the mRNA and the delivery carrier are as defined in the composition described in the seventh aspect.
[0051] In some embodiments of the present invention, the method employs microfluidic technology.
[0052] In some preferred embodiments of the present invention, the total flow rate of microfluidic synthesis is 11-13 mL / min; and / or, the flow rate ratio of the aqueous phase to the lipid phase is 2:1-4:1.
[0053] In some specific embodiments of the present invention, the total flow rate of microfluidic synthesis is 12 mL / min; and / or, the flow rate ratio of the aqueous phase to the lipid phase is 3:1.
[0054] The eleventh aspect of the present invention provides the use of mRNA as described in the first aspect, DNA as described in the second aspect, G protein of rabies virus as described in the third aspect, recombinant expression vector as described in the fourth aspect, or transformant as described in the fifth aspect in the preparation of a medicament for alleviating, preventing, and / or treating diseases caused by rabies virus.
[0055] In some embodiments of the present invention, the disease is rabies; and / or, the drug is a vaccine.
[0056] The twelfth aspect of the present invention provides a method for alleviating, preventing and / or treating diseases caused by rabies virus, the method comprising administering to a subject in need an effective amount of mRNA as described in the first aspect, a composition as described in the seventh aspect, a pharmaceutical composition as described in the eighth aspect and / or a vaccine as described in the ninth aspect.
[0057] In some embodiments of the present invention, the method satisfies at least one of the following conditions:
[0058] (1) The disease mentioned is rabies;
[0059] (2) The mRNA, the composition, the pharmaceutical composition, or the vaccine shall be administered in two doses, with a one-week interval between the two doses; and / or,
[0060] (3) The dosage of the mRNA, the composition, the pharmaceutical composition or the vaccine is 20-150 μg / time, for example 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150 μg / time;
[0061] (4) The mRNA, the composition, the pharmaceutical composition or the vaccine is administered by subcutaneous injection.
[0062] The thirteenth aspect of the present invention provides an mRNA as described in the first aspect, a composition as described in the seventh aspect, a pharmaceutical composition as described in the eighth aspect, or a vaccine as described in the ninth aspect, for alleviating, preventing, and / or treating diseases caused by rabies virus.
[0063] In some embodiments of the present invention, the disease is rabies.
[0064] The present invention also provides a method for preparing mRNA as described in the first aspect, the method comprising the following steps:
[0065] First, the mRNA sequence excluding polyadenylated nucleotides is synthesized. Then, using this as a template and primers containing the polyadenylated nucleotide sequence, a double-stranded DNA containing the complete sequence of the target mRNA is obtained through PCR. Next, using this double-stranded DNA as a template, an in vitro transcription reaction is performed in a reaction system containing a 5' cap and converting uridine nucleotides (U) to pseudouridine (Ψ) to obtain the final complete mRNA molecule with intracellular G protein expression activity.
[0066] Intact mRNA molecules are ionized (cationic) at low pH and coated into nanoparticles by two auxiliary lipids, DSPC (distearate phosphatidylcholine) and cholesterol, as well as cationic lipid compound 6 and polyethylene glycol-modified lipid (DMG-PEG2000), yielding lipid nanoparticles containing mRNA (mRNA-LNP). These lipid nanoparticles are then dialyzed, concentrated, filtered, and stored to obtain the vaccine containing the target antigen.
[0067] The present invention also provides an exemplary immunization program for the vaccine as described in the ninth aspect: the first dose is administered as soon as possible after exposure to rabies virus, 30 μg intramuscularly; the second dose is administered one week later, 30 μg intramuscularly.
[0068] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.
[0069] The reagents and raw materials used in this invention are all commercially available.
[0070] The significant advantages of this invention are as follows: The rabies mRNA vaccine produced by this invention does not rely on cells; it is prepared through in vitro reactions. Compared to traditional inactivated or subunit vaccines, the production process is simpler and more controllable, avoiding potential biological contamination during production and reducing the probability of adverse immune reactions. The vaccine provided by this invention exhibits stronger immunogenicity than traditional inactivated vaccines, eliciting a stronger humoral immune response and providing better protection. Attached Figure Description
[0071] Figure 1 shows the sequence alignment results of the G protein of the rabies virus strain.
[0072] Figure 2 shows the alignment results of five mRNA sequences (C1-C5) obtained by codon optimization of the G protein coding sequence of CTN-1 rabies virus strain.
[0073] Figure 3 shows the protein levels of C1-C6 sequences with Pseudo-U or N1-U introduced, based on Western blotting results. NC represents an empty LNP, and the theoretical size of the G protein is 53.6 kDa.
[0074] Figure 4 shows the protein levels of mRNA sequences containing Pseudo-U or N1-U, as detected by in vitro flow cytometry. NC represents an empty vector LNP.
[0075] Figures 5A-5N show the in vitro cell flow cytometry results after introducing Pseudo-U or N1-U; they are Pseudo-U C1 (Figure 5A), Pseudo-U C2 (Figure 5B), Pseudo-U C3 (Figure 5C), Pseudo-U C4 (Figure 5D), Pseudo-U C5 (Figure 5E), Pseudo-U C6 (Figure 5F), NC (Figure 5G), N1-U C1 (Figure 5H), N1-U C2 (Figure 5I), N1-U C3 (Figure 5J), N1-U C4 (Figure 5K), N1-U C5 (Figure 5L), N1-U C6 (Figure 5M), and N1-U C7 (Figure 5N), respectively. NC represents an empty LNP.
[0076] Figures 6A-6G show the results of detecting G protein-specific binding antibody levels in mouse serum at different time points; these are the results for 1 week after the first immunization (Figure 6A), 2 weeks after the first immunization (Figure 6B), 3 weeks after the first immunization (Figure 6C), 4 weeks after the first immunization (Figure 6D), 6 weeks after the first immunization (Figure 6E), 8 weeks after the first immunization (Figure 6F), and 10 weeks after the first immunization (Figure 6G).
[0077] Figures 7A-7G show the results of detecting neutralizing antibody levels in mouse serum at different time points; these are the results for 1 week after the first immunization (Figure 7A), 2 weeks after the first immunization (Figure 7B), 3 weeks after the first immunization (Figure 7C), 4 weeks after the first immunization (Figure 7D), 6 weeks after the first immunization (Figure 7E), 8 weeks after the first immunization (Figure 7F), and 10 weeks after the first immunization (Figure 7G).
[0078] Figure 8 shows a comparison of the immunization effects of vaccines.
[0079] Figures 9A-9C show the flow cytometry results of the antigen molecular conformation; they are flow cytometry results for C2Ψ (Figure 9A), C6Ψ (Figure 9B), and NC (Figure 9C), respectively.
[0080] Figure 10 shows the fluorescence staining results of the antigen protein molecules translated and expressed after C2Ψ enters the cell. Detailed Implementation
[0081] The present invention will be described in detail below with reference to embodiments, but this does not imply any adverse limitation on the invention. The present invention has been described in detail, and specific embodiments thereof have been disclosed. It will be apparent to those skilled in the art that various changes and modifications can be made to the specific embodiments of the present invention without departing from the concept and scope of the invention.
[0082] the term
[0083] As used in this invention, the term "nucleic acid" refers to a nucleotide chain of any length and includes both DNA and RNA. The terms "nucleotide sequence," "nucleic acid," or "polynucleotide" include oligonucleotides (i.e., short polynucleotides). It also refers to synthetic and / or non-naturally occurring nucleic acid molecules (e.g., those containing nucleotide analogs or modified backbone residues or bonds). The term also refers to deoxyribonucleotides or ribonucleotide oligonucleotides in single-stranded or double-stranded form, modified nucleotides or bases, and / or their analogs, or any substrate capable of being incorporated into the chain by DNA or RNA polymerases. The term covers nucleic acids containing natural nucleotide analogs. The term also covers nucleic acid-like structures having a synthetic backbone. Unless otherwise indicated, a particular polynucleotide sequence also implicitly encompasses its conserved modified variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as explicitly indicated sequences. Specifically, degenerate codon substitution can be achieved by generating sequences in which the third position of one or more selected (or all) codons is replaced by mixed bases and / or deoxyinosine residues (see Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Molecular Cell Probes 8:91-98 (1994)).
[0084] As used in this invention, the term "polynucleotide modification" refers to the process of attaching auxiliary chemical groups or functional groups to individual nucleotide molecules in DNA and RNA. These modifications can alter the function of nucleotides, such as regulating gene expression, repairing DNA damage, and participating in biological processes like protein synthesis. For example, this invention includes replacing natural UDP (uridine diphosphate) with Pseudo-U (pseudouridine, Ψ) or replacing natural UDP with N1-methylated pseudouridine.
[0085] The term "UTR" used in this invention refers to the untranslated region, which is located at the 5' and 3' ends of mature mRNA (the 5' UTR is upstream of the translation start codon, and the 3' UTR is downstream of the translation stop codon). It does not encode proteins but has translation regulatory functions and participates in regulating mRNA stability and intracellular localization.
[0086] The term "mRNA vaccine" used in this invention refers to the third generation of vaccines, following inactivated vaccines, live attenuated vaccines, subunit vaccines, and viral vector vaccines. An mRNA vaccine involves introducing mRNA containing an antigen protein into the recipient, where it is directly translated to form the corresponding antigen protein, thereby inducing a specific immune response and achieving immunoprotection or treatment. Since mRNA vaccines utilize the viral gene sequence rather than the virus itself, they do not contain viral components and pose no risk of infection. In vitro transcribed (IVT) mRNA mimics the structure of endogenous mRNA, consisting of five parts from 5' to 3': a 5' cap, a 5' UTR, an open reading frame encoding the antigen, a 3' UTR, and a PolyA tail. mRNA vaccines typically contain modified nucleosides, such as pseudouridine, N1-methylpseudouridine, or other nucleoside analogs. The use of modified nucleosides, particularly modified uridine, prevents pattern recognition receptor recognition, ensuring that the translation process produces sufficient levels of protein.
[0087] The term "lipid nanoparticle" (LNP) used in this invention is a key technology in lipid-carrier drug delivery systems and represents a significant advancement in oligonucleotide-based therapeutics. LNP formulations consist of four types of lipids: ionizable cationic lipids, phospholipids, cholesterol or cholesterol derivatives, and polyethylene glycol (PEG)-lipids. Oligonucleotides (e.g., mRNA) encapsulated within the lipid nanoparticles are protected from enzymatic degradation during delivery and are efficiently delivered into cells, where the contents of the lipid nanoparticles (e.g., mRNA) are released and translated into therapeutic proteins. Those skilled in the art can prepare lipid nanoparticles using conventional methods of the prior art, such as using Moderna's formulations combined with microfluidic (MF) synthesis processes. The "N / P ratio" or "nitrogen-to-phosphorus ratio" refers to the molar ratio of ionizable lipid amine to oligonucleotide phosphate (N / P) in the LNP, representing the charge balance between the ionizable cationic lipid cationic tertiary amine and the oligonucleotide backbone anionic phosphate groups.
[0088] As used in this invention, the term "recombinant expression vector" can refer to any suitable recombinant expression vector capable of being used to transform or transfect one or more target genes or sequences into any suitable host cell and preferably to express said genes or sequences in the host cell. Suitable vectors include those designed for amplification and expansion or for expression or both of the above, and examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, granules or phage vectors, DNA or RNA expression vectors associated with cationic condensers, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic or prokaryotic cells, such as production cells.
[0089] As used in this invention, the term "transformer" refers to the transfection or introduction of a recombinant expression vector or nucleic acid for expression into a suitable host cell to obtain a transformant. Various techniques can be used to achieve this, such as protoplast fusion, calcium phosphate precipitation, electroporation, retroviral transduction, viral transfection, gene gun, lipid-based transfection, or other conventional techniques. In this application, the term "host cell" refers to any type of cell that may contain the nucleic acid or vector described herein. In exemplary aspects, the host cell is a eukaryotic cell, such as a plant, animal, fungus, or algae; or it may be a prokaryotic cell, such as a bacterium or protozoan.
[0090] As used in this invention, the term "pharmaceutical composition" includes suitable pharmaceutically acceptable carriers, such as pharmaceutical excipients, including buffers, as known in the art. "Pharmaceutically acceptable carriers" include any and all physiologically compatible solvents, dispersion media, isotonic agents, and absorption delay agents. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextran and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. The pharmaceutical compositions described herein can be prepared by mixing the mRNA or DNA of this application, having the desired purity, with one or more optional pharmaceutical excipients (Remington's Pharmaceutical Sciences, 16th edition, Osol, A. ed. (1980)), preferably in the form of lyophilized formulations or aqueous solutions. The pharmaceutical compositions of this application may also contain more than one active ingredient required for the specific indication being treated, preferably those having complementary activities that do not adversely affect each other. For example, it is desirable to also provide other active ingredients, such as anti-rabies virus antibodies, anti-rabies virus virucidal agents, small molecule drugs, or immunomodulators. The active ingredients are suitably combined in an amount effective for the intended use. Sustained-release formulations can be prepared, suitable examples of which include a semi-permeable matrix of a solid hydrophobic polymer containing the mRNA or DNA of this application, said matrix being a shaped article, such as a film or microcapsule.
[0091] Example 1 Experimental Method
[0092] I. In vitro transcription and mRNA transfection
[0093] 1. PCR to obtain linearized target fragment
[0094] According to the requirements of the PCR reaction, add 8.7 μL of ddH2O, 0.5 μL of template DNA (source: GenScript synthesis, template DNA is a plasmid with pCDNA3.1 as the backbone, containing T7 promoter, 5'UTR (actcttctggtccccacag actcagagagaacccgccacc, SEQ ID NO:31), target protein coding sequence, 3'UTR (gctggagcctcggtggccatgcttcttg ccccttgggcctccccccagcccctcctccttcctgcacccgtacccccgtggtctttgaataaagtctgagtgggcggca, SEQ ID NO:32), and polyadenine sequence (100 adenosine residues) to a 1.5 mL centrifuge tube, 0.4 μL of forward primer and 0.4 μL of reverse primer sequence Primer F:CTA GAGAACCCACTGCTTA (SEQ ID NO:29) and Primer, respectively. R:TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTAGATGCCGCCCACTCAGAC (SEQ ID NO:30; Source: GenScript Synthetic) and 10 μL of PrimerSTAR MAX polymerase (Source: TAKARA, Catalog No.: R450A) were mixed thoroughly.
[0095] The PCR reaction system is shown in Table 1 below.
[0096] Table 1 PCR reaction system
[0097] The final PCR reaction conditions are shown in Table 2 below:
[0098] Table 2 PCR reaction conditions
[0099] After the PCR reaction is complete, the PCR products are obtained and verified by gel electrophoresis. If the nucleic acid bands are uniform, the next step of IVT reaction can be carried out. If not, the reaction needs to be repeated.
[0100] 2. In vitro transcription (IVT)
[0101] Small-scale IVT tests were performed according to the proportions shown in Table 3 below (20 μL system):
[0102] Table 3 IVT System
[0103] After preparation, the entire reaction system was incubated in a 37°C water bath for 2 hours. After the reaction was complete, DNA template digestion was performed by adding 1 μL of DNase I (source: Vazyme, catalog number: EN401-01) (35 μL for 1 mL IVT reaction). After digestion at 37°C for 15 minutes, IVT recovery was performed. The recovery steps are as follows:
[0104] I. Add 80 μL of ddH2O to 20 μL of digestion product, and bring the volume to 100 μL.
[0105] II. Add 350 μL Solution D and 250 μL anhydrous ethanol (Source: Shanghai Testing, Catalog No.: 801769722), mix thoroughly, transfer to a nucleic acid purification column (Source: Solarbio, Catalog No.: N1012), and centrifuge at 10000×g for 1 min.
[0106] III. Add 500 μL of 70% ethanol, centrifuge at 10000g for 1 min, repeat once, and then centrifuge at 10000×g for 2 min.
[0107] IV. Add 70 μL of sodium citrate (source: Sigma, catalog number: C8532) to the purification column, incubate at room temperature for 1 min, centrifuge at 10000×g for 2 min, and collect the flow-through liquid as the target RNA.
[0108] After preparing a 1% agarose gel according to the above ratio, RNA electrophoresis was performed at 160V for 20 minutes. After electrophoresis, the gel was observed using a gel imaging system (source: Tanon, catalog number: Tanon 4600SF). If a single band was observed, the concentration could be determined. In this invention, the introduction and replacement of Pseudo-U or N1-U modified nucleotides is 100%.
[0109] 3. Cell transfection
[0110] This experiment uses
[0111] 1 μg of mRNA sample and 3 μL of lipofectamine 2000 were diluted separately in 50 μL of serum-free culture medium. The two were mixed and incubated at room temperature for 20 min. Then, the mixed sample was added to 1e6 293T cells and cultured at 37°C and 5% CO2 for 18-20 h. The cells were then collected.
[0112] II. Expression level detected by Western blot (WB)
[0113] 1. Wash the transfected cells once with 1×PBS (source: Sangon Biotech, catalog number: B548117-0500), and then add 50μL of 1× cell lysis buffer (20mM Tris-HCl (pH=7.4), 150mM NaCl, 3mM KCl2, 0.1% Triton-X) for lysis.
[0114] 2. After preparing the cell lysis buffer into immunoblotting electrophoresis samples, SDS-PAGE gel electrophoresis was performed and the samples were electrotransferred onto cellulose acetate (NC) membranes.
[0115] 3. After blocking the NC membrane with TBST buffer containing 5% skim milk powder, the protein expression level was detected after incubation with the corresponding antibody. G protein antibody (Glycoprotein Polyclonal Antibody, manufacturer: MYBIOSOURCE, catalog number: MBS1491332) was used as the primary antibody.
[0116] III. In Vitro Flow Cytometry
[0117] 1. Wash the transfected cells three times with 1×PBS, then resuspend them in 500μL of 1×PBS.
[0118] 2. Take two 100 μL portions from the single-cell suspension of each sample and add them to a 1.5 mL EP tube, and label them as the control group and the test group, respectively.
[0119] 3. Two antibodies were used in this experiment for detection: 523-11 (Source: BioLegend, 20221219A015), which recognizes rabies G protein in both pre-fusion and post-fusion conformations, with the corresponding secondary antibody being APC anti-mouse IgG1 (Source: BioLegend, 406610); and RVC20 (Source: BioLegend, Batch No.: M-202405250772), which only recognizes rabies G protein in the pre-fusion conformation, with the corresponding secondary antibody being PE anti-human Fc (Source: BioLegend, 410708).
[0120] 4. Sample Preparation: Add 50 μL of control flow cytometry buffer to the control group from step 2, and add 50 μL of flow cytometry buffer containing 523-11 and RVC20 to the experimental group. Incubate at 4°C for 1 h, then centrifuge at 500×g for 4 min at 4°C, discard the supernatant, wash three times with 150 μL 1×PBS, and resuspend in 75 μL 1×PBS. Then, add flow cytometry buffer containing APC anti-mouse IgG1 and PE anti-human Fc to both the control and experimental groups, respectively. Incubate at 4°C for 1 h, then centrifuge at 500×g for 4 min at 4°C, discard the supernatant, wash three times with 150 μL 1×PBS, and resuspend in 75 μL 1×PBS.
[0121] 5. Flow cytometry analysis was performed on a flow cytometer (Source: Cytek, Catalog No.: NL-CLC V16 B14 R8).
[0122] IV. Preparation of Lipid Nanoparticles
[0123] Preparation of cationic lipid compound 6
[0124] Step 1: Preparation of 6-1
[0125] Reaction formula:
[0126] Table 4 Material Proportions
[0127] Operation process:
[0128] 6-Bromhexanoic acid, 1,2-epoxydodecane, ferric chloride, and pyridine were added to a 250 mL reaction flask according to Table 4. After the addition was complete, the mixture was stirred at room temperature for 16 h. TLC (PE:EA = 4:1) showed that the reaction was complete (rf value of the product was 0.5). After purification by column chromatography, 6.8 g of a colorless oil was obtained.
[0129] Step 2: Preparation of 6-2
[0130] Reaction formula:
[0131] Table 5 Material Proportions
[0132] Operation process:
[0133] Add 6-1, octanoic acid, EDCI, DMAP, and dichloromethane to the reaction flask according to Table 5, and stir at room temperature for 16 h. TLC (PE:EA = 20:1) showed that the reaction was complete (product rf value 0.6). Wash the reaction solution twice with 100 mL of water, dry the organic phase with anhydrous sodium sulfate, filter, concentrate, and purify by column chromatography to obtain 6.5 g of colorless oil.
[0134] Step 3: Preparation of Compound 6
[0135] Reaction formula:
[0136] Table 6 Material Proportions
[0137] Operation process:
[0138] 6-2, ethanolamine, K2CO3, KI, and acetonitrile were added to the reaction flask according to Table 6, and the mixture was heated to 65°C and stirred for 16 h. TLC (DCM:MeOH = 10:1) showed that the reaction was complete (product rf value 0.5). The reaction solution was filtered, concentrated, and purified by column chromatography to obtain 2.8 g of colorless oil.
[0139] 1 H NMR(600MHz,Chloroform-d)δ5.10–5.05(m,2H),4.22(dd,J=11.8,3.3Hz,2H),4.01(dd,J=11.8,6.8Hz,2H),3.61(d,J= 5.1Hz,2H),2.73–2.49(m,6H),2.30(td,J=7.5,5.1Hz,8H),1.65–1.50(m,16H),1.33–1.23(m,52H),0.91–0.85(m,12H).
[0140] MS(ES+)m / z): 910.7(M+H) + .
[0141] The selected target sequence mRNAs were ionized (cationic) at low pH and coated into nanoparticles with two auxiliary lipids: DSPC (distearylphosphatidylcholine, catalog number: B90536, manufacturer: Nippon Seika Co., Ltd.) and cholesterol (catalog number: C00373, manufacturer: Nippon Seika Co., Ltd.), as well as cationic lipid compound 6, polyethylene glycol-modified lipid (DMG-PEG2000, catalog number: M-DMG-2000, purchased from: JenKem). An aqueous solution of the mRNA was prepared by mixing the mRNA dissolved in ultrapure water with 100 mM (millimoles per liter, or mmol / L) citrate buffer at pH 4.0 at a 1:1 volume ratio. The ratios of the four lipid components (molar ratio, e.g., cationic lipid:cholesterol:DSPC:DMG-PEG2000 = 50:38.5:10:1.5) were adjusted and dissolved in 99.5% ethanol to form a lipid solution. mRNA and lipid solutions were mixed in a NanoAssemblr microfluidic mixing system (manufacturer: Precision Nanosystems) at a volume ratio of H₂O:EtOH = 3:1 and a constant total flow rate of 12 mL / min. Lipid nanoparticles were prepared according to a nitrogen-to-phosphorus ratio of ionizable lipids to mRNA of (3–15):1; in this example, a nitrogen-to-phosphorus ratio of 6:1 was used. Lipid nanoparticles containing mRNA (mRNA-LNP) were obtained. After dialysis, concentration, and filtration, the lipid nanoparticles were stored to obtain the vaccine containing the target antigen.
[0142] V. Animal vaccination and serum collection
[0143] BALB / c mice: For mouse vaccination, 5- to 7-week-old female BALB / c mice (purchased from: Spifor (Suzhou) Biotechnology Co., Ltd.) were intramuscularly immunized with a vaccine containing the target antigen (hereinafter referred to as "immunization"), twice, 3 weeks apart. The dosage for each administration is shown in the table above. Using a sterile insulin syringe of appropriate specifications, 400 μL of the test sample was accurately drawn (the test sample was slowly inverted 5-10 times before drawing to mix it), and 100 μL was injected intramuscularly into the right hind limb of the animal. Serum from the immunized mice was collected at different time points according to the immunization schedule and inactivated at 56°C for 0.5 hours to detect rabies G protein-specific binding antibodies and neutralizing antibodies.
[0144] VI. Combining antibody level detection
[0145] 1. Antigen Coating: Dilute rabies virus G protein antigen (source: ACRO, RAG-V55H5) to 1 ng / μL, and add 100 μL to a 96-well ELISA plate (source: Nest, catalog number: 514201). Incubate overnight at 4°C in the dark. Block the plate for 2 hours at room temperature with 1×PBST solution containing 3% bovine serum albumin.
[0146] 2. Sample dilution: The immunized mouse serum was diluted 500 times as the initial concentration, and then serially diluted 2 times in PBS buffer, for a total of 10 dilutions.
[0147] 3. Detection: Transfer the diluted sample to a coated plate washed with 1×PBST and incubate at 37°C for 1 hour. After washing the plate with PBST, incubate the plate with goat anti-mouse IgG HRP (source: Bio-Tech, C030205) at 37°C for 1 hour. After washing the plate with PBST, develop the color using tetramethylbenzidine (TMB) solution (source: Invitrogen, catalog number: 00-4201-56), terminate the color development reaction with 1M sulfuric acid, and measure the absorbance at 450 nm using a microplate reader (Synergy H1, purchased from BioTek).
[0148] VII. Neutralizing Antibody Level Detection
[0149] Serum samples collected from immunized animals were serially diluted with cell culture medium. The diluted serum was mixed with a pseudovirus suspension at a 1:1 ratio in 96-well plates. 293T cells were then added to the serum-pseudovirus mixture in the 96-well plates, and the plates were incubated at 37°C in an incubator containing 5% CO2 (i.e., the incubator contains 5% CO2 and 9% air). After 48 hours, the cells were lysed, and luciferase substrate was added to detect luciferin luminescence levels. Luciferin luminescence levels represent the degree of pseudovirus infection of target cells. NT50 is defined as the dilution factor, indicating an inhibition of pseudovirus infection of more than 50% compared to the control group.
[0150] VIII. Fluorescent staining detection of antigen proteins
[0151] 1. Wash the transfected cells three times with 1×PBS, then add 4% paraformaldehyde solution and fix at room temperature for 5 minutes.
[0152] 2. After washing the fixed cells three times with 1×PBS, block them with 1×PBS containing 1% goat serum at room temperature for 1 hour.
[0153] 3. Two antibodies were used in this experiment for detection: 523-11 (source: Apexbio, 20221219A015), which recognizes rabies G protein in both pre-fusion and post-fusion conformations, with the corresponding secondary antibody being FITC Goat Anti-Mouse IgG (source: Apexbio, K1201); and RVC20 (source: Apexbio, batch number: M-202405250772), which only recognizes rabies G protein in the pre-fusion conformation, with the corresponding secondary antibody being Cy3 Goat Anti-Human IgG (source: Apexbio, K1208).
[0154] 4. Sample Preparation: Add 50 μL of PBS buffer (containing 1% BSA) containing 523-11 and RVC20 to the cells from step 2, incubate at room temperature for 1 h, and wash three times with 1×PBS. Then add staining buffer containing FITC Goat Anti-Mouse IgG and Cy3 Goat Anti-Human IgG to the cells, incubate at room temperature for 1 h, and wash three times with 1×PBS. Add DAPI to stain the cell nuclei, wash three times with 1×PBS, and observe and photograph using a fluorescence microscope.
[0155] Example 2 Selection of vaccine antigen
[0156] Based on the distribution of rabies virus in China, the G protein of the most widely distributed CTN-1 strain was selected as the target antigen. The amino acid sequence of the protein is as follows:
[0157] >ACR39382.1 glycoprotein[Lyssavirus rabies]
[0158] Currently, the strains used in inactivated rabies vaccines mainly include aG, Flury, PM, CVS, PV, and SAD. The G protein of CTN-1 strain (amino acid sequence as shown in SEQ ID NO:1) shares over 99% homology with the G proteins of other vaccine strains listed (amino acid sequences as shown in SEQ ID NO:2-SEQ ID NO:7), with over 80% of the amino acid sequences being completely identical. The G protein sequences of each strain are shown in Table 7, and the sequence alignment is shown in Figure 1.
[0159] Therefore, it can be inferred that vaccines using CTN-1 strain G protein as an immunogen should have good broad-spectrum protective efficacy against different rabies virus strains.
[0160] Table 7 G protein sequence
[0161] Example 3: Screening of candidate antigen sequences
[0162] For mRNA vaccines, once the target antigen of the vaccine is determined, the next step is to design the coding sequence of the mRNA based on the protein sequence of the antigen, so as to ensure that the designed mRNA molecule can efficiently express the target antigen protein in vivo. Five mRNA sequences (C1-C5) were designed based on the codon bias of mammals and humans to target the G protein sequence of CTN-1 rabies virus. These five sequences encode the same target protein sequence, with a GC content of 56% and a nucleotide sequence similarity of over 85% (sequence C1, C2 similarity 87.1501%; sequence C1, C3 similarity 85.8779%; sequence C1, C4 similarity 88.2952%; sequence C1, C5 similarity 86.4504%; sequence C2, C3 similarity 85.4326%; sequence C2, C4 similarity 86.9593%; sequence C2, C5 similarity 85.5598%; sequence C3, C4 similarity 88.3588%; sequence C3, C5 similarity 85.5598%; sequence C4, C5 similarity 85.687%, CLUSTALW). The sequence alignment is shown in Figure 2.
[0163] Rabies virus G proteins exist in two natural conformations: pre-fusion and post-fusion. Before invading target cells, the rabies virus G protein is in the pre-fusion conformation. During the G protein-mediated viral invasion of target cells, the conformation changes to the post-fusion conformation. Only the pre-fusion conformation of the G protein can stimulate the immune system to produce protective neutralizing antibodies; the post-fusion conformation cannot. It is generally believed that the pre-fusion conformation is less stable than the post-fusion conformation; that is, the pre-fusion conformation can spontaneously transform into the post-fusion conformation, while the post-fusion conformation generally cannot transform back into the pre-fusion conformation. Therefore, in the design of traditional subunit vaccines, certain amino acid sites of the natural antigen molecule are usually altered to stabilize the antigen protein in the pre-fusion conformation, thereby improving the vaccine's protective efficacy. Specifically, for the rabies virus G protein, changing amino acid position 270 from histidine to proline (H270P) can block the transformation of the G protein from the pre-fusion to the post-fusion conformation. Therefore, C6 was designed based on C1. Compared with C1, only the amino acid at position 270 of the mature G protein (the N-terminal signal peptide was cleaved during protein maturation, actually encoding position 289 in the CDS) was changed from histidine to proline (H270P, a866c). Previous analysis showed high amino acid sequence homology among the G proteins of various major rabies virus strains. However, there is a lack of commercially available detection antibodies targeting the CTN-1 strain G protein. To ensure that the antigen protein designed based on the CTN-1 strain G protein can be effectively detected, C7 was also designed. Two protein detection tags, HA and HiBiT, were added to the C-terminus of the CTN-1 strain G protein, with sequences YPYDVPDYA (SEQ ID NO:18) and VSGWRLFKKISA (SEQ ID NO:19), respectively. The two tags are linked by a linker (GSSG; SEQ ID NO:20).
[0164] The sequences of C1-C7 are shown in Table 11. The designed mRNAs were prepared by IVT under conditions where pseudo-U or N1-U replaced natural uridine monophosphate (U) (replacement rate 100%). The protein expression levels of each mRNA were detected by Western blotting (WB) and flow cytometry.
[0165] The flow cytometry results are shown in Table 8, Figure 4, and Figures 5A-5N. All mRNAs can be expressed as proteins. Table 8 shows the flow cytometry results (area under the curve of the positive region on the right only), and the relative expression levels were obtained based on the flow cytometry results (Figures 5A-5N) (Table 9) and plotted as a bar chart (Figure 4).
[0166] Table 8 Results of cell flow cytometry expression detection
[0167] Table 9 Relative Expression Levels
[0168] NC relative expression level: 0.0117.
[0169] The results of Western blot (WB) (Figure 3) and flow cytometry expression assays were consistent, showing that all mRNAs were expressed as proteins. The C2 sequence, transcribed in vitro with pseudo-U replacing the natural UTP, exhibited the highest expression level. Although the expression level of sequence C6 was slightly lower than that of C2, C6 contains an H270P mutation in the amino acid design of the antigen. Subsequent experiments will mainly focus on comparing the vaccine preparation of sequences C2 and C6 under pseudo-U conditions (C2Ψ and C6Ψ).
[0170] Example 4: Immunization of BALB / c mice
[0171] BALB / c mice: For mouse vaccination, cationic lipid mRNA vaccines corresponding to C2Ψ and C6Ψ were prepared. Female BALB / c mice aged 5 to 7 weeks (purchased from: Spifor (Suzhou) Biotechnology Co., Ltd.) were intramuscularly immunized (hereinafter referred to as "immunization"). The number of BALB / c mice in each group was 6 (n=6). A commercially available inactivated rabies virus vaccine (lyophilized human rabies vaccine (Vero cells, Liaoning Chengda)) was selected as a control. The immunization methods are shown in Table 10 below.
[0172] Table 10. Immunization Schedule for BALB / c Mice
[0173] Using a sterile insulin syringe of appropriate specifications, accurately draw 400 μL of the test sample (invert the sample slowly 5-10 times before drawing to mix it), and inject 100 μL into the right hind limb of the animal via intramuscular injection.
[0174] Serum from the immunized mice was collected at different planned time points and inactivated at 56°C for 0.5 hours to detect rabies virus G protein-specific IgG and neutralizing antibodies. The results are shown in Figures 6A-6G and 7A-7G.
[0175] The results showed that the vaccine prepared by C2Ψ had the best immunization effect when administered twice with a 5μg dose at 7-day intervals.
[0176] Firstly, both C2Ψ and C6Ψ vaccines showed good dose-response effects. At the same time, compared with inactivated vaccines of the same immunization schedule (0 and 7 days), both mRNA vaccines showed significant advantages, with faster and stronger immune responses.
[0177] Compared to the standard 5-dose inactivated vaccine regimen (0, 3, 7, 21, 28 days), both mRNA vaccines showed a stronger immune response starting 14 days after the first immunization (Figure 8). Although the inactivated vaccine showed some increase in binding and neutralizing antibodies after injections on days 21 and 28, the levels remained lower than those of the mRNA vaccine. Furthermore, the neutralizing antibody levels of the 5-dose inactivated vaccine began to decline as early as the eighth week after the first immunization, and the persistence of the immune response was also lower than that of the mRNA vaccine.
[0178] Comparing the immunization effects of vaccines C2Ψ and C6Ψ, both mRNA vaccine sequences reached peak levels of binding and neutralizing antibodies at week 6 after the first immunization, and the levels were comparable. However, at week 2 after the first immunization, the binding and neutralizing antibodies produced by vaccine C2Ψ were significantly higher than those produced by vaccine C6Ψ.
[0179] Example 5: Antigen molecule study of vaccine C2Ψ and C6Ψ
[0180] After transfecting 293T cells with RNA molecules C2Ψ and C6Ψ, the antigen protein molecules translated and expressed after the mRNA entered the cells were detected by cell flow cytometry. The results are shown in Figures 9A-9C.
[0181] In the results, the horizontal axis represents the detection signal of antibody 523-11, which represents the total G protein expression level, and the vertical axis represents the detection signal of antibody RVC20, which represents the G protein expression level in the pre-fusion conformation. The results show that the antigen molecule containing the H270P mutation does not significantly increase the proportion of the pre-fusion conformation of wild-type CTN-1 G protein, which is consistent with the inferior immunogenicity of vaccine C6Ψ compared to vaccine C2Ψ.
[0182] After transfecting 293T cells with RNA molecule C2Ψ, the antigen protein molecules translated and expressed after C2Ψ entered the cells were further detected by fluorescent staining. The results are shown in Figure 10.
[0183] The results showed that after transfection of 293T cells with RNA molecules C2Ψ, they were able to be correctly located on the cell membrane surface, and most of the antigen molecules were in the pre-fusion conformation. This result is consistent with the previous flow cytometry results.
[0184] Table 11 Experimental group sequence
[0185] While specific embodiments of the present invention have been described above, those skilled in the art should understand that these are merely illustrative examples, and various changes or modifications can be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.
Claims
1. An isolated mRNA, said mRNA containing the coding sequence of the G protein of rabies virus, characterized in that, The encoded sequence is selected from any of the following: (1) The G protein comprises the amino acid sequence shown in SEQ ID NO:1, and the coding sequence comprises a nucleic acid sequence selected from any of the sequences shown in SEQ ID NO:10-14 and 17; (2) The G protein contains an amino acid sequence as shown in SEQ ID NO:
8.
2. The mRNA as described in claim 1, characterized in that, In (2), the coding sequence of the G protein comprises the nucleic acid sequence shown in SEQ ID NO:15; and / or, The mRNA further comprises one or more of a 5'-cap structure, a 5'UTR, a 3'UTR, and poly(A); and / or, The mRNA also contains polynucleotide modifications; Preferably, the mRNA also satisfies at least one of the following conditions: (i) The poly(A) contains 80-120 adenosine residues; (ii) The 5'UTR contains a nucleotide sequence as shown in SEQ ID NO:31; (iii) The 3'UTR contains a nucleotide sequence as shown in SEQ ID NO:32; (iv) The polynucleotide modification is selected from one or more of the following: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification and 5-methylcytidine modification; the polynucleotide modification is preferably pseudouridine modification or N1-methyl-pseudouridine modification.
3. An isolated DNA, said DNA encoding the G protein of rabies virus, characterized in that, The DNA satisfies any of the following: (1) The DNA is a single-stranded DNA, which is the template strand for transcription to obtain the mRNA as described in claim 1 or 2; or, the DNA is a coding strand that is inversely complementary to the template strand for transcription to obtain the mRNA as described in claim 1 or 2. (2) The DNA is double-stranded DNA, which includes the template strand and the coding strand described in (1), wherein the template strand and the coding strand are inversely complementary; Optionally, the DNA may further contain a protein tag; the protein tag may be, for example, an HA tag and / or a HiBiT tag.
4. A G protein of rabies virus, characterized in that, The G protein contains the sequence shown in SEQ ID NO:
8.
5. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the mRNA as described in claim 1 or 2 or the DNA as described in claim 3; Preferably, the backbone vector of the recombinant expression vector is pcDNA3.1; and / or, the promoter of the recombinant expression vector is the T7 promoter.
6. A transformant, characterized in that, The transformant comprises the mRNA as described in claim 1 or 2, the DNA as described in claim 3, or the recombinant expression vector as described in claim 5; Preferably, the host cell of the transformant is a eukaryotic cell; More preferably, the host cell is selected from yeast cells or mammalian cells, such as 293T cells.
7. A method for preparing the G protein of rabies virus, characterized in that, The method includes the step of culturing the transformant as described in claim 6 under conditions suitable for the expression of the G protein.
8. A composition, characterized in that, The composition comprises (1) the mRNA as described in claim 1 or 2, and (2) a delivery vector; Preferably, the delivery carrier is a lipid nanoparticle; More preferably, the lipid nanoparticles are composed of cationic lipids, cholesterol, phospholipids, and lipid conjugates; and / or, The N / P ratio of the ionizable lipids in the lipid nanoparticles to the mRNA is (2-20):1, preferably (3-15):
1.
9. The composition according to claim 8, characterized in that, The lipid nanoparticles are composed of compound 6, cholesterol, DSPC, and DMG-PEG2000, with a molar ratio of compound 6:cholesterol:DSPC:DMG-PEG2000 of (45-50):(38.5-40):(10-12):(1.5-4). The structural formula of compound 6 is shown below:
10. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the mRNA as described in claim 1 or 2, or the composition as described in claim 8 or 9, and a pharmaceutically acceptable carrier and / or excipient.
11. A vaccine, characterized in that, The vaccine comprises the mRNA as described in claim 1 or 2, the composition as described in claim 8 or 9, or the pharmaceutical composition as described in claim 10, and an adjuvant.
12. A method for preparing a composition for alleviating, preventing, and / or treating diseases caused by rabies virus, characterized in that, The method includes the step of mixing an aqueous phase containing mRNA with a lipid phase containing a delivery vector, wherein the mRNA and the delivery vector are as defined in the composition of claim 8 or 9; Preferably, the method employs microfluidic technology; More preferably, the total flow rate of the microfluidic synthesis is 11-13 mL / min, preferably 12 mL / min; and / or, the flow rate ratio of the aqueous phase to the lipid phase is 2:1-4:1, preferably 3:
1.
13. The use of the mRNA as described in claim 1 or 2, the DNA as described in claim 3, the G protein of rabies virus as described in claim 4, the recombinant expression vector as described in claim 5, or the transformant as described in claim 6 in the preparation of a medicament for alleviating, preventing, and / or treating diseases caused by rabies virus; Preferably, the disease is rabies; and / or, the drug is a vaccine.
14. A method for alleviating, preventing, and / or treating diseases caused by rabies virus, characterized in that, The method includes administering to a subject in need an effective amount of one or more of the following: the mRNA as described in claim 1 or 2, the composition as described in claim 8 or 9, the pharmaceutical composition as described in claim 10, and the vaccine as described in claim 11; Preferably, the disease is rabies.
15. The mRNA of claim 1 or 2, the composition of claim 8 or 9, the pharmaceutical composition of claim 10, or the vaccine of claim 11, for the purpose of alleviating, preventing, and / or treating diseases caused by rabies virus; Preferably, the disease is rabies.