Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

32 results about "Chinese han population" patented technology

Han Nationality. As the largest ethnic group in both China and world wide, Han nationality has a population of about 1.16 billion accounting for 19% of the world's total population.

Chinese population linkage analysis single nucleotide polymorphism (SNP) marker sets and use method and application thereof

The invention relates to Chinese population linkage analysis single nucleotide polymorphism (SNP) marker sets and a use method and application thereof. On the basis of hundreds of millions of Chinese Han population data results in the mass data of the International HapMap Project, medium-density and high-density SNP marker sets for linkage analysis are constructed and optimized, according to the statistical comparisons of multiple parameters such as the linkage disequilibrium, the polymorphism level, the typing success rate, the distribution position and density of genomes and the functional characteristic, and the multi-level selections and experimental verifications. The two marker sets separately contain 3000 and 6001 loci, wherein the 6001 loci contain the 3000 loci. The SNP sets aim at the Han genetic background in design, have high polymorphism in Chinese and can realize the aim of efficiently marking the Chinese family sample genomes. The selection of polymorphic loci is based on the neutral evolution principle, and all the loci are in a non-gene function region, thus the influence of evolution on the gene function can be avoided. Meanwhile, the characteristics that the marking loci have high typing detectability and can uniformly cover the whole genomes can ensure that the whole genomes can be screened completely and new pathogenic genes can be located and found. The two sets of SNP markers are used to customize probes or chips and perform whole-genome genotyping to family samples; and the typing data are used for linkage analysis, and the haplotyping and fine locating of the linkage candidate region are also adopted, thus the use method has more accurate locating result than the traditional method while the cost is lower and the speed is higher. The distribution and coverage of the 6001 SNP marker set in human chromosomes are shown in the appended drawings.
Owner:BEIJING INST OF GENOMICS CHINESE ACAD OF SCI CHINA NAT CENT FOR BIOINFORMATION +1

Comprehensive genetic analysis method of susceptibility of complex diseases

The invention relates to a comprehensive genetic analysis method of susceptibility of complex diseases, which comprises the following steps: 1) establishing related genetic databases of complex diseases and determining related detection sites; 2) carrying out genotyping for SNPs sites within individual whole genome by using the Affymetrix6.0 chip technology to obtain the corresponding genotype of each SNP site; 3) exporting determined disease-related SNP site typing results from 900,000 SNP site detection results of a 6.0 chip, and calculating a CGR value according to the genotyping results; and 4) carrying out particular and deep genetic analysis for increased-risk diseases and high-risk diseases according to the calculated disease-related CGR value. The invention can improve the certainty of the susceptibility predication of complex diseases of Chinese Han population, shortens genetic analysis time and prevents calculation errors caused by manual calculation.
Owner:孟涛 +1

Fluorescence labeling composite amplification detection system with 18 loci

The invention relates to a five-color fluorescence-labeling composite amplification system simultaneously analyzing 18 loci of human genomic DNA. The system divides the 18 loci into four groups, and relates to fluorescence labels in five colors in all. The fluorescence-labeling composite amplification system has the advantages of high sensitivity and capability of detecting the whole 18 loci under the condition that DNA template quantity is 0.2 ng. In Chinese Han population, the overall random matching probability is 8.8*10<-21>, and the cumulative non-parentage exclusion rate is 0.999999999993.
Owner:AGCU SCIENTECH

SCML4 gene sequence and expression change detection and application of SCML4 gene sequence in coronary heart disease prediction

The invention relates to the technical field of biology. On the one hand, the invention relates to a single nucleotide polymorphism (SNP) site of a coronary heart disease susceptibility gene SCML4, and a corresponding composition and a kit for detecting the SNP site, and particularly relates to an application of a nucleic acid affinity ligand of the SNP site in preparation of the composition for detecting, screening or predicting the coronary heart disease susceptibility of Chinese han population; and on the other hand, the invention relates to a corresponding composition and kit for detecting the SCML4 gene, and further relates to an application of the nucleic acid affinity ligand of the SCML4 gene in preparation of the composition for detecting, screening or predicting the coronary heart disease susceptibility of Chinese han population. A new further scientific basis is provided for research and development of specific coronary heart disease treatment; and a new clue is provided for discovery of a new molecular mechanism of the coronary heart disease, development of new drug targets and individual-based treatment of the coronary heart disease.
Owner:田小利 +1

Detection agent for ABO blood type gene and shaping method

The invention discloses a detection reagent and a typing method for the simultaneous genotyping of antigens of ABO blood group and specific A2, comprising four primers, two of which are sequential specific primers and the other two of which are inner comparison primers. The method can carry out simultaneous amplification to the blood group genes of the antigens of the ABO blood group and the specific A2 subtypes, which are very common among the Chinese population. The method can detect four alleles, A101, A102, B101 and O01, and six A2 alleles, A201, A202, A202, A204, A205 and A206, which are very common among the Chinese population. Compared with the traditional detection methods, the detection method of the invention is fast, simple, practical, specific and sensitive, is suitable for the genetic identification of ABO blood groups of Chinese Han population and can be used in the research of the ABO blood group of human beings.
Owner:SHENZHEN BLOOD CENT

Kit for detecting susceptibility risk sites of ankylosing spondylitis

The invention discloses a kit for detecting susceptibility risk sites of ankylosing spondylitis, belonging to the fields of molecular biology and medical science. The kit is used for detecting the following locus genotypes: rs6600247, rs10865331, rs10510607, rs12504282, rs11742270, rs30187, rs10045403, rs10050860, rs639575, rs8006884, rs2297518, rs9901869, rs8070463 and / or rs2836883. The kit has the beneficial effect that the kit is used for detecting the combination of a plurality of specific susceptibility sites of the Chinese Han population, so that the treatment is assisted.
Owner:古洁若

Method for detecting smoking addiction of Chinese Han population by single nucleotide polymorphism

The invention discloses a method for detecting smoking addiction of the Chinese Han population by single nucleotide polymorphism, and the method comprises the following steps: 1, determining 18 susceptibility genes and 203 single nucleotide polymorphism sites related to smoking addiction, and customizing a Taqman OpenArray chip for genotyping; 2, extracting DNA and RNA from a blood sample; 3, carrying out preliminary screening on specific smoking addiction susceptibility sites in the Chinese Han population; 4, based on the results of genotyping, genome methylation sequencing and transcriptomesequencing, finding out a single nucleotide polymorphism site with a potential biological function. The invention relates to the technical field of biogenetic medicine. According to the invention, themethod can provide basis and guidance accurately and effectively for judging the smoking addiction susceptibility of the Chinese Han population, so that high-risk individuals are prevented from directly or excessively contacting tobacco products, and the purpose of accurate prevention is achieved.
Owner:刘强 +1

Kit for detecting VKH (Vogt Koyanagi Harada) syndrome

The invention relates to a kit for detecting VKH (Vogt Koyanagi Harada) syndrome. The kit contains primer pairs of a reagent used for amplifying gene segments at loci of rs78377598, rs77258390, rs78597810, rs12568393, rs12561798, rs76436269, rs3021304, rs442309 and rs224058 and a Sequenom MassARRAY single-base extension primer for specifically detecting idiotypes. The kit is used for predicating the genetic predisposition of a subject for the VKH syndrome by detecting whether the SNP (single nucleotide polymorphism) loci of the subject are varied, and can be used for early screening for the occurrence of the VKH syndrome of Chinese Han population and providing a basis for clinical diagnosis and treatment.
Owner:THE FIRST AFFILIATED HOSPITAL OF CHONGQING MEDICAL UNIVERSITY

LRSAM1 gene SNP mutation site genotyping primer and application thereof in predication of coronary heart disease

The invention belongs to the technical field of biology, and particularly relates to an LRSAM1 gene SNP mutation site genotyping primer and application thereof in predication of coronary heart disease, comprising the following steps: (1) a primer for amplifying the rs3802358 site: an upstream primer sequence 5'ATCCTGAAATGTAAGCAAATGACTGT3'; a downstream primer sequence 5'GCCAGGATCCAGCCAGGTA3'; (2)a probe for performing mutation sit genotyping: a G type probe sequence 5'CCACACATACGGCTG3'; an A type probe sequence 5'CCACACATATGGCTG3'. The invention discloses a new LRSAM1 gene which can explain the hereditary basis of coronary heart disease of Chinese Han population and is related to susceptibility of coronary heart disease, and meanwhile confirms an SNP site rs3802358 closely related to susceptibility of coronary heart disease on the LRSAM1 gene,and is high in test precision and sensitivity.
Owner:南京金域医学检验所有限公司

THSD7A gene sequence, expression change detection, and application of sequence in coronary heart disease prediction

The invention relates to the biotechnical field, relates to a coronary heart disease susceptibility gene THSDA related single nucleotide polymorphism (SNP) site, a corresponding composition and a kit for detecting the SNP site, and an application of the nucleic acid affinity ligand of the SNP site in the preparation of compositions for detecting, screening and predicting the coronary heart disease susceptibility of Chinese Han population. The invention also relates to a corresponding composition and a kit for detecting the THSD7A gene, and an application of the nucleic acid affinity ligand of the THSD7A gene in the preparation of compositions for detecting, screening and predicting the coronary heart disease susceptibility of Chinese Han population. New further scientific bases are provided for the research and development of targeted coronary heart disease gene treatment, and a new clue is provided for founding of new coronary heart disease molecule mechanisms, development of new drug targets and the customized treatment of the coronary heart disease.
Owner:田小利 +1

Combined marker for deducing individual age of Chinese Han population and application of combined marker

The invention discloses a combined marker for deducing the individual age of Chinese Han population and application of the combined marker. The combined marker comprises eight CpG loci, namely, chr6 (chr6): 11044628, cg06639320, cg14361627, chr1: 207823723, cg19283806, cg17740900, cg07553761 and cg26947034, and the CpG loci of the combined marker comprise the following eight CpG loci: the chr6: 11044628, the cg06639320, the cg14361627, the chr1: The eight CpGs disclosed by the invention all have strong age correlation, and the age deduction model constructed by combining the eight CpGs has high accuracy and sensitivity on individual age deduction of Chinese Han people. In actual case application, the age deduction method constructed by the age deduction model can accurately deduce the age of an unknown sample, and the age deduction error is 0.27 years old.
Owner:HUAZHONG UNIV OF SCI & TECH

Susceptible SNP site of NTN1 gene and application thereof

InactiveCN106987635AAids in assessing genetic riskMicrobiological testing/measurementDNA/RNA fragmentationIncomplete bilateral cleft lipRisk allele
The patent is a susceptible SNP site of an NTN1 gene and an application thereof and discloses a genotype of an SNP marker rs4791331 related to assisted diagnosis of non-syndromic cleft lip and palate. Two alleles exist: T and C, wherein the allele T is a risk allele and an application of the allele T in a diagnostic kit for non-syndromic cleft lip and palate is developed. The invention is conductive to comprehensively evaluating the effect of heritable variation in genesis and development and lapse of NSCO of Chinese Han populations and has important meaning in guiding NSOC high risk groups to prevent and screen.
Owner:AFFILIATED STOMATOLOGICAL HOSPITAL OF NANJING MEDICAL UNIV

Biomarkers for predicting venous thromboembolism genetic risk of Chinese Han population, kit and application thereof

The invention provides a group of complete gene locus combinations for predicting the venous thromboembolism genetic risk of Chinese Han people, optimizes the complete gene locus combinations to obtain a simplest gene locus combination, and establishes a model for predicting the venous thromboembolism genetic risk of Chinese Han people, which is relatively high in prediction capability and relatively low in clinical cost. The defect that the current domestic clinical venous thromboembolism risk assessment is lack of a multi-gene collective characterization and genetic risk prediction model and method is overcome, and the method has a wide application prospect.
Owner:西安时代基因医学科技有限公司

Fluorescent-labeled 32-plex InDels composite amplification system and application thereof

The invention belongs to the technical field of biological detection and particularly relates to a fluorescent-labeled 32-plex InDels composite amplification system and application thereof. The constructed composite amplification system comprises 32 InDel sites and one sex site, the InDel marker with the minor allele frequency (MAF) equal to or greater than 0.4 in the Chinese Han population is selected, and amplified fragments range from 70 bp to 160bp. The composite amplification system is adopted for carrying out genetic typing on 204 unrelated individuals of the Chinese Han population, the cumulative personal recognition probability is 0.999999999999966, and the cumulative non-parent exclusion probability is 0.9982. Studies shown that the constructed composite amplification system has high recognition ability for the Chinese Han population and meanwhile can correctly type DNA templates as low as 31.25 pg and have significant advantages in degrading amplified types of DNA.
Owner:HUAZHONG UNIV OF SCI & TECH

Kit for screening dilated cardiomyopathy

The invention relates to a kit for screening dilated cardiomyopathy. The detection genes of the kit are MYBPC3, SCN5A, MYH7 and MYPN. The present invention also provides the application of four genes MYBPC3, SCN5A, MYH7 and MYPN in preparing a kit for screening dilated cardiomyopathy. The advantages of the present invention are: the present invention screens out the most susceptible 4 sporadic dilated cardiomyopathy pathogenic genes in Chinese Han population, and develops an effective early diagnosis method and diagnostic kit for sporadic dilated cardiomyopathy in Chinese Han population, Effectively improve the early detection rate of patients with dilated cardiomyopathy, so as to achieve early treatment and improve the survival rate of patients; compared with the current expensive and inefficient genetic screening methods for dilated cardiomyopathy, the discovery of these four high-risk disease-causing genes It will make screening more targeted, thereby reducing testing costs and improving detection efficiency.
Owner:苏州科诺医学检验实验室有限公司

Application of human chromosome InDel gene locus, primer group and product thereof, and individual identification method of detected material

The invention provides application of a human chromosome InDel gene locus, a primer group and a product thereof, and an individual identification method of a detected material, and relates to the technical field of biology. The invention provides application of 66 InDel gene loci of a human chromosome in individual identification or paternity identification. The inventor autonomously screens 66 InDel gene loci from a dbSNP database, evaluates population genetic parameters of 66-plex InDels (66 InDel gene loci) in 251 Chinese Han population, and analyzes the forensic medicine application value of the 66-plex InDels (66 InDel gene loci). Results show that 66 InDel gene loci have good genetic polymorphism in Chinese Han people, and can be independently applied to forensic individual identification and paternity identification research.
Owner:ACADEMY OF MILITARY MEDICAL SCI

A fluorescent-labeled 32-plex InDels compound amplification system and its application

The invention belongs to the technical field of biological detection and particularly relates to a fluorescent-labeled 32-plex InDels composite amplification system and application thereof. The constructed composite amplification system comprises 32 InDel sites and one sex site, the InDel marker with the minor allele frequency (MAF) equal to or greater than 0.4 in the Chinese Han population is selected, and amplified fragments range from 70 bp to 160bp. The composite amplification system is adopted for carrying out genetic typing on 204 unrelated individuals of the Chinese Han population, the cumulative personal recognition probability is 0.999999999999966, and the cumulative non-parent exclusion probability is 0.9982. Studies shown that the constructed composite amplification system has high recognition ability for the Chinese Han population and meanwhile can correctly type DNA templates as low as 31.25 pg and have significant advantages in degrading amplified types of DNA.
Owner:HUAZHONG UNIV OF SCI & TECH

Application of IL12RB1 gene single nucleotide polymorphism (SNP) rs2305740 in detecting tuberculosis susceptibility

The invention discloses application of IL12RB1 gene single nucleotide polymorphism (SNP) rs2305740 in detecting tuberculosis susceptibility. The application provided by the invention is the application of a substance for detecting rs2305740 site in preparing products for evaluation or auxiliary evaluation of the tuberculosis risk of a to-be-tested patient, or in preparing products for diagnosis or auxiliary diagnosis of tuberculosis of a to-be-tested patient. The inventor of the invention finds, through a case-control study in Chinese Han population, a significant relationship between the gene polymorphism of IL12RB1 gene SNP-rs2305740 sites and tuberculosis resistance. The population with IL12RB1-rs2305740GG genotype and GGGAG diplotype has lower risk of tuberculosis in Mycobacterium tuberculosis infection. The invention provides new insight for the association between inflammation and immune related gene SNP and tuberculosis susceptibility, and has a significant value in screening tuberculosis susceptibility genes and preventing tuberculosis.
Owner:THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY

THSD7A (Thrombospondin type-1 domain-containing 7A) gene sequence and application thereof to expression change detection and coronary heart disease prediction

The invention relates to the technical field of biology. On one hand, the invention relates to a single nucleotide polymorphism (SNP) site of a coronary heart disease susceptible gene THSD7A (Thrombospondin type-1 domain-containing 7A) and a corresponding composition and a corresponding kit which are used for detecting the SNP site; the invention especially relates to application of a nucleic acid affinity ligand of the SNP site to preparation of a composition which is used for detecting, screening or predicting coronary heart disease susceptibility of Chinese Han population. On the other hand, the invention relates to a corresponding composition and a corresponding kit which are used for detecting the THSD7A gene and further relates to application of a nucleic acid affinity ligand of the THSD7A gene to preparation of the composition for detecting, screening or predicting the coronary heart disease susceptibility of Chinese Han population. The invention provides new further scientific evidence for researching and developing targeted coronary heart disease gene therapy, and a new clue is provided for finding a new coronary heart disease molecule mechanism and developing a new medicine target point and individualized treatment of a coronary heart disease.
Owner:田小利 +1

Detection agent for ABO blood type gene and shaping method

The invention discloses a detection reagent and a typing method for the simultaneous genotyping of antigens of ABO blood group and specific A2, comprising four primers, two of which are sequential specific primers and the other two of which are inner comparison primers. The method can carry out simultaneous amplification to the blood group genes of the antigens of the ABO blood group and the specific A2 subtypes, which are very common among the Chinese population. The method can detect four alleles, A101, A102, B101 and O01, and six A2 alleles, A201, A202, A202, A204, A205 and A206, which arevery common among the Chinese population. Compared with the traditional detection methods, the detection method of the invention is fast, simple, practical, specific and sensitive, is suitable for the genetic identification of ABO blood groups of Chinese Han population and can be used in the research of the ABO blood group of human beings.
Owner:SHENZHEN BLOOD CENT

A test kit for detecting vkh syndrome

The invention relates to a kit for detecting VKH (Vogt Koyanagi Harada) syndrome. The kit contains primer pairs of a reagent used for amplifying gene segments at loci of rs78377598, rs77258390, rs78597810, rs12568393, rs12561798, rs76436269, rs3021304, rs442309 and rs224058 and a Sequenom MassARRAY single-base extension primer for specifically detecting idiotypes. The kit is used for predicating the genetic predisposition of a subject for the VKH syndrome by detecting whether the SNP (single nucleotide polymorphism) loci of the subject are varied, and can be used for early screening for the occurrence of the VKH syndrome of Chinese Han population and providing a basis for clinical diagnosis and treatment.
Owner:THE FIRST AFFILIATED HOSPITAL OF CHONGQING MEDICAL UNIVERSITY

System and method for establishing age evaluation model based on deep learning technology

The invention discloses a system and method for establishing an age evaluation model based on a deep learning technology. The method comprises the steps of photographing a full-mouth curved-surface fault film of Chinese Han population in the northwest, dividing a curved-surface fault film data set into a training set, a verification set and a test set according to the proportion of 8:1:1, inputting the training set into an EfficitNet-B5 network, carrying out the training of a classifier, and finally, establishing an automatic classification model of 18 years old or not through the performanceof the classifier on the test set. A traditional deep learning model is simplified, a label directly related to an output value is added to an image, a neural network model related to the input imageand the output value is established through a computer algorithm, and then automatic evaluation of the image is achieved; and the whole curved surface fault film is selected as the input image of theneural network instead of being limited to teeth in a certain area, the most comprehensive tooth information is provided for a computer to explore the correlation between the tooth structure and the age, and missing of other structural new information with prompt significance is avoided.
Owner:西安交通大学口腔医院 +1

Application of TNFRSF13B gene rs34562254 SNP

The invention discloses a TNFRSF13B gene rs34562254 single nucleotide polymorphism (SNP) or genotype of a human genome in preparing products for detecting or screening Chinese Han population hepatitisC genetic susceptibility or products of the SNP related to the hepatitis C. in practical application, a substance detecting polymorphism / allele / genotype of rs34562254 can be combined with other substances (such as substances detecting other SNP / allele / genotype related to the hepatitis C) to prepare the products for screening Chinese Han population hepatitis C genetic susceptible people.
Owner:JIANGSU PROVINCE HOSPITAL THE FIRST AFFILIATED HOSPITAL WITH NANJING MEDICAL UNIV +2

Application of single nucleotide polymorphism rs2305740 in il12rb1 gene in detecting tuberculosis susceptibility

The invention discloses application of IL12RB1 gene single nucleotide polymorphism (SNP) rs2305740 in detecting tuberculosis susceptibility. The application provided by the invention is the application of a substance for detecting rs2305740 site in preparing products for evaluation or auxiliary evaluation of the tuberculosis risk of a to-be-tested patient, or in preparing products for diagnosis or auxiliary diagnosis of tuberculosis of a to-be-tested patient. The inventor of the invention finds, through a case-control study in Chinese Han population, a significant relationship between the gene polymorphism of IL12RB1 gene SNP-rs2305740 sites and tuberculosis resistance. The population with IL12RB1-rs2305740GG genotype and GGGAG diplotype has lower risk of tuberculosis in Mycobacterium tuberculosis infection. The invention provides new insight for the association between inflammation and immune related gene SNP and tuberculosis susceptibility, and has a significant value in screening tuberculosis susceptibility genes and preventing tuberculosis.
Owner:THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY

Application of single nucleotide polymorphism (SNP) rs7576984 and rs2066802 in detecting tuberculosis susceptibility

ActiveCN106929581AGood tuberculosis riskGood risk of TBMicrobiological testing/measurementNucleotideMycobacterium
The invention discloses application of STAT1 gene single nucleotide polymorphism (SNP) rs7576984 and rs2066802 in detecting tuberculosis susceptibility. The application provided by the invention is the application of a substance for detecting rs7576984 site or rs2066802 site in preparing products for evaluation or auxiliary evaluation of the tuberculosis risk of a to-be-tested patient. The inventor of the invention finds, through a case-control study in Chinese Han population, a significant relationship between the gene polymorphism of STAT1-rs7576984 and rs2066802 sites and tuberculosis affecting risk. The population with STAT1-rs7576984CG genotype and STAT1 'TA' haplotype-formed diplotype has higher risk of tuberculosis in Mycobacterium tuberculosis infection. The invention provides new insight for the association between inflammation and immune related gene SNP and tuberculosis susceptibility, and has a significant value in screening tuberculosis susceptibility genes and preventing tuberculosis.
Owner:THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY

Application of single nucleotide polymorphisms rs7576984 and rs2066802 in detecting tuberculosis susceptibility

ActiveCN106929581BGood tuberculosis riskGood risk of TBMicrobiological testing/measurementSusceptibility geneMycobacterium
The invention discloses application of STAT1 gene single nucleotide polymorphism (SNP) rs7576984 and rs2066802 in detecting tuberculosis susceptibility. The application provided by the invention is the application of a substance for detecting rs7576984 site or rs2066802 site in preparing products for evaluation or auxiliary evaluation of the tuberculosis risk of a to-be-tested patient. The inventor of the invention finds, through a case-control study in Chinese Han population, a significant relationship between the gene polymorphism of STAT1-rs7576984 and rs2066802 sites and tuberculosis affecting risk. The population with STAT1-rs7576984CG genotype and STAT1 'TA' haplotype-formed diplotype has higher risk of tuberculosis in Mycobacterium tuberculosis infection. The invention provides new insight for the association between inflammation and immune related gene SNP and tuberculosis susceptibility, and has a significant value in screening tuberculosis susceptibility genes and preventing tuberculosis.
Owner:THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY

Application of TNFSF11 (tumor necrosis factor superfamily member 11) gene rs9525641 SNP (single nucleotide polymorphism)

The invention discloses application of TNFSF11 (tumor necrosis factor superfamily member 11) gene rs9525641 SNP (single nucleotide polymorphism) or a genotype in human genomes in preparing products for detecting or screening hepatitis C chronicity or hepatitis C related SNP of the Chinese Han population. In practical use, substances for detecting polymorphism / allele / genetype of the rs9525641 can be combined with other substances (such as substances for detecting other SNP / allele / genotype substances related to hepatitis C) to prepare products for screening people with hepatitis C chronicity inthe Chinese Han population.
Owner:YIXING PEOPLES HOSPITAL +2

Thsd7a gene sequence and expression change detection and its application in the prediction of coronary heart disease

The invention relates to the technical field of biology. On one hand, the invention relates to a single nucleotide polymorphism (SNP) site of a coronary heart disease susceptible gene THSD7A (Thrombospondin type-1 domain-containing 7A) and a corresponding composition and a corresponding kit which are used for detecting the SNP site; the invention especially relates to application of a nucleic acid affinity ligand of the SNP site to preparation of a composition which is used for detecting, screening or predicting coronary heart disease susceptibility of Chinese Han population. On the other hand, the invention relates to a corresponding composition and a corresponding kit which are used for detecting the THSD7A gene and further relates to application of a nucleic acid affinity ligand of the THSD7A gene to preparation of the composition for detecting, screening or predicting the coronary heart disease susceptibility of Chinese Han population. The invention provides new further scientific evidence for researching and developing targeted coronary heart disease gene therapy, and a new clue is provided for finding a new coronary heart disease molecule mechanism and developing a new medicine target point and individualized treatment of a coronary heart disease.
Owner:田小利 +1

Application of lta Gene Single Nucleotide Polymorphism rs2009658 in Detection of Tuberculosis Susceptibility

The invention discloses application of LTA (Lymphotoxin Alpha) gene single nucleotide polymorphism rs2009658 to detection of tuberculosis (TB) susceptibility. The application provided by the invention refers to preparation of a product for evaluation or assistance in assessing TB-suffering risks of a person to be detected by substances for detecting the single nucleotide polymorphism of rs2009658 loci, or preparation of a product for diagnosis or auxiliary diagnosis on whether the person to be detected suffers from TB or not. The inventor of the invention finds that a significant correlation occurs between gene polymorphism of LTA gene SNP-rs2009658 loci and the TB suffering risks through case control studies of Chinese Han populations. The populations with LTA-rs2009658GC genotypes and LTA-TNF 'GGCCG' haplotypes are at higher onset risks for mycobacterium tuberculosis infection. The invention provides a new insight into the association between the inflammatory and immune-related genes SNP and the susceptibility to TB, and is of great values in the screening and prevention of TB susceptibility genes.
Owner:THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY

Ntn1 Gene Susceptible SNP Site and Its Application

InactiveCN106987635BAids in assessing genetic riskMicrobiological testing/measurementDNA/RNA fragmentationIncomplete bilateral cleft lipRisk allele
The patent is a susceptible SNP site of an NTN1 gene and an application thereof and discloses a genotype of an SNP marker rs4791331 related to assisted diagnosis of non-syndromic cleft lip and palate. Two alleles exist: T and C, wherein the allele T is a risk allele and an application of the allele T in a diagnostic kit for non-syndromic cleft lip and palate is developed. The invention is conductive to comprehensively evaluating the effect of heritable variation in genesis and development and lapse of NSCO of Chinese Han populations and has important meaning in guiding NSOC high risk groups to prevent and screen.
Owner:AFFILIATED STOMATOLOGICAL HOSPITAL OF NANJING MEDICAL UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More