36 results about "CYP3A5" patented technology

The invention relates to a gene chip used for detecting gene mutation relating to a high blood pressure personalized medicine. The gene chip for detecting the gene mutation relating to high blood pressure personalized medicine comprises a solid phase support, a gene probe (an oligonueleotide probe) fixed in the solid phase support sequentially and a PCR primer used for amplifying the mutated gene fragment in the sample; the gene probe (the oligonueleotide probe) and the PCR primer are designed aiming at one or two points of the gene mutation in ACE (I / D) and CYP3A5*3 and / or two or more points as follows: CYP2C9*3, CYP2C9*13, AGTR1(A1166C), CYP2D6*10, ADRB1(C1165G), TSC(C1784T), ADRB3(T727C), SCNN1G_rs5729, SCNN1G_rs5723, ENOSA_rs1799983 and GNB3(C825T). The invention provides the gene chip and applications thereof for conveniently, quickly and systematically detecting the gene mutation relating to high blood pressure personalized medicine so as to determine drug reactions.

The invention discloses a relevant gene combination, a primer, a probe and application used for detecting a chemotherapeutic effect on acute myelogenous leukemia. The gene combination comprises four gene combinations closely relevant to pharmacotherapy of the acute myelogenous leukemia: medicament metabolism phase I enzyme gene CYP3A5, medicament metabolism phase II enzyme genes NAT2 and GSTO2, and medicament transport protein gene OATP1B1; and the gene combination comprises the following SNP loci: the locus rs776746 of the gene CYP3A5, the locus rs1799931 of the gene NAT2, the locus rs156697 of the gene GSTO2, and the locus rs4149056 of the gene OATP1B1. A method is performed by hybridizing a specific primer and probes which are subjected to fluorescence marks of different colors with target gene fragments in a nucleic acid sample after PCR amplification. The treatment effect of a leukemia medicament is detected and analyzed by mononucleotide extension technology so as to direct clinical medicament application, reduce a toxic or side effect of the medicament application for a patient, and increase a curative effect.

The invention discloses primers for detecting polymorphism of CYP3A4, CYP3A5 and MDR1 genes with an ARMs-PCR (amplification refractory mutation system-polymerase chain reaction) method and a prepared kit. Primer sequences are shown in SEQ 1-SEQ 18. The primers can perform typing testing on CYP3A4, CYP3A5 and MDR1 genes of humans quickly and accurately through specific amplification after primer combination. Genetic typing or preparation of the typing kit can be performed according to the primers and the primers are used for detecting metabolic capacity of Chinese people for related drugs such as tacrolimus, cyclosporine A and the like, so that a reference basis can be provided for special doctors who determine optimal drug dosage and individual drug use, and drug use risks are reduced.

Genetic polymorphisms responsible or associated with altered expression of cytochrome P450 CYP3A5 enzyme are described. Single nucleotide polymorphisms are provided. Methods for identifying subjects having a low or high drug metabolizing phenotype associated with CYP3A5 expression are provided. Assays, kits and methods for determining and assaying the CYP3A5 genotype and phenotype of individual patients are disclosed. Oligonucleotide probes and primers for use in the assays, kits and methods are described. Assays and methods for determining and evaluating an individual's metabolism of drugs and therapeutic agents, the potential for drug interactions, and thereby toxicity and effectiveness of certain drugs and treatment modalities, are provided.

The invention discloses a DNA micro-array chip and a detection method thereof and the application on detecting the polymorphism of CYP3A4, CYP3A5 and MDR1 genes. The chip comprises a solid phase carrier and a probe. The nucleotide sequence of the probe is shown as SEQ ID No: 1-SEQ ID No: 49. The probe is firstly arranged on the solid phase carrier. And then the target nucleotide sequence of a sample to be detected is marked and prepared. After that, the target nucleotide sequence is hybridized with the probe on the chip. Finally, the hybridization result is detected to obtain the information of the CYP3A4, CYP3A5 and MDR1 genes in the sample to be detected. The chip of the invention can be used for the detection of a plurality of genes of a plurality of samples simultaneously once only and has the advantages of simple operation and high result accuracy. Large amount of genetic information of patients can be obtained through detection once. The DNA micro-array chip and the detection method thereof can be used for instructing the formulation of reasonable drug schemes and realizing the personalized medical treatment.

The invention relates to an absolute quantitative method for biomass spectra of CYP450 enzyme hypotypes, and belongs to the technical field of proteomics. In the method, on the basis of liquid chromatography (LC) / mass spectrometry (MS) / MS, the absolute quantification of four CYP450 enzyme hypotypes, namely CYP1A2, CYP2B6, CYP3A4 and CYP3A5 in systems such as liver microsome and the like is realized simultaneously by a strategy that CYP450 generates specific peptide quantitative enzymes by pancreatic enzyme hydrolysis. The method mainly comprises the following steps of: preprocessing a proteinsample, preparing a standard curve, measuring the protein sample and preparing a quality control sample. The absolute quantitative method has excellent linear relations, is high in accuracy and repeatability, is sensitive, precise and reliable, and can be used for medicinal metabolism and the evaluation of the mutual effect of medicaments.

The invention relates to a metabotropic diagnosis kit used for detecting tacrolimus. The diagnosis kit comprises a reagent for detecting gene CYP3A4 rs2242480 SNP loci, a reagent for detecting gene CYP3A5 rs776746 SNP loci, and a reagent for detecting the total bilirubin content. The current clinical dosage of tacrolimus is determined according to the weight of patients, and different dosages of tacrolimus are needed for treatment so that different genotype patients can have the same target plasma concentration. By testing single nucleotide polymorphism (SNP) and clinical biochemical indicators of 170 pairs of liver transplantation donor CYP3A5 rs776746 loci and liver transplantation receptor CYP3A4 rs2242480 loci, the relation with tacrolimus metabolism is discussed, and the basis is provided for individualized drug administration of clinical liver transplantation patients.

The invention discloses a primer group and a kit for detecting genetic typing of CYP3A5. The primer group for detecting CYP3A5 gene typing comprises a CY3A5*1 primer pair, a CY3A5*2 primer pair, a CY3A5*3 primer pair, a CY3A5*4 primer pair, a CY3A5*5 primer pair, a CY3A5*6 primer pair and an internal reference primer pair. The application of the kit helps to realize good typing for CYP3A5 gene; and in clinical application of organ transplantation, good guidance effects on individualized use and secure use of immunosuppressant are realized.

The invention relates to a method and kit for detecting SNP sites related to tacrolimus and cyclosporin A individalized medication. The detection method comprises the following steps: (1) designing specific primers aiming at CYP3A4, CYP3A5 and MDR1 genes; (2) performing specific polymerase chain reaction (PCR) amplification so as to obtain target fragments containing CYP3A4, CYP3A5 and MDR1 genes;(3) performing restrictive enzyme disgestion on PCR product fragments; (4) performing single base extension reaction; (5) performing desalting purification treatment; and (6) then detecting and analyzing gene sequences of target genes CYP3A4, CYP3A5 and MDR1 genes. The method for detecting SNP sites related to tacrolimus and cyclosporin A individalized medication is high in detection accuracy, high in experiment repeatability, great in flux and low in cost. The invention also provides a kit for detecting SNP sites related to tacrolimus and cyclosporin A individalized medication. The kit comprises a specific primer pair for amplifying CYP3A4, CYP3A5 and MDR1 genes. The kit for detecting SNP sites related to tacrolimus and cyclosporin A individalized medication has the advantages of simplified experimental procedure, short manual operation time, low difficulty and high experiment automation degree.

The invention relates to the field of biomedicine, in particular to a product for detecting polymorphism of a CYP3A5 gene and a detection method and application of the product. A primer composition for detecting the polymorphism of the CYP3A5 gene is provided and comprises a primer group used for detecting CYP3A5*3 sites, wherein fluorescent reporter groups of a wild type specific probe and a mutant type specific probe are different from each other. The primer composition can accurately detect the polymorphism of the CYP3A5 gene, has the advantages of being high in sensitivity and good in specificity, can accurately detect the genotype of 0.1 ng genome DNA, and can also tolerate 500 ng genome DNA. Besides, the invention provides an enzyme-containing multiplex PCR detection kit. The detection process is greatly simplified.

The invention relates to a primer composition and a kit for detecting hypertension medicine related genes. The primer composition comprises an NPPA primer group, an ADRB1 primer group, a CYP2D6 primergroup, an AGTR1 primer group, a CYP2C9 primer group, a CYP3A5 primer group and a GNB3 primer group, and the kit comprises the primer composition. Compared with the prior art, a kit is acquired and can rapidly, sensitively, simply and conveniently detect gene polymorphisms of hypertension medicine related genes (NPPA, ADRB1, CYP2D6, AGTR1, CYP2C9, CYP3A5 and GNB3) by combining an ARMS technique and an SYBR dye, the kit comprises a specific ARMS detection primer, an internal control primer and a PCR reaction solution, the ARMS detection primer is designed, an Scorpions probe replaces with the SYBR dye, so that detection cost is greatly reduced, the primer composition is more suitable for detection NPPA, ADRB1, CYP2D6, AGTR1, CYP2C9, CYP3A5 and GNB3 gene polymorphisms of Chinese patients, and the primer composition has the advantages of rapidness in detection, high sensitivity, high specificity, simple method and accurate result and suitable for popularization and application.

The invention discloses a cytochrome P450 gene genetic variation detecting chip. It includes the probe fixed on the solid phase carrier to hybridize with the cytochrome P450 gene nucleotide sequence and / or complementation sequence. The invention also discloses the used chip detecting method. The detecting chip can effectively detect subtype genetic variation of CYP2C9, CYP2C19, CYP2D6, CYP3A5, forecast the therapeutic effectiveness of over 40% clinic common medicine to realize individualization medical treatment.

The invention provides a gene detection kit for detecting individualized drug use of a tacrolimus drug. The kit comprises the following components including two pairs of PCR amplification and sequencing primers for CYP3A5*3 (-253-1A>G) and POR (1508C>T) site regions, a PCR amplification reagent, a PCR product purification reagent and a DNA sequencing reagent. According to the sequencing primers for the CYP3A5*3 (-253-1A>G) site, the forward primer is TGCCCTTGCAGCATTTAG, and the reverse primer is ACACCCAGGAAGCCAGAC; according to the sequencing primers for the POR (1508C>T) site, the forward primer is GGTGGTTGTGGAGTACGAGA, and the reverse primer is CGCTCCTGGATGAAGCCTAT. The kit is used for genotyping detection of the CYP3A5*3 (-253-1A>G) and POR (1508C>T). By applying the kit in detection, the individual drug metabolism type including a normal metabolite and a slow metabolism type can be identified, the drug dosage is adjusted, the drug efficacy is improved, the toxic and side effects ofthe drug are reduced, and individualized treatment is realized.

The invention discloses a detection kit and a detection method for calcium ion antagonist metabolism marker and application thereof. The kit comprises the following components: a CYP3A5 * 3 amplification primer, a CYP3A5 * 3 sequencing primer, an NPPA (T2238C) amplification primer, an NPPA (T2238C) sequencing primer and a positive control. According to the invention, CYP3A5 * 3 and NPPA (T2238C) are amplified through multiple RPA in one tube, so that a large number of amplification products are rapidly and effectively generated at a constant temperature. Single-stranded DNA is specifically captured through amino-labeled single-stranded DNA directly combined with carboxyl modifiers, after washing, sequencing primers and sequencing raw materials are added to perform pyrosequencing, damage of strong alkaline reagents to amplified fragments is reduced, the sequencing process is simplified, and the sequencing time is shortened.

The invention provides a rapid detection kit for CYP3A5*3 genotype based on a POCT mode. The kit comprises at least a fluorescent quantitative PCR primer (SEQ ID NO: 1-4) and probe for detecting CYP3A5*3 (rs776746) genotype and a cell lysate. In addition, the kit may comprise dNTPs, DNA polymerase, Mg<2+>, a reaction buffer, a standard positive template, a sampling rod, a sample collection tube and the like. The kit can realize real-time detection without DNA purification. A sample can be directly added into a reagent for a PCR reaction, the kit is especially suitable for rapid accurate detection of samples with low DNA content (such as oral exfoliated cells), and the detection accuracy is 99% or more. The detection sensitivity is high, and the detection limit of genomic DNA as low as 0.125 ng can be accurately detected. The whole detection takes a short time, and a detection result can be obtained within one hour and provides a medicine use basis for a doctor at the first time, thereby reducing the risk of medicine administration.

The invention provides a CYP3A5*3 detection kit, and belongs to the technical field of molecular biology and nucleic acid detection. The CYP3A5*3 detection kit is designed by employing a bidirectional amplification refractory mutation system PCR (Bi-Amplification Refractory Mutation System PCR, BI-ARMS-PCR) technology on the basis of ARMS-PCR. A specific primer is designed aiming at two alleles of rs776746, and the rs776746 site base in a to-be-detected sample is determined by reading the electrophoresis band quantity and size, and thus whether a tested person carries CYP3A5*3 is determined, and the tested person is guided for medicine usage.

Methods for detecting variant genes having a polymorphism associated with reduced metabolism of a substrate selected from the group consisting of a CYP3A4 substrate, a CYP3A5 substrate and a GSTM1 substrate in an individual are disclosed. The methods are genotyping methods to identify specific polymorphisms which have been found to be associated with reduced metabolism of chemotherapeutic agents, such as cyclophosphamide and BCNU. Also disclosed are novel polymorphic nucleic acid molecules useful in the methods of the invention.

The invention provides a primer group for gene group detection for medication guidance of anxiety patients, related application and a corresponding kit, the primer group comprises primers for detecting variation related to each gene in the gene group, and the gene group comprises the following genes: CYP2C9, CYP2C19, CYP3A4, CYP3A5, NAT2, ABCB1, SCN1A, UGT1A4 and POLG.

The invention provides a kit for detecting gene polymorphism of a drug for hypertension by a multiple fluorescent PCR method. The kit comprises 7 types of gene polymorphism detection (CYP2C9*1 and *3, CYP2D6*1 and *10, CYP3A5*1 and *3, ADRB1(1165G > C), AGTR1(1166A > C), ACE (I / D) and NPPA (2238 T > C)) related to drug susceptibility of hypertension. Amplification is performed through four reaction buffer liquids, and each of the reaction buffer liquids comprises four fluorescent channels. The types of alleles of 7 sites are judged through an amplification result, so that clinical medication is guided.

The invention discloses application of a broad-spectrum fluorescent probe for detecting cytochrome oxidase CYP3A, and belongs to the technical field of biological medicines. The specific probe substrate can be used for determining the enzymatic activity of CYP3A in a biological system. The CYP3A enzyme activity determination process comprises the following steps: selecting a BN compound 4-site hydroxylation reaction as a probe reaction, and determining the CYP3A enzyme activity in various biological samples by quantitatively detecting the generation amount of hydroxylation metabolites in unit time. The BN series probe can be used for simultaneously detecting the activity of CYP3A4 and CYP3A5, and is a broad-spectrum probe for detecting the activity of CYP3A, so that efficient discovery and deep research related to CYP3A based on a mechanism inhibitor can be realized. The probe can also be used for rapidly screening reversible and irreversible inhibitors, activators and inducers of CYP3A in vitro, and can be used for detecting drug-drug interaction of CYP3A on a living body level.

The invention discloses a primer group for detecting polymorphism of a human cytochrome P450 related gene. The primer group comprises specific primers and probes aiming at gene sites of CYP2C19*2, CYP2C19*3, CYP3A4*18, CYP2C9*3, CYP2D6*10 and CYP3A5*3. The invention further relates to a kit for detecting polymorphism sites of the human cytochrome P450 related gene. The kit comprises PCR (Polymerase Chain Reaction) reaction liquid freeze-dried powder (PCR buffer, dNTPs, MgCl2, UNG enzyme, Taq enzyme and trehalose) with the primers and the probes. The invention further relates to a method for detecting polymorphism sites of the human cytochrome P450 related gene. By adopting the method, a DNA (Deoxyribonucleic Acid) extraction procedure is avoided, micro whole-blood amplification is directlyimplemented, a small amount of blood is used, and patients can be relieved from pain; the time and the labor can be saved, and in addition, economic expense can be greatly reduced.

The invention relates to the technical field of biological detection, in particular to a primer combination, a reagent kit and a method for detecting CYP3A5*3. PNA (peptide nucleic acid) Clamp LAMP (loop-mediated isothermal amplification) technologies are adopted, PNA and LAMP processes are combined with one another, A sites of rs776746 are blocked by PNA-A, G sites of the rs776746 are blocked by PNA-G, highly similar genes CYP3A4 are blocked by PNA-I, accordingly, corresponding LAMP reaction cannot continue to be carried out, and the purpose of detecting CYP3A5 genotypes can be achieved. The primer combination, the reagent kit and the method have the advantages that the method includes simple steps, the primer combination, the reagent kit and the method are high in specificity and low in cost, and the CYP3A5*3 is easy and convenient to identify.

The invention provides a drug gene mutation detection kit based on an SNV array technology and a detection method. The kit comprises all common variants of drug-related genes ABCB1, CYP2C19, HTR2C, CYP3A5, SLCO2B1, EPHX1, PLA2G4A, UGT1A, CYP2D6, ACE, DRD2, CRHR1, FKBP5, VKORC1, CYP1A1, HLA_B, UGT1A4, MC4R, TPMT and MT-RNR1. The kit can hybridize and capture common related variation types of the genes simultaneously and specifically, and realize efficient, accurate and comprehensive drug gene mutation detection. Meanwhile, detection of drug gene mutation sites is achieved on the basis of the SNV array technology, high convenience, sensitivity and specificity of the SNP array technology are continued, the standardization degree of clinical drug gene mutation detection can be remarkably improved, and a new technical thought and a personalized medication guidance basis are provided for clinical precise medication.

The present invention provides fluorescence-based real-time PCR assays for the rapid detection of single nucleotide polymorphisms (SNPs). The genotyping assay can be used to detect SNPs of a number of genes of interest that include, but are not limited to, the human multidrug resistance gene (MDR1) single nucleotide polymorphisms C3435T and G2677T, and cytochrome P-450 3A5 single nucleotide polymorphisms CYP3A5*3 (A22893G) and CYP3A5*6 (G30597A).

The invention discloses a CYP3A5 protein, encoding gene and recombinant vector and application thereof in preparing drugs for resisting tumor recurrence or metastasis. The protein has an amino acid sequence as shown in SEQ ID NO.1, and the encoding gene has a nucleotide sequence as shown in SEQ ID NO.2. The protein can inhibit metastasis and invasion of hepatoma cells, and a very wide application prospect in preparation of the drugs for resisting tumor recurrence or metastasis is achieved.

The invention provides a drug tamoxifen treatment effect-related gene (CYP2D6, CYP3A5 and RRAS2) polymorphism detection kit and a drug tamoxifen treatment effect-related gene (CYP2D6, CYP3A5 and RRAS2) polymorphism detection method, wherein the kit comprises a PCR buffer solution, specific ARMS detection primers and quality control primers. The present invention further provides the tamoxifen treatment effect-related gene (CYP2D6, CYP3A5 and RRAS2) polymorphism detection method. According to the present invention, with the method, the tamoxifen treatment effect-related gene (CYP2D6, CYP3A5 andRRAS2) polymorphism can be rapidly and accurately detected; and the kit has characteristics of high sensitivity, strong specificity, simple method, accurate result and the like.

The invention relates to an absolute quantitative method for biomass spectra of CYP450 enzyme hypotypes, and belongs to the technical field of proteomics. In the method, on the basis of liquid chromatography (LC) / mass spectrometry (MS) / MS, the absolute quantification of four CYP450 enzyme hypotypes, namely CYP1A2, CYP2B6, CYP3A4 and CYP3A5 in systems such as liver microsome and the like is realized simultaneously by a strategy that CYP450 generates specific peptide quantitative enzymes by pancreatic enzyme hydrolysis. The method mainly comprises the following steps of: preprocessing a proteinsample, preparing a standard curve, measuring the protein sample and preparing a quality control sample. The absolute quantitative method has excellent linear relations, is high in accuracy and repeatability, is sensitive, precise and reliable, and can be used for medicinal metabolism and the evaluation of the mutual effect of medicaments.