Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

113 results about "Granular cell" patented technology

Granule cell 1. Any of the small neurons that pack the granular cell layer of the cerebellar cortex, immediately below the Purkinje cell layer. Granule cells receive inputs (mossy fibers) from the spinal cord and brainstem (except the inferior olive). 2. Any of the neurons of the cerebral cortex that are not pyramidal cells.

Microanalysis of cellular function

ActiveUS20130261021A1Rapid and efficient testingRapid and efficient timingDielectrophoresisLibrary screeningAntibody-Secreting CellsGranular cell
An inverted microwell (102) provides rapid and efficient microanalysis system (100) and method for screening of biological particles (128), particularly functional analysis of cells on a single cell basis. The use of an inverted open microwell system (102) permits identification of particles, cells, and biomolecules that may be combined to produce a desired functional effect also functional screening of secreted antibody therapeutic activity as well as the potential to recover cells and fluid, and optionally expand cells, such as antibody secreting cells, within the same microwell.
Owner:CELLPLY SRL

Particle/cell separation device and compositions

A particle / cell separation device is described which is particularly adapted for neutrophil depletion from a preparation of whole blood or platelet-rich plasma. Also described are blood and platelet rich plasma compositions produced using the device which are neutrophil-depleted.
Owner:BLUE ENGINE BIOLOGICS LLC

Biological reagents and methods to verify the efficiency of sample preparation and nucleic acid amplification and/or detection

ActiveUS20070015139A1Affects the efficiency of the release of the nucleic acid contentMicrobiological testing/measurementMicroorganism lysisGranular cellTest sample
This invention relates to reagent comprising: any one of cells, viral particles, organelles, parasites, cells comprising organelles, cells comprising viral particles, cells comprising parasites, cells comprising bacterial cells and any combination thereof, the cells, viral particles, organelles or parasites comprising at least one nucleic acid sequence serving as an internal control (IC) target for nucleic acid testing (NAT) assay; wherein the reagent is suitable to be added to a test sample undergoing sample preparation to release, concentrate and / or purify nucleic acids and amplification and / or detection of nucleic acids so as to be used to verify: (i) the efficiency of sample preparation; and (ii) the efficiency of nucleic acid amplification and / or detection. The present invention also relates to a method to verify or validate the preparation and amplification and / or detection of a nucleic acid target sequence in a sample spiked with a reagent of the present invention.
Owner:GENEOHM SCI CANADA

In-vitro recombined human skin epidermis model and preparation method and application thereof

The invention discloses an in-vitro recombined human skin epidermis model.A layer of hemidesmosome protein is arranged on the lower surface of a basal cell layer, the upper surface of the basal cell layer is covered with 6-8 spinous cell layers containing short protruding spinous cells, the upper surface of the spinous cell layers is covered with 3-4 granular cell layers containing transparent granular cells, the upper surface of the granular cell layers is covered with a keratinocyte layer, all the cell layers are obviously separated, and the overall barrier function of a lipid composition is approximate to that of human skin.A preparation method comprises the steps of preparation of matrigel particles, screening and amplification of epidermal stem cells, preparation of the basal cell layer, preparation of the spinous cell layers, preparation of the granular cell layers, and maturation and keratinization of the in-vitro recombined epidermis model.The model is applied to evaluation of cosmetics with the human skin barrier repair effect, screening of plant extract with the human skin barrier repair effect, evaluation and detection of irritation of medical apparatus materials on the human skin and detection of irritation of chemicals on the skin.
Owner:GUANGDONG BOXI BIO TECH CO LTD

Preparation method of recombination human granular cell colony stimulating factor

A process for preparing the recombinant human granulocyte colony stimulating factor includes such steps as fermenting culture of DH5 alpha-PBV220-hGCSF strain, separating cytoryctes, washing, modifying renaturation, ultrafilter, the second renaturation, and chromatography. Its advantages are high purity and high activity.
Owner:深圳未名新鹏生物医药有限公司

Blood cell counter, diagnosis support method and computer program product

A blood cell counter comprising: a detector for detecting blood cells in blood of a subject; and a controller for obtaining, based on a detection result by the detector, first analytical information about hemoglobin amount of red blood cells in the blood and second analytical information about granulocytes in the blood, and for outputting diagnosis support information for supporting determination of whether an inflammatory response of the subject is an infectious inflammatory response or a noninfectious inflammatory response, based on the first analytical information and the second analytical information that have been obtained. A method and computer program product are also disclosed.
Owner:SYSMEX CORP

Viral nanoparticle cell-targeted delivery platform

This invention is a process for the manufacture of a plant viral capsid to be used for the targeted delivery of therapeutics to diseased cells. The process uses a plant virus as the starting material. The choice of the plant virus overcomes a problem in the manufacture of a uniform starting material. The final product has an advantage over other plant virus-based delivery systems in that the plant virus selected has a natural structure that is resistant to breakdown during the delivery process. This system takes advantage of the reversible divalent cation switch that this capsid employs to assemble and disassemble.
Owner:NORTH CAROLINA STATE UNIV

Method for promoting in-vitro maturing of human immature oocyte by utilizing 3D printing technology

The invention discloses a method for promoting in-vitro maturing of human immature oocyte by utilizing a 3D printing technology. The method comprises the following steps: separating and collecting granular cells in clinic, propagating the granular cells in an in-vitro culture mode for 2 to 7 days; evenly mixing biological hydrogel with the pre-processed granular cells, printing artificial follicles by a biological 3D printing technology; adding a culture liquid into the artificial follicles, wherein the volume percentage content of human mature follicular fluid of the culture liquid is not less than 10%; culturing for 24 to 48 hours, then adding an immature oocyte-cumulus granular cell composite body, and culturing the 3D cells for 24 to 48 hours to promote the maturing. In the provided method, a 3D cell printing technology is adopted, human granular cells are used to construct an immature oocyte 3D culturing system, and multiple growth factors and simulated follicle culture liquid are added at the same time to create a simulated human follicle so as to promote the in-vitro maturing of immature oocyte.
Owner:ZHEJIANG UNIV +1

Immunochromatography test paper for fast diagnosis of human granulocytic anaplasmosis and its preparation

The invention discloses an immune chromatography reagent paper for rapidly diagnosing anaplasmosises of granular cells of a human body, comprising a sample loading pad (1), a colloidal gold pad (2) of an msp2 antibody containing a golden mark, a pyroxylin film (3) for wrapping a quality control line (6) and a detection line (5), and a sample absorbing pad (4), wherein the upper surface of the pyroxylin film (3) is respectively provided with the colloidal gold pad (2) and the sample absorbing pad (4); the sample loading pad (1) is arranged on the upper surface of the colloidal gold pad (2); the detection line (5) is an msp2 polyclonal antibody which is coated on the pyroxylin film (3); and the quality control line (6) is a goat-anti-rabbit IgG antibody which is coated on the pyroxylin film (3). The invention also provides a preparation method for the immune chromatography reagent paper which is suitable for diagnosing anaplasmosises of granular cells of a human body on site.
Owner:ZHEJIANG SCI-TECH UNIV

miRNA biomarker for diagnosis of polycystic ovarian syndromes and application thereof

The invention provides a miRNA biomarker for diagnosis of polycystic ovarian syndromes.The miRNA biomarker is miR27a.Research shows that miR27a promotes apoptosis of granular cells, inhibits generation of aromatase, makes female hormones in granular cells disproportionate and leads to ovulation failures to cause polycystic ovarian syndromes.By inducing a mouse polycystic ovarian syndrome model with DHT, it is found that miR27a is highly expressed in the mouse polycystic ovarian syndrome model, and the effect of miR27a and target genes thereof in nosogenesis of polycystic ovarian syndromes is verified.miR27a can serve as a biomarker for polycystic ovarian syndromes, and a theoretical basis is provided for clinical pharmacy.
Owner:CHINA AGRI UNIV

Construction method of Mir3061 gene Rosa26 fixed-point knock-in heterozygote mouse model and application thereof

ActiveCN109943593AGood medical clinical application prospectStable introduction of DNAVector-based foreign material introductionDiseaseGranular cell
The invention discloses a construction method of a Rosa26 gene Mir3061 fixed-point knock-in heterozygote mouse model and an application thereof. The constructed mouse gene is Rosa26LSL / +, and the construction method is provided for the first time and is not reported in any domestic or foreign literature reports. And the model provides an effective experimental animal model for the research on thepathogenesis of POF, the research and development of medicines and the evaluation of drug effect. The invention also provides the application of the mouse model in screening and preparing medicines for detecting / treating reproductive development diseases and medicines for detecting / treating aging and apoptosis diseases of ovarian granulosa cells. The model provides an effective experimental animalmodel for reproductive development genetics, preparation of medicines for detecting / treating ovarian diseases and screening of related medicines, and has good practical value, good medical clinical application prospect and great social benefit.
Owner:SHANGHAI GERIATRIC INST OF CHINESE MEDICINE

Method for obtaining FSHR full-length coding region sequence with multiple splice forms

The invention provides a method for obtaining an FSHR (follicle-stimulating hormone receptor) full-length coding region sequence with multiple splice forms. The method comprises the steps: extracting total RNA of a sheep granular cell, and reversely transcribing into cDNA; according to initiation codon upstream and termination codon downstream of a cDNA sequence of a sheep FSHR gene, designing two pairs of primers, wherein an upstream primer F1 is CAAAAGGGCTCAGTGTGGAG, an upstream primer F2 is CGTCTGCAGAAGCAGAAGCA, a downstream primer R1 is CTTATGGATGTGCCAGGGAG, and a downstream primer R2 is AGTGCTCTGTCAGCTCTTGC; taking the obtained cDNA as a template, carrying out PCR amplification of the FSHR gene, and extracting the PCR product by a Tiangen gel extraction kit; and adding an A tail into the PCR product, and cloning, sequencing and verifying an T vector. The obtained FSHR full-length coding region sequence with the multiple splice forms is characterized by comprising the oFSHR695, oFSHR694, oFSHR648, oFSHR633 and oFSHR595.
Owner:新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心

Blood cell separation method for portunus trituberculatus

The invention discloses a blood cell separation method for portunus trituberculatus. The method comprises the following steps: diluting iodixanol with an isotonic solution obtained by regulating an osmotic pressure of a PBS buffer solution by utilizing a sodium chloride solution, and performing gradient preparation to obtain three iodixanol solutions of different concentrations; forming gradient solutions of different densities by adopting a cushion technology, and standing to form a continuous density gradient solution to serve as a cell separation solution; collecting blood cells of portunustrituberculatus, and taking mixed cell suspension obtained by diluting the isotonic solution; slowly dropping the mixed cell suspension into the cell separation solution, centrifuging, and dividing the blood cells of portunus trituberculatus into three layers, wherein the uppermost layer refers to clear cells, the intermediate layer refers to small granular cells, and the lowest layer refers to large granular cells. The method has the advantages that only one-step density gradient centrifugation is adopted, the operation is simple, and experiments discover that the separated blood cells haveexcellent viabilities and can be used for cell culture.
Owner:NINGBO UNIV

Method for producing tripterygium alkaloids by plant suspension cultivation cell

The method for producing tripterygium alkaloids includes the following steps: selecting and taking explant, surface sterilization, inducing callus, subculture, selecting cell strain, solid subculture, suspension culture, separating large-block callus, storing large-block callus, separating granular cell line with good dispersity, cell line suspension culture, mixed on-culture of suspension culture cell line and large-block callus and extracting total alkaloid. The total thunder god vine alkaloid amount contained by the invented product is 2.9 times than of plant body, and it has the advantages of strong cell line stability, short productino period, high medicine component content, and its production process doen not contaminate environment.
Owner:北京达科豪科技有限公司 +2

Application of PIK3R2 in pig ovarian granular cells

The invention discloses application of PIK3R2 in pig ovarian granular cells. A PIK3R2 interference small fragment is synthesized with PIK3R2 as a research object, ovarian granular cells are transfected, it is found that PIK3R2 promotes granular cell apoptosis and inhibits cell proliferation, and research is performed by regulating the functions of miR-126-3p cells expressed by PIK3R2 in granular cells. After exogenous disturbance PIK3R2 is supplemented, cell function phenotype caused by miR-126-3p can be restored through the verification, it is shown that PIK3R2 is an important functional target of miR-126-3p in granular cells, and miR-126-3p can regulate cell development of the granular cells by means of PIK3R2. By means of PIK3R2 and application of targeted miRNA of miR-126-3p in ovarian granular cells, PIK3R2 has good application value for researching an ovarian follicles locking mechanism.
Owner:SOUTH CHINA AGRI UNIV

Application of RBP1 gene in sow ovarian granular cells

The invention discloses application of a RBP1 gene in sow ovarian granular cells. RBP1 is taken as a research object, and a molecular and cell biological method is adopted to study the application ofthe RBP1 in sow ovarian granular cells. The molecular and cell biological method includes the following steps that through ChIP-Seq, it is found that the enrichment degree of H3K4me3 is different in RBP1 gene promoter regions in follicles different in size; through qRT-PCR, it is found that the expression quantity of the RBP1 gene in follicles different in size is different significantly. By promoting or inhibiting the enrichment degree of H3K4me3 in the sow ovarian granular cells, it is found that promotion of the enrichment degree of H3K4me3 can promote transcription of the RBP1 gene, and inhibition of the enrichment degree of H3K4me3 can inhibit transcription of the RBP1 gene; through RBP1 over-expression or interference with RBP1, it is found that RBP1 can promote proliferation of thesow ovarian granular cells and inhibit apoptosis.
Owner:SOUTH CHINA AGRI UNIV

Method for constructing heterozygote mouse model of Amh gene fixed-point knock-in 2A-Cre and application thereof

ActiveCN109943564AGood medical clinical application prospectStable introduction of DNAIn-vivo testing preparationsDiseaseGranular cell
The invention discloses a method for constructing a heterozygote mouse model of an Amh gene fixed-point knock-in 2A-Cre and an application thereof. According to the method, the heterozygote mouse model can be obtained, and an effective experimental animal model is provided for the research of POF pathogenesis, the research and development of drugs and the evaluation of drug effect. The invention provides the application of the heterozygote mouse model in screening and preparing drugs for detecting / treating reproductive development diseases, drugs for detecting / treating ovarian diseases and drugs for aging and apoptosis diseases of ovarian granulosa cells. The invention provides the method for constructing the heterozygote mouse model for the first time, and no domestic and foreign literature reports are found before. The model has good medical clinical application prospect, has great application value in preparing medicaments for detecting / treating ovarian diseases, and has great social benefit.
Owner:SHANGHAI GERIATRIC INST OF CHINESE MEDICINE

Separation culture method of laying duck small yellow follicle granular cells

The invention discloses a separation culture method of laying duck small yellow follicle granular cells. The separation culture method includes following steps: selecting a laying duck, killing the laying duck by bloodletting a jugular vein, respectively using bromogeramine diluent and alcohol to disinfect the body of the laying duck, and separating follicles of 3-8 mm in an ovary; stripping outer-layer blood vessels and connective tissue of the follicles, fixing the follicles, discharging yolk, stripping granular cell layers, and cleaning before centrifuging to abandon supernate, adding an enzymolysis solution for digestion, sieving, cleaning with an M199 culture medium, centrifuging to abandon supernate; adding red blood cell lysis liquid, and centrifuging to abandon supernate; adding an M199 culture medium containing fetal calf serum, suspending granular cells, adjusting density of suspension cells, and inoculating for culture to obtain the laying duck small yellow follicle granular cells. The separation culture method is suitable for both separation of granular cells in big yellow follicles of ducks and separation of small yellow follicle granule cells; the granular cells are high in purity and activity and stable in cell function; the separation culture method has the advantages of simple operation, easiness in repeating and stable result.
Owner:ANIMAL SCI RES INST GUANGDONG ACADEMY OF AGRI SCI

1ncRNA SFR1 as well as application thereof and product and method for regulating and controlling follicular development

The invention provides 1ncRNA SFR1 as well as application thereof and a product and a method for regulating and controlling follicular development and relates to the technical field of biologics. Theinvention provides novel long-chain non-encoding RNA SFR1, wherein the 1ncRNA SFR1 is related to apoptosis of granular cells, and by regulating and controlling expression of 1ncRNA SFR1, correspondingregulation and control functions on channels, genes and hormones related to follicular development can be also achieved. Therefore, by adopting the 1ncRNA SFR1 and a corresponding product provided bythe invention, effective in-vivo / in-vitro regulation and control on follicular development can be achieved, and powerful guarantee can be provided for research on follicular development and physiology and biochemical functions. In addition, through the regulation and control functions of the 1ncRNA SFR1 on follicular development, the population fertility can be improved while excellent propertiesof genetic resources of mammals, particularly sheep, are maintained, and thus the economic benefits of breeding can be increased.
Owner:JILIN ACAD OF AGRI SCI

Oocyte culture fluid and culture method thereof

The invention provides oocyte culture fluid and a culture method of the oocyte culture fluid. The oocyte culture fluid is easy to prepare and low in cost and comprises G-IVF culture fluid, follicular fluid and granular cells. According to the oocyte culture fluid and the culture method of the oocyte culture fluid, the follicular fluid extracted from the follicle of a patient and granular cells around the oocyte are treated specially and added into the culture fluid, so that in-vitro maturity culturing is carried out on the immature egg of the remaining ICSI period, then fertilization, embryonic development and pregnancy results are analyzed, a simple, convenient and effective in-vitro maturity culture scheme is set up, the effective utilization rate of the immature egg is increased, and more pregnancy opportunities can be provided for the infertility patient.
Owner:付蕾

Separation, primary culture and subculture method for granular cells in follicles in porcine ovary GV period

The invention discloses a separation, primary culture and subculture method for granulosa cells in follicles in a pig ovary GV period. The method comprises the following steps: collecting a cyst-free healthy pig ovary, and cleaning the ovary; separating granular cells; carrying out primary culture on the granular cells for 48 hours; changing liquid in a culture bottle for primary culture; after changing the liquid, continuously culturing the cells for 36 hours, and cleaning, digesting and terminating the cultured cells; and finally, sub-packaging and subculturing the cells for 48 hours. The invention provides a pollution-free ovary collection method, optimizes a granulosa cell acquisition and culture method, and further provides a primary granulosa cell subculture method. Granular cells obtained by the method are almost free of pollution, high in cell uniformity, high in consistency in the growth and development period, high in cell survival rate, high in success rate of making oxidative stress models and the like, and high in result consistency, practicability, stability and feasibility. In addition, the number of obtained cells is large, many subsequent experiments can be carried out, the number of times of going to a slaughter house is reduced, and the efficiency is high.
Owner:DALI UNIV

Application of nicotinamide mononucleotide in preparation of medicine for preventing, improving and/or treating polycystic ovarian syndrome

The invention relates to the field of biological medicines, in particular to an application of nicotinamide mononucleotide in preparation of a medicine for preventing, improving and / or treating the polycystic ovarian syndrome (PCOS). A PCOS rat model is constructed by combining letrozole with high-fat feed, the protective effect of the nicotinamide mononucleotide on the PCOS is studied, and experimental results show that nicotinamide mononucleotide intervention can obviously improve the follicular development condition of PCOS rats, increase the number of corpus luteum, thicken granular cell layers, restore the oestrus cycle of the rats, reduce body weight and fasting blood sugar, reduce serum androgen, luteinizing hormone, insulin and insulin resistance index level, increase secretion oflactic acid and ATP, and improve ovarian energy metabolism.
Owner:NANHUA UNIV

Embryonic stem cell specific marker GM-CSFR alpha and application thereof

InactiveCN103193882AImprove featuresHigh sensitivityMicroorganism based processesTissue cultureGranular cellMacrophage Colony-Stimulating Factor Receptors
The invention provides an embryonic stem cell specific marker GM-CSFR alpha (granular cell-macrophage colony stimulating-factor receptor alpha link) and an application thereof. The embryonic stem cell is directly used as immunogen, the prepared GM-CSFR alpha polyclonal antibody or rabbit antibody GM-CSFR alpha is used as a stem cell identification reagent, the detected specificity and sensitivity are higher, and the embryonic stem cell specific marker GM-CSFR alpha can be used for the separation and activity detection of the embryonic stem cell. An embryonic stem cell detection reagent kit containing the GM-CSFR alpha polyclonal antibody or a rabbit antibody GM-CSFR alpha not only can be used for testing the totipotency of the embryonic stem cell, but also can be used for detecting the activity of the stem cell, so that the function of the detection reagent kit can be enlarged.
Owner:ZHEJIANG UNIV

Novel cervical exfoliated cell separation method

The invention discloses a novel cervical exfoliated cell separation method, which is characterized by: placing cervical exfoliated cells in phosphate buffer solution (PBS) and uniformly mixing by whirling to obtain cell suspension; adding the cell suspension into mucilage separating solution; centrifuging, removing supernate, adding the phosphate buffer solution (PBS) again and re-suspending sediment to obtain re-suspended cell suspension; and adding the re-suspended cell suspension into neutral granular cell separating solution Ficoll, centrifuging, removing supernate and obtaining the settlement which is pure cells after centrifugation. The method of the invention greatly purify clinically extracted cervical exfoliated cell specimens, adopts simple and convenient operation steps, is suitable for large-scale cell separation with stable and reliable effect, can obtain high-purity target cells, has high actual use value and a promising market prospect.
Owner:ANHUI PROVINCIAL HOSPITAL

Application of trichostatin A (TSA) to preparation of medicament for inhibiting activities of swine ovary granular cells

The invention belongs to the field of medicaments and veterinary medicines and discloses application of trichostatin A (TSA) to preparation of a medicament for inhibiting activity of swine ovary granular cells. In the invention, the influence of the TSA to the activities of the swine ovary granular cells is systemically studied, and a result shows that the TSA has no influence to the growth of the swine ovary granular cells at low concentration (below 10ng / mL), with the increase of the concentration, the growth of the swine ovary granular cells is inhibited (P<0.05), and the inhibition effect is dose-dependent. After the granular cells are treated by using 200ng / mL TSA, the cell cycle is retardant within a period G0 / G1, and the marked decrease of gene expression of Cyclin D2 and CDK4 (Cyclin-Dependent Kinase 4) is possible to be an important reason for the cycle retardance. Accordingly, the TSA can be applied to preparation of the medicament for inhibiting the activities of the swine ovary granular cells.
Owner:NANJING AGRICULTURAL UNIVERSITY

Solution and method for culturing bovine somatic cell cloned embryos

The invention provides a solution and method for culturing bovine somatic cell cloned embryos. The culture solution comprises merchant oviduct culture solution for bovine somatic cell cloned embryos (mSOF), and comprises activin A as well, wherein the concentration of the activin A is 20 to 80 ng / mL. The culture method comprises: culturing a bovine somatic-cell granular cell monolayer under conventional conditions for 3 days; adding the activin A in a concentration of 20 to 80 ng / mL to the merchant oviduct culture solution for bovine somatic cell cloned embryos (mSOF) from the fourth day; obtaining the solution for culturing bovine somatic cell cloned embryos; and using the solution for culturing bovine somatic cell cloned embryos for 5 days to obtain the bovine somatic cell cloned embryos. The solution and the method have the advantages of improving the 8 / 16 cell rate, blastula rate and hatchability of embryos and significantly raising the gene expression level of Na / K-ATPase, Glut-1, ActR II, Smad2 and the like, and are particularly suitable for application in the field of bovine somatic cell cloning.
Owner:NORTHWEST A & F UNIV

Method for evaluating sperm intracorporal conception rate of breeding bull according to extracorporal fertilization rate of breeding bull

ActiveCN103392670AEstimation of Actual FertilityKeep abreast of fertilityAnimal husbandryGranular cellBovine oocyte
The invention discloses a method for evaluating the sperm intracorporal conception rate of a breeding bull according to the extracorporal fertilization rate of the breeding bull, and belongs to the technical field of animal reproduction. The method includes the steps that COCs is washed by bull oocyte egg picking liquid and bull oocyte mature liquid respectively, placed in the bull oocyte mature liquid for culture, and placed in bull sperm drips capacitated by BO-AB liquid for fertilization; then granular cells are taken off by IVC SOF liquid, then eggs with the granular cells which are taken off are placed in SOF liquid for culture, and the extracorporal fertilization cleavage rate is measured; artificial insemination is conducted, the conception rate of the breeding bull is measured, and the breeding bull is evaluated according to the relevance of the cleavage rate and the conception rate. The method has the advantages that by the utilization of sperm extracorporal fertilization rate of the breeding bull, the practical conception capacity of the breeding bull can be rapidly estimated, the breeding capacity of the breeding bull can be known in time, the problem that a large amount of time, labor and money need to be wasted for detecting the breeding capacity of a breeding bull individual through manual insemination is solved, and resources are saved.
Owner:内蒙古赛科星繁育生物技术(集团)股份有限公司

Application of HMGA2 gene in polycystic ovary syndrome disease

The present invention provides a method or a kit for diagnosing polycystic ovary syndrome by the detection of HMGA2-IMP2 pathway. The present invention also provides a method or a kit for diagnosing female granular cell abnormality by the detection of the HMGA2-IMP2 pathway.
Owner:SHANDONG UNIV +1

Jujube cheese and preparation process thereof

The invention discloses a jujube cheese which is prepared by mixing the following raw materials in parts by weight: 25-35 parts of golden-silk jujube, 25-35 parts of wild jujube, 0.6-1 part of sweetener, 0.15-0.3 part of stabilizer and 10 parts of xylitol. The advantages of the jujube of the invention are as follows: 1. the jujube cheese can kill enzyme in granular cells to prevent browning phenomenon; 2. the jujube cheese does not damage stone cells and pulp in the jujube pulp; 3. the jujube cheese can lead fine pulp particles to be evenly suspended in the jujube pulp to increase mouth feel, thus people can feel the color, aroma and taste of the jujube, and CMC is odorless, tasteless and non-toxic, and has good binding force and diffusivity; and 4. the jujube cheese preserves the nutrition constituents and the flavor of red jujubes and the wild jujubes to the greatest extent, and is a natural, green, healthy and high-nutritive-value beverage.
Owner:TIANJIN HENGAN FOOD

Culture method for in-vitro human oocyte preantral follicles

InactiveCN103146643APromote maturityGuaranteed quality of lifeGerm cellsGranular cellGranulosa cell proliferation
The invention provides a culture method for in-vitro human oocyte preantral follicles. The culture method is characterized by comprising the following specific steps of: 1) unfreezing the in-vitro human oocytes placed in frozen protecting solution containing cane sugar and propylene glycol and subjected to liquid nitrogen low-temperature storage, and then reviving and culturing; and 2) separating and extracting the in-vitro human oocytes obtained by reviving and culturing, then placing the in-vitro human oocytes in nutrient solution containing follicle-stimulating hormone (FSH), and performing preantral culture, wherein the culture for in-vitro human oocyte preantral follicles needs the support of FSH, and FSH can be used for promoting the growth of the follicles, increasing the survival time of the follicles, promoting the proliferation of granular cells, and promoting the maturation of the oocytes, as well as is an important factor for regulating and controlling the growth and development of the follicles; and trichostatin A can be used for effectively inhibiting the proliferation of tumour cells, regulating and controlling the progress of a cell cycle and then inducing the apoptosis of tumour cells, thus ensuring the survival quality of the cells. The method has important significance on researches in the aspect of test-tube babies.
Owner:孔凡锋
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More