22 results about "Pro-Apoptotic Proteins" patented technology

The invention belongs to the field of biological medicines, and particularly discloses application of a Ptprj agonist GJ103 in preparation of a medicine for treating acute kidney injury (AKI) induced by cisplatin. In-vivo and in-vitro experiments prove that the GJ103, by activating Ptprj, can significantly down-regulate expression of pro-apoptotic protein Bax and Cleved Caspase-3, up-regulate anti-apoptotic protein Bcl2 and reduce infiltration of inflammatory factors TNF-alpha and IL-6, so that apoptosis and inflammatory response of renal tubular epithelial cells are relieved. In in-vivo experiments, GJ103 (20-40mg / kg / day) can reduce serum creatinine and urea nitrogen levels of cis-platinum model mice and improve pathological injuries such as renal tubule dilatation; in in-vitro experiments, 20-40 [mu] M of GJ103 can inhibit apoptosis of renal tubular epithelial cells and reduce expression of renal injury markers NGAL and Kim-1. The pharmaceutical composition contains GJ103 and a pharmaceutical carrier, the preparation form can be a 4mg / mL injection (the purity is greater than or equal to 99.46%) or an oral preparation, and a new strategy is provided for clinical treatment of cisplatin renal toxicity.

The invention discloses an application of a phellinus igniarius extract in preparation of a lung cancer H1299 cell inhibitor, the active ingredient of the inhibitor comprises the phellinus igniarius extract, and the inhibitor at least has the following functions: a, inhibiting proliferation and clone formation of lung cancer H1299 cells; b, inhibiting the invasion and metastasis capability of lung cancer H1299 cells; c, arresting the cell cycle of the lung cancer H1299 in the S period; and d, the lung cancer H1299 cyclin Cyclind1 is down-regulated, the pro-apoptotic protein Bax is up-regulated, and the expression of p-AKT and Bcl-2 proteins is inhibited. The phellinus igniarius extract is phellinus igniarius extract powder or phellinus igniarius extract liquid, and the concentration of the phellinus igniarius extract liquid is 0.1-1.0 mg / ml. According to the application of the phellinus igniarius extract in preparation of the lung cancer H1299 cell inhibitor, a new thought is provided for preparation and / or screening of lung cancer drugs, a good working foundation is laid, and a new strategy is provided for clinical application.

Strategies for blocking anti-apoptotic proteins or activating proapoptotic proteins in combination with immune checkpoint blockade therapy to prevent or reverse acquired resistance are described, providing methods to detect, prevent, and / or reverse acquired resistance to ICB therapy. Anti-melanoma therapy can be enhanced by administering an effective amount of an activator of a pro-apoptotic protein, such as a BAX activator, and / or a downregulator of an anti-apoptotic protein, such as a BH3 mimetic. Also described is a method of detecting acquired resistance to anti-melanoma therapy by assaying a sample of tumor DNA for deletion and / or amplification of genes indicative of acquired resistance.

The invention relates to the technical field of bacteriophages, and particularly discloses a genetically engineered bacteriophage hydrogel for fat ablation therapy and a preparation method and application of the genetically engineered bacteriophage hydrogel for fat ablation therapy, and the genetically engineered M13 bacteriophage is formed by inserting an adipocyte targeting sequence ATS into a gene VIII of the M13 bacteriophage, a coding gene of pro-apoptotic protein Bax is integrated in a genome of the M13 bacteriophage; the nucleotide sequence of the adipocyte targeting sequence ATS is TGTAAAGGTGGCCGTGCTAAAGACTGT, the expression level of pro-apoptotic protein Bax in adipocytes of a treatment group is remarkably improved through hydrogel constructed through the M13-ATS-Bax bacteriophage, experiments prove that the constructed M13-ATS-Bax bacteriophage can be combined with the adipocytes in a targeting mode and efficiently express the Bax protein, and the expression level of the pro-apoptotic protein Bax is remarkably improved. The compound formed by the hydrogel has a remarkable effect of killing fat cells.

The present invention discloses an application of a medicated serum prepared from Herba Lycopodii in liver cancer cells, and belongs to the field of medical technology. The present invention provides a medicated serum prepared from Herba Lycopodii in the preparation of a drug for inhibiting the proliferation and invasion of liver cancer cells, and promoting apoptosis of liver cancer cells. The present invention verifies that the Herba Lycopodii medicated serum can effectively inhibit the proliferation and invasion of HepG2 cells, promote cell apoptosis, and inhibit the phosphorylation of mTOR protein in the mTOR signaling pathway of HepG2 cells, upregulate the expression of pro-apoptotic proteins caspase-9, caspase-3, and bax, and downregulate the expression of anti-apoptotic protein bcl-2. The present invention studies the effects of the Herba Lycopodii medicated serum on related apoptosis genes in the mTOR molecular signaling pathway of HepG2 liver cancer cells and the proliferation, invasion, and apoptosis of HepG2 liver cancer cells from the perspective of in vitro experiments, in order to provide an experimental basis for clinical application.

The present invention relates to the stratification and treatment of patients suffering of cancer. Due to the fact that anti-PD1 therapy targets lymphocytes and the efficiency of anti-cancer therapy is measured by the impact on the tumor cells, the inventors postulated that studying the molecular mechanisms of resistance of anti-PD1 therapy should take into consideration existing intercellular communication between lymphocytes and tumor cells. As exosomes are the carriers for the intercellular transfer of the miRNA responsible of chemoresistance, they herein investigated whether exposure of T cells to anti-PD1 therapy might promote the expression of exosomal miRNA (exomiR) causing the chemoresistance of cancer cells. Surprisingly, they found that anti-PD1 exposure of T-cell promotes an enrichment of exosomal miRNA-4315. They also noted that exosomal miRNA-4315 induced a phenomenon of apopto-resistance to conventional chemotherapies in cancer cells receiving exosomal miRNA-4315. At molecular level, they discern that the apopto-resistance phenomenon was associated with the miRNA-4315-mediated down-regulation of Bim, a pro-apoptotic protein. In cellular and mice models, they observed that the BH3 mimetic agent ABT263 circumvented this resistance. Thus, the invention relates to methods of stratification using exosomal miRNA-4315 and method of treatment of patients suffering of cancer using BH3 mimetic agent.

The present invention provides a kind of magnetic targeting, engineered extracellular vesicle loaded with hepatocyte responsive mRNA and its construction method and application, which belongs to the field of biomedicine technology. A kind of engineered extracellular vesicle, including genetically engineered extracellular vesicles, the surface of which is coupled with transferrin-modified superparamagnetic iron oxide nanoparticles and loaded with an agonist of the pro-apoptotic protein BAX; PTGFRN (Δ687) ‑ MCP fusion protein is expressed on the extracellular vesicle membrane, and MCPRNA binding protein increases the loading capacity of the extracellular vesicle to iBaxmRNA containing miR ‑ 122 recognition site; The agonist of the pro-apoptotic protein BAX is embedded in the phospholipid bilayer of the extracellular vesicle. The preparation method of the engineered extracellular vesicle of the present invention is simple, has the advantages of aortic plaque magnetic targeting, efficient nucleic acid drug loading, low side effects, etc., and provides a reference for the treatment of atherosclerosis and other age-related diseases.

The application discloses an mRNA drug for enhancing T cell efficacy and application, and belongs to the technical field of biological medicine. The mRNA drug encodes a protein, which is a BH3 domain of pro-apoptotic protein Puma or Bim fused with an aptamer scaffold; and the administration mode is an intratumoral administration dosage form. The application provides an mRNA anti-tumor drug, which is locally administered intratumorally in the form of the mRNA drug, induces local cell apoptosis of a lesion, and can synergistically enhance T cell-mediated killing effect. Finally, the effect of synergistically inhibiting growth of a solid tumor in vivo is achieved. The novel mRNA drug provided by the application exhibits a strong and effective tumor inhibition effect in a solid tumor model.

Streptomyces sp. MTCC-25420 and Streptomyces sp. MTCC-25512 isolated from the Shivalik region of India, has been demonstrated for tetrahydroanthracene antibiotics including setomimycin production. Combination of specific physico-chemical conditions have led to the antibiotic complex formation (upto 5.0 g / L) in 2-10 days of fermentation with maximum production at 4-8 days in shake flask as well as 5 L to 500 L stirred tank bioreactors using modified production media in combination with additional carbon / nitrogen / minerals and elicitations with yields upto 800 mg / L of are 9,9′ bianthracene antibiotic setomimycin. Setomimycin significantly abrogated cancer cell proliferation and inhibited cancer cell migration and invasion in highly metastatic cancer cells (MiaPaca-2, MCF-7, HT-29 and HCT-116) of Pancreatic, Breast and Colorectal origin by down regulating ERK and MEK proteins which are the major regulators of cell proliferation, differentiation and apoptosis. Interestingly setomimycin upregulated pro-apoptotic protein Par-4 and downregulated anti-apoptotic protein BCL-2 in Colon as well as breast cancer cells HCT-116 and MCF-7 respectively. Strong affinity of setomimycin towards MEK protein has been confirmed by molecular docking studies and Western blot analysis.

The invention relates to application of beauveria bassiana in preparation of a medicine for treating multiple myeloma. The invention shows that the Beauverin has a remarkable effect of resisting multiple myeloma, and the action mechanism of the Beauverin is that the expression of anti-apoptotic protein Bcl-2 is inhibited, the expression of pro-apoptotic protein Bax is promoted, the release of cytochrome C is promoted, the activation of Caspase proteases such as Caspase 3 and the like is caused, and finally the apoptosis of cells is caused. Beauveria bassiana regulates an apoptosis pathway through multiple targets, plays a role in resisting multiple myeloma, and provides an experimental basis for developing a novel treatment strategy. Compared with the prior art, the specific action mechanism of the beauveria bassiana is defined, and the value of the beauveria bassiana as a potential anti-tumor drug is highlighted.

The invention discloses application of INO80E in preparation of an anti-atherosclerosis medicine, and belongs to the technical field of biological medicines. The invention reveals for the first time that INO80E can interact with histone deacetylase 1 (HDAC1) so as to deacetylate a transcription factor YY1, so that vascular endothelial cell apoptosis is inhibited, and the purpose of delaying an atherosclerosis process is achieved. Experiments prove that the expression level of INO80E in an atherosclerosis model is remarkably reduced; overexpression of INO80E can effectively reverse endothelial cell apoptosis induced by oxidized low-density lipoprotein (ox-LDL) and restore expression balance of anti-apoptotic protein Bcl-2 and pro-apoptotic protein BAX. Therefore, the INO80E can be used as a brand new drug target for treating or preventing atherosclerosis related diseases, can be used for preparing diagnostic reagents or drugs, and has the advantages of no equipment dependence and strong targeting.

The invention discloses an application of a compound in treatment of lung cancer, the compound is 9, 10-bis (chloromethyl) anthracene, the molecular formula of the compound is C16H12Cl2, the compound is combined with a G-quadruplex structure in cell genome DNA to induce a continuous DNA damage reaction, and the effect of treating the lung cancer is achieved by down-regulating an EGFR / PI3K / Akt / Erk signal channel, up-regulating pro-apoptotic protein and down-regulating anti-apoptotic protein. Therefore, proliferation of EGFR mutation non-small cell lung cancer cells is inhibited, and apoptosis of the cells is induced. The invention can overcome the defects in the prior art that the EGFR mutation NSCLC treatment means is easy to generate drug resistance, has large toxic and side effects and lacks new mechanism small molecule drugs.

This invention belongs to the field of novel pharmaceutical uses, and more specifically, relates to the application of ethyl acetate extract of turmeric in the preparation of drugs for treating acute ulcerative colitis. The preparation method of the extract is as follows: turmeric slices are soaked overnight in 10-20 times their weight in a 60%-80% ethanol solution, refluxed at 80-90°C for 2-4 times, each time for 1-3 hours. The extracts are combined and concentrated until no alcohol odor remains, then dried to constant weight to obtain the total extract. The total extract is reconstituted with water and extracted 2-4 times with ethyl acetate at an equal volume ratio. The extracts are combined and dried to constant weight to obtain the final product. Experimental results show that this extract can significantly improve weight loss, disease activity index, colonic shortening, and histopathological damage in model mice, and effectively upregulate intestinal tight junction proteins and downregulate the expression of pro-inflammatory factors and pro-apoptotic proteins. This extract can be formulated into various dosage forms, providing a new natural drug option for the treatment of UC.

A nucleic acid for the controlled expression of a nucleic acid encoding a pro-apoptotic protein in an individual, including: a regulatory polynucleotide including a minimal promoter and at least one AARE (amino acid response element) nucleic acid, the regulatory polynucleotide being activated in an individual upon consumption of a diet deficient in at least one essential amino acid; and a nucleic acid encoding a pro-apoptotic protein, which is placed under the control of the regulatory polynucleotide.

Provided nucleic acid-based expression construct for the target cell-specific production of a therapeutic protein, such as a pro-apoptotic protein, within a target cell, including a target cell that is associated with aging, disease, or other condition, in particular a target cell that is a senescent cell or a cancer cell. Also provided are formulations and systems, including fusogenic lipid nanoparticle (LNP) formulations and systems, for the delivery of nucleic acid-based expression constructs as well as methods for making and using such nucleic acid-based expression constructs, formulations, and systems for reducing, preventing, and / or eliminating the growth and / or survival of a cell, such as a senescent cell and / or a cancer cell, which is associated with aging, disease, or other condition as well as methods for the treatment of aging, disease, or other conditions by the in vivo administration of a formulation, such as a fusogenic LPN formulation, comprising an expression construct for the target cell-specific production of a therapeutic protein, such as a pro-apoptotic protein, in a target cell that is associated with aging, disease, or other condition, in particular a target cell that is a senescent cell or a cancer cell.

The application discloses application of norisoboldine or a pharmaceutically acceptable salt, a polymorph or a solvate thereof in preparation of a drug for preventing or treating myocardial ischemia-reperfusion injury. It is found that the compound can rapidly target ischemia-reperfusion damaged myocardial cells, inhibit ROS / MDA oxidative stress, quench inflammation storm, and reversely change mitochondrial membrane potential collapse, down-regulate pro-apoptotic protein Bax and up-regulate anti-apoptotic protein Bcl-2, and then inhibit Caspase 3 cleavage, thereby effectively blocking a lethal apoptosis network of myocardial cells from the source. The drug can significantly improve the survival rate of myocardial cells and reduce the myocardial infarction area, and provides a multi-target, mechanism clear new candidate drug for clinical prevention and treatment of acute cardiovascular critical illness.

The present application relates to the technical field of medicine, and particularly relates to application of ganoderma triterpene in preparation of medicine for treating cervical cancer. Ganoderma triterpene (Ganodecalone A, referred to as GDA) can inhibit migration, proliferation and clonogenic capacity of cervical cancer cells; GDA can arrest the cell cycle of cervical cancer cells in G0 / G1 phase, and with the increase of the concentration of GDA, the proportion of cells in G0 / G1 phase is significantly increased; GDA can promote apoptosis of cervical cancer cells, and with the increase of the concentration of GDA, the proportion of late apoptotic cells is significantly increased; GDA can promote apoptosis of cervical cancer cells by reducing the phosphorylation level of Akt in the cervical cancer cells. GDA and Akt phosphorylation agonist SC79 are mutually antagonistic, and when GDA is combined with Akt phosphorylation inhibitor MK-2206, the apoptosis of two strains of cervical cancer cells is promoted. GDA can induce apoptosis of cells by inhibiting phosphorylation of Akt, up-regulating pro-apoptotic protein Bad and down-regulating anti-apoptotic protein Bcl-2, and thus the anti-tumor effect is exerted.

The invention provides application of frankincense processed product volatile oil in preparation of a medicine. The medicine is used for resisting apoptosis or promoting cell proliferation. The frankincense processed product volatile oil can activate a cAMP signal channel and promote the expression of PKA so as to influence a downstream signal channel, inhibit the phosphorylation of pro-apoptotic protein Bad and promote the expression of anti-apoptotic proteins Bcl-2 and Bcl-xl, thereby effectively inhibiting the apoptosis. Therefore, when the frankincense processed product volatile oil is prepared into the medicine, cell apoptosis can be effectively inhibited, and then cell proliferation is promoted.

The risk with introducing manipulated T-cell is unforeseen adverse events. During the development of chimeric antigen receptor (CAR) T-cell therapies almost all clinical trial has shown some adverse events ranging from cytokine mediated toxicities to tissue damage and death. By the present invention, we aim to induce multiple layers of safety checkpoints. As a last resort we will be able to induce suicide in all cells which we have introduced to the body. Here we describe the scientific background to the parts of our suicide switch and the details regarding the proteins which are included. Safety switches are being tested on CAR-T cells, but they have a few drawbacks. Due to the limited space on the CAR vector, there is only room for one gene switch. Presently the results show they induce apoptosis in around 70-90% of cells, while the desired target is for all cells to be removed from the tissue. By utilising the space available on a synthetic chromosome, we can include multiple genes under Tet operons which allow us to turn multiple genes on / off. Life or death of a cell depends on the balance of the pro and anti-apoptotic proteins. The scale is always shifting a bit back and forth but only when tipped completely over the apoptotic cascade is initiated. By fine tuning the balance we aim to ensure that the hSync carrying cells have a survival advantage in the tumour in the absence of inducing agent. On the other hand, the moment that agent is administrated the cells will undergo apoptosis and express “find me” and “eat me” markers making sure they are removed without risk of tissue damage. The present invention encompasses compositions and methods for use in cellular gene therapeutics using a modular approach to genetically engineer cells to carry a synthetic chromosome having a regulatable system including one or more safety switches.

The embodiment of the invention provides a preparation method of mitochondrial derived vesicles as well as a preparation and application of the mitochondrial derived vesicles. The preparation method comprises the following steps: feeding SIRT3 plasmids and an LNPs lipid nanoparticle solution into aged Raw264.7 macrophages, extracting mitochondria, incubating, and then extracting the mitochondria derived vesicles. According to the preparation method, the mitochondrial derived vesicles with high-efficiency delivery advantage and treatment effect can be obtained, and the vesicles can regulate and restore macrophage metabolism, so that senescent macrophages are updated, and meanwhile, pro-apoptotic proteins overexpressed in a damaged environment are consumed, and myofibroblast apoptosis is promoted, so that the treatment effect is achieved. The preparation method is simple and can be applied to large-scale clinical application, and the mitochondrial derived vesicles have biological safety, can be used for continuous observation and treatment and have wide clinical application advantages.

This invention relates to the application of hedera saponin A1 in the preparation of drugs for the prevention and / or treatment of seborrheic keratosis or its secondary lesions. Through molecular-level experiments, this invention verifies that hedera saponin A1 can directly bind to the AKT1 protein, inhibiting AKT1-induced upregulation of pro-apoptotic proteins, thereby initiating cell apoptosis. Compared with existing technologies, this invention is a non-invasive treatment, painless, non-invasive, and leaves no scars after healing. Furthermore, this invention has the dual efficacy of "treating seborrheic keratosis" and "chemopreventing malignant transformation." In addition, hedera saponin A1 has a significant killing effect on seborrheic keratosis lesion cells, exhibiting a killing effect on the epidermal layer of isolated seborrheic keratosis lesion tissue, but without inducing significant apoptosis in dermal cells.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a PCBP2 overexpression vector in preparation of an MIRI treatment medicine. In order to solve the problem that effective targets for resisting apoptosis of myocardial cells are deficient in treatment of apoptosis-dominated myocardial ischemia reperfusion injury, the invention provides application of a PCBP2 overexpression vector in preparation of an MIRI treatment medicine, and endogenous protein PCBP2 down-regulated in ischemia reperfusion injury is accurately up-regulated through the overexpression vector. The myocardial cell apoptosis balance is efficiently regulated and controlled: the apoptosis rate of the myocardial cells is directly reduced by remarkably up-regulating anti-apoptotic protein Bcl-2 and down-regulating pro-apoptotic protein Bax, and the excessive apoptosis process of the myocardial cells in an apoptosis-dominant injury scene is blocked from the molecular level. According to the invention, dual protection on the myocardial structure and function is realized at the same time, the cardiac function can be improved, the myocardial infarction area can be reduced, and a new candidate strategy is provided for anti-apoptosis treatment of apoptosis-dominated myocardial ischemia-reperfusion injury.