Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

76 results about "Ryanodine receptor" patented technology

Ryanodine receptors (RyRs) form a class of intracellular calcium channels in various forms of excitable animal tissue like muscles and neurons. There are three major isoforms of the ryanodine receptor, which are found in different tissues and participate in different signaling pathways involving calcium release from intracellular organelles. The RYR2 ryanodine receptor isoform is the major cellular mediator of calcium-induced calcium release (CICR) in animal cells.

Synergistic Mixtures of Anthranilamide Invertebrate Pest Control Agents

ActiveUS20080027046A1BiocideOrganic chemistryRyanodine receptorPyrazole-5-carboxamide
Disclosed are mixtures and compositions for controlling invertebrate pests relating to combinations comprising (a) 3-bromo-N-[4-chloro-2-methyl-6-[(methylamino)carbonyl]phenyl]-1-(3-chloro-2-pyridinyl)-1H-pyrazole-5-carboxamide, and its N-oxides, and suitable salts thereof and a component (b) wherein the component (b) is at least one compound or agent selected from neonicotinoids, cholinesterase inhibitors, sodium channel modulators, chitin synthesis inhibitors, ecdysone agonists, lipid biosynthesis inhibitors, macrocyclic lactones, GABA-regulated chloride channel blockers, juvenile hormone mimics, ryanodine receptor ligands, octopamine receptor ligands, mitochondrial electron transport inhibitors, nereistoxin analogs, pyridalyl, flonicamid, pymetrozine, dieldrin, metaflumizone, biological agents, and suitable salts of the foregoing. Also disclosed are methods for controlling an invertebrate pest comprising contacting the invertebrate pest or its environment with a biologically effective amount of a mixture or composition of the invention.
Owner:FMC CORP

Mixtures of anthranilamide invertebrate pest control agents

Disclosed are mixtures and compositions for controlling invertebrate pests relating to combinations comprising (a) 3-bromo-N-[4-cyano-2-methyl-6[(methylamino)carbonyl]phenyl]-1-(3-chloro-2-pyridinyl)-1H-pyrazole-5-carboxamide, an N-oxide, or a salt thereof, Formula (1) and (b) at least one invertebrate pest control agent selected from neonicotinoids, cholinesterase inhibitors, sodium channel modulators, chitin synthesis inhibitors, ecdysone agonists, lipid biosynthesis inhibitors, macrocyclic lactones, GABA-regulated chloride channel blockers, juvenile hormone mimics, ryanodine receptor ligands, octopamine receptor ligands, mitochondrial electron transport inhibitors, nereistoxin analogs, pyridalyl, flonicamid, pymetrozine, dieldrin, metaflumizone, biological agents, and salts of the foregoing. Also disclosed are methods for controlling an invertebrate pest comprising contacting the invertebrate pest or its environment with a biologically effective amount of a mixture or composition of the invention.
Owner:FMC AGRO SINGAPORE PTE LTD +1

Mixtures of Anthranilamide Invertebrate Pest Control Agents

InactiveUS20090104145A1BiocideDead animal preservationRyanodine receptorPyrazole-5-carboxamide
Disclosed are mixtures and compositions for controlling invertebrate pests relating to combinations comprising (a) 3-bromo-N-[4-cyano-2-methyl-6-[(methylamino)carbonyl]phenyl]-1-(3-chloro-2-pyridinyl)-1H-pyrazole-5-carboxamide, an N-oxide, or a salt thereof, Formula (1) and (b) at least one invertebrate pest control agent selected from neonicotinoids, cholinesterase inhibitors, sodium channel modulators, chitin synthesis inhibitors, ecdysone agonists, lipid biosynthesis inhibitors, macrocyclic lactones, GABA-regulated chloride channel blockers, juvenile hormone mimics, ryanodine receptor ligands, octopamine receptor ligands, mitochondrial electron transport inhibitors, nereistoxin analogs, pyridalyl, flonicamid, pymetrozine, dieldrin, metaflumizone, biological agents, and salts of the foregoing. Also disclosed are methods for controlling an invertebrate pest comprising contacting the invertebrate pest or its environment with a biologically effective amount of a mixture or composition of the invention.
Owner:HUGHES KENNETH ANDREW +4

Novel anti-arrhythmic and heart failure drugs that target the leak in the ryanodine receptor (RyR2) and uses thereof

The present invention provides methods for limiting or preventing a decrease in the level of RyR2-bound FKBP12.6 in a subject. The present invention further provides methods for treating and preventing atrial and ventricular cardiac arrhythmias, heart failure, and exercise-induced sudden cardiac death in a subject. Additionally, the present invention provides use of JTV-519 in a method for limiting or preventing a decrease in the level of RyR2-bound FKBP12.6 in a subject who has, or is a candidate for, atrial fibrillation. Also provided are uses of 1,4-benzothiazepine derivatives in methods for treating and preventing atrial and ventricular cardiac arrhythmias and heart failure in a subject, and for preventing exercise-induced sudden cardiac death. The present invention also provides methods for identifying agents for use in treating and preventing atrial fibrillation and heart failure, and agents identified by these methods.
Owner:THE TRUSTEES OF COLUMBIA UNIV IN THE CITY OF NEW YORK

O-formammidotiazol-benzamide derivatives based on ryanodine receptor, and preparation method and applications thereof

The invention provides o-formammidotiazol-benzamide derivatives, and a preparation method and applications thereof. The o-formammidotiazol-benzamide derivatives have the chemical structure general formula represented by the formula I or the formula II. The invention discloses the structure general formula of the compounds, the synthesis method and the applications of the compounds as insecticides, acaricides and bactericides; the compounds are mixed with agriculturally acceptable auxiliary agents or synergistic agents for use in processing crafts of preparing the insecticides, the acaricides and the bactericides. The invention also discloses the applications of the compounds in combination with the commercial insecticides, the acaricides, the bactericides, anti-plant virus agents and plant activators for prevention and treatment of agriculture, forestry, horticulture plant diseases, insect attacks, acarus attacks and virus diseases, and the preparation method of the compounds.
Owner:JIANGXI TIANREN ECOLOGY

Novel anti-arrythmic and heart failure drugs that target the leak in the ryanodine receptor (RyR2)

The present invention provides novel 1,4-benzothiazepine intermediates and derivatives, methods for synthesizing same, and methods for assaying same. The present invention also provides methods for using these novel compounds to limit or prevent a decrease in the level of RyR2-bound FKBP12.6 in a subject; to prevent exercise-induced sudden cardiac death in a subject; and to treat or prevent heart failure, atrial fibrillation, or exercise-induced cardiac arrhythmia in a subject. The present invention further provides methods for identifying an agent that enhances binding of RyR2 and FKBP12.6, and agents identified by these methods. Additionally, the present invention provides methods for identifying agents for use in treating or preventing heart failure, atrial fibrillation, or exercise-induced cardiac arrhythmia, and in preventing exercise-induced sudden cardiac death. Also provided are agents identified by such methods.
Owner:THE TRUSTEES OF COLUMBIA UNIV IN THE CITY OF NEW YORK

Synergistic mixtures of anthranilamide invertebrate pest control agents

ActiveUS8022067B2BiocideDead animal preservationRyanodine receptorPyrazole-5-carboxamide
Disclosed are mixtures and compositions for controlling invertebrate pests relating to combinations comprising (a) 3-bromo-N-[4-chloro-2-methyl-6-[(methylamino)carbonyl]phenyl]-1-(3-chloro-2-pyridinyl)-1H-pyrazole-5-carboxamide, and its N-oxides, and suitable salts thereofanda component (b) wherein the component (b) is at least one compound or agent selected from neonicotinoids, cholinesterase inhibitors, sodium channel modulators, chitin synthesis inhibitors, ecdysone agonists, lipid biosynthesis inhibitors, macrocyclic lactones, GABA-regulated chloride channel blockers, juvenile hormone mimics, ryanodine receptor ligands, octopamine receptor ligands, mitochondrial electron transport inhibitors, nereistoxin analogs, pyridalyl, flonicamid, pymetrozine, dieldrin, metaflumizone, biological agents, and suitable salts of the foregoing.Also disclosed are methods for controlling an invertebrate pest comprising contacting the invertebrate pest or its environment with a biologically effective amount of a mixture or composition of the invention.
Owner:FMC CORP

Phosphodiesterase 4D in the ryanodine receptor complex protects against heart failure

InactiveUS20060293266A1Effective treatmentBiocideOrganic active ingredientsPhosphodiesteraseRyanodine receptor complex
The present invention provides compositions useful for treating and preventing ryanodine receptor associated disorders comprising a PDE-associated agent and a pharmaceutically acceptable carrier. The present invention also provides methods for treating or preventing ryanodine receptor associated disorders including cardiac disorders and diseases, skeletal muscular disorders and diseases, cognitive disorders and diseases malignant hyperthermia, diabetes and sudden infant death syndrome. The present invention further provides methods for regulating PKA phosphorylation of a ryanodine receptor as well as methods for regulating Ca+2 release and reuptake in cells. Also provided are kits for use in delivering a PDE-associated agent to cardiac cells in a subject, comprising the composition of the present invention and a catheter.
Owner:THE TRUSTEES OF COLUMBIA UNIV IN THE CITY OF NEW YORK

Novel anti-arrythmic and heart failure drugs that target the leak in the ryanodine receptor (RYR2)

The present invention provides novel 1,4-benzothiazepine intermediates and derivatives, methods for synthesizing same, and methods for assaying same. The present invention also provides methods for using these novel compounds to limit or prevent a decrease in the level of RyR2-bound FKBPl2.6 in a subject; to prevent exercise-induced sudden cardiac death in a subject; and to treat or prevent heart failure, atrial fibrillation, or exercise-induced cardiac arrhythmia in a subject. The present invention further provides methods for identifying an agent that enhances binding of RyR2 and FKBP12.6, and agents identified by these methods. Additionally, the present invention provides methods for identifying agents for use in treating or preventing heart failure, atrial fibrillation, or exercise-induced cardiac arrhythmia, and in preventing exercise-induced sudden cardiac death. Also provided are agents identified by such methods.
Owner:THE TRUSTEES OF COLUMBIA UNIV IN THE CITY OF NEW YORK

O-carboxamido benzamide derivative based on ryanodine receptor, and preparation method and application thereof

The invention provides a series of o-carboxamido benzamide derivatives, and preparation methods and applications thereof. The o-carboxamido benzamide derivatives have the chemical structure general formula represented as the formula I. The invention also discloses: the general formula and the synthetic method of the compounds and an application of the compounds in insecticides, acaricides and bactericides, and a process of preparing the acaricides and bactericides by mixing the compounds with agriculturally acceptable additives or synergists, and also discloses the combination of the compounds with commercial insecticides, acaricides, bactericides, anti-plant-viral agents and plant activators to prevent and treat diseases, pest damage, mite damage and viral diseases in the fields of agriculture, forestry and horticulture.
Owner:JIANGXI TIANREN ECOLOGY

Agents for treating disorders involving modulation of ryanodine receptors

The present invention relates to 1,4-benzothiazepine derivatives and their use to treat conditions, disorders and diseases associated with ryanodine receptors (RyRs) that regulate calcium channel functioning in cells. The invention also discloses pharmaceutical compositions comprising the compounds and uses thereof to treat diseases and conditions associated with RyRs, in particular cardiac, musculoskeletal and central nervous system (CNS) disorders.
Owner:ARMGO PHARMA

Anti-arrythmic and heart failure drugs that target the leak in the ryanodine receptor (RyR2)

The present invention provides novel 1,4-benzothiazepine intermediates and derivatives, methods for synthesizing same, and methods for assaying same. The present invention also provides methods for using these novel compounds to limit or prevent a decrease in the level of RyR2-bound FKBP12.6 in a subject; to prevent exercise-induced sudden cardiac death in a subject; and to treat or prevent heart failure, atrial fibrillation, or exercise-induced cardiac arrhythmia in a subject. The present invention further provides methods for identifying an agent that enhances binding of RyR2 and FKBP12.6, and agents identified by these methods. Additionally, the present invention provides methods for identifying agents for use in treating or preventing heart failure, atrial fibrillation, or exercise-induced cardiac arrhythmia, and in preventing exercise-induced sudden cardiac death. Also provided are agents identified by such methods.
Owner:THE TRUSTEES OF COLUMBIA UNIV IN THE CITY OF NEW YORK

Application of insertion/deletion polymorphic locus in sudden unexplained death detecting kit

ActiveCN106367482AIncreased risk of SUDPredict susceptibilityMicrobiological testing/measurementSudden unexplained deathRyanodine receptor
The invention relates to an application of a No.rs10692285 insertion / deletion polymorphic locus on the gene of a Ryanodine receptor type 2 in detecting sudden unexplained death, and the invention also discloses a kit for detecting the sudden unexplained death. The kit comprises a specific primer pair for detecting the No.rs10692285 insertion / deletion polymorphic locus on the gene of the Ryanodine receptor type 2, wherein the specific primer pair is as follows: a sense primer: 5'GCATGTTTATTATGCAAGTT3', and an antisense primer: 5'ATACAATTAAGCCCACGA3'; or the sequence of a sense primer: 5'CATTCATTGCATGTTTATTATG3', and the sequence of an antisense primer: 5'CATTATTTCACAGCACCCG3'; or the sequence of a sense primer: 5'TAAATGAACAAAGAAAACCTTC\3', and the sequence of an antisense primer: 5'CTCGGTCACAGTAGGTGG3'. The kit provided by the invention, by detecting and analyzing the gene carrying type of the rs10692285 locus on the gene of the Ryanodine receptor type 2 of an individual, can predict the susceptibility of the individual to the sudden unexplained death.
Owner:SUZHOU UNIV

Pesticide composition for shortening the virus lethal time

The present invention is related to a pesticide composition for shortening the virus lethal time that comprises 0.01-75% of a ryanodine receptor insecticide or a diamides insecticide and 107-1012 PIB / ml of baculovirus. The pesticide composition of the present invention can effectively reduce the lethal time to the pest compared to the baculovirus alone, and also can increase the control effect of the pest compared to the same concentration of the insecticide.
Owner:NAT TAIWAN UNIV

Transgenic animal model for catecholaminergic polymorphic ventricular tachycardia (CPVT) and use thereof

The present invention refers to non-human transgenic mammals, preferably rodents, or mice, which comprise a mutation in the gene encoding for the cardiac ryanodine receptor (RyR2).Transgenic animals carrying the amino acid change R4496C in the RyR2 protein show a phenotype similar to that of Catecholaminergic Polymorphic Ventricular Tachycardia (CPVT) (OMIM: 604772). Further provided are methods for using these animals as in vivo model of Catecholaminergic Polymorphic Ventricular Tachycardia and RyR2 dependent arrhythmias, in drug screening and for understanding the molecular basis of RyR2 dependent arrhythmias.
Owner:PRIORI SILVIA G +1

Novel anti-arrhythmic and heart failure drugs that target the leak in the ryanodine receptor (RYR2) and uses thereof

The present invention provides methods for limiting or preventing a decrease in the level of RyR2-bound FKBP12.6 in a subject. The present invention further provides methods for treating and preventing atrial and ventricular cardiac arrhythmias, heart failure, and exercise-induced sudden cardiac death in a subject. Additionally, the present invention provides use of JTV-519 in a method for limiting or preventing a decrease in the level of RyR2-bound FKBP12.6 in a subject who has, or is a candidate for, atrial fibrillation. Also provided are uses of 1,4-benzothiazepine derivatives in methods for treating and preventing atrial and ventricular cardiac arrhythmias and heart failure in a subject, and for preventing exercise-induced sudden cardiac death. The present invention also provides methods for identifying agents for use in treating and preventing atrial fibrillation and heart failure, and agents identified by these methods.
Owner:THE TRUSTEES OF COLUMBIA UNIV IN THE CITY OF NEW YORK

Method of modulating activity of calcium channels in cardiac cells and reagents therefor

The present invention relates generally to novel peptides that are capable of modulating the activity of calcium channels in cardiac cells. More specifically, the present invention provides a method of modulating the activity of a cardiac calcium channel comprising contacting a cardiac ryanodine receptor (RyR2) with an amount of a fragment of a dihydropyridine receptor (DHPR) polypeptide sufficient to modulate the activity of said RyR2, and determining the activity of said calcium channel. The inventive method is useful for the treatment of a range of disorders and diseases associated with cardiac dysfunction, particularly those diseases and disorders involving reduced cardiac output and / or aberrant excitation-contraction coupling, calcium overload, or calcium leakage, in cardiac cells.
Owner:AUSTRALIEN NAT UNIV

Methods of determining activity of ryanodine receptor modulators

InactiveUS20070196856A1Different absorptionDifferent emissionBiocideImage analysisSKELETAL MUSCLE RYANODINE RECEPTORCell biology
Methods for identifying modulators of ryanodine receptors are disclosed. In preferred embodiments the activity of the ryanodine receptor is stimulated to a baseline level and the ability of a test compound to increase or decrease the baseline level indicates that the test compound is a modulator of ryanodine receptor activity.
Owner:ALLERGAN INC

Pharmacological therapy for neuronopathic Gaucher disease

The instant disclosure relates to methods and compositions for the treatment of Gaucher disease, particularly type II and III neuronopathic Gaucher disease (nGD). The methods include the step of administering to an individual in need thereof an effective amount of a ryanodine receptor inhibitor or a pharmaceutically acceptable salt thereof.
Owner:CHILDRENS HOSPITAL MEDICAL CENT CINCINNATI

Method and special primer of method for fast identifying plutella xylostella ryanodine receptor gene mutation

InactiveCN102952889ATimely adjustment of prevention and control strategiesHigh sensitivityMicrobiological testing/measurementDNA/RNA fragmentationAgricultural scienceOpen reading frame
The invention discloses a method and a special primer of the method for fast identifying the plutella xylostella ryanodine receptor gene mutation. The invention provides a specific primer combination, which consists of a single chain DNA (deoxyribonucleic acid) molecule shown as a sequence 1 of a sequence table, a single chain DNA molecule shown as a sequence 2 of the sequence table and a single-chain DNA molecule shown as a sequence 3 of the sequence table. The specific primer combination can be used for the following (a) or (b): (a) the specific primer combination can be used for identifying whether plutella xylostella generates the G4899E mutation of the ryanodine receptor gene or not, and the G4899E mutation of the ryanodine receptor gene refers to that an open reading frame of the ryanodine receptor gene is mutated into A from G in the 14696 locus nucleotide of the 5' tail end; and (b) the specific primer combination is used for the auxiliary identification of the resistance of plutella xylostella on bisamide pesticides. The specific primer combination and the application of the specific primer combination have the important significance in the aspects of monitoring the resistance gene frequency of plutella xylostella field populations on the bisamide pesticides and the bisamide pesticide resistance generation and development trend of the plutella xylostella field populations, timely regulating the plutella xylostella preventing and control strategy, guiding the reasonable pesticide use and delaying the resistance development.
Owner:CHINA AGRI UNIV

Method of using ryanodine receptor antagonists to treat amyotrophic lateral sclerosis

InactiveUS20070049630A1Prevent and ameliorate damageBiocideMuscular disorderNeuronal damageAmyotrophic lateral sclerosis
The present invention provides a method of providing neural protection in in human patients suffering from amyotrophic lateral sclerosis comprising administering to said patients suffering from said amyotrophic lateral sclerosis an effective amount of a compound that is a ryanodine receptor antagonist in pharmaceutically acceptable vehicle to inhibit or prevent neuronal njury or death.
Owner:ALLERGAN INC

Disinsection combination containing fosthiazate and ryanodine receptor inhibitor insecticide

The invention discloses disinsection combination containing fosthiazate and ryanodine receptor inhibitor insecticide. The first active ingredient of the combination is fosthiazate, the second active ingredient is selected from ryanodine receptor inhibitor insecticide, such as chlorantraniliprole, cyantraniliprole or flubendiamide, and the weight ratio of the first active ingredient to the second active ingredient is 1:20 to 20:1. The combination can be prepared into agriculturally allowable missible oil, atrazine or granula formulations, has the advantages that the components are reasonable, the insecticidal efficacy is good, the activity and the insecticidal efficacy of the combination are not the simple supraposition of the activity of all the components, and compared with the existing single formulation, the combination not only has obvious insecticidal efficacy, but also has obvious potentiation, has high safety, and meets the safety requirement of pesticide formulation.
Owner:SHAANXI SUNGER ROAD BIO SCI

Chilo suppressalis ryanodine receptor gene CsRyR, encoded protein thereof and application of chilo suppressalis ryanodine receptor gene CsRyR

The invention discloses a chilo suppressalis ryanodine receptor gene CsRyR, which is used for encoding a nucleotide sequence with a chilo suppressalis ryanodine receptor protein CsRyR, wherein the nucleotide sequence has at least 70 percent of homology with a nucleotide sequence shown as SEQ ID NO:1. The invention further discloses a protein encoded by using the chilo suppressalis ryanodine receptor gene CsRyR. The protein has an amino acid sequence shown as SEQ ID No:2. The chilo suppressalis ryanodine receptor gene CsRyR is used for screening and / or evaluating a substance for regulating and controlling the activity of a chilo suppressalis ryanodine receptor.
Owner:ZHEJIANG UNIV

Manufacture method of chlorantraniliprole soluble powder and application in aerial control on forestall defoliators

The invention provides a manufacture method of chlorantraniliprole soluble powder and application in aerial control on forestall defoliators, and belongs to the field of study on agricultural science, technical field of agriculture and fractionized field of plant protection. According to the manufacture method of the chlorantraniliprole soluble powder and application in aerial control on the forestall defoliators, the chlorantraniliprole is a ryanodine receptor inhibitor and is an insecticide with a completely new action mechanism and high safety. After being processed into the soluble powder, the chlorantraniliprole can be applied to aerial control medicines, and thus the shortcomings that wettable powder has a plurality of precipitates and easily blocks a spray head of an airplane can be solved.
Owner:浙江森得保生物制品有限公司 +2

Mixtures of anthranilamide invertebrate pest control agents

Disclosed are mixtures and compositions for controlling invertebrate pests relating to combinations comprising (a) 3-bromo-N-[4-cyano-2-methyl-6[(methylamino)carbonyl]phenyl]-1-(3-chloro-2-pyridinyl)-1H-pyrazole-5-carboxamide, an N-oxide, or a salt thereof, Formula (1) and (b) at least one invertebrate pest control agent selected from neonicotinoids, cholinesterase inhibitors, sodium channel modulators, chitin synthesis inhibitors, ecdysone agonists, lipid biosynthesis inhibitors, macrocyclic lactones, GABA-regulated chloride channel blockers, juvenile hormone mimics, ryanodine receptor ligands, octopamine receptor ligands, mitochondrial electron transport inhibitors, nereistoxin analogs, pyridalyl, flonicamid, pymetrozine, dieldrin, metaflumizone, biological agents, and salts of the foregoing. Also disclosed are methods for controlling an invertebrate pest comprising contacting the invertebrate pest or its environment with a biologically effective amount of a mixture or composition of the invention.
Owner:FMC AGRO SINGAPORE PTE LTD +1