26 results about "U6 promoter" patented technology

The invention discloses an oil palm U6 promoter gene and application thereof, and belongs to the technical field of biology. The nucleotide sequence of the promoter gene is shown as SEQ ID NO.1. The oil palm RNA polymerase III type promoter gene, namely the oil palm endogenous U6 promoter gene EgU6, is obtained by cloning in an oil palm genome for the first time, and the promoter gene has high transcriptional activity and can drive downstream fluorescent protein mNeonGreen expression. The candidate oil palm endogenous U6 promoter gene can be provided for subsequently establishing a high-efficiency oil palm gene editing technology system based on a CRISPR / cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / Cas9) system.

The invention discloses a method for rapidly establishing an ovarian cancer model based on SauriCas9, and particularly discloses a recombinant plasmid for targeted knockout of Pten and Trp53 genes, and the recombinant plasmid comprises an EPI vector system. The recombinant plasmid takes an ori element as a replication start site, and sequentially comprises an sgRNA sequence of a targeted Trp53 gene and Pten controlled by double U6 promoters, a CAG promoter, a SauriCas9 nuclease expression unit, a fluorescent protein expression element, a resistance gene, an orip element and an EBNA1 protein expression element. The invention also discloses a method for rapidly establishing an ovarian cancer model based on SauriCas9, and the established ovarian cancer cell model. By adopting the method to construct the ovarian cancer cell model, the period from cell editing to animal tumor formation is shortened, the stability and immune integrity of the genetic background of the model are ensured, and large-scale drug screening and high-throughput experiments are facilitated.

This invention belongs to the field of molecular genetics and discloses a method and application for controlling fish fertility using in vivo gene editing technology. The applicant, for the first time, cloned a carp-specific U6 promoter and used this promoter to construct the U6 gene. MOVIE gRNA transgenic vectors and water The Cas9 vector allows for the establishment of an in vivo editing system. This strategy enables the heritability of sterility, a reproductive control trait, through hybridization of fertile parents to produce sterile offspring. The operation is highly efficient, simple, and environmentally friendly. Furthermore, since high-copy-rate short, scattered repetitive sequences exist in all fish species, this strategy has broad applicability across species.

The application provides a U6 promoter derived from Micropterus salmoides, and the sequence is shown in one of SEQ ID NO:1-4. The application clones four U6 promoters derived from Micropterus salmoides and analyzes the transcriptional activity and cross-species adaptability, and the results show that the four promoters can exhibit good transcriptional activity in fish cells, and the transcriptional activity of MsU6-1, 3 and 4 is significantly higher than that of the human-derived U6 promoter, and can be used for exogenous gene expression in fish cells and Cas9-based gene editing means.

The invention provides a micropterus salmoides sourced U6 promoter. The sequence of the promoter is shown as one of SEQ ID NO: 1-4. Four micropterus salmoides-sourced U6 promoters are cloned, the transcriptional activity and cross-species adaptability of the four promoters are analyzed, results show that the four promoters can show better transcriptional activity in fish cells, the transcriptional activity of MsU6-1, 3 and 4 is remarkably higher than that of a human-sourced U6 promoter, and the promoters can be used for exogenous gene expression in the fish cells and can be used for preparing fish cells. The invention further discloses a gene editing means based on Cas9.

This invention discloses a method for improving gene editing efficiency in citrus based on cloning the citrus U6 promoter, relating to the field of biotechnology. The method includes: PCR amplification of the promoter CsU6.1 using genomic DNA from Late Orange leaves as a template; recovery of the amplified fragment and ligation into a linearized pNGerRGEB32 vector to obtain a pNGerRGEB32-CsU6.1 vector containing the CsU6.1 promoter; then, using pNGerRGEB32-CsU6.1 as a template, designing primers containing a target sequence for PCR amplification; recovering the amplified product fragment and ligating it into a linearized pNGerRGEB32-CsU6.1 vector to obtain a pNGerRGEB32-CsU6.1-sgRNA gene editing vector containing the target sequence; and then genetically transforming citrus, achieving upregulation of sgRNA expression and improving gene editing efficiency.

The present disclosure relates to the technical field of molecular biology, and in particular to an adeno-associated virus structural plasmid capable of improving adeno-associated virus titer, which is provided with a Rep gene expression cassette and a Cap gene expression cassette in sequence in the gene expression direction. The Rep gene expression cassette includes a rep gene regulated and transcribed by a first promoter, and a transcription termination signal fragment is arranged behind the rep gene; the Cap gene expression cassette includes a cap gene regulated and transcribed by a second promoter, wherein the first promoter includes any one of a P5 promoter, an RSV promoter, an MMTV promoter, a UBC promoter, and a U6 promoter, and the second promoter includes one or more of a CMV promoter, a CBh promoter, a CAG promoter, an EF1α promoter, and an SFFV promoter.

The invention belongs to the technical field of cultivation of new varieties of ornamental plants, and particularly relates to a begonia U6 promoter BsU6-3 and application thereof. The nucleotide sequence of the U6 promoter BsU6-3 is shown as SEQ ID No.1. The promoter is mainly used for constructing a begonia CRISPR / Cas9 gene editing system, or is used for driving LUC fluorescent protein expression. In the gene editing process, an endogenous U6 promoter of a receptor plant or a related species is used, so that the gene editing method has very important technical significance for improving the transcription efficiency of sgRNA and improving the gene editing efficiency. In the application, the inventor clones a series of U6 promoters in a begonia sempervirens genome, and performs preliminary comparative analysis on the transcriptional activity of the promoters by taking an LUC reporter gene as an example. Based on the results, a good technical foundation can be laid for subsequent efficient gene editing system construction and further begonia new variety cultivation.

The invention relates to the technical field of gene editing, and discloses a sugarcane endogenous U6 promoter and application thereof, the sugarcane endogenous U6 promoter is ScU6-29, ScU6-23 or ScU6-48, the nucleotide sequence of the ScU6-29 is as shown in SEQ ID NO.2, the nucleotide sequence of the ScU6-23 is as shown in SEQ ID NO.3, and the nucleotide sequence of the ScU6-48 is as shown in SEQ ID NO.4. The invention further discloses a preparation method of the sugarcane endogenous U6 promoter. Compared with an existing U6 promoter (such as a rice U6 promoter) for sugarcane gene editing, the sugarcane U6 endogenous promoter can remarkably improve the sugarcane gene editing efficiency. The sugarcane endogenous U6 promoter provided by the invention can improve the efficiency of various gene editing tools (including base editing, AFID small fragment deletion system and CRISPR / Cas9), so that various requirements of sugarcane gene editing can be met, the application range is wide, a theoretical basis is provided for optimization of subsequent sugarcane gene editing carriers, and the sugarcane endogenous U6 promoter has broad application prospects. The sugarcane breeding process and the cultivation of high-quality new germplasm are greatly accelerated.

The invention discloses an organoid gene editing method and application thereof in constructing a disease model. The organ-like gene editing method comprises the following steps: fixing an organ-like; under a microscope, injecting the virus suspension into the organoid; the organoid after injection is cultured; wherein the adopted virus is an adenovirus packaged with an hCas9-P2A-EGFP fusion protein coding sequence driven by a CBh promoter and a gRNA coding sequence driven by two U6 promoters. According to the method, gene editing is directly carried out on a complete organoid based on the CRISPR-Cas9 technology, the organoid gene editing method which is efficient, low in damage and easy and convenient to operate is provided, the related disease model can be rapidly constructed, the occurrence mechanism of human diseases can be simulated, and the method has a good application prospect. Therefore, more stable and reliable technical support and ideal experimental subjects are provided for etiological research, drug research and development, therapeutic schedule verification and the like.

The invention discloses a polygene editing fragment / vector / cell line and a preparation method and application thereof, the polygene editing fragment can be used for editing pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes at the same time, the nucleotide sequence of the fragment is shown as SEQ ID No: 1, and the polygene editing vector and cell line can be prepared through the fragment and further used for preparing polygene editing pigs. The multi-gene editing fragment is formed by connecting a U6 promoter and five pairs of sgRNAs in series, each pair of sgRNAs is massively screened and is in an optimal, shortest and most efficient arrangement and connection mode, and the multi-gene editing fragment can be used for simultaneously performing fragment deletion on five genes of pig CMAH, ANPEP, CD163, ANTXR1 and MSTN. Due to the creative design of the segment, the five genes can be subjected to targeted editing at the same time, the gene editing efficiency of a multi-gene editing carrier and a cell line can be greatly improved, a foundation is laid for subsequent efficient gene editing research, and new materials and tools are further provided for pig gene improvement or new variety breeding.

The application discloses a pitaya U6 gene promoter and application thereof. The pitaya U6 gene promoter is any one of proHuU6.1, proHuU6.1.2 and proHuU6.1.3, the DNA nucleotide sequence of proHuU6.1 is shown in SEQ ID NO. 4, the DNA nucleotide sequence of proHuU6.1.2 is shown in SEQ ID NO. 5, and the DNA nucleotide sequence of proHuU6.1.3 is shown in SEQ ID NO. 6. The application first clones the pitaya U6 snRNA gene RNA polymerase III promoter, i.e., the pitaya endogenous U6 promoter, from pitaya genomic DNA, provides an efficient promoter sequence for studying the transformation of pitaya and close plants, and has important significance for constructing a pitaya gene editing system and creating pitaya germplasm resources with excellent traits.

The application discloses a carp U6 promoter which is cross-species function-conserved and drives long-fragment sequence expression and an application thereof, and belongs to the technical field of genetic engineering and molecular biology. The existing U6 promoter is strong in species specificity, low in activity in non-mammals such as fish, and mainly suitable for short-fragment RNA transcription, and is difficult to drive long-fragment target gene expression, thereby limiting complex gene editing and transgenic aquatic animal creation. The application provides a U6 promoter derived from a carp, and the nucleotide sequence is shown in SEQ ID NO:1. The promoter has cross-species function-conservation, and can drive long-fragment target gene transcription. An expression cassette and a recombinant vector constructed based on the promoter can realize high-efficiency expression of long-fragment target genes in fish cells and mammal cells. The promoter and related biological materials derived therefrom can provide efficient and cross-species applicable key technical tools for fish gene function research and editing breeding.

The invention relates to the technical field of non-coding RNA (Ribonucleic Acid) of parasites, and discloses a method for researching regulation and control of variant antigen genes of plasmodium non-coding RNA, which comprises the following steps: S1, constructing a modified plasmid pLN-ENR-GFP by overexpression plasmid: replacing a promoter region with a plasmodium falciparum U6 promoter; after PCR amplification, carrying out HindIII / EcoRI double enzyme digestion on a product, and inserting the product into a pLN-ENR-GFP carrier; adding a 9 * T terminator at the 3'end, introducing EcoRI / ApaI enzyme cutting sites at the two ends, and carrying out enzyme cutting connection: inserting an RUF6-15 fragment into the modified pLN-ENR-GFP vector; s2, synchronization of plasmodium and plasmid transfection and synchronization: taking a plasmodium falciparum in-vitro culture with a plasmodium falciparum body proportion of more than 60% in a cyclic body stage, and adding 5% of D-sorbitol (1 ml of cell volume: 14 ml of sorbitol); according to the method for researching the regulation and control of the variant antigen gene of the plasmodium non-coding RNA, a plasmodium falciparum RUF6-15 transgenic overexpression strain (138nt) is constructed, efficient and stable expression of target ncRNA is realized through optimization of a U6 promoter (SEQ ID NO: 1) and a PolyT terminator, and the technical bottleneck of functional verification of medium-length ncRNA of the plasmodium is broken through.

The invention discloses a chieh-qua U6 promoter and application thereof in chieh-qua CRISPR / Cas9 gene editing, and belongs to the technical field of molecular biology. The chieh-qua U6 promoter disclosed by the invention is a chieh-qua U6-1 promoter and a chieh-qua U6-2 promoter, the nucleotide sequence of the chieh-qua U6-1 promoter is shown as SEQ ID NO.9, and the nucleotide sequence of the chieh-qua U6-2 promoter is shown as SEQ ID NO.11. The chieh-qua U6 promoter is a chieh-qua U6-1 promoter and a chieh-qua U6-2 promoter. The CRISPR / Cas9 gene editing vector is constructed by replacing an arabidopsis U6 promoter and 3 '-UTR in the vector with a chieh-qua U6 promoter and 3'-UTR corresponding to U6-1, and the chieh-qua is transformed by agrobacterium tumefaciens, so that the target gene is edited, and an effective way is provided for researching the gene function of the chieh-qua and accelerating the cultivation of new varieties.

This invention discloses a carp U6 promoter with cross-species functional conservation that drives the expression of long sequence fragments and its applications, belonging to the fields of genetic engineering and molecular biology. Existing U6 promoters exhibit strong species specificity, low activity in non-mammals such as fish, and are mainly suitable for short RNA transcription, making it difficult to drive the expression of long target genes, thus limiting complex gene editing and the creation of transgenic aquatic animals. This invention provides a carp-derived U6 promoter, the nucleotide sequence of which is shown in SEQ ID NO:1. This promoter exhibits cross-species functional conservation and can drive the transcription of long target genes. Expression cassettes and recombinant vectors constructed based on this promoter can achieve efficient expression of long target genes in fish and mammalian cells. The promoter and related biomaterials provided by this invention can provide an efficient, cross-species applicable key technical tool for fish gene function research and editing breeding.

The invention relates to a chimeric antigen receptor for knocking down DMGDH gene expression and application of the chimeric antigen receptor, the chimeric antigen receptor comprises a plasmid structure capable of simultaneously expressing CD19CAR and knocking down T cell DMGDH expression, and the chimeric antigen receptor comprises a U6 promoter, an anti-DMGDH shRNA sequence started by the U6 promoter, an EF1 alpha promoter and a three-generation CD19CAR sequence started by the EF1 alpha promoter which are sequentially connected in series; the sequence of the shRNA for targeted inhibition of the DMGDH is as shown in SEQ ID NO.15: GCTCGGAGTATAAACAGGTTACTGAGTAACCTGTTTATACTCCGAGCTTTTT, and the sequence of the shRNA for targeted inhibition of the DMGDH is as shown in SEQ ID NO.15: The third-generation CD19CAR sequence is formed by connecting a CD19 single-chain variable region, a human CD8alpha hinge region, a human CD28 transmembrane region and intracellular region, an intracellular costimulatory region 4-1BB and a human CD3zeta intracellular region in series. After being subjected to antigen stimulation in vitro, the CART cells with the DMGDH expression knocked down show enhanced tumor cytotoxicity, lower cell depletion level and higher cytokine secretion capacity.

The invention discloses a pitaya U6 gene promoter and application thereof. The dragon fruit U6 gene promoter disclosed by the invention is any one of proHuU6.1, proHuU6.1. 2 and proHuU6.1.3, the DNA (Deoxyribose Nucleic Acid) nucleotide sequence of the proHuU6.1 is shown as SEQ ID NO.4, the DNA nucleotide sequence of the proHuU6.1. 2 is shown as SEQ ID NO.5, and the DNA nucleotide sequence of the proHuU6.1.3 is shown as SEQ ID NO.6. The dragon fruit U6 gene promoter disclosed by the invention has the advantages that the dragon fruit U6 gene promoter can be used for promoting the growth of the dragon fruit; the RNA polymerase III type promoter, namely the pitaya endogenous U6 promoter, of the pitaya U6 snRNA gene is obtained through cloning in the pitaya genome DNA for the first time, an efficient promoter sequence is provided for research on transformation of the pitaya and related plants, and the method has important significance on construction of a pitaya gene editing system and creation of pitaya germplasm resources with excellent characters.

The invention discloses a method for improving citrus gene editing efficiency based on citrus U6 promoter cloning, and relates to the technical field of biology.The method comprises the steps that PCR amplification is conducted on a promoter CsU6.1 with citrus grandis leaf genome DNA as a template, amplified fragments are recycled, a linear pNGerRGEB32 vector is linked, and a pNGerRGEB32-CsU6.1 vector containing the promoter CsU6.1 is obtained; the method comprises the following steps: by taking pNGerRGEB32-CsU6.1 as a template, designing a primer containing a target sequence, carrying out PCR (Polymerase Chain Reaction) amplification, recovering an amplification product fragment, connecting a linear pNGerRGEB32-CsU6.1 vector to obtain a pNGerRGEB32-CsU6.1-sgRNA gene editing vector containing the target sequence, and then carrying out genetic transformation on citrus to realize up-regulation of sgRNA expression and improvement of gene editing efficiency.

The application discloses a U6 promoter derived from Onobrychis viciafilia and application of the U6 promoter in gene editing of the Onobrychis viciafilia. The U6 promoter derived from the Onobrychis viciafilia comprises OvU6-1, OvU6-4 and OvU6-24 promoters. The application also discloses an Onobrychis viciafilia CRISPR / Cas9 gene editing vector constructed based on the U6 promoter. Experiments prove that, compared with AtU6, GmU6 and MsU6 promoters in the prior art, the gene editing efficiency of the Onobrychis viciafilia CRISPR / Cas9 gene editing vector constructed based on the U6 promoter derived from the Onobrychis viciafilia is significantly improved, and the Onobrychis viciafilia CRISPR / Cas9 gene editing vector can induce deletion and insertion mutations of various lengths, and has an advantage in producing diversified editing types. The application not only provides a more accurate and powerful tool for research on gene functions of the Onobrychis viciafilia, but also provides key technical support for construction of a molecular breeding system of the Onobrychis viciafilia.

The invention belongs to the technical field of biological medicine, and particularly relates to the field of gene therapy and pain therapy. The invention provides an sgRNA and AAV-CRISPRi virus system for targeted inhibition of TRPV1 gene, the AAV-CRISPRi virus system is a CRISPRi system based on AAV delivery, and the core functional structure sequence of the AAV-CRISPRi virus system is a 5 '-ITR inverted repeat sequence, an EF1 alpha core promoter, a ZIM3 transcription inhibition structural domain, a linker, a sadCas9-NLS nuclear localization signal-SV40 poly (A) termination signal-U6 promoter, and an sgRNA-3'-ITR inverted repeat sequence, according to the core functional structure, the miniaturization of a CRISPRi system is realized, and the infection success rate and the target gene inhibition efficiency are improved while the plasmid construction and AAV packaging costs are reduced. The AAV-CRISPRi virus system for targeted inhibition of the TRPV1 gene is used for preparing drugs for chronic pain, and has the characteristics of high efficiency, strong specificity and few side effects.

The application discloses a lentivirus vector and application thereof. A U6 promoter and a PI3Kdelta small molecule interfering RNA (PI3Kdelta-shRNA) sequence are cloned to the upstream of an EF1 promoter of a CD38-CAR lentivirus vector, and the CD38-CAR lentivirus vector information is the same as that of a prior application patent (application number 201710560649.2) of the present applicant. The modified chimeric antigen receptor is used for modifying T lymphocytes, the PI3Kdelta expression of the modified CD38-CAR-T cells is reduced, the killing of CD38 positive tumors is reduced, and the secretion of cytokines is reduced. The method can be used for down-regulating PI3Kdelta or other target genes of other target CAR-T cells, and further regulating the biological functions of the CAR-T cells.

The invention relates to the technical field of gene agriculture, in particular to a mango U6 promoter and application thereof. According to the application, seven U6 promoter sequences are screened from a mango genome by utilizing a conserved sequence of an arabidopsis thaliana U6 promoter on the basis of genome data of'miscanthus spp ', MiU6-2P-1, MiU6-6P-1, MiU6-6P-3 and MiU6-7P-2 in the seven MiU6 promoters successfully drive a GUS reporter gene to be expressed in the arabidopsis thaliana, the MiU6-6P-3 has the highest transcriptional activity, and then the MiU6-7P-2 and the MiU6-2P-1 have the highest transcriptional activity. Furthermore, transient expression is carried out in transgenic tobacco and mango leaves, and detection finds that the GUS activity of the MiU6-6P-3 and the MiU6-7P-2 is relatively high. In combination with GUS activity detection of the three different transgenic plants, MiU6-6P-3 is preferentially recommended to be used as a U6 promoter, and then MiU6-7P-2 is recommended to be used. The research provides a candidate U6 promoter for editing mangoes by using a CRISPR / Cas9 genome editing technology.

This invention discloses the U6 promoter of *Cucurbita stenoptera* and its application in CRISPR / Cas9 gene editing of *Cucurbita stenoptera*, belonging to the field of molecular biology technology. The *Cucurbita stenoptera* U6 promoter of this invention comprises the U6-1 promoter and the U6-2 promoter. The nucleotide sequence of the U6-1 promoter is shown in SEQ ID NO.9, and the nucleotide sequence of the U6-2 promoter is shown in SEQ ID NO.11. By replacing the Arabidopsis thaliana U6 promoter and 3'-UTR in the vector with the corresponding 3'-UTR of the *Cucurbita stenoptera* U6 promoter and U6-1, a CRISPR / Cas9 gene editing vector is constructed. *Agrobacterium*-mediated transformation of *Cucurbita stenoptera* is then used to achieve the editing of the target gene, providing an effective approach for studying the gene function of *Cucurbita stenoptera* and accelerating the breeding of new varieties.

The invention provides a CXCL7 gene targeting composition and application of the CXCL7 gene targeting composition in preparation of a medicine for treating fungal keratitis, and relates to the field of biological medicine. The composition disclosed by the invention is formed by transfecting a carrier containing a CXCL7 targeted interference sequence, and the CXCL7 targeted interference sequence is shown as SEQ ID No.1. The vector is an adeno-associated virus vector, and the CXCL7 targeting interference sequence is inserted into the downstream of a U6 promoter of the adeno-associated virus vector. According to the invention, CXCL7 is used as a new target of fungal keratitis, expression of CXCL7 is inhibited by means of gene intervention, the problems of excessive immune response and difficult control of inflammatory response are solved, and accurate local treatment is realized by an AAV vector system; in addition, excessive activation of immune response can be effectively relieved, excessive aggregation of immune cells is reduced, secretion of inflammatory factors is reduced, accordingly, inflammatory response of the cornea is relieved, and cornea repair is helped.

The application discloses a method for rapidly establishing an ovarian cancer model based on SauriCas9, and particularly discloses a recombinant plasmid for knocking out Pten and Trp53 genes, which comprises an EPI vector system; the recombinant plasmid takes an ori element as a replication start site, and sequentially comprises sgRNA sequences for targeting Trp53 genes and Pten controlled by a double U6 promoter, a CAG promoter, a SauriCas9 nuclease expression unit, a fluorescent protein expression element, a resistance gene, and an orip element and an EBNA1 protein expression element. The application further discloses a method for rapidly establishing an ovarian cancer model based on SauriCas9, and an ovarian cancer cell model obtained by construction. The ovarian cancer cell model is constructed by adopting the method, the period from cell editing to animal tumorigenesis is shortened, the stability and immune integrity of the genetic background of the model are ensured, and large-scale drug screening and high-throughput experiments are facilitated.