A mediated CA16 inactivated vaccine, preparation method and application thereof

Abstract

The present invention provides a mediated CA16 inactivated vaccine, comprising an immunizing amount of CoxA16 virus inactivated purified antigen, and also comprising glycerol, sucrose, squalene, Tween-20 and heparan sulfate. The present invention provides a mediated CA16 inactivated vaccine that can be used to prepare immunization through a specific immune mode. After the vaccine product enters the respiratory mucosal cells through cell internalization, it can stimulate the natural immune system in the epithelial cells, promote the recognition of viral antigens by the DC system and T / B cells, and the activation and differentiation of the specific immune system.

Description

Technical Field

[0001] The present invention belongs to the field of medical biotechnology. Specifically, the present invention relates to a mediated CA16 inactivated vaccine and an immunization method thereof, which mediates the entry of CoxA16 virus antigen into respiratory mucosal cells. Background Art

[0002] Coxsackievirus A 16 Strain (CA16), as a member of the enterovirus family, is of great significance in the pathogenic spectrum of hand, foot and mouth disease (HFMD), which is common in children. In 2008, a large-scale epidemic of hand, foot and mouth disease also occurred in Fuyang, Anhui Province, my country, and the infected people mainly appeared in infants and young children, which aroused serious concern from all walks of life. In response, the Ministry of Health of my country has officially included hand, foot and mouth disease in the types of infectious diseases that must be reported since May 2008. In 2009, the epidemic characteristics of the pathogens of hand, foot and mouth disease in my country gradually changed from EV71 virus infection in 2008 to the co-epidemic of EV71 and CA16, and this epidemic characteristic trend has continued to increase. Data show that the proportion of hand, foot and mouth disease cases caused by CA16 virus and EV71 virus has reached more than 80% of the cases. With the listing and application of EV71 inactivated vaccine, CA16 virus is likely to become the main pathogen of hand, foot and mouth disease in children. Therefore, the development and application of CA16 vaccine also obviously has important public health significance.

[0003] In recent years, with the advancement of related research work, the research on CA16 vaccine has made multiple technical advances, but because the pathology and related immunological mechanisms of CA16 virus infection are still not very clear, its products have not made substantial progress so far. Our previous non-human primate experimental results on CA16 inactivated vaccine suggest that conventional CA16 inactivated vaccine preparation methods and conventional immunization models are difficult to obtain a good immune response, especially when the virus attacks, they fail to show effective immune clinical protection effects. Although the results of this animal model cannot fully support the infection and immune mechanism of CA16 virus in humans, it is obviously necessary to further optimize and explore the preparation method of CA16 inactivated vaccine and vaccine immunization model, and further understand the immunological mechanism of this vaccine.

[0004] The CA16 virus inactivated antigen, its virus strain and its preparation technology used in the present invention all have independent intellectual property rights. (China patent number is CN201210328369.6, authorization announcement number is CN102839159B) Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the existing CA16 inactivated vaccine and immune model, and to prepare a mediated CA16 inactivated vaccine using a specific formula, which can enter the respiratory mucosal cells through cell internalization, stimulate the natural immune system in epithelial cells, recruit and activate different types of natural lymphocytes (Innate Lymphoid Cells, ILCs), and coordinate the antigen uptake and presentation of DC cells, thereby inducing a complete and effective specific immune response.

[0006] The technical solution of the present invention is proposed based on the following ideas:

[0007] A large number of population epidemiological and clinical observations, as well as our previous animal experimental results, suggest that both CA16 and EV71 can cause infection through the human respiratory system, and respiratory epithelial tissue, as an organ with natural immune function, can play an important role in the activation of the body's antiviral immune response. The natural lymphocytes ILCs, which have recently attracted widespread attention, are one of the main components to accomplish this role. This type of cell population, which is divided into three types (ILC1, ILC2, and ILC3), is usually activated by the stimulation of a class of ligand signaling molecules produced by epithelial cells, mainly members of the TNFα factor family, and expresses characteristic receptors and ligands to play a signaling role and nonspecific inflammatory mediator effects, as well as specific immune response coordination effects whose mechanisms are still unclear. Such a systematic process forms the basis of the body's specific antiviral immune response.

[0008] As an enterovirus with humans as its main host, the CA16 virus can infect a variety of human cells including respiratory epithelial cells. Therefore, based on the fact that the virus can be transmitted through the respiratory tract, we first focused on the process of CA16 virus infecting human bronchial epithelial cells 16HBE cultured in vitro before implementing the present invention. When the multiplicity of infection is 0.1 to 0.2, the CA16 virus can cause a typical cytopathic process in 16HBE cells. The process of gradual swelling, rounding, and eventual shedding of cells is accompanied by the viral kinetic proliferation process. The specific q-RT-PCR test results of cell-specific transcription products at different times of infection, that is, transcriptions that have the function of activating signal molecules for ILCs, showed that the epithelial cells can upregulate their inflammatory signal molecules against ILCs in the early stages of CA16 virus infection (see Figures 1A - 1C This result suggests that the process of CA16 infecting epithelial cells in the trachea, which have an important role in activating innate immunity, is actually a stage of upregulating signal molecules in the tissue that activate the innate immune system.

[0009] In order to achieve the stimulation of the body's natural immune response by viral antigens rather than live viruses, and to be able to observe the signaling effect of this stimulation on the immune system in a mouse model, we used inactivated CA16 viral antigens and mixed them with a lipid formula that mediates the entry of antigen particles into cells, thereby achieving an internalization of antigen particles with an efficiency of >50% for mouse tracheal epithelial cells. On this basis, we also conducted real-time monitoring of the expression changes of related signaling molecules in mouse tracheal epithelial cells that had mediated the entry of CA16 antigen particles. The results showed that the cells' CD160, GITRL, LIGHT, CD40L, TNF-α, IFN-λ, and other immune signaling molecules all showed varying degrees of upregulation (see Figures 2A - 2B This result is similar to the result of CA16 virus infection of human tracheal epithelial cells, suggesting that we can also stimulate the natural immune molecular signaling system of mouse tracheal epithelial cells using the antigen internalization-mediated method.

[0010] The purpose of the present invention is achieved through the following technical solutions:

[0011] A mediated CA16 inactivated vaccine comprises an immunizing amount of CoxA16 virus inactivated purified antigen, glycerol, sucrose, squalene, Tween-20 and heparan sulfate. The vaccine dosage form is a nasal immunization vaccine preparation.

[0012] Each 100-200 μl of vaccine contains 200 U of inactivated purified CoxA16 virus antigen.

[0013] In the vaccine, the percentage of glycerol is 3% (ml / ml), the percentage of sucrose is 3% (g / ml), the percentage of squalene is 1.5% (ml / ml), the percentage of Tween-20 is 0.5% (ml / ml), and the content of heparan sulfate is 50 μg / dose (100-200 μl).

[0014] The mediated CA16 inactivated vaccine contains the following components per 100 μl of the vaccine: 200 U of purified inactivated CA16 virus antigen, 3 μl of glycerol, 3 μg of sucrose, 1.5 μl of squalene, 0.5 μl of Tween-20 and 50 μg of heparan sulfate.

[0015] The method for preparing the CA16 inactivated vaccine is characterized by comprising the following steps:

[0016] 1) Using the diploid cell KMB17 strain and the CA16 virus GX-2K-D strain, in accordance with the production and testing procedures for CA16 inactivated vaccines, a qualified CA16 virus inactivated purified antigen was prepared;

[0017] 2) The inactivated CA16 virus purified antigen is diluted with phosphate buffer, and glycerol, sucrose, squalene, Tween-20 and heparan sulfate are added to obtain a mixed preparation, which is the desired mediated CoxA16 inactivated vaccine product.

[0018] The CA16 inactivated vaccine is used in the preparation of medicines for preventing and treating diseases caused by CoxA16 virus.

[0019] The immunization method of the CA16 inactivated vaccine is nasal immunization.

[0020] In this application,

[0021] The role of "glycerol" in the vaccine of the present application is to stabilize the solution system and mediate the auxiliary effect of antigen components entering cells.

[0022] The role of "sucrose" in the vaccine of the present application is: as a stabilizer component, it has the effect of alleviating irritation and increasing the vaccine recipient's acceptance of the dosage form.

[0023] The role of "squalene" in the vaccine of the present application is: it has the function of acting as a liposome that can mediate the entry of antigens into cells.

[0024] The role of "Tween-20" in the vaccine of the present application is to stabilize the antigen in the solution system and to assist the antigen in entering the cells.

[0025] The role of "heparan sulfate" in the vaccine of the present application is to promote antigen stimulation of the body to produce cellular immunity.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] 1. Provided is a CA16 inactivated vaccine that can be used to prepare mediated immunization through a specific immune mode. After the vaccine product enters the respiratory mucosal cells through cell internalization, it can stimulate the natural immune system in epithelial cells, promote the recognition of viral antigens by the DC system and T / B cells, and the activation and differentiation of the specific immune system.

[0028] 2. It provides a specific immunization method of mediated CA16 inactivated vaccine in the form of nasal spray, which can stimulate the body's natural immune system to recruit and activate different types of ILCs, coordinate the antigen uptake and presentation of DC cells, and transform the stimulating effect of viral antigens into a complete activation process of natural immunity-specific immunity.

[0029] 3. A lipid formulation (such as squalene) that mediates the entry of antigen particles into cells was used to achieve an efficiency of >50% for the internalization of CA16 virus antigen particles in mouse tracheal epithelial cells and its stimulation of the body's natural immune response. The signaling effect of this stimulation on the immune system was observed in a mouse model. The real-time monitoring results of the expression changes of related signaling molecules in mouse tracheal epithelial cells that had mediated the entry of CA16 virus antigen particles showed that the immune signaling molecules of the cells, such as CD160, GITRL, LIGHT, OC40L, and TNF-α, all showed varying degrees of upregulation (see Figures 3A - 3B ).

[0030] 4. CA16 inactivated vaccine is difficult to obtain a good immune response in conventional immunization mode, especially when it fails to show effective immune clinical protection effect during virus attack. The mediated CA16 inactivated vaccine and immunization method prepared by the present invention can induce complete and effective natural immunity - specific immune response, and co-localization of DC cells and CA16 antigen occurs (see Figures 4A - 4C ). It also induced mice to produce serum neutralizing antibodies against CA16 virus and showed positive conversion of CTL (see Figures 5A - 5C ), secrete corresponding cytokines to participate in the body's immune function, so that the vaccine can achieve the best effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1A The morphological changes of 16HBE cells within 48 hours after infection with CA16 virus;

[0032] Figure 1B This is the kinetic proliferation curve of 16HBE cells infected with CA16;

[0033] Figure 1C The expression changes of ILCs activation-related signaling molecules in 16HBE cells after infection with CA16 virus;

[0034] Figure 2A Fluorescence detection of the internalization efficiency of CA16 antigen in CP-M175 cells (fluorescence intensity was detected using grayscale software);

[0035] Figure 2B The expression changes of signaling molecules related to ILCs activation in CP-M175 cells after CA16 antigen internalization;

[0036] Figure 3A The distribution of CA16 antigen in respiratory tissues (tissue samples include oral, nasal and lung tissues on days 1, 2 and 3 after mice were immunized with CA16 inactivated vaccine);

[0037] Figure 3BThe expression of ILCs activation-related signaling molecules in the respiratory tissues of mice immunized with CA16 antigen;

[0038] Figure 4A Confocal fluorescence microscopy images of CA16 antigen and ILC1 and ILC3 in the respiratory mucosal tissue of mice immunized with CA16 antigen;

[0039] Figure 4B Detection of immune molecules secreted by ILC1 activation in the respiratory mucosal tissues of mice immunized with CA16 antigen;

[0040] Figure 4C Confocal fluorescence microscopy images of CA16 antigen and DC cells in the respiratory mucosal tissue of mice immunized with CA16 antigen;

[0041] Figure 5A The neutralizing antibody titers induced by CA16 inactivated vaccine after immunizing mice through different routes;

[0042] Figure 5B The IFN-γ-specific immune response induced by CA16 inactivated vaccine after immunization of mice through different routes;

[0043] Figure 5C To test the protective efficiency of CA16 inactivated vaccine on suckling mice after immunization of mice by non-immunization route (the suckling mice born by immunized mice were attacked by CA16 virus and the survival rate curve of suckling mice within 14 days was tested). DETAILED DESCRIPTION

[0044] The features of the present invention will be described in more detail with the help of the following examples. It should be noted that the following examples are merely illustrative and the protection scope of the present invention is not limited by these examples.

[0045] In the embodiment,

[0046] Human diploid cell line KMB17: The intellectual property rights belong to the Institute of Medical Biology, Chinese Academy of Medical Sciences, and this study is authorized for use.

[0047] CA16 virus GX-20K-D strain: Deposit number CGMCC No.6350, see the applicant's authorized patent for details, patent number CN201210328369.6, authorization announcement number CN102839159B.

[0048] Example 1 Preparation of CA16 inactivated vaccine for specific route immunization

[0049] Using human diploid cell KMB17 strain and CA16 virus GX-20K-D strain with independent intellectual property rights, qualified CoxA16 virus inactivated purified antigen was prepared according to the process technology and inspection procedures of CoxA16 inactivated vaccine.

[0050] The inactivated CA16 virus purified antigen is diluted with phosphate buffer, and glycerol, sucrose, squalene, Tween-20 and heparan sulfate are added at the same time. The resulting mixed preparation is the desired mediated CoxA16 inactivated vaccine product. Prepare a mediated CA16 inactivated vaccine for specific immunization. Each 100 μl of the vaccine contains 200 U of inactivated CA16 virus purified antigen, 3 μl of glycerol, 3 μg of sucrose, 1.5 μl of squalene, 0.5 μl of Tween-20 and 50 μg of heparan sulfate.

[0051] Example 2 Nasal spray immunization method of CA16 inactivated vaccine for specific route immunization

[0052] The prepared CA16 inactivated vaccine for specific immunization was used to immunize Balb / c mice by nasal spray, which can stimulate the natural immune system of the mice to recruit and activate different types of ILCs, coordinate the antigen uptake and presentation of DC cells, promote the recognition of viral antigens by DC system and T / B cells, and the initiation and differentiation of specific immune system. At the same time, it can induce mice to produce serum neutralizing antibodies against CA16 virus, show positive conversion of CTL, further secrete corresponding cytokines to participate in the body's immune function, induce complete and effective specific immune response, and make the vaccine play the best effect.

[0053] The specific tests are as follows:

[0054] 1. Using tissue culture methods to monitor the expression changes of related signaling molecules in mouse tracheal epithelial cells CP-M175 that have mediated the entry of CA16 antigen particles in real time

[0055] method:

[0056] Using CA16 recombinant virus capable of expressing GFP fluorescent protein 5 CCID 50 After mixing with lipofectin-2000 transfection buffer (lipofectin-2000 is a multi-purpose transfection reagent that can provide efficient transfection in various adherent cells and suspension cell lines. Refer to the product manual for use), add mouse tracheal epithelial cells CP-M175 strain (cell number is about 5x10) grown in 6-well plates (two wells) 5 / each well), cultured at 37°C for 24 hours, placed under a fluorescence microscope, confirmed that the transfected cells had fluorescence, and counted the number of cells expressing fluorescence in 200 cells to determine the transfection efficiency of the antigen entering the cells. The expression changes of related signal molecules of mouse tracheal epithelial cells CP-M175 that have mediated the entry of CA16 antigen particles were monitored in real time.

[0057] result:

[0058] After CA16 virus inactivated antigen particles were transfected and internalized into mouse tracheal epithelial cells CP-M175, the cells upregulated the expression of ILCs activation-related signaling molecules (see Figures 2A - 2B , Figures 2A - 2B It shows that after the CA16 inactivated vaccine virus antigen particles enter the mouse tracheal epithelial cells CP-M175 through internalization, the expression of related signaling molecules activated by cellular innate immunity ILCs is upregulated. ).

[0059] Figure 2A Display: The results of detecting the fluorescence intensity of the internalization efficiency of CA16 antigen in CP-M175 cells using grayscale software.

[0060] Figure 2B It shows the expression changes of signaling molecules related to ILCs activation in CP-M175 cells after CA16 antigen internalization. The results show that the immune signaling molecules such as CD160, GITRL, LIGHT, OC40L, TNF-α, IFN-α, IFN-β, etc. of the cells are upregulated to varying degrees.

[0061] in conclusion:

[0062] Real-time monitoring of the expression changes of related signaling molecules in mouse tracheal epithelial cells CP-M175 that have mediated the entry of CA16 antigen particles showed that the inactivated CA16 virus antigen entered the mouse tracheal epithelial cells CP-M175 in an internalized manner, which could upregulate the expression of ILCs activation-related signaling molecules, stimulate the innate immune system to recruit and activate different types of ILCs, coordinate the antigen uptake and presentation of DC cells, and promote the recognition of viral antigens by the DC system and T / B cells and the initiation and differentiation of the specific immune system.

[0063] 2. Observe the signaling effect of CA16 vaccine antigen stimulation on the immune system in a mouse model, and monitor in real time the expression changes of related signaling molecules in mouse respiratory cells that have mediated the entry of CA16 virus antigen particles

[0064] method:

[0065] The prepared CA16 inactivated vaccine for specific immunization was used to immunize Balb / c mice via nasal spray. Then, oral, nasal and lung tissue samples were taken from the mice on the 1st, 2nd and 3rd day after immunization. After the quality was determined, the samples were extracted with the cell RNA extraction solvent TRNzol-A. + After dissolution, the RNA-PCR amplification test of the cellular innate immunity-related model molecules was quantitatively performed (the specific primer sequences are shown in Table 1), and the mRNA copy number of each target molecule was determined per 100 mg of tissue, and the expression changes of related signal molecules in the mouse respiratory cells that have mediated the entry of CA16 virus antigen particles were monitored in real time.

[0066] Table 1. Primer sequences for RNA-PCR detection of cellular innate immunity-related signaling molecules

[0067] 4 - 1BBL F AAGCCTCAGGTAGATGACT 4 - 1BBL R GAACGGTCCACTAACTTGT BTLA F GCCAGGACAGGAGAGTTA BTLA R CTTACACCAAGTCACATTAGG CD160 F CCTGAGACCAACTTAGAACA CD160 R AACACCAACTGAGATGACTT GITRL F CCAAGGTGTCCAGAATGAA GITRL R TGAGATGAACTCTTCCAACA IKKα F TGGAAGAGACTGCTGACA IKKα R ATGAAGAACACTTGCTGAGA IKKβ F CTCCGAAGATACTTGAACCA IKKβ R CGATGCGATGTCACTCAG LIGHT F TTCTGAGCACCTACATTCC LIGHT R CTTCTGACCAACCATTCCT LTα3 F ACTGCCGCTTCCTCTATA LTα3 R GTGTCATGTGGAGAACCT NIK F AGCAACTGGAGATAGAACTG NIK R CTGAGGCAGGAGAGGATT OC40L F TGCTTCTGTGCTTCATCTAT OC40L R ATCTGGTAACTGCTCCTCT RANKL F TCACTCTGTCCTCTTGGTA RANKL R CAGGTAATAGAAGCCATCTTG TAK F CCATCACTTACACAGCAATC TAK R CCTCACAGATACATACACAGA TLIA F AATAAGCAACAACTGGTTCC TLIA R ATTAGTCTGTCTCCTTCTTCC TNFα F GTGGAACTGGCAGAAGAG TNFβ R GAGAAGAGGCTGAGACATAG GAPDH F GGTGAAGGTCGGTGTGAACG GAPDH R CTCGCTCCTGGAAGATGGTG IFNα F CTTCCTVAGACTCATAACCT IFNα R AGTCCTTCCTGTCCTTCA IFNβ F AACTCCACCAGCAGACAG IFNβ R GAGAGCAGTTGAGGACATC

[0068] result:

[0069] The results of pathological histological examination of mouse respiratory tissue samples that have been mediated by CA16 virus antigen particles and real-time monitoring of the expression changes of related signaling molecules in mouse respiratory cells showed that after the mediated CA16 inactivated vaccine was immunized in Balb / c mice by nasal spray, its antigen components could be distributed in the corresponding respiratory tissues and induce corresponding tissue pathological changes, thereby inducing the expression of immune signaling molecules such as CD160, GITRL, LIGHT, OC40L, TNF-α, etc. in respiratory tissue cells to show different degrees of upregulation (see Figures 3A - 3B , indicating that the mediated CA16 inactivated vaccine virus antigen particles are widely distributed in the respiratory tract tissues after nasal immunization of mice, and can stimulate the upregulation of signal molecules related to the natural immune system in these tissues).

[0070] Figure 3A The results show that: CA16 antigen distribution in respiratory tissues (tissue samples include oral, nasal and lung tissues on days 1, 2 and 3 after mice were immunized with CA16 inactivated vaccine). The mediated CA16 inactivated vaccine virus antigen particles are widely distributed in respiratory tissues after nasal immunization of mice.

[0071] Figure 3B It shows that the expression of ILCs activation-related signaling molecules in the respiratory tissues of mice immunized with CA16 inactivated vaccine is upregulated.

[0072] in conclusion:

[0073] The CA16 inactivated vaccine for specific immunization, after immunizing Balb / c mice by nasal spray, can stimulate the signaling effect of mouse respiratory tissue cells on the immune system, and induce the upregulation of the expression of immune signaling molecules in respiratory tissue cells, stimulate the innate immune system to recruit and activate different types of ILCs, coordinate the antigen uptake and presentation of DC cells, promote the recognition of viral antigens by the DC system and T / B cells, and the initiation and differentiation of the specific immune system.

[0074] 3. Detection of the effect of CA16 inactivated vaccine after nasal immunization in mice

[0075] method:

[0076] 1. The introduction of CA16 vaccine antigens through the mouse nasal cavity is intended to simulate the natural infection mode of the virus to stimulate the immune system and find the correlation between the CA16 antigen and the natural immune system. Therefore, based on the understanding that the viral antigen can be recognized by the intracellular natural immune-related pattern recognition receptor (PRR) after entering the tracheal mucosal epithelial cells and induce related gene responses, we used confocal fluorescence microscopy to observe the fluorescence co-localization of ILCs and DCs with CA16 antigens, performed histochemical examinations on some cytokines expressed by ILCs activation, and also examined the DC surface marker molecule CD116 + / CD103 + The co-localization with CA16 antigen was observed to determine whether CA16 antigen had a co-localization relationship with ILCs and DCs and activated ILCs to secrete other immune molecules.

[0077] 2. Based on the fact that the CA16 vaccine antigen immunization model introduced through the nasal route in mice has effectively activated ILCs and the natural immune system in the respiratory mucosal tissue, we further analyzed the indicators of immune response induced by this antigen immunization process in mice, in order to evaluate the characteristics of the CA16 vaccine antigen immunization model introduced through the nasal route in mice, which can induce complete and effective natural immunity - specific immune response.

[0078] result:

[0079] (1) The results of confocal fluorescence microscopy observation of the fluorescence co-localization of ILCs and DCs with CA16 antigen showed that CA16 antigen co-localized with ILC1 and ILC3 in respiratory mucosal tissues.

[0080] Figure 4A Display: In the respiratory mucosal tissue of mice immunized with CA16 antigen, confocal fluorescence microscopy observation results showed the co-localization relationship between CA16 antigen and ILC1 and ILC3.

[0081] Figure 4B Shown: In the respiratory mucosal tissue of mice immunized with CA16 antigen, some immune molecules secreted by ILC1 activation were identified through histochemical detection.

[0082] Figure 4C Shown: In the respiratory mucosal tissues of mice immunized with CA16 antigen, the DC surface marker molecule CD116 + / CD103 + Confocal fluorescence microscopy observation of CA16 antigen showed the co-localization relationship between CA16 antigen and DC cells.

[0083] (2) The results of the analysis of the indicators of immune response induced in mice by the nasal CA16 vaccine antigen immunization model showed that single or double nasal immunization could induce mice to produce anti-CA16 serum neutralizing antibodies. The Elispot test results of mouse CTL response also showed that no matter the single or double immune stimulation, obvious positive conversion of IFN-γ specific cellular immune response could be detected. At the same time, the protection efficiency of suckling mice born after mice immunized with CA16 virus was also tested.

[0084] Figure 5A The results show that the titer of neutralizing antibodies induced by the inactivated CA16 vaccine was tested after mice were immunized by different routes. The results show that single or double nasal immunization can induce mice to produce serum neutralizing antibodies against CA16, and a relatively high level of neutralizing antibodies can be induced 8 weeks after the second immunization.

[0085] Figure 5B The results show that the IFN-γ specific cellular immune response induced by the inactivated CA16 vaccine was detected after mice were immunized by different routes. The results show that no matter the primary or secondary immune stimulation, it can induce a significant positive conversion of the IFN-γ specific cellular immune response.

[0086] Figure 5C The results show that the survival rate of suckling mice born from mice immunized with the inactivated CA16 vaccine was tested within 14 days after the mice were immunized with the CA16 virus. The results show that the vaccine has a significant protective effect on suckling mice.

[0087] Conclusion: The mediated CA16 inactivated vaccine and immunization method prepared by the present invention can induce complete and effective natural immunity - specific immune response, and co-localization of DC cells and CA16 antigen occurs (see Figure 4A-4C, indicating that after the mediated CA16 inactivated vaccine virus antigen particles enter the respiratory mucosal tissue, they can significantly activate the ILCs system, and DC cells and CoxA16 antigens co-localize). It also induces mice to produce serum neutralizing antibodies against CA16 virus, and at the same time shows positive conversion of CTL (see Figure 5A -C, indicating that the immune response evaluation of the mediated CA16 inactivated vaccine virus antigen particles after nasal immunization of mice showed that it can induce mice to produce serum neutralizing antibodies against CA16 virus, and at the same time show positive conversion of CTL), secrete corresponding cytokines to participate in the body's immune function, so that the vaccine can achieve the best effect.

Claims

1. Use of a mediated CA16 inactivated vaccine in the preparation of a drug for preventing and treating diseases caused by CoxA16 virus, characterized in that: The mediated CA16 inactivated vaccine contains the following components per 100 μl of the vaccine: 200 U of purified inactivated CA16 virus antigen, 3 μl of glycerol, 3 μg of sucrose, 1.5 μl of squalene, 0.5 μl of Tween-20 and 50 μg of heparan sulfate; The preparation method of the CA16 inactivated vaccine comprises the following steps: 1) Using the diploid cell KMB17 strain and the CA16 virus GX-2K-D strain, in accordance with the production and testing procedures for CA16 inactivated vaccines, a qualified CA16 virus inactivated purified antigen was prepared; 2) diluting the inactivated CA16 virus purified antigen with phosphate buffer, and adding glycerol, sucrose, squalene, Tween-20 and heparan sulfate, and the obtained mixed preparation is the desired mediated CoxA16 inactivated vaccine product; The immunization method of the CA16 inactivated vaccine is nasal immunization.

Images