Application of thyroid hormone and its analogs in the preparation and treatment of α-thalassemia

Abstract

The present invention provides the use of thyroid hormone and its analogs in the preparation of a drug for treating α-thalassemia. Specifically, the drug can be used to regulate ζ-globin gene expression. During K562 cell differentiation, the thyroid hormone analogs can specifically and significantly upregulate the expression of the ζ-globin gene (HBZ) by as much as 50 times. After treatment with thyroid hormone and its analogs in model animal zebrafish embryos, the expression of the ζ-globin gene (hbae5) can also be specifically upregulated by as much as 30-70 times. Therefore, the present invention uses thyroid hormone and its analogs to specifically activate the expression of the ζ-globin gene, that is, to reactivate the silenced ζ-globin gene in α-thalassemia patients to inhibit the destruction of red blood cells. This method provides a method for preparing a drug for treating α-thalassemia, provides an economical, safe and effective method for the treatment of α-thalassemia, and can be widely promoted and used.

Description

Technical Field

[0001] The present invention belongs to the technical field of thalassemia, and particularly relates to the application of thyroid hormone and analogs thereof in the preparation and treatment of α-thalassemia. Background Art

[0002] Thalassemia is one of the most common single-gene inherited disorders worldwide, with a significant impact on human health. It is caused by deletions or mutations in the globin gene, leading to impaired globin chain synthesis. This leads to an imbalance in the composition of hemoglobin, ultimately causing red blood cell destruction and hemolytic anemia. The most common territories are α-thalassemia and β-thalassemia, depending on the type of globin chain affected. α-thalassemia is characterized by decreased α-globin synthesis, while β-thalassemia is characterized by decreased β-globin synthesis. Although the number of α-thalassemia carriers is higher than that of β-thalassemia, and the number of patients with α-thalassemia intermedia (also known as HbH disease) and α-thalassemia major (also known as Bart's hydrops fetalis syndrome) in my country is far higher than in other countries and regions, making it a truly "hard-hit area," there is still no proven and effective treatment for these diseases. Therefore, patients with α-thalassemia face a significant unmet medical need.

[0003] α-thalassemia is a hemolytic anemia caused by the destruction of red blood cells due to reduced synthesis of α-globin chains. It can be divided into four types based on the number of α-globin gene deletions or mutations: (1) quiescent α-thalassemia; (2) α-thalassemia minor; (3) α-thalassemia intermedia (also known as HbH disease); and (4) α-thalassemia major (also known as Bart's hydrops fetalis syndrome). Patients with quiescent α-thalassemia and α-thalassemia minor do not require special treatment; however, some patients with α-thalassemia intermedia (HbH disease) with severe anemia require blood transfusions. For children with α-thalassemia major (Bart's hydrops fetalis syndrome), some hospitals have reported that intrauterine blood transfusions can alleviate their symptoms. Apart from this, there is currently no effective treatment.

[0004] However, blood transfusion therapy can cause the following problems:

[0005] 1. Blood transfusion can cause serious maternal and fetal complications, and lead to iron overload in the patient's body, which in turn causes damage to multiple organs. The main organs affected include the heart, liver, pancreas and various endocrine organs, endangering the life safety of mother and baby.

[0006] 2. Blood transfusion can cause adverse reactions such as fever, chills and rash. In more severe cases, it can lead to acute hemolysis, tracheal constriction and decreased blood pressure.

[0007] 3. Blood transfusion may carry the risk of blood-borne infectious diseases.

[0008] 4. Intrauterine blood transfusion is technically demanding and difficult to implement, making it difficult to apply widely.

[0009] 5. The cost of blood transfusion is high, which places a huge financial burden on patients who need lifelong blood transfusions.

[0010] ζ-globin is an α-globin-like protein expressed only during the embryonic period and also has oxygen-carrying functions. The gene encoding this protein is well-preserved in most patients with α-thalassemia, with its expression gradually shut down during embryonic development. Studies have shown that re-expressing ζ-globin in mice lacking the α-globin gene through transgenic methods can completely restore normal development in α-thalassemia mice. Therefore, reactivating the silenced ζ-globin gene in patients to compensate for the defective α-globin is expected to be an effective treatment for α-thalassemia. However, to date, no drugs have been developed that can activate ζ-globin gene expression. Summary of the Invention

[0011] In view of the deficiencies in the prior art, the primary purpose of the present invention is to provide the use of thyroid hormone and its analogs in the preparation of treatment for α-thalassemia.

[0012] The second object of the present invention is to provide the use of thyroid hormone and its analogs in regulating ζ-globin gene expression.

[0013] In order to achieve the above primary purpose, the solution of the present invention is:

[0014] Thyroid hormone and its analogs can be used in the preparation of treatment for α-thalassemia.

[0015] In order to achieve the above second purpose, the solution of the present invention is:

[0016] Thyroid hormone and its analogs can be used to regulate ζ-globin gene expression.

[0017] Specifically, thyroid hormone and its analogs can specifically upregulate the expression of the ζ-globin gene.

[0018] Triac (also known as Tiratricol or 3,3',5-triiodothyroacetic acid) (chemical name: 2-[4-(4-Hydroxy-3-iodophenoxy)-3,5-diiodophenyl]acetic acid, molecular formula: C 14Triac (H9I3O4) is a thyroid hormone analog used to treat thyroid hormone resistance syndrome, hyperlipidemia, localized lipodystrophy, and obesity. Triac is also currently being studied in clinical trials for the treatment of Allan-Herndon-Dudley syndrome.

[0019] The inventors have discovered that Triac can specifically and significantly upregulate the expression of the ζ-globin gene (HBZ) during K562 cell differentiation. Furthermore, in zebrafish embryos, treatment with Triac specifically upregulates the expression of the ζ-globin gene (hbae5), while no significant upregulation of other globin genes is observed. Furthermore, the inventors have discovered that thyroid hormone (3,3',5-Triiodo-L-thyronine, abbreviated as T3 or 3,3',5,5'-tetraiodothyronine, abbreviated as T4) exhibits similar functions. Therefore, the inventors have discovered for the first time that the thyroid hormone analog Triac and thyroid hormone (T3 or T4) can specifically activate ζ-globin gene expression at the cellular and animal levels, making them the first small molecule compounds to specifically activate ζ-globin gene expression and potentially play an important role in the treatment of α-thalassemia.

[0020] Specifically, Triac was purchased from Selleck Biotechnology Co., Ltd. of the United States, T3 (3,3',5-Triiodo-L-thyronine) was purchased from Sigma, and T4 (3,3',5,5'-tetraiodothyronine) was purchased from Shenggong Biotechnology (Shanghai) Co., Ltd.

[0021] Due to the adoption of the above solution, the beneficial effects of the present invention are:

[0022] The present invention uses thyroid hormone and its analogs to specifically activate the expression of the ζ-globin gene, that is, to inhibit the destruction of red blood cells by reactivating the silent ζ-globin gene in patients with α-thalassemia, thereby providing a method for preparing a drug for treating α-thalassemia, particularly for α-thalassemia intermedia (HbH disease) and α-thalassemia major (Bart's hydrops fetalis syndrome). This provides an economical, safe and effective method for the treatment of α-thalassemia and can be widely promoted and used. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1Schematic diagram of the expression of various genes during the differentiation of human K562 cells in Example 1 of the present invention (the vertical axis Relative Expression is relative expression).

[0024] Figure 2 Schematic diagram of the expression of the ζ-globin gene (hbae5) in zebrafish embryos after treatment with Triac, T3 and T4 in Example 2 of the present invention.

[0025] Figure 3 Schematic diagram of the expression of various genes in zebrafish embryos after treatment with Triac, T3 and T4 in Example 3 of the present invention (the vertical axis Relative Expression is relative expression). DETAILED DESCRIPTION

[0026] The present invention provides use of thyroid hormone and its analogs in the preparation of a drug for treating α-thalassemia.

[0027] Experimental Materials:

[0028] K562 cells were cultured in 1640 medium supplemented with 10% fetal bovine serum (FBS). Hemin was dissolved in 0.2 mol / L NaOH solution at a working concentration of 20 μmol / L for treating K562 cells. Triac, T3, and T4 were dissolved in dimethyl sulfoxide (DMSO) at a working concentration of 20 μmol / L for treating K562 cells and 5 μmol / L for treating zebrafish embryos.

[0029] The present invention will be further described below with reference to the examples.

[0030] Example 1:

[0031] In K562 cells, the process of Triac specifically activating the expression of the ζ-globin gene (HBZ) is as follows:

[0032] During K562 cell differentiation, cells were treated with hemin or hemin + Triac for 72 hours and then collected by centrifugation at 2000 rpm for 5 minutes. Total RNA was extracted using TRIzol reagent (Invitrogen), and cDNA was synthesized using a reverse transcription kit (ReverTra Ace, TOYOBO). Finally, gene expression levels were detected by quantitative PCR using SYBR Green Realtime PCR Master Mix (TOYOBO).

[0033] The quantitative PCR reaction system is:

[0034]

[0035]

[0036] The quantitative PCR reaction conditions are:

[0037] Hot start: 95°C, 10 minutes;

[0038] Denaturation: 95°C, 10 seconds;

[0039] Annealing / extension: 60°C, 30 seconds.

[0040] 40 cycles.

[0041] Melting curve analysis.

[0042] like Figure 1 As shown, after K562 cells were treated with Triac for 72 hours, quantitative PCR results showed that the expression of ζ-globin gene (HBZ) was upregulated by 50.9 times.

[0043] In fact, the sequence of human ζ-globin gene (HBZ) (NM_005332.3) (SEQ ID NO.1) is as follows:

[0044] ATGTCTCTGACCAAGACTGAGAGGACCATCATTGTGTCCATGTGGGCCAAGATCTCCACG

[0045] CAGGCCGACACCATCGGCACCGAGACTCTGGAGAGGCTCTTCCTCAGCCACCCGCAGACC

[0046] AAGACCTACTTCCCGCACTTCGACCTGCACCCGGGGTCCGCGCAGTTGCGCGCGCACGGC

[0047] TCCAAGGTGGTGGCCCGCCGTGGGCGACGCGGTGAAGAGCATCGACGACATCGGCGGCGCC

[0048] CTGTCCAAGCTGAGCGAGCTGCACGCCTACATCCTGCGCGTGGACCCGGTCAACTTCAAG

[0049] CTCCTGTCCCACTGCCTGCTGGTCACCCTGGCCGCGCGCTTCCCCGCCGACTTCACGGCC

[0050] GAGGCCCACGCCGCCTGGGACAAGTTCCTATCGGTCGTATCCTCTGTCCTGACCGAGAAG

[0051] TACCGCTGA.

[0052] The Realtime PCR primers are as follows:

[0053]

[0054]

[0055] Example 2:

[0056] During zebrafish embryonic development, Triac, T3, and T4 were added to the embryos 96 hours after fertilization. After treatment with Triac, T3, and T4 for 24 hours, the embryos were fixed with 4% paraformaldehyde, and the expression of the ζ-globin gene (hbae5) was detected by whole-embryo in situ hybridization.

[0057] like Figure 2 As shown, in zebrafish embryos, Triac, T3 and T4 significantly activated the expression of the ζ-globin gene (hbae5), that is, significantly upregulated it.

[0058] Example 3:

[0059] During zebrafish embryonic development, Triac, T3, and T4 were added to zebrafish embryos starting 96 hours after fertilization. After 24 hours of treatment, the embryos were collected and total RNA was extracted using TRIzol reagent (Invitrogen). cDNA was then synthesized using a reverse transcription kit (ReverTra Ace, TOYOBO). Finally, quantitative PCR was performed using SYBR Green Realtime PCR Master Mix (TOYOBO) to detect gene expression levels.

[0060] The quantitative PCR reaction system is:

[0061]

[0062] The quantitative PCR reaction conditions are:

[0063] Hot start: 95°C, 10 minutes;

[0064] Denaturation: 95°C, 10 seconds;

[0065] Annealing / extension: 60°C, 30 seconds.

[0066] 40 cycles.

[0067] Melting curve analysis.

[0068] like Figure 3 As shown, in zebrafish embryos, Triac, T3 and T4 significantly activated the expression of the ζ-globin gene (hbae5), that is, quantitative PCR results showed that the expression of the ζ-globin gene (hbae5) was upregulated by 76 times, 31 times and 41 times, respectively.

[0069] In fact, the sequence of the zebrafish ζ-globin gene (hbae5) (NM_001326701.1) (SEQ ID NO.16) is as follows:

[0070] ATGAGTCTTCTGCTAAAGACAAGGCCGCCGTGAGGGGCTTCTGGGCCAAGATTGCCCCA

[0071] AAGGGAGAGCAAATTGGTAACGAGGCGTTTTCCAGATTGCTTTTGGTGTACCCTCAGACC

[0072] AAGACCTACTTCTCCACTGGAACGATCTGGCCCCCGGCTCTCCCTCTGTGAAGAAGCAG

[0073] GGAAAGAAGATCGTCGGTGGACTCGGTCTGGCTGTTGATAAAATCGACGACCTTTTCAAC

[0074] GGCCTGCTGAACCTCAGTGAATTGCACGCCTTTCAGCTGAGAGTCGACCCTGCTAACTTC

[0075] AAGCTCCTGTCTCACTGTCTGCTGGTGGTGTTCGCCATGCTCTTCCCTGATGACTTCACC

[0076] GCTGAGGTCCATCTGGCCATCGACAAGTTCCTGGCAAGAGTGGCTTTGGCTCTGTCTGAC

[0077] AAATATCGTTAA.

[0078] The Realtime PCR primers are as follows:

[0079]

[0080] The above description of the embodiments is intended to facilitate understanding and use of the present invention by those skilled in the art. Those skilled in the art will readily be able to make various modifications to these embodiments and apply the general principles described herein to other embodiments without resorting to creative effort. Therefore, the present invention is not limited to the above-described embodiments. Any improvements or modifications made by those skilled in the art based on the principles of the present invention that do not depart from the scope of the present invention should be considered within the scope of protection of the present invention.

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087] Sequence Listing <110> Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine <120> Application of thyroid hormone and its analogs in the preparation and treatment of α-thalassemia <141> 2020-04-17 <160> 30 <170> SIPOSequenceListing 1.0 <210> 1 <211> 429 <212> DNA <213> Human ζ-globin gene sequence (2 Ambystoma laterale x Ambystomajeffersonianum) <400> 1 atgtctctga ccaagactga gaggaccatc attgtgtcca tgtgggccaa gatctccacg 60 caggccgaca ccatcggcac cgagactctg gagaggctct tcctcagcca cccgcagacc 120 aagacctact tcccgcactt cgacctgcac ccggggtccg cgcagttgcg cgcgcacggc 180 tccaaggtgg tggccgccgt gggcgacgcg gtgaagagca tcgacgacat cggcggcgcc 240 ctgtccaagc tgagcgagct gcacgcctac atcctgcgcg tggacccggt caacttcaag 300 ctcctgtccc actgcctgct ggtcaccctg gccgcgcgct tcccgccga cttcacggcc 360 gaggcccacg ccgcctggga caagttccta tcggtcgtat cctctgtcct gaccgagaag 420 taccgctga 429 <210> 2 <211> 18 <212> DNA <213> Human-β-actin-F(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 2 ccaaccgcga gaagatga 18 <210> 3 <211> 20 <212> DNA <213> Human-β-actin-R(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 3 ccagaggcgt acagggatag 20 <210> 4 <211> 17 <212> DNA <213> Human-HBA1 / 2-F(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 4 aaggtcggcg cgcacgc 17 <210> 5 <211> 18 <212> DNA <213> Human-HBA1 / 2-R(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 5 ctcaggtcga agtgcggg 18 <210> 6 <211> 21 <212> DNA <213> Human-HBZ-F(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 6 ggaccatcat tgtgtccatg t 21 <210> 7 <211> 21 <212> DNA <213> Human-HBZ-R(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 7 gggaagtagg tcttggtctg c 21 <210> 8 <211> 20 <212> DNA <213> Human-HBE1-F(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 8 tgcatgtgga tcctgagaac 20 <210> 9 <211> 19 <212> DNA <213> Human-HBE1-R(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 9 cgacagcaga caccagctt 19 <210> 10 <211> 20 <212> DNA <213> Human-HBG1 / 2-F(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 10 agcacctgga tgatctcaag 20 <210> 11 <211> 20 <212> DNA <213> Human-HBG1 / 2-R(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 11 aaacggtcac cagcacattt 20 <210> 12 <211> 19 <212> DNA <213> Human-HBD-F(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 12 gatgcagttg gtggtgagg 19 <210> 13 <211> 19 <212> DNA <213> Human-HBD-R(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 13 gggttgccca taacagcat 19 <210> 14 <211> 20 <212> DNA <213> Human-HBB-F(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 14 gcacgtggat cctgagaact 20 <210> 15 <211> 20 <212> DNA <213> Human-HBB-R(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 15 cactggtggg gtgaattctt 20 <210> 16 <211> 432 <212> DNA <213> Related: 2 Ambystoma laterale x Ambystomajeffersonianum <400> 16 atgagtcttt ctgctaaaga caaggccgcc gtgaggggct tctgggccaa gattgcccca 60 aagggagagc aaattggtaa cgaggcgttt tccagattgc ttttggtgta ccctcagacc 120 aagacctact tctcccactg gaacgatctg gccccggct ctccctctgt gaagaagcag 180 ggaaagaaga tcgtcggtgg actcggtctg gctgttgata aaatcgacga ccttttcaac 240 ggcctgctga acctcagtga attgcacgcc tttcagctga gagtcgaccc tgctaacttc 300 aagctcctgt ctcactgtct gctggtggtg ttcgccatgc tcttccctga tgacttcacc 360 gctgaggtcc atctggccat cgacaagttc ctggcaagag tggctttggc tctgtctgac 420 aaatatcgtt aa 432 <210> 17 <211> 20 <212> DNA <213> Zebrafish-β-actin-F(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 17 tgctgttttc ccctccattg 20 <210> 18 <211> 19 <212> DNA <213> Zebrafish-β-actin-R(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 18 ttctgtccca tgccaacca 19 <210> 19 <211> 21 <212> DNA <213> Zebrafish-hbae1-F(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 19 ctgaggctgt cagcaaaatc g 21 <210> 20 <211> 21 <212> DNA <213> Zebrafish-hbae1-R(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 20 gaacaaagtg gccagaacca c 21 <210> 21 <211> 21 <212> DNA <213> Zebrafish-hbae3-F(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 21 gctgatggat gacctgaagg g 21 <210> 22 <211> 21 <212> DNA <213> Zebrafish-hbae3-R(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 22 ctcaggagtg aagtcgtctg g 21 <210> 23 <211> 21 <212> DNA <213> Zebrafish-hbae5-F(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 23 tgctgaacct cagtgaattg c 21 <210> 24 <211> 21 <212> DNA <213> Zebrafish-hbae5-R(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 24 ggaacttgtc gatggccaga t 21 <210> 25 <211> 20 <212> DNA <213> Zebrafish-hbbe1-F(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 25 tccacgtaga tcccgacaac 20 <210> 26 <211> 20 <212> DNA <213> Zebrafish-hbbe1-R(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 26 tactgtcttc ccagagcgga 20 <210> 27 <211> 21 <212> DNA <213> Zebrafish-hbbe2-F(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 27 ggactggaca gagccatgaa g 21 <210> 28 <211> 21 <212> DNA <213> Zebrafish-hbbe2-R(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 28 gaggcaatca cgattgtcag g 21 <210> 29 <211> 20 <212> DNA <213> Zebrafish-hbbe3-F(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 29 ttgtgtggac agctgaggag 20 <210> 30 <211> 20 <212> DNA <213> Zebrafish-hbbe3-R(2 Ambystoma laterale x Ambystomajeffersonianum) <400> 30 acggatagac gaccaagcat 20

Claims

1. Application of Triac in the preparation of drugs for the treatment of α-thalassemia.

2. The use according to claim 1, characterized in that: Triac treats α-thalassemia by upregulating the expression of the ζ-globin gene to compensate for the defective α-globin.

Images