Composition, kit and application for colorectal cancer detection

Abstract

Provided are a composition, a kit and an application for colorectal cancer detection. The provided composition comprises reagents for detecting the methylation status of ADHFE1 gene, PPP2R5C gene and SDC2 gene, and can be used to detect colorectal cancer with high sensitivity and specificity.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a composition, a kit and an application thereof for colorectal cancer detection. Background Art

[0002] Colorectal cancer, which occurs in the colon and rectum of the lower digestive tract, is a common malignant tumor. According to the latest statistics, the number of new cases of colorectal cancer worldwide ranks third among men and second among women, and the death rate ranks fourth among men and third among women (Bray et al., 2018). In my country, the prevention and control of colorectal cancer is also very severe, ranking third in new cases of malignant tumors (388,000) and fifth in deaths (187,000) (Zheng Rongshou et al., 2019). Colorectal cancer develops slowly and generally goes through processes such as polyps, adenomas, and intestinal cancer. It can take up to 5-10 years for adenoma to develop into intestinal cancer. If intervention is carried out in the early stages of colorectal cancer development, the mortality rate can be significantly reduced. The five-year survival rate of patients with stage I colorectal cancer can reach more than 90%, while the five-year survival rate of patients with stage IV colorectal cancer is less than 20% (Marzieh Araghi et al., 2020).

[0003] Traditional colorectal cancer early screening technologies mainly include colonoscopy, fecal occult blood test, tumor markers CEA and CA19-9, etc. These technical means currently have certain limitations. Colonoscopy is the gold standard for colorectal cancer diagnosis. By inserting the lens and light source from the anus, the end of the ileum can be reached through the cavity through the rectum, sigmoid colon and other parts. The image can be transmitted to the display in real time for the operating doctor to observe. The image of the colonoscope is intuitive and clear, and various lesions such as cancer, polyps, ulcers, and bleeding can be observed. Polyps can also be removed under the microscope. However, it is an invasive detection technology with a complicated preparation process. It requires diet control and intestinal cleaning, and the compliance of the examinee is low. It also has requirements for equipment and personnel. It needs to be operated by professional personnel and anesthesiologists in the hospital. Some examinees will feel uncomfortable and there is a risk of complications (3-5 cases / 1000 people). Fecal occult blood test is a non-invasive method that detects blood components (hemoglobin) in the stool to determine whether there is gastrointestinal bleeding, so that doctors can judge the risk of colorectal cancer. This method is quick and simple, and the compliance of the examinee is high. However, this detection method is easily affected by the liver, blood products, green leafy vegetables, etc. in the diet, resulting in false positives. At the same time, it has low sensitivity for early colorectal cancer patients with less bleeding, and is prone to missed diagnosis. CEA and other broad-spectrum tumor markers have low specificity, are prone to more false positives, and have limited sensitivity. Therefore, it is necessary to establish an accurate, simple, and economical method for early screening of colorectal cancer.

[0004] DNA methylation is an important gene expression regulation mechanism that can regulate gene expression and silencing, and has a significant impact on the occurrence and development of tumors. Abnormal methylation of cancer-related genes often occurs in the early stages of cancer, so DNA methylation signals are considered to be potential early screening markers for tumors. Human fecal samples are mixed with intestinal cell DNA, which carries information such as methylation. By detecting and analyzing this information, the possibility of the subject suffering from colorectal cancer can be inferred. Some genes have been proven to be methylation markers for colorectal cancer detection in feces, such as SFRP2, SEPT9, NDRG4 and SDC2 (Hannes M Müller et al., 2004; Jie Chen et al., 2019), but their performance cannot fully meet clinical needs. For example, the sensitivity and specificity of SFRP2 for colorectal cancer is only 77% (Hannes M Müller et al., 2004). Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems in the related art to a certain extent, and provides a composition, a kit and an application for colorectal cancer detection. The provided composition can be used to detect colorectal cancer, and its specificity and sensitivity are both high, which can assist clinical detection and enrich the diagnosis and detection of colorectal cancer.

[0006] Specifically, the present invention provides the following technical solutions:

[0007] In a first aspect of the present invention, the present invention provides a composition for colorectal cancer detection, comprising reagents for detecting the methylation status of ADHFE1 gene, PPP2R5C gene and SDC2 gene.

[0008] In the second aspect of the present invention, the present invention provides a kit for diagnosing colorectal cancer, wherein the kit comprises the composition for detecting colorectal cancer according to the first aspect.

[0009] In a third aspect of the present invention, the present invention provides a method for determining the methylation status of genes in a sample, wherein the genes include SDC2 gene, ADHFE1 and PPP2R5C gene, and the method comprises:

[0010] (1) obtaining genomic DNA, wherein the genomic DNA comes from the sample;

[0011] (2) performing a methylation conversion treatment on the genomic DNA to obtain a conversion product, wherein the genomic DNA is subjected to the methylation treatment and the methylated sites and the unmethylated sites show differences;

[0012] (3) Using primer sets and probes to perform fluorescence quantitative PCR detection on the conversion products to determine the gene methylation status in the sample.

[0013] In a fourth aspect of the present invention, the present invention provides an isolated nucleic acid sequence, the isolated nucleic acid sequence comprises a primer set and a probe, the primer set comprising: (a) at least one pair of sequences shown in SEQ ID NO: 3 to SEQ ID NO: 40,

[0014] (b) at least one pair of sequences shown in SEQ ID NO:41 to SEQ ID NO:60; and

[0015] (c) at least one pair of sequences shown in SEQ ID NO:61 to SEQ ID NO:98;

[0016] The probe comprises:

[0017] At least one of the sequences shown in SEQ ID NO: 100 to SEQ ID NO: 112,

[0018] At least one of the sequences shown in SEQ ID NO: 113 to SEQ ID NO: 127,

[0019] At least one of the sequences shown in SEQ ID NO:128 to SEQ ID NO:142.

[0020] In the fifth aspect of the present invention, the present invention provides a method for evaluating the colorectal cancer status of a subject, the method comprising: a) providing a sample from the subject, the sample containing the target nucleic acid of the subject, the target nucleic acid including the ADHFE1 gene, the PPP2R5C gene and the SDC2 gene; b) evaluating the methylation status of the target nucleic acid; and c) evaluating the colorectal cancer status of the subject based on the methylation status of the target nucleic acid.

[0021] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0023] Figure 1 is a schematic diagram of the methylation levels of colorectal cancer and non-colorectal cancer samples in the TCGA database provided according to an embodiment of the present invention;

[0024] Figure 2is a fluorescence quantitative PCR amplification curve diagram of the positive standard in Example 2 of the present invention;

[0025] Figure 3 is a fluorescence quantitative PCR amplification curve diagram of the negative standard in Example 2 of the present invention;

[0026] Figure 4 is a detection flow chart of the kit for diagnosing colorectal cancer provided in Example 3 of the present invention;

[0027] Figure 5 It is a ROC curve diagram of each gene detecting colorectal cancer samples in Example 3 of the present invention. DETAILED DESCRIPTION

[0028] The embodiments of the present invention are described in detail below. It should be noted that the described embodiments are exemplary and are intended to be used to explain the present invention, but cannot be understood as limiting the present invention. In the process of describing the scheme provided by the present invention, the relevant terms in the text are explained and illustrated. These explanations and illustrations are only for the convenience of understanding the scheme and cannot be regarded as limiting the protection scheme of the present invention.

[0029] In one aspect of the present invention, the present invention provides a composition for colorectal cancer detection, comprising reagents for detecting ADHFE1 gene, PPP2R5C gene and SDC2 gene. The composition mentioned herein does not require that two or more substances must be present in a mixed contact form, and the composition mentioned refers to application in the same environment when used. For example, when detecting colorectal cancer, the methylation status of ADHFE1 gene, PPP2R5C gene and SDC2 gene is detected simultaneously.

[0030] The methylation modification of the ADHFE1 gene, PPP2R5C gene and SDC2 gene mentioned in this article is closely related to the occurrence and development of cancer, and shows significant differences in normal tissues and cancerous tissues. For example, the SDC2 gene, ADHFE1 gene, and PPP2R5C gene show high methylation levels in cancer tissues. The ADHFE1 gene encodes a transhydrogenase, and the abnormal regulation caused by the hypermethylation of this gene can shorten the cycle of intestinal cancer cells and promote the proliferation of cancer cells (Hu YH et al., 2019). Compared with normal tissues of the large intestine, the ADHFE1 gene is highly methylated in cancer tissues and advanced adenoma tissues (Tae CH et al., 2013). Its methylation level is significantly different in normal tissues, intestinal cancer tissues and adenoma tissues, and is an ideal marker for intestinal cancer detection (Naumov VA et al., 2013. Fan, J et al., 2020). The PPP2R5C gene encodes a regulatory subunit of PP2A phosphatase and is a negative regulator of cell growth and proliferation (Veerle JANSSENS et al., 2001). There is evidence that its encoded protein can regulate the dephosphorylation of p53 protein to respond to DNA damage, thereby inhibiting the growth of colorectal cancer cells (Li HH et al., 2007). The hypermethylation state of the PPP2R5C gene is closely related to the occurrence and development of colorectal cancer and can be used as a potential marker for colorectal cancer detection (Galamb O et al., 2016). The SDC2 gene encodes a cell-intrinsic membrane protein that has important biological functions in processes such as cell division and migration (Kim JH et al., 2018). By comparing the methylation modification status of cancer tissues and paracancerous tissues of colorectal cancer patients, multiple studies have found that the methylation level of the SDC2 gene is significantly different in cancer tissues and paracancerous tissues, and the detection rate in cancer tissues, adenoma tissues, polyp tissues and normal tissues has a significant decreasing trend, which can be used as an effective marker for colorectal cancer detection (Oh TJ et al., 2017).

[0031] At present, the SDC2 gene has become a relatively reliable standard for the diagnosis and detection of colorectal cancer. This article combines the SDC2 gene with the ADHFE1 gene and the PPP2R5C gene, which has higher sensitivity and specificity than the detection of the SDC2 gene alone. Moreover, compared with other genes, such as NDRG4, BMP3 and other genes, the diagnosis of colorectal cancer by combining the SDC2 gene, ADHFE1 gene and PPP2R5C gene has higher specificity and sensitivity. For example, the sensitivity can reach more than 85%, and the specificity can reach more than 90%. For another example, the sensitivity can reach more than 87%, or even more than 90%, and the specificity can reach more than 90%, or even more than 94%. Moreover, it can show more differentiation in colorectal cancer samples and normal samples.

[0032] In at least some embodiments, the reagents include primer sets and probes. "Primers" provided herein refer to short nucleic acid sequences with free 3' hydroxyls, which can form base pairs with complementary templates and serve as the starting point for template strand replication. Under appropriate buffer and temperature conditions, primers can initiate the synthesis of DNA in the presence of different nucleoside triphosphates and polymerization reagents (such as DNA polymerase or reverse transcriptase).

[0033] The term "probe" refers to a fragment of a polynucleotide, such as RNA or DNA, which can specifically bind to the mRNA or complementary DNA (cDNA) of a specific gene and has a length of several to hundreds of base pairs. Since the probe is labeled, the probe can be used to check the presence or expression level of the target mRNA or cDNA to be bound.

[0034] In some embodiments, the primer set comprises:

[0035] (a-1) at least one of the sequences shown in SEQ ID NO: 3 to SEQ ID NO: 40 (for example, at least one pair of the sequences shown);

[0036] (b-1) at least one of the sequences shown in SEQ ID NO:41 to SEQ ID NO:60 (for example, at least one pair of the sequences shown); and

[0037] (c-1) at least one of the sequences shown in SEQ ID NO:61 to SEQ ID NO:98 (for example, at least one pair of the sequences shown);

[0038] The probe comprises:

[0039] (a-2) at least one of the sequences shown in SEQ ID NO: 100 to SEQ ID NO: 112,

[0040] (b-2) at least one of the sequences shown in SEQ ID NO: 113 to SEQ ID NO: 127,

[0041] (c-2) at least one of the sequences shown in SEQ ID NO: 128 to SEQ ID NO: 142.

[0042] In at least some embodiments, the primer set includes (a-1) at least one pair of sequences shown in SEQ ID NO:3 to SEQ ID NO:40, (b-1) at least one pair of sequences shown in SEQ ID NO:41 to SEQ ID NO:60, and (c-1) at least one pair of sequences shown in SEQ ID NO:61 to SEQ ID NO:98; the probe includes: (a-2) at least one of the sequences shown in SEQ ID NO:100 to SEQ ID NO:112, (b-2) at least one of the sequences shown in SEQ ID NO:113 to SEQ ID NO:127, and (c-2) at least one of the sequences shown in SEQ ID NO:128 to SEQ ID NO:142.

[0043] At least one pair of the sequences mentioned refers to any forward primer and any reverse primer of a certain same gene (i.e., ADHFE1 gene, PPP2R5C gene, or SDC2 gene mentioned herein) as a pair of primers. It should be noted that when the primers and probes for the same gene are used in combination, any forward primer of a certain same gene and a reverse primer located after the forward primer, as well as a probe located between the forward and reverse primers can be used in combination, that is, the amplification and detection of colorectal cancer-related genes can be achieved. Those skilled in the art can align the sequence to the genome according to the sequence provided herein, and select a combination of primers and probes for use. For example, a forward primer numbered SEQ ID NO:7 or SEQ ID NO:11 can be used as a pair of primers in combination with a reverse primer numbered SEQ ID NO:8 or SEQ ID NO:24, and can be used in combination with probes numbered SEQ ID NO:115, SEQ ID NO:114, SEQ ID NO:125, or SEQ ID NO:126 as needed.

[0044] In some embodiments, the primer set further includes the sequence shown in SEQ ID NO: 1 to SEQ ID NO: 2, and the probe further includes the sequence shown in SEQ ID NO: 99. The sequences shown in SEQ ID NO: 1 to SEQ ID NO: 2 and the sequence shown in SEQ ID NO: 99 can be used for PCR amplification and detection of the internal reference gene GAPDH gene.

[0045] The sequences are listed in Table 1. These primer sets and probes are designed for the methylated sequences of the related genes ADHFE1, PPP2R5C, and SDC2, and can specifically identify the methylated sequences; and using the GAPDH gene as an internal reference, the amplification of the internal reference gene will not be affected by the methylation modification, so the number of templates in the sample can be quantified; by calculating the difference between the Ct value of the target gene and the Ct value of the internal reference gene, the methylation degree of the sample can be determined, which can be used to help detect colorectal cancer. The 5' end of the probe mentioned can be connected to FAM, VIC, ROX, CY5 fluorescent groups, and the 3' end can be connected to quenching groups such as MGB. The fluorescent groups and quenching groups used can be groups commonly used in the art.

[0046] Table 1 Primer set and probe sequence list

[0047]

[0048]

[0049]

[0050]

[0051] In some embodiments, reagents for detecting the ADHFE1 gene include sequences shown in SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:127; reagents for detecting the PPP2R5C gene include sequences shown in SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:139; reagents for detecting the SDC2 gene include sequences shown in SEQ ID NO:89, SEQ ID NO:90 and SEQ ID NO:101; the composition also includes reagents for detecting the GAPDH gene, and the reagents for detecting the GAPDH gene include sequences shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:99.

[0052] The primers or probes mentioned above can be artificially synthesized, for example, using phosphoramidite solid support for synthesis or other chemical synthesis methods commonly used in the art.

[0053] In at least some embodiments, the composition includes at least one selected from the following: PCR buffer, salt ions, dNTPs, DNA polymerase or target nucleic acid. The target nucleic acid mentioned can be extracted from the sample by some commercially available kits. The target nucleic acid is a nucleic acid sequence containing genes from ADHFE1, PPP2R5C, and SDC2.

[0054] In at least some embodiments, the fluorescent quantitative PCR detection conditions mentioned include 95 degrees Celsius for 10 minutes, 95 degrees Celsius for 15 seconds, 55 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds, for a total of 45 cycles.

[0055] In at least some embodiments, the mass ratio of the primer set to the probe is 1:1:1:1. Thus, an ideal detection result can be obtained.

[0056] In another aspect of the present invention, the present invention provides a kit for diagnosing colorectal cancer, the kit comprising the composition described above. The kit provided by the present invention can specifically detect the methylation modification of ADHFE1, PPP2R5C, and SDC2 genes in a sample, thereby assessing the risk of the subject suffering from colorectal cancer. The present invention jointly detects the methylation status of the three genes ADHFE1, PPP2R5C, and SDC2, which can effectively improve the detection performance compared with single gene methylation detection.

[0057] In at least some embodiments, the kit further includes at least one of the following reagents: a DNA extraction reagent, a DNA methylation conversion reagent, and a nucleic acid purification reagent. The DNA extraction reagent can be used to obtain DNA in a sample. The DNA methylation conversion reagent can convert cytosine in DNA into uracil. The nucleic acid purification reagent can be used to obtain purified nucleic acid, which can then be used in subsequent reaction processes.

[0058] The kit mentioned above can also be used to determine the methylation status of genes in a sample or to assess the prevalence of colorectal cancer in a subject by the same method described below. To this end, the present invention also provides the use of the reagent in preparing a kit, which is used to determine the methylation status of genes in a sample. The present invention also provides the use of the reagent in preparing a kit, which is used to assess the prevalence of colorectal cancer in a subject.

[0059] In another aspect of the present invention, the present invention provides a method for determining the methylation status of genes in a sample, wherein the genes include ADHFE1 gene, PPP2R5C gene and SDC2 gene.

[0060] The method comprises:

[0061] (1) obtaining genomic DNA, wherein the genomic DNA comes from the sample;

[0062] (2) performing a methylation conversion treatment on the genomic DNA to obtain a conversion product;

[0063] (3) Using primer sets and probes to perform fluorescence quantitative PCR detection on the conversion products to determine the gene methylation status in the sample.

[0064] The methylation state generally refers to the presence or absence of 5-methylcytosine in one or more CpG dinucleotides in a DNA sequence. The present invention provides a method for determining the methylation state of a gene in a sample, which can be used for accurate, simple and economical early screening of colorectal cancer, and can improve the detection rate of colorectal cancer, especially early colorectal cancer, in high-risk groups for colorectal cancer and general physical examination groups, thereby improving the survival rate of colorectal cancer patients, saving a large amount of medical expenses and reducing medical burdens.

[0065] The sample is not particularly limited and can be a biological sample containing the target nucleic acid, which is isolated from the body. It includes but is not limited to at least one of a tissue sample, a blood sample, a saliva sample, a secretion or an excrement. The excrement mentioned can be a urine sample, a sweat sample or a tear sample. In some preferred embodiments, the excrement is a fecal sample. Since the fecal sample contains intestinal exfoliated cells and the detection using the fecal sample is non-invasive, the fecal sample can be used as the preferred detection object.

[0066] The methylation conversion treatment mentioned can be some chemical reagents, such as sodium bisulfite. For example, some commercial kits can be used to perform methylation conversion treatment, such as using EZ DNA Methylation-Gold Kit to perform bisulfite conversion on DNA. The obtained product can be column purified and re-dissolved using a commercial kit to obtain a purified product.

[0067] In another aspect of the present invention, the present invention provides a separable nucleic acid sequence, wherein the separable nucleic acid sequence comprises a primer set and a probe, wherein the primer set comprises:

[0068] (a) at least one pair of sequences shown in SEQ ID NO: 3 to SEQ ID NO: 40,

[0069] (b) at least one pair of sequences shown in SEQ ID NO:41 to SEQ ID NO:60, and

[0070] (c) at least one pair of sequences shown in SEQ ID NO:61 to SEQ ID NO:98;

[0071] The probe comprises:

[0072] At least one of the sequences shown in SEQ ID NO: 100 to SEQ ID NO: 112,

[0073] At least one of the sequences shown in SEQ ID NO: 113 to SEQ ID NO: 127,

[0074] At least one of the sequences shown in SEQ ID NO:128 to SEQ ID NO:142.

[0075] The present invention further provides a method for evaluating the disease state of colorectal cancer in a subject, the method comprising: a) providing a sample of a subject, the sample containing a target nucleic acid of the subject, the target nucleic acid including nucleic acids from the ADHFE1 gene, the PPP2R5C gene and the SDC2 gene; b) evaluating the methylation state of the target nucleic acid; and c) evaluating the disease state of colorectal cancer in the subject based on the methylation state of the target nucleic acid. The reagent used to evaluate the methylation state of the target nucleic acid can be a chemical reagent, such as sulfite or bisulfite, bisulfite, which can be sodium bisulfite. After being treated with these chemical reagents, the non-methylated cytosine in the target nucleic acid will be converted to uracil, and the methylated cytosine will not undergo such a conversion. Then, the difference in the converted sequence is analyzed by means of various means, such as sequencing, PCR, high-resolution melting curve analysis, etc.; especially the means of fluorescent quantitative PCR, which can be quickly and conveniently distinguished. Of course, the reagent used to evaluate the methylation state of the target nucleic acid can also be some biological reagents, such as polypeptides or enzymes, such as some methylation-sensitive restriction enzymes.

[0076] The subject mentioned herein is a human being. For example, it can be a patient who needs to be diagnosed. The type of biological sample from the subject includes but is not limited to at least one of secretions or excretions such as tissue samples, blood samples, and saliva samples. The excretions mentioned can be urine samples, sweat samples, or tear samples. Moreover, since fecal samples contain intestinal exfoliated cells and the use of fecal samples for detection has the characteristics of non-invasiveness, fecal samples can be used as the preferred detection object.

[0077] In at least some embodiments, the subject is a mammal. In at least some embodiments, the methylation status of the target nucleic acid is assessed in step b) using the primer set and probe mentioned above.

[0078] The method further comprises isolating the target nucleic acid from the sample. Some commercial kits in the art can be used to isolate the target nucleic acid from the sample.

[0079] The method also includes amplifying the target nucleic acid. Some commonly used reagents for nucleic acid amplification can be used. The reagents for nucleic acid amplification can include enzymes, such as enzymes that can be used in polynucleotide amplification reactions, such as enzymes used in fluorescent quantitative polymerase reaction (qPCR).

[0080] The method also includes evaluating the methylation state of the target nucleic acid to obtain a methylation index, and comparing the methylation index with a reference value to determine the methylation state of the sample. In some embodiments, the methylation state of the target nucleic acid is evaluated using a chemical reagent. According to a preferred embodiment of the present invention, the chemical reagent includes bisulfite or sulfite. In some preferred embodiments, the reference value comes from the internal reference gene GAPDH, by comparing the amplification Ct value of ADHFE1, PPP2R5C, and SDC2 genes with the amplification Ct value of the internal reference GAPDH gene, and judging the methylation state of the sample gene based on a threshold value. The threshold value mentioned can be set according to a large number of clinical sample analyses of known pathological information. Of course, the methylation index mentioned can also be some other common methylation indicators, such as methylation frequency, methylation haplotype load, etc.

[0081] In at least some embodiments, the method further includes using an internal reference gene to determine whether the DNA content meets the detection requirements, and using the difference (ΔCt) between the Ct value of the target gene and the Ct value of the internal reference gene to determine the methylation status.

[0082] In at least some embodiments, the method further comprises using GAPDH as an internal reference gene to evaluate the colorectal cancer status of the subject by a fluorescent quantitative PCR method;

[0083] When the Ct value of GAPDH was greater than 37, it was judged as quality control failure;

[0084] When the ADHFE1, PPP2R5C, and SDC2 genes were greater than 37, it was determined to be negative;

[0085] When the Ct value of ADHFE1, PPP2R5C, and SDC2 genes is ≤37, the difference △Ct between the amplification Ct value of ADHFE1, PPP2R5C, and SDC2 genes and the amplification Ct value of the internal reference GAPDH gene is calculated, and the colorectal cancer status of the subject is evaluated based on the ROC curve results and AUC results of the △Ct of ADHFE1, PPP2R5C, and SDC2 genes.

[0086] The method further includes determining that the test result is positive when ΔCt(ADHFE1)≤8, ΔCt(PPP2R5C)≤5, and ΔCt(SDC2)≤12.

[0087] The method also includes assessing the likelihood of colorectal cancer based on the methylation status of the subject to achieve the purpose of auxiliary diagnosis and tumor screening, thereby providing treatment to the subject as early as possible. In at least some embodiments, the treatment includes at least one of chemotherapy, radiotherapy, immunotherapy, cell therapy, and surgery.

[0088] The scheme of the present invention will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used are not indicated by the manufacturer and are all conventional products that can be obtained commercially.

[0089] Example 1

[0090] The inventors determined the target nucleic acid for colorectal cancer diagnosis according to the following methods and steps:

[0091] First, the inventors compared the significant differences in the methylation levels of different genes in tumor / non-tumor samples in the Cancer Genome Atlas (TCGA) database, thereby screening and determining the candidate genes for methylation detection: CDH4, ZNF132, PPP2R5C, LONRF2, ADHFE1, SDC2, NDRG4, BMP3;

[0092] Secondly, specific primers and probes were designed for the candidate genes. In the process of designing primers and probes, the inventors found that because it involves detecting the methylation of the target nucleic acid, most of the C in the genome sequence to be tested is converted to U after bisulfite conversion, and the genome complexity is low. When designing primers and probes, many single bases appear continuously, and the annealing temperature is generally low, so there are relatively few areas where primers can be designed.

[0093] Next, based on the primers and probes designed above, a small amount of tumor / non-tumor samples were used to preliminarily screen the candidate genes, and the sensitivity / specificity results of each gene were as follows: CDH4 (61.5% / 61.5%), ZNF132 (50% / 100%), PPP2R5C (78.9% / 100%), LONRF2 (77.8% / 72%), ADHFE1 (100% / 91.3%), SDC2 (88.9% / 100%), NDRG4 (70% / 95%), BMP3 (65% / 90%). Among them, BMP3, NDRG4, ADHFE1, PPP2R5C and SDC2 had good sensitivity / specificity.

[0094] Furthermore, by comparing the methylation data of the above five candidate genes with good sensitivity / specificity in the TCGA database, it was found that compared with the BMP3 gene and the NDRG4 gene, the ADHFE1, PPP2R5C and SDC2 genes all showed lower background in paracancerous tissues, and showed more obvious differences between cancer tissues and paracancerous tissues. Figure 1 shown.

[0095] Therefore, the inventors finally identified ADHFE1, PPP2R5C, and SDC2 genes as target nucleic acids for colorectal cancer diagnosis, and further designed and optimized specific primers and probe sequences for the above target genes, as shown in Table 1.

[0096] Example 2

[0097] The inventors used the primers and probes of the target nucleic acids (ADHFE1, PPP2R5C, SDC2 genes) for colorectal cancer diagnosis obtained in Example 1 to perform fluorescence quantitative PCR amplification in positive or negative cell lines to verify the effects of the primers and probes.

[0098] Step 1. Sample collection: positive standard DNA (CpGenome Human Methylated DNA Standard Set, Sigma-Aldrich, S8001M), negative standard DNA (CpGenome Human Non-Methylated DNA Standard Set, Sigma-Aldrich, S8001U)

[0099] Step 2, DNA modification: Take 10 ng of each of the above standard DNAs, use EZ DNA Methylation-Gold Kit (ZYMO RESEARCH) to perform bisulfite conversion on the DNA, column purification, and then re-dissolve in 33 ul NF water for later use.

[0100] Step 3: PCR test:

[0101] Taking the primers and probes in Table 1 as examples, fluorescent quantitative PCR detection was performed according to the following PCR system and PCR reaction procedure: wherein the primers and probes for ADHFE1 selected SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 127; the primers and probes for PPP2R5C selected SEQ ID NO: 53, SEQ ID NO: 54 and SEQ ID NO: 139; the primers and probes for SDC2 selected SEQ ID NO: 89, SEQ ID NO: 90 and SEQ ID NO: 101; the primers and probes for the internal reference GAPDH gene selected SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 99.

[0102] The probe SEQ ID NO: 127 has FAM at its 5' end and BHQ1 at its 3' end;

[0103] The probe SEQ ID NO: 139 has CY5 at the 5' end and BHQ3 at the 3' end;

[0104] The probe SEQ ID NO: 101 has VIC at the 5' end and BHQ1 at the 3' end;

[0105] The 5' end of the probe SEQ ID NO: 99 is ROX, and the 3' end is MGB.

[0106] (1) PCR system is shown in Table 2:

[0107] Table 2 PCR system

[0108] Components Final concentration PCR Buffer 1x Magnesium ion 2~5mM dNTP 0.2~0.8mM Primers 0.2~0.8μM Probe 50~200mM Taq Polymerase 1～5U template Up to 30ul

[0109] (2) PCR reaction procedure is shown in Table 3:

[0110] Table 3 PCR reaction program

[0111]

[0112] Step 4, result analysis: Calculate the difference (△Ct value) between the amplification Ct value of ADHFE1, PPP2R5C, and SDC2 genes and the amplification Ct value of the internal reference GAPDH gene, and determine whether the gene methylation level of the sample is normal based on the judgment threshold set by analyzing a large number of clinical samples with known pathological information.

[0113] Among them, the amplification results of the above primers and probes are as follows Figure 2 and Figure 3 shown.

[0114] Example 3

[0115] The inventors have designed and developed a kit for colorectal cancer diagnosis, including specific primers and probes for specific detection of methylation of ADHFE1 gene, PPP2R5C gene and SDC2 gene, wherein the specific primers contained in different kits are selected from the primers listed in Table 1, and the probes are selected from the probes listed in Table 1. Each kit includes at least one forward and reverse primer for specific detection of ADHFE1 gene, at least one forward and reverse primer for specific detection of PPP2R5C gene, and at least one forward and reverse primer for specific detection of SDC2 gene; and may also include at least one probe for detecting ADHFE1 gene, at least one probe for detecting PPP2R5C gene, and at least one probe for detecting SDC2 gene as needed.

[0116] The developed kit may also include forward and reverse primers and probes for detecting an internal reference gene, such as GAPDH, as required.

[0117] The 5' end of the probe is connected to a fluorescent group, which may be FAM, VIC, ROX or CY5, and the 3' end may be connected to a quenching group, such as MGB.

[0118] The primer and probe sequences in the kit may be provided in powder form.

[0119] In addition, the provided kit may also contain PCR reaction buffer, polymerase, DNA methylation conversion reagent, etc. as needed, so as to facilitate technicians in this field to diagnose colorectal cancer according to the method of the present invention.

[0120] Example 4

[0121] The inventors used the kit for colorectal cancer diagnosis shown in Example 3 to perform methylation detection on the sample by the following method, the steps are as follows: Figure 4 As shown, including:

[0122] 1. Sample collection:

[0123] A total of 201 colorectal cancer samples, 184 healthy controls, 4 adenoma samples, and 7 polyp samples were collected.

[0124] 2. Sample DNA extraction:

[0125] DNA was extracted from the collected samples using a commercial stool sample DNA extraction kit.

[0126] 3. DNA modification:

[0127] DNA was bisulfite converted, column purified, and re-eluted using EZ DNA Methylation-Gold Kit (ZYMO RESEARCH).

[0128] 4. PCR detection:

[0129] In this embodiment, the primers and probes for ADHFE1 are SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 127; the primers and probes for PPP2R5C are SEQ ID NO: 53, SEQ ID NO: 54 and SEQ ID NO: 139; the primers and probes for SDC2 are SEQ ID NO: 89, SEQ ID NO: 90 and SEQ ID NO: 101; the primers and probes for the internal reference GAPDH gene are SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 99. According to the PCR system and reaction conditions of the above embodiment 2, the collected samples were subjected to fluorescence quantitative PCR detection.

[0130] 5. Result analysis:

[0131] The detection was performed using a Macrostone 96S qPCR instrument. The baseline and threshold values ​​were set according to the default settings, and the threshold value of the Ct value of each gene was 37.

[0132] Among them, when the Ct value of GAPDH was greater than 37, it was judged as quality control failure;

[0133] When the ADHFE1, PPP2R5C, and SDC2 genes were greater than 37, it was determined to be negative;

[0134] When the Ct value of ADHFE1, PPP2R5C, and SDC2 genes was ≤37, the difference (△Ct value) between the amplification Ct value of ADHFE1, PPP2R5C, and SDC2 genes and the amplification Ct value of the internal reference GAPDH gene was calculated, and the ROC curve of the △Ct of the three genes to be detected was drawn using SPSS software. The ROC curve is shown in Figure 5 The performance and area under the curve (AUC) of each gene are shown in Table 4.

[0135] Table 4 Performance and area under the curve (AUC) of each gene

[0136] Gene AUC Threshold SEN SPE △Ct_ADHFE1 0.886 11.04 79.10％ 88.60％ △Ct_PPP2R5C 0.883 12.66 83.60％ 83.20％ △Ct_SDC2 0.902 11.15 81.10％ 92.40％

[0137] In order to further improve the performance of the kit, the △Ct values ​​of the three genes were integrated for analysis, and the AUC reached 0.945. It was finally determined that the gene test was positive when △Ct (ADHFE1) ≤ 8, △Ct (PPP2R5C) ≤ 5, and △Ct (SDC2) ≤ 12, and the sample was determined to be positive when any gene was positive. Under this judgment condition, the sensitivity reached 87.56% when the specificity was 94.02%.

[0138] Sensitivity is used to indicate the ratio of positive samples or patients diagnosed with colorectal cancer through detection.

[0139] Specificity refers to the ratio of samples or patients diagnosed as normal by clinical pathology through detection.

[0140] The above results show that the present invention can achieve better detection performance than single gene detection through joint detection of multiple genes.

[0141] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0142] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention. SEQUENCE LISTING <110> BGI Biotech (Shenzhen) Co., Ltd. Shenzhen BGI Co., Ltd. <120> Composition, kit and application for colorectal cancer detection <130> BI3210459P <160> 142 <170> PatentIn version 3.5 <210> 1 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer 1 <400> 1 tttaggagtg agtggaagat aga 23 <210> 2 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer 1 <400> 2 aaaccacacc atcctaatta cct 23 <210> 3 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 1 <400> 3 tcgttggggt agttggc 17 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 1 <400> 4 cctatctaaa cctcaaacca atcg 24 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 2 <400> 5 gttttgggtt tttatcgcgc 20 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 2 <400> 6 gccctaaaaa actacatcgc g 21 <210> 7 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 3 <400> 7 gatggtgcga gcgtc 15 <210> 8 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 3 <400> 8 ctatctaaac ctcaaaccaa tcg 23 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 4 <400> 9 ggtaatttta agggtggatg 20 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 4 <400> 10 ctcaaaacca ttttcccac 19 <210> 11 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 5 <400> 11 aagtaaggag atttaaggta g 21 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 5 <400> 12 ctcaaaacca ttttcccac 19 <210> 13 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 6 <400> 13 gggttatttg tttaagtttt aagt 24 <210> 14 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 6 <400> 14 ccccaaatcc tcaaca 16 <210> 15 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 7 <400> 15 gttgtagttg ttttagtaag t 21 <210> 16 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 7 <400> 16 ttaaaactta aacaaataac cc 22 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 8 <400> 17 gattggtttg aggtttaga 19 <210> 18 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 8 <400> 18 aatcctcttc cctcct 16 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 9 <400> 19 gattggtttg aggtttaga 19 <210> 20 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 9 <400> 20 ttacaattac ctcaacaaat ac 22 <210> twenty one <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 10 <400> twenty one ggtaatttta agggtggatg gtg 23 <210> twenty two <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 10 <400> twenty two tcacctatct aaacctcaaa cca 23 <210> twenty three <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 11 <400> twenty three aggtttagat aggtgatttc gc 22 <210> twenty four <211> 16 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 11 <400> twenty four aaactacccg cctccc 16 <210> 25 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 12 <400> 25 ttggcgtttt ggtttttatt tc 22 <210> 26 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 12 <400> 26 cctatctaaa cctcaaacca atcg 24 <210> 27 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 13 <400> 27 gatttaaggt agaattcgag gtttac 26 <210> 28 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 13 <400> 28 cacgaaataa aaaccaaaac g 21 <210> 29 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 14 <400> 29 cgtagttttt tgggtgtgat tc 22 <210> 30 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 14 <400> 30 aaaacgatat ccaaattctc cg 22 <210> 31 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 15 <400> 31 cgtattttgt gatttcgttg tttc 24 <210> 32 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 15 <400> 32 aaaaattcga aaaatttaaa taccg 25 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 16 <400> 33 cgtttgttta ttcgtttcgc 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 16 <400> 34 cgccgctaaa acaactaacg 20 <210> 35 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 17 <400> 35 cgttttgaga ggttgtatcg c 21 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 17 <400> 36 aaaaattcga aaaatttaaa taccg 25 <210> 37 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 18 <400> 37 gtttagggcg gtatttaaat ttttc 25 <210> 38 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 18 <400> 38 atataacccg ctcaaatcct acg 23 <210> 39 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 forward primer 19 <400> 39 tgtatcgcgt attttgtgat ttc 23 <210> 40 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 reverse primer 19 <400> 40 ccgcttactt tcaaaaattc g 21 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C forward primer 1 <400> 41 ggttttcgtt gtttcgtttc 20 <210> 42 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C reverse primer 1 <400> 42 ccaaatcgac gtcctccg 18 <210> 43 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C forward primer 2 <400> 43 ggttttaggt cggggtttc 19 <210> 44 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C reverse primer 2 <400> 44 cctcctccga actccg 16 <210> 45 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C forward primer 3 <400> 45 tttcggtatg ggttttaggt c 21 <210> 46 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C reverse primer 3 <400> 46 cctcctccga actccg 16 <210> 47 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C forward primer 4 <400> 47 cgttgtttcg tttcggagtt c 21 <210> 48 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C reverse primer 4 <400> 48 caaatcgacg tcctccg 17 <210> 49 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C forward primer 5 <400> 49 tgtttcggtt ttcgttgttt c 21 <210> 50 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C reverse primer 5 <400> 50 caaatcgacg tcctccg 17 <210> 51 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C forward primer 6 <400> 51 ggaaacggga gagcgc 16 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C reverse primer 6 <400> 52 cgccgatcta acctcctacg 20 <210> 53 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C forward primer 7 <400> 53 cgggacggaa aggaaac 17 <210> 54 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C reverse primer 7 <400> 54 gccgatctaa cctcctacg 19 <210> 55 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C forward primer 8 <400> 55 ggttggagga tgaagtt 17 <210> 56 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C reverse primer 8 <400> 56 tccaaccctc tacttaac 18 <210> 57 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C forward primer 9 <400> 57 ggtatgggtt ttaggt 16 <210> 58 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C reverse primer 9 <400> 58 actaaaaaat aaaaccccc 19 <210> 59 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C forward primer 10 <400> 59 aagtagaggg ttggag 16 <210> 60 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C reverse primer 10 <400> 60 aaaaccctta actccc 16 <210> 61 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 1 <400> 61 agtgtagaaa ttaataagtg agagggc 27 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 1 <400> 62 ttcctcctcc tacgcctact 20 <210> 63 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 2 <400> 63 ataagtgaga gggcgtcgc 19 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 2 <400> 64 ttcctcctcc tacgcctact 20 <210> 65 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 3 <400> 65 cgttgcggta ttttgtttc 19 <210> 66 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 3 <400> 66 aacgaaacct cctacccaa 19 <210> 67 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 4 <400> 67 aaattagaaa ttgaatttcg gtacg 25 <210> 68 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 4 <400> 68 aactactctc taaaactcttcttactctac t 31 <210> 69 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 5 <400> 69 gcgttgggta ggaggtttc 19 <210> 70 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 5 <400> 70 atattcccca aaaaccgact act 23 <210> 71 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 6 <400> 71 tcgtttaggg tgtttgaagt tac 23 <210> 72 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 6 <400> 72 ccaacgaatc tccgatatat actt 24 <210> 73 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 7 <400> 73 cgtggtttgg gaaggac 17 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 7 <400> 74 cgaaataaaa ccgttccctc 20 <210> 75 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 8 <400> 75 ggagtttggg tcgggttc 18 <210> 76 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 8 <400> 76 aaatttccaa atcatcccta atctc 25 <210> 77 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 9 <400> 77 gggagtgtag aaattaataa gtgagagg 28 <210> 78 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 9 <400> 78 ctcctacgcc tactcccg 18 <210> 79 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 10 <400> 79 gagttcgagt tttcgagttt gagt 24 <210> 80 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 10 <400> 80 ctacccaacg ctcgacg 17 <210> 81 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 11 <400> 81 gagttcgagt tttcgagttt gagt 24 <210> 82 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 11 <400> 82 cgaaacctcc tacccaacg 19 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 12 <400> 83 gagtcggtga gtgggttagg 20 <210> 84 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 12 <400> 84 gctcccctat tccctacg 18 <210> 85 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 13 <400> 85 atattttaaa cggcgcgc 18 <210> 86 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 13 <400> 86 taaatcctac tcaccttaaa cttaataacc t 31 <210> 87 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 14 <400> 87 ttgaggaagg gaagaggg 18 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 14 <400> 88 caatccccaa atatacaccg 20 <210> 89 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 15 <400> 89 tttagggatc ggttgttttt agtc 24 <210> 90 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 15 <400> 90 gaattcgtat acgcgaacta cg 22 <210> 91 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 16 <400> 91 agtttaaggt gagtaggatt tacgc 25 <210> 92 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 16 <400> 92 ttttacccta attacaaaca acgac 25 <210> 93 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 17 <400> 93 ggtttttgcg gttagattaa atc ​​23 <210> 94 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 17 <400> 94 aaaaaacgct actcgctaac gt 22 <210> 95 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 18 <400> 95 gtagggaata ggggag 16 <210> 96 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 18 <400> 96 aaataacttc aaaaacctc 19 <210> 97 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SDC2 forward primer 19 <400> 97 gaagaagttg ggagtgat 18 <210> 98 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> SDC2 reverse primer 19 <400> 98 cctcttccct tcctca 16 <210> 99 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> GAPDH probe 1 <400> 99 cccaaaacac atttcttcca ttc 23 <210> 100 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> SDC2 probe 1 <400> 100 aaacgaagtt ttttgtttag cgtt 24 <210> 101 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SDC2 probe 2 <400> 101 gaaaaaactt cgttttaccc taattac 27 <210> 102 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SDC2 probe 3 <400> 102 acaccgaaaa ttacgattta atctaac 27 <210> 103 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SDC2 probe 4 <400> 103 acaccaaaaa ttacaattta atctaac 27 <210> 104 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SDC2 probe 5 <400> 104 ctactcgcta acgttaccc 19 <210> 105 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SDC2 probe 6 <400> 105 ctactcacta acattaccc 19 <210> 106 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> SDC2 probe 7 <400> 106 cctcttccct tcctca 16 <210> 107 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SDC2 Probe 8 <400> 107 taacgccaac gaacaacgct tt 22 <210> 108 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SDC2 Probe 9 <400> 108 ctaaaccaaa ccgcaattct cgata 25 <210> 109 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SDC2 Probe 10 <400> 109 taacaccaac aaacaacact tt 22 <210> 110 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SDC2 Probe 11 <400> 110 ctaaaccaaa ccacaattct caata 25 <210> 111 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SDC2 probe 12 <400> 111 accccgcgat ccgcgaaaat aaaa 24 <210> 112 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SDC2 probe 13 <400> 112 cccgcgatcc gcgaaaataa aaacaccg 28 <210> 113 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 1 <400> 113 tcacctatct aaacctcaaa cca 23 <210> 114 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 2 <400> 114 cccaacgacg ctcgcac 17 <210> 115 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 3 <400> 115 caacgacgct cgcaccat 18 <210> 116 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 4 <400> 116 taaataatac gaacgccgct aaaac 25 <210> 117 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 5 <400> 117 atacgaacgc cgctaaaaca actaac 26 <210> 118 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 6 <400> 118 cccaacaaca ctcacac 17 <210> 119 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 7 <400> 119 caacaacact cacaccat 18 <210> 120 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 8 <400> 120 taaataatac aaacacccact aaaac 25 <210> 121 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 9 <400> 121 atacaaacac cactaaaaca actaac 26 <210> 122 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 10 <400> 122 actcaaaacc attttcccac gaaat 25 <210> 123 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 11 <400> 123 aacgaaaaac gccactacccgatacga 27 <210> 124 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 12 <400> 124 aacgccacta cccgatacga actacacc 28 <210> 125 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 probe 13 <400> 125 aaaaaccaaa acgccaacta cccca 25 <210> 126 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 Probe 14 <400> 126 cccacgaaat aaaaaccaaa acgccaac 28 <210> 127 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ADHFE1 Probe 15 <400> 127 caaaacgcca actaccccaa cgac 24 <210> 128 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C Probe 1 <400> 128 cgaaccgcgc tctccc 16 <210> 129 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C Probe 2 <400> 129 tttcctttcc gtcccgtctc g 21 <210> 130 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 3 <400> 130 aattaaaacg cgcaacgcaa 20 <210> 131 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 4 <400> 131 cgattcgcga acgacc 16 <210> 132 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 5 <400> 132 ctttaccccg acctccgcta 20 <210> 133 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 6 <400> 133 caaaccacac tctccc 16 <210> 134 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 7 <400> 134 tttcctttcc atcccatctc a 21 <210> 135 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 8 <400> 135 aattaaaaca cacaacacaa 20 <210> 136 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 9 <400> 136 acacaattca caaacaacca 20 <210> 137 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 10 <400> 137 ctttacccca acctccacta 20 <210> 138 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 11 <400> 138 ccgcccgcga accgcgctc 19 <210> 139 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 12 <400> 139 tacgcgctcc aaccctctac ttaaccgc 28 <210> 140 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 13 <400> 140 caaccctcta cttaaccgcc cgcgaa 26 <210> 141 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 14 <400> 141 cgttacgcgc tccaaccctc t 21 <210> 142 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PPP2R5C probe 15 <400> 142 tacgttacgc gctccaaccc tct 23

Claims

1. A composition for colorectal cancer detection, characterized in that: Contains reagents for detecting the methylation status of the ADHFE1 gene, PPP2R5C gene, and SDC2 gene; The reagent for detecting the methylation status of the ADHFE1 gene includes primers whose sequences are shown in SEQ ID NO: 7 and SEQ ID NO: 8, and a probe whose sequence is shown in SEQ ID NO: 127; The reagent for detecting the methylation status of the PPP2R5C gene includes primers whose sequences are shown in SEQ ID NO:53 and SEQ ID NO:54, and a probe whose sequence is shown in SEQ ID NO:139; The reagent for detecting the methylation status of the SDC2 gene includes primers whose sequences are shown in SEQ ID NO:89 and SEQ ID NO:90, and a probe whose sequence is shown in SEQ ID NO:

101.

2. The composition according to claim 1, characterized in that The composition also includes a reagent for detecting the GAPDH gene, wherein the reagent for detecting the GAPDH gene includes primers whose sequences are shown as SEQ ID NO:1 and SEQ ID NO:2, and a probe whose sequence is shown as SEQ ID NO:

99.

3. The composition according to claim 1, characterized in that The composition comprises at least one selected from the following: PCR buffer, salt ions, dNTPs, DNA polymerase or target nucleic acid.

4. Use of the composition according to any one of claims 1 to 3 in the preparation of a kit for diagnosing colorectal cancer.

5. A kit for diagnosing colorectal cancer, characterized in that: The kit comprises the composition according to any one of claims 1 to 3.

6. The kit according to claim 5, characterized in that Further comprising at least one of the following reagents: DNA extraction reagents, DNA methylation conversion reagents, nucleic acid purification reagents.

Images