Nanoparticles with a single site for template polynucleotide attachment

Abstract

The present invention provides a nanoparticle, the nanoparticle comprises a scaffold, a single template site for binding a template polynucleotide to the scaffold, and a plurality of auxiliary sites for binding an auxiliary oligonucleotide to the scaffold, wherein the scaffold is selected from an asymmetric acrylamide polymer scaffold or a dendrimer comprising a lysyl constituent repeating unit, the single template site for binding a template polynucleotide to the scaffold is selected from a covalent template binding site and a non-covalent template binding site, and the plurality of auxiliary sites for binding an auxiliary oligonucleotide to the scaffold are selected from a covalent auxiliary oligonucleotide binding site and a non-covalent auxiliary oligonucleotide binding site. A method for using the nanoparticle is also provided.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application is an international application filed under the Patent Cooperation Treaty, which claims the benefit of priority to U.S. Provisional Patent Application No. 62 / 952,799 filed on December 23, 2019 and U.S. Provisional Patent Application No. 62 / 952,866 filed on December 23, 2019, the entire contents of which are incorporated herein by reference.

[0003] Sequence Listing

[0004] This application contains a sequence listing created on December 16, 2020; the file is in ASCII format, named 1912732.txt, and is 3.2KB in size. The entire text of this file is hereby incorporated by reference into this application. Background Art

[0005] Many current sequencing platforms use "sequencing by synthesis" (SBS) technology and fluorescence-based detection methods. In some examples, many target polynucleotides or template polynucleotides to be sequenced separated from the library are attached to the surface of the substrate in a process called inoculation. Then, in a process called clustering, multiple copies of the template polynucleotide can be synthesized, which are attached to the position of the template polynucleotide inoculated on the surface close to the copy. Subsequently, nascent copies of the clustered polynucleotide are synthesized under the following conditions: when each nucleotide is attached to the nascent chain, the nascent copy of the clustered polynucleotide emits a signal identifying each nucleotide. Multiple copies of the inoculated template polynucleotide are clustered near the position where it was initially inoculated so that the signal generated during the visualization polymerization is amplified, thereby improving detection.

[0006] SBS seeding and clustering works best when the template polynucleotides seed as much of the available substrate surface as possible, which maximizes the amount of sequencing information that can be obtained during a sequencing run. In contrast, in general, the smaller the available surface area of ​​the substrate used for seeding and clustering, the less efficient the SBS process may be, resulting in increased time, reactants, costs, and data processing complexity to obtain a given amount of sequencing information for a given library.

[0007] When the template polynucleotide with sequence different from each other from the library is inoculated or attached to each position on the surface with a distance far enough apart from each other, so that clustering produces spatially different clusters (this situation is generally referred to as monoclonality) of the replication polynucleotide derived from the inoculation of a single template polynucleotide respectively, inoculation and clustering effect are also fine.That is to say, the library of template polynucleotide can usually include a large amount of template polynucleotide molecules, and the nucleotide sequences of these template polynucleotide molecules are different from each other.If two such template polynucleotides are inoculated too close on the surface of substrate, clustering may produce a colony mixed in space of replication polynucleotide, in which some of them have a sequence inoculated in the template polynucleotide nearby, and other replication polynucleotides have a sequence of another template polynucleotide also inoculated in the vicinity on the surface.Or, two clusters formed by two different template polynucleotides inoculated too close to each other may be too adjacent to each other or abut each other, so that the imaging system used in the SBS process may not be able to distinguish them as separate clusters, even if there may not be or rarely have the spatial mixing of the sequence attached to substrate between these clusters.This unfavorable condition is generally referred to as polyclonality. Obtaining unambiguous sequence information from polyclonal clusters (if present) can be more difficult, time-consuming, expensive, and less efficient, and requires more complex data analysis. Summary of the invention

[0008] Therefore, it is desirable to perform SBS under conditions where as much available surface area of ​​the substrate surface as possible is used for seeding and clustering, while also promoting separation of the seeded template polynucleotides so as to maximize the monoclonality of the clusters as much as possible and minimize polyclonal clusters as much as possible. Compositions and methods that can be used to advantageously increase seeding density and monoclonal clustering in SBS are disclosed herein.

[0009] In one aspect, a nanoparticle is provided, comprising a scaffold, a single template site selected from a covalent template binding site and a non-covalent template binding site for binding a template polynucleotide to the scaffold, and a plurality of auxiliary sites selected from a covalent auxiliary oligonucleotide binding site and a non-covalent auxiliary oligonucleotide binding site for binding an auxiliary oligonucleotide to the scaffold, wherein the scaffold is a compound of formula I:

[0010]

[0011] Each X is a compound of formula II:

[0012]

[0013] Where R 2 Selected from Formula IIIa:

[0014] Where R 5 Selected from x is an integer in the range of 1-2,000, and y is an integer in the range of 1-10,000, and the ratio of x:y may be about 10:90 to about 1:99, and wherein each R z are independently H or C 1-4 Alkyl; and formula IIIb:

[0015] Where R 5 Selected from y is an integer in the range of 1-2,000, and x and z are integers whose sum is in the range of 1-10,000, and the ratio of (x:y):z may be about (85):15 to about (95):5, and wherein each R z are independently H or C 1-4 Alkyl, R 1 comprising a single template site for binding the template polynucleotide to the scaffold, R 4 Selected from optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Alkenyl, optionally substituted C 1 -C 20 Alkynyl, optionally substituted C 1 -C 20 Oxaalkyl, optionally substituted C 1 -C 20 Thioalkyl and optionally substituted C 1 -C 20 Azaalkyl, wherein the substitution includes C 1 -C 20 alkyl, double bond oxygen and hydroxyl groups, and R 3 An auxiliary site for binding an auxiliary oligonucleotide is included.

[0016] In one example, the single template site includes a covalent template binding site. In another example, the covalent template binding site is selected from amine-NHS ester binding site, amine-imidate binding site, amine-pentafluorophenyl ester binding site, amine-hydroxymethylphosphine binding site, carboxyl-carbodiimide binding site, thiol-maleimide binding site, thiol-haloacetyl binding site, thiol-pyridyl disulfide binding site, thiol-thiosulfonate binding site, thiol-vinyl sulfone binding site, aldehyde-hydrazide binding site, aldehyde-alkoxyamine binding site, aldehyde-NHS ester binding site, hydroxyl-isocyanate binding site, azide-alkyne binding site, azide-phosphine binding site, trans-cyclooctene-tetrazine binding site, norbornene-tetrazine binding site, azide-cyclooctyne binding site, azide-norbornene binding site, oxime binding site, SpyTag-SpyCatcher binding site, Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 -Benzylcytosine binding site and sortase coupling binding site.

[0017] In another example, the single template site includes a non-covalent template binding site. In yet another example, the non-covalent template binding site includes a polynucleotide hybridization site. In yet another example, the non-covalent template binding site includes a non-covalent peptide binding site, and the non-covalent peptide binding site is selected from a coiled-coil binding site and an avidin-biotin binding site.

[0018] In another example, the plurality of auxiliary sites for binding the auxiliary oligonucleotide to the scaffold include a covalent auxiliary oligonucleotide binding site. In yet another example, the covalent auxiliary oligonucleotide binding site is selected from an amine-NHS ester binding site, an amine-imidate binding site, an amine-pentafluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, a hydroxyl-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a trans-cyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a Snap-tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 - a benzylcytosine binding site, a sortase conjugate binding site, and any combination of two or more thereof.

[0019] In another example, the auxiliary oligonucleotide binding site includes a non-covalent auxiliary oligonucleotide binding site. In yet another example, the non-covalent auxiliary oligonucleotide binding site includes a polynucleotide hybridization site. In yet another example, the non-covalent auxiliary oligonucleotide binding site includes a non-covalent peptide binding site, and the non-covalent peptide binding site is selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

[0020] In another example, the nanoparticle further comprises a single template polynucleotide bound to a single template site. In yet another example, the scaffold further comprises a plurality of auxiliary oligonucleotides bound to a plurality of auxiliary sites.

[0021] In another example, the nanoparticles have a diameter of at least 10 nm, a diameter of at least 20 nm, a diameter of at least 30 nm, a diameter of at least about 40 nm, a diameter of at least about 50 nm, a diameter of at least about 60 nm, a diameter of at least about 70 nm, a diameter of at least about 80 nm, a diameter of at least about 90 nm, a diameter of at least about 100 nm, a diameter of at least about 125 nm, a diameter of at least about 150 nm, a diameter of at least about 175 nm, a diameter of at least about 200 nm, a diameter of at least about 225 nm, a diameter of at least about 250 nm, a diameter of at least about 275 nm, a diameter of at least At least about 300 nm in diameter, at least about 325 nm in diameter, at least about 350 nm in diameter, at least about 375 nm in diameter, at least about 400 nm in diameter, at least about 425 nm in diameter, at least about 450 nm in diameter, at least about 475 nm in diameter, at least about 500 nm in diameter, at least about 550 nm in diameter, at least about 600 nm in diameter, at least about 650 nm in diameter, at least about 700 nm in diameter, at least about 750 nm in diameter, at least about 800 nm in diameter, at least about 850 nm in diameter, at least about 900 nm in diameter, or at least about 950 nm in diameter.

[0022] On the other hand, a method is provided, which includes a single template polynucleotide being bonded to a single template site of nanoparticle. In yet another aspect, a method is provided, which includes a plurality of auxiliary oligonucleotides being bonded to a plurality of auxiliary sites of nanoparticle. In yet another example, the method also includes synthesizing a copy selected from a copy of a template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of one or more supports attached to the copy of the two, wherein the copy attached to the support extends from the auxiliary oligonucleotide. In yet another example, the method also includes attaching the support to a substrate, wherein attaching includes hybridizing the auxiliary oligonucleotide with the oligonucleotide attached to the substrate.

[0023] In one example, the substrate includes a plurality of nanopores, and the oligonucleotides attached to the substrate are attached in the plurality of nanopores. In another example, no more than one support is incorporated in any one of the nanopores. In yet another example, the method further includes synthesizing a copy selected from a copy of a template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of one or more substrates attached to the copy of the two, wherein the copy attached to the substrate extends from the oligonucleotides attached to the substrate. In yet another example, the method further includes sequencing at least one of the copies attached to the support and the copies attached to the substrate, wherein sequencing includes sequencing while synthesizing.

[0024] In another aspect, a nanoparticle is provided, comprising a scaffold, a single template site selected from a covalent template binding site and a non-covalent template binding site for binding a template polynucleotide to the scaffold, and a plurality of auxiliary sites selected from a covalent auxiliary oligonucleotide binding site and a non-covalent auxiliary oligonucleotide binding site for binding an auxiliary oligonucleotide to the scaffold, wherein the scaffold comprises a dendrimer, wherein the dendrimer comprises 2 to 10 generations of constituent repeating units, the constituent repeating units comprising lysine, wherein the upstream generation lysine forms a peptide bond with the first lysine of the immediately downstream generation and forms an isopeptide bond with the second lysine of the immediately downstream generation, the single template site extends from the C-terminus of the first generation lysine of the dendrimer, and the plurality of auxiliary sites extend from the NH 2 of the last generation lysine of the dendrimer. 2 Group extension.

[0025] In one example, the single template site includes a covalent template binding site. In another example, the covalent template binding site is selected from amine-NHS ester binding site, amine-imidate binding site, amine-pentafluorophenyl ester binding site, amine-hydroxymethylphosphine binding site, carboxyl-carbodiimide binding site, thiol-maleimide binding site, thiol-haloacetyl binding site, thiol-pyridyl disulfide binding site, thiol-thiosulfonate binding site, thiol-vinyl sulfone binding site, aldehyde-hydrazide binding site, aldehyde-alkoxyamine binding site, aldehyde-NHS ester binding site, hydroxyl-isocyanate binding site, azide-alkyne binding site, azide-phosphine binding site, trans-cyclooctene-tetrazine binding site, norbornene-tetrazine binding site, azide-cyclooctyne binding site, azide-norbornene binding site, oxime binding site, SpyTag-SpyCatcher binding site, Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 -Benzylcytosine binding site and sortase coupling binding site.

[0026] In another example, the single template site includes a non-covalent template binding site. In yet another example, the non-covalent template binding site includes a polynucleotide hybridization site. In yet another example, the non-covalent template binding site includes a non-covalent peptide binding site, and the non-covalent peptide binding site is selected from a coiled-coil binding site and an avidin-biotin binding site.

[0027] In another example, the plurality of auxiliary sites for binding the auxiliary oligonucleotide to the scaffold include a covalent auxiliary oligonucleotide binding site. In yet another example, the covalent auxiliary oligonucleotide binding site is selected from an amine-NHS ester binding site, an amine-imidate binding site, an amine-pentafluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, a hydroxyl-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a trans-cyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a Snap-tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 - a benzylcytosine binding site, a sortase conjugate binding site, and any combination of two or more thereof.

[0028] In another example, the auxiliary oligonucleotide binding site includes a non-covalent auxiliary oligonucleotide binding site. In yet another example, the non-covalent auxiliary oligonucleotide binding site includes a polynucleotide hybridization site. In yet another example, the non-covalent auxiliary oligonucleotide binding site includes a non-covalent peptide binding site, and the non-covalent peptide binding site is selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

[0029] In another example, the nanoparticle further comprises a single template polynucleotide bound to a single template site. In yet another example, the scaffold further comprises a plurality of auxiliary oligonucleotides bound to a plurality of auxiliary sites.

[0030] In another example, the nanoparticles have a diameter of at least 10 nm, a diameter of at least 20 nm, a diameter of at least 30 nm, a diameter of at least about 40 nm, a diameter of at least about 50 nm, a diameter of at least about 60 nm, a diameter of at least about 70 nm, a diameter of at least about 80 nm, a diameter of at least about 90 nm, a diameter of at least about 100 nm, a diameter of at least about 125 nm, a diameter of at least about 150 nm, a diameter of at least about 175 nm, a diameter of at least about 200 nm, a diameter of at least about 225 nm, a diameter of at least about 250 nm, a diameter of at least about 275 nm, a diameter of at least At least about 300 nm in diameter, at least about 325 nm in diameter, at least about 350 nm in diameter, at least about 375 nm in diameter, at least about 400 nm in diameter, at least about 425 nm in diameter, at least about 450 nm in diameter, at least about 475 nm in diameter, at least about 500 nm in diameter, at least about 550 nm in diameter, at least about 600 nm in diameter, at least about 650 nm in diameter, at least about 700 nm in diameter, at least about 750 nm in diameter, at least about 800 nm in diameter, at least about 850 nm in diameter, at least about 900 nm in diameter, or at least about 950 nm in diameter.

[0031] On the other hand, a method is provided, which includes a single template polynucleotide being bonded to a single template site of nanoparticle. In yet another aspect, a method is provided, which includes a plurality of auxiliary oligonucleotides being bonded to a plurality of auxiliary sites of nanoparticle. In yet another example, the method also includes synthesizing a copy selected from a copy of a template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of one or more supports attached to the copy of the two, wherein the copy attached to the support extends from the auxiliary oligonucleotide. In yet another example, the method also includes attaching the support to a substrate, wherein attaching includes hybridizing the auxiliary oligonucleotide with the oligonucleotide attached to the substrate.

[0032] In one example, the substrate includes a plurality of nanopores, and the oligonucleotides attached to the substrate are attached in the plurality of nanopores. In another example, no more than one support is incorporated in any one of the nanopores. In yet another example, the method further includes synthesizing a copy selected from a copy of a template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of one or more substrates attached to the copy of the two, wherein the copy attached to the substrate extends from the oligonucleotides attached to the substrate. In yet another example, the method further includes sequencing at least one of the copies attached to the support and the copies attached to the substrate, wherein sequencing includes sequencing while synthesizing.

[0033] In another aspect, a nanoparticle is provided, comprising a scaffold, a single template site selected from a covalent template binding site and a non-covalent template binding site for binding a template polynucleotide to the scaffold, and a plurality of auxiliary sites selected from a covalent auxiliary oligonucleotide binding site and a non-covalent auxiliary oligonucleotide binding site for binding an auxiliary oligonucleotide to the scaffold, wherein the scaffold is a compound of formula IV:

[0034]

[0035] Each X is a compound of formula V:

[0036]

[0037] Where R 2 Selected from Formula VIa:

[0038] And Formula VIb: wherein p is an integer selected from 1 to 20, and R 5 Includes an auxiliary site for binding an auxiliary oligonucleotide, R 3 Select from direct key, m is an integer from 1 to 2,000, and n is an integer from 1 to 10,000, R 1 comprising a single template site for binding the template polynucleotide to the scaffold, R 4 Selected from optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Alkenyl, optionally substituted C 1 -C 20 Alkynyl, optionally substituted C 1 -C 20 Oxaalkyl, optionally substituted C 1 -C 20 Thioalkyl and optionally substituted C 1 -C 20 Azaalkyl, wherein the substitution includes C 1 -C 20 alkyl, double bond oxygen and hydroxyl groups, and R 3 includes an auxiliary site for binding to an auxiliary oligonucleotide. In any of the foregoing examples, the trithiocarbonate group Optionally, a direct bond, -CH 2 -key, -S-key, -N-key or -O-key replacement.

[0039] In one example, the single template site includes a covalent template binding site. In another example, the covalent template binding site is selected from amine-NHS ester binding site, amine-imidate binding site, amine-pentafluorophenyl ester binding site, amine-hydroxymethylphosphine binding site, carboxyl-carbodiimide binding site, thiol-maleimide binding site, thiol-haloacetyl binding site, thiol-pyridyl disulfide binding site, thiol-thiosulfonate binding site, thiol-vinyl sulfone binding site, aldehyde-hydrazide binding site, aldehyde-alkoxyamine binding site, aldehyde-NHS ester binding site, hydroxyl-isocyanate binding site, azide-alkyne binding site, azide-phosphine binding site, trans-cyclooctene-tetrazine binding site, norbornene-tetrazine binding site, azide-cyclooctyne binding site, azide-norbornene binding site, oxime binding site, SpyTag-SpyCatcher binding site, Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 -Benzylcytosine binding site and sortase coupling binding site.

[0040] In another example, the single template site includes a non-covalent template binding site. In yet another example, the non-covalent template binding site includes a polynucleotide hybridization site. In yet another example, the non-covalent template binding site includes a non-covalent peptide binding site, and the non-covalent peptide binding site is selected from a coiled-coil binding site and an avidin-biotin binding site.

[0041] In another example, the plurality of auxiliary sites for binding the auxiliary oligonucleotide to the scaffold include a covalent auxiliary oligonucleotide binding site. In yet another example, the covalent auxiliary oligonucleotide binding site is selected from an amine-NHS ester binding site, an amine-imidate binding site, an amine-pentafluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, a hydroxyl-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a trans-cyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a Snap-tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 - a benzylcytosine binding site, a sortase conjugate binding site, and any combination of two or more thereof.

[0042] In another example, the auxiliary oligonucleotide binding site includes a non-covalent auxiliary oligonucleotide binding site. In yet another example, the non-covalent auxiliary oligonucleotide binding site includes a polynucleotide hybridization site. In yet another example, the non-covalent auxiliary oligonucleotide binding site includes a non-covalent peptide binding site, and the non-covalent peptide binding site is selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

[0043] In another example, the nanoparticle further comprises a single template polynucleotide bound to a single template site. In yet another example, the scaffold further comprises a plurality of auxiliary oligonucleotides bound to a plurality of auxiliary sites.

[0044] In another example, the nanoparticles have a diameter of at least 10 nm, a diameter of at least 20 nm, a diameter of at least 30 nm, a diameter of at least about 40 nm, a diameter of at least about 50 nm, a diameter of at least about 60 nm, a diameter of at least about 70 nm, a diameter of at least about 80 nm, a diameter of at least about 90 nm, a diameter of at least about 100 nm, a diameter of at least about 125 nm, a diameter of at least about 150 nm, a diameter of at least about 175 nm, a diameter of at least about 200 nm, a diameter of at least about 225 nm, a diameter of at least about 250 nm, a diameter of at least about 275 nm, a diameter of at least At least about 300 nm in diameter, at least about 325 nm in diameter, at least about 350 nm in diameter, at least about 375 nm in diameter, at least about 400 nm in diameter, at least about 425 nm in diameter, at least about 450 nm in diameter, at least about 475 nm in diameter, at least about 500 nm in diameter, at least about 550 nm in diameter, at least about 600 nm in diameter, at least about 650 nm in diameter, at least about 700 nm in diameter, at least about 750 nm in diameter, at least about 800 nm in diameter, at least about 850 nm in diameter, at least about 900 nm in diameter, or at least about 950 nm in diameter.

[0045] On the other hand, a method is provided, which includes a single template polynucleotide being bonded to a single template site of nanoparticle. In yet another aspect, a method is provided, which includes a plurality of auxiliary oligonucleotides being bonded to a plurality of auxiliary sites of nanoparticle. In yet another example, the method also includes synthesizing a copy selected from a copy of a template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of one or more supports attached to the copy of the two, wherein the copy attached to the support extends from the auxiliary oligonucleotide. In yet another example, the method also includes attaching the support to a substrate, wherein attaching includes hybridizing the auxiliary oligonucleotide with the oligonucleotide attached to the substrate.

[0046] In one example, the substrate includes a plurality of nanopores, and the oligonucleotides attached to the substrate are attached in the plurality of nanopores. In another example, no more than one support is incorporated in any one of the nanopores. In yet another example, the method further includes synthesizing a copy selected from a copy of a template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of one or more substrates attached to the copy of the two, wherein the copy attached to the substrate extends from the oligonucleotides attached to the substrate. In yet another example, the method further includes sequencing at least one of the copies attached to the support and the copies attached to the substrate, wherein sequencing includes sequencing while synthesizing.

[0047] In another aspect, a nanoparticle is provided, comprising a scaffold, a single template site selected from a covalent template binding site and a non-covalent template binding site for binding a template polynucleotide to the scaffold, and a plurality of auxiliary sites selected from a covalent auxiliary oligonucleotide binding site and a non-covalent auxiliary oligonucleotide binding site for binding an auxiliary oligonucleotide to the scaffold, wherein the scaffold is a compound of formula VII:

[0048]

[0049] Each X is a compound of formula VIII:

[0050]

[0051] Where y is an integer from 1 to 20, R 2 Selected from Formula IXa:

[0052] And Formula IXb: wherein p is an integer selected from 1 to 20, and R 5 Includes an auxiliary site for binding an auxiliary oligonucleotide, R 3 Select from direct key, m is an integer from 1 to 2,000, and n is an integer from 1 to 10,000, R 1 comprising a single template site for binding the template polynucleotide to the scaffold, R 4 Selected from optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Alkenyl, optionally substituted C 1 -C 20 Alkynyl, optionally substituted C 1 -C 20 Oxaalkyl, optionally substituted C 1 -C 20Thioalkyl and optionally substituted C 1 -C 20 Azaalkyl, wherein the substitution includes C 1 -C 20 alkyl, double bond oxygen and hydroxyl groups, and R 3 includes an auxiliary site for binding to an auxiliary oligonucleotide. In any of the foregoing examples, the trithiocarbonate group Optionally, a direct bond, -CH 2 -key, -S-key, -N-key or -O-key replacement.

[0053] In one example, the single template site includes a covalent template binding site. In another example, the covalent template binding site is selected from amine-NHS ester binding site, amine-imidate binding site, amine-pentafluorophenyl ester binding site, amine-hydroxymethylphosphine binding site, carboxyl-carbodiimide binding site, thiol-maleimide binding site, thiol-haloacetyl binding site, thiol-pyridyl disulfide binding site, thiol-thiosulfonate binding site, thiol-vinyl sulfone binding site, aldehyde-hydrazide binding site, aldehyde-alkoxyamine binding site, aldehyde-NHS ester binding site, hydroxyl-isocyanate binding site, azide-alkyne binding site, azide-phosphine binding site, trans-cyclooctene-tetrazine binding site, norbornene-tetrazine binding site, azide-cyclooctyne binding site, azide-norbornene binding site, oxime binding site, SpyTag-SpyCatcher binding site, Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 -Benzylcytosine binding site and sortase coupling binding site.

[0054] In another example, the single template site includes a non-covalent template binding site. In yet another example, the non-covalent template binding site includes a polynucleotide hybridization site. In yet another example, the non-covalent template binding site includes a non-covalent peptide binding site, and the non-covalent peptide binding site is selected from a coiled-coil binding site and an avidin-biotin binding site.

[0055] In another example, the plurality of auxiliary sites for binding the auxiliary oligonucleotide to the scaffold include a covalent auxiliary oligonucleotide binding site. In yet another example, the covalent auxiliary oligonucleotide binding site is selected from an amine-NHS ester binding site, an amine-imidate binding site, an amine-pentafluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, a hydroxyl-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a trans-cyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a Snap-tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 - a benzylcytosine binding site, a sortase conjugate binding site, and any combination of two or more thereof.

[0056] In another example, the auxiliary oligonucleotide binding site includes a non-covalent auxiliary oligonucleotide binding site. In yet another example, the non-covalent auxiliary oligonucleotide binding site includes a polynucleotide hybridization site. In yet another example, the non-covalent auxiliary oligonucleotide binding site includes a non-covalent peptide binding site, and the non-covalent peptide binding site is selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

[0057] In another example, the nanoparticle further comprises a single template polynucleotide bound to a single template site. In yet another example, the scaffold further comprises a plurality of auxiliary oligonucleotides bound to a plurality of auxiliary sites.

[0058] In another example, the nanoparticles have a diameter of at least 10 nm, a diameter of at least 20 nm, a diameter of at least 30 nm, a diameter of at least about 40 nm, a diameter of at least about 50 nm, a diameter of at least about 60 nm, a diameter of at least about 70 nm, a diameter of at least about 80 nm, a diameter of at least about 90 nm, a diameter of at least about 100 nm, a diameter of at least about 125 nm, a diameter of at least about 150 nm, a diameter of at least about 175 nm, a diameter of at least about 200 nm, a diameter of at least about 225 nm, a diameter of at least about 250 nm, a diameter of at least about 275 nm, a diameter of at least At least about 300 nm in diameter, at least about 325 nm in diameter, at least about 350 nm in diameter, at least about 375 nm in diameter, at least about 400 nm in diameter, at least about 425 nm in diameter, at least about 450 nm in diameter, at least about 475 nm in diameter, at least about 500 nm in diameter, at least about 550 nm in diameter, at least about 600 nm in diameter, at least about 650 nm in diameter, at least about 700 nm in diameter, at least about 750 nm in diameter, at least about 800 nm in diameter, at least about 850 nm in diameter, at least about 900 nm in diameter, or at least about 950 nm in diameter.

[0059] On the other hand, a method is provided, which includes a single template polynucleotide being bonded to a single template site of nanoparticle. In yet another aspect, a method is provided, which includes a plurality of auxiliary oligonucleotides being bonded to a plurality of auxiliary sites of nanoparticle. In yet another example, the method also includes synthesizing a copy selected from a copy of a template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of one or more supports attached to the copy of the two, wherein the copy attached to the support extends from the auxiliary oligonucleotide. In yet another example, the method also includes attaching the support to a substrate, wherein attaching includes hybridizing the auxiliary oligonucleotide with the oligonucleotide attached to the substrate.

[0060] In one example, the substrate includes a plurality of nanopores, and the oligonucleotides attached to the substrate are attached in the plurality of nanopores. In another example, no more than one support is incorporated in any one of the nanopores. In yet another example, the method further includes synthesizing a copy selected from a copy of a template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of one or more substrates attached to the copy of the two, wherein the copy attached to the substrate extends from the oligonucleotides attached to the substrate. In yet another example, the method further includes sequencing at least one of the copies attached to the support and the copies attached to the substrate, wherein sequencing includes sequencing while synthesizing. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] These and other features, aspects and advantages of the present disclosure will be better understood when the following detailed description is read with reference to the accompanying drawings, in which:

[0062] FIG. 1 illustrates an example of nanoparticles according to aspects of the present disclosure.

[0063] Figure 2 Examples of portions of a scaffold of nanoparticles according to aspects of the present disclosure are shown.

[0064] Figure 3 Examples of single template polynucleotide sites and auxiliary attachment sites for nanoparticles according to aspects of the present disclosure are shown.

[0065] Figure 4 An example of a method of synthesizing nanoparticles according to the present disclosure is shown.

[0066] Figure 5 An example of a nanoparticle having a dendrimer structure having a constituent repeating unit including lysine is shown.

[0067] Figure 6 Exemplary synthesis methods for synthesizing nanoparticles according to aspects of the present disclosure are shown.

[0068] Figure 7 An example of template attachment to nanoparticles according to aspects of the present disclosure is shown.

[0069] Figure 8 Examples of non-covalent attachment of a template polynucleotide to a nanoparticle by hybridization are shown in accordance with aspects of the present disclosure.

[0070] Fig. 9 An example of non-covalent attachment of a template polynucleotide to a nanoparticle via a coiled-coil peptide binding site is shown in accordance with aspects of the present disclosure.

[0071] Fig.10 is a graph showing the number of nanoparticles per nanopore according to the nanopore surface area according to aspects of the present invention.

[0072] Figures 11A-11C An example of seeding a substrate with a template polynucleotide using a scaffold according to aspects of the present disclosure is shown. DETAILED DESCRIPTION

[0073] The references to "one example", "another example", "an example", etc. throughout this specification mean that the specific elements (e.g., features, structures, and / or characteristics) described in conjunction with the example are included in at least one example described herein, and may or may not be present in other examples. In addition, it should be understood that the elements used in any example may be combined in various examples in any suitable manner, unless the context clearly indicates otherwise.

[0074] The present disclosure relates to compositions and methods for increasing monoclonal clustering during SBS. In one example, the size exclusion principle is used to prevent the inoculation of a single template polynucleotide, thus preventing the promotion of clustering too close to each other. By associating each single template polynucleotide with a given nanoparticle of sufficient spatial dimension, the template polynucleotide can be induced to attach to the substrate surface at a distance far enough from each other to reduce the formation of polyclonal clusters and increase the formation of monoclonal clusters. The nanoparticle may include a binding site for the template polynucleotide. The nanoparticle may have only one single site for attaching the template polynucleotide. Therefore, one and only one template polynucleotide may be able to attach to the nanoparticle so that the template polynucleotide is attached to the support to prevent the second template polynucleotide from attaching to the same nanoparticle, and the attached template polynucleotide has occupied its single template polynucleotide binding site. Each nanoparticle only attaches a single template polynucleotide, and directly or indirectly due to the size of the attached nanoparticle, the spatial distribution of the template polynucleotides attached to this type of particles reduces the formation of polyclonal clusters.

[0075] In addition to template polynucleotide (referred to as auxiliary binding site in this article), nanoparticle may also include other types of one or more binding sites for nanoparticle to be attached to compositions or surfaces.For example, in addition to single template polynucleotide binding site, nanoparticle may also include auxiliary binding site that allows nanoparticle to be attached to substrate surface for SBS process.In another example, nanoparticle may have one or more auxiliary binding sites for one or more surface polymers to be attached to nanoparticle.In another example, nanoparticle may include one or more auxiliary binding sites for auxiliary oligonucleotide to be attached to nanoparticle, wherein as a part of clustering process, oligonucleotide may be combined with the end of template polynucleotide or its copy, as described more fully below.In another example, such auxiliary oligonucleotide may be hybridized with oligonucleotide attached to substrate surface for SBS process, so that nanoparticle with single template polynucleotide attached thereto may be attached to such substrate surface.

[0076] In view of the fact that scaffold can include a single binding site for template polynucleotide and one or more auxiliary sites for attaching, for example, auxiliary oligonucleotide, a single template polynucleotide binding site can have a different chemistry or structure from the auxiliary binding site. In all binding sites, a single template polynucleotide binding site can be a unique template polynucleotide binding site with following chemistry and structure: designed to be attached to the template polynucleotide with the corresponding chemistry or structure for being attached thereto. In contrast, one or more auxiliary binding sites can have different chemistry or structures, which are incompatible with being combined with or being attached to the template polynucleotide. On the contrary, one or more auxiliary binding sites can have other compositions or structures (such as auxiliary oligonucleotide, polymer, etc.) that are intended to be combined with or attached to the auxiliary binding site and are compatible with being combined with or being attached to the template polynucleotide and are incompatible with being combined with or being attached to the template polynucleotide. Therefore, the template polynucleotide will be unable to be combined with or be attached to one or more auxiliary binding sites, thereby causing each nanoparticle at the single template polynucleotide binding site of nanoparticle to only attach one template polynucleotide.

[0077] Template polynucleotide can be the polynucleotide obtained from sample, such as the polydeoxyribonucleic acid separated from sample or the cDNA molecule replicated by the mRNA molecule obtained from sample.For example, SBS process can be performed to determine the nucleotide sequence of template polynucleotide, or compared with reference sequence, one or more polymorphisms or changes in the genetic sequence of identification template polynucleotide.Library can be prepared by one or more samples, and this library comprises multiple template polynucleotides obtained from one or more samples.Template polynucleotide can be obtained by obtaining the polynucleotide sequence of the part of the sequence being present in sample or being replicated by sample.By sequencing multiple template polynucleotide in SBS process, sequence, genotype or other sequence related information about template polynucleotide can be determined, and when collecting and analyzing the sequence information about multiple template polynucleotides in library, sequence, genotype or other sequence related information about obtaining the sample in library can be determined.

[0078] Template polynucleotide can be processed as a part of the process of obtaining template polynucleotide from sample. The processing part can include adding polynucleotide sequence to the 5-end, 3-end or both ends of the template to help carry out subsequence SBS processing. As further disclosed herein, template polynucleotide can be further modified by adding features that promote or allow to form a bond with the site on the nanoparticle.

[0079] The template polynucleotide can have any given length suitable for obtaining sequencing information in an SBS process. For example, the template polynucleotide can be about 50 nucleotides in length, about 75 nucleotides in length, about 100 nucleotides in length, about 125 nucleotides in length, about 150 nucleotides in length, about 175 nucleotides in length, about 200 nucleotides in length, about 225 nucleotides in length, about 250 nucleotides in length, about 275 nucleotides in length, about 300 nucleotides in length, about 325 nucleotides in length, about 350 nucleotides in length, about 375 nucleotides in length, about 400 nucleotides in length, about 450 nucleotides in length, about 460 nucleotides in length, about 480 nucleotides in length, about 490 nucleotides in length, about 500 nucleotides in length, about 510 nucleotides in length, about 520 nucleotides in length, about 530 nucleotides in length, about 540 nucleotides in length, about 550 nucleotides in length, about 560 nucleotides in length, about 575 nucleotides in length, about 580 nucleotides in length, about 590 nucleotides in length, about 600 nucleotides in length, about 610 nucleotides in length, about 620 nucleotides in length, about 630 nucleotides in length, about 640 nucleotides in length, about 650 nucleotides in length, about 660 nucleotides in length, about 675 nucleotides in length, about 680 nucleotides in length, about 690 nucleotides in length, about 710 nucleotides in length, about 720 nucleotides in length, about 730 nucleotides in length, about 740 nucleotides in length, about 750 nucleotides in length, A length of about 425 nucleotides, a length of about 450 nucleotides, a length of about 475 nucleotides, a length of about 500 nucleotides, a length of about 525 nucleotides, a length of about 550 nucleotides, a length of about 575 nucleotides, a length of about 600 nucleotides, a length of about 625 nucleotides, a length of about 650 nucleotides, a length of about 675 nucleotides, a length of about 700 nucleotides, a length of about 725 nucleotides, a length of about 750 nucleotides, a length of about 775 nucleotides, a length of about 800 nucleotides, about 825 nucleotides in length, about 850 nucleotides in length, about 875 nucleotides in length, about 900 nucleotides in length, about 925 nucleotides in length, about 950 nucleotides in length, about 975 nucleotides in length, about 1,000 nucleotides in length, about 1,025 nucleotides in length, about 1,050 nucleotides in length, about 1,075 nucleotides in length, about 1,100 nucleotides in length, about 1,125 nucleotides in length, about 1,150 nucleotides in length, about 1,175 nucleotides in length 5 nucleotides in length, about 1,200 nucleotides in length, about 1,225 nucleotides in length, about 1,250 nucleotides in length, about 1,275 nucleotides in length, about 1,300 nucleotides in length, about 1,325 nucleotides in length, about 1,350 nucleotides in length, about 1,375 nucleotides in length, about 1,400 nucleotides in length, about 1,425 nucleotides in length, about 1,450 nucleotides in length, about 1,475 nucleotides in length, about 1,500 nucleotides in length, or longer.

[0080] In some examples, there may be two or more different auxiliary binding site populations on the nanoparticle, some having one type of chemistry or structure compatible with binding or attachment to one composition or structure population, while others having a second type of chemistry or structure compatible with binding or attachment to another composition or structure population. For example, one auxiliary site population may have a chemistry or structure compatible with binding to auxiliary oligonucleotides (these auxiliary oligonucleotides may bind to copies of template polynucleotides that participate in, for example, clustering of template polynucleotides on nanoparticles, as described more fully below), while other auxiliary sites may have different chemistry or structures compatible with binding or attachment to the surface of a substrate to perform SBS.

[0081] Nanoparticles can include a support. The support is a structural component of the nanoparticle that occupies a volume according to the minimum distance amount desired between template nanoparticles or the maximum density of template nanoparticles attached to the nanoparticles (as may be desired for a given application). The support can include the aforementioned binding site, such as a single template polynucleotide binding site and one or more auxiliary binding sites. The support can constitute the nanoparticle together with the binding site. The support can be synthesized to include and it can include more than one type of chemistry or structure for attachment once synthesized. That is, the support can be synthesized to include or be modified to include a single site attached to the template polynucleotide, plus one or more additional binding sites with a chemistry or structure different from the single template polynucleotide binding site corresponding to the auxiliary binding site.

[0082] The support may include an asymmetric polymer, wherein several polymer chains extend from a support core, which also includes different binding sites for a template polynucleotide. A polymer chain, straight or branched, may extend from a support core, which has an auxiliary binding site on the polymer, and another binding site with an orthogonal binding chemistry relative to the auxiliary binding site is present on the support core for binding to a single template polynucleotide. In one example, the support may include a core, from which a heteropolymer or homopolymer containing an acrylamide monomer extends, which includes an auxiliary binding site and another binding site with different binding chemistry for binding to a template polynucleotide. In one example, the support core may include attachment points for two or three straight or branched polymers.

[0083] In one example, the scaffold may include two or three separate linear or branched polymers that are like the scaffold core. A non-limiting example of a scaffold is a compound of Formula I:

[0084]

[0085] Each X is a compound of formula II:

[0086]

[0087] Where R 2 Selected from Formula IIIa:

[0088] Where R 5 Selected from x is an integer in the range of 1-2,000, and y is an integer in the range of 1-10,000, and the ratio of x:y may be about 10:90 to about 1:99, and wherein each R z are independently H or C 1-4 Alkyl; and formula IIIb:

[0089] Where R 5 Selected from y is an integer in the range of 1-2,000, and x and z are integers whose sum is in the range of 1-10,000, and the ratio of (x:y):z may be about (85):15 to about (95):5, and wherein each R z are independently H or C 1-4 Alkyl, R 1 comprising a single template site for binding the template polynucleotide to the scaffold, R 4 Selected from optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Alkenyl, optionally substituted C 1 -C 20 Alkynyl, optionally substituted C 1 -C 20 Oxaalkyl, optionally substituted C 1 -C 20 Thioalkyl and optionally substituted C 1 -C 20 Azaalkyl, wherein the substitution includes C 1 -C 20 alkyl, double bond oxygen and hydroxyl groups, and R 3 includes an auxiliary site for binding to an auxiliary oligonucleotide. In any of the foregoing examples, the trithiocarbonate group Optionally, a direct bond, -CH 2- key, -S-key, -N-key or -O-key replacement.

[0090] In another example, where R 2 Is a compound of formula IIIa: y may be 0, and x may be an integer from 1 to 2,000.

[0091] In one example, R 1 Including amine-NHS ester binding site, amine-imidate binding site, amine-pentafluorophenyl ester binding site, amine-hydroxymethylphosphine binding site, carboxyl-carbodiimide binding site, thiol-maleimide binding site, thiol-haloacetyl binding site, thiol-pyridyl disulfide binding site, thiol-thiosulfonate binding site, thiol-vinyl sulfone binding site, aldehyde-hydrazide binding site, aldehyde-alkoxyamine binding site, aldehyde-NHS ester binding site, hydroxyl-isocyanate binding site, azide-alkyne binding site, azide-phosphine binding site, trans-cyclooctene-tetrazine binding site, norbornene-tetrazine binding site, azide-cyclooctyne binding site, azide-norbornene binding site, oxime binding site, SpyTag-SpyCatcher binding site, Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 - a benzylcytosine binding site or a sortase-coupled binding site. In a specific non-limiting example, R 1 These include amine groups, tetrazine groups or dibenzocyclooctene groups.

[0092] In one example, each R 3 The binding sites may include amine-NHS ester binding sites, amine-imidate binding sites, amine-pentafluorophenyl ester binding sites, amine-hydroxymethylphosphine binding sites, carboxyl-carbodiimide binding sites, thiol-maleimide binding sites, thiol-haloacetyl binding sites, thiol-pyridyl disulfide binding sites, thiol-thiosulfonate binding sites, thiol-vinyl sulfone binding sites, aldehyde-hydrazide binding sites, aldehyde-alkoxyamine binding sites, aldehyde-NHS ester binding sites, hydroxyl-isocyanate binding sites, azide-alkyne binding sites, azide-phosphine binding sites, trans-cyclooctene-tetrazine binding sites, norbornene-tetrazine binding sites, azide-cyclooctyne binding sites, azide-norbornene binding sites, oxime binding sites, SpyTag-SpyCatcher binding sites, Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 - a benzylcytosine binding site or a sortase conjugate binding site. In a specific non-limiting example, each R3 comprises an azide group.

[0093] In a specific non-limiting example, the bracket includes the following structure (for simplicity of description, only one X is fully drawn, and the structures of the other two Xs are the same as the structure of the fully drawn X):

[0094]

[0095] In another example, X may include

[0096] In another example, X may include In another example, X may include

[0097] In another example, R 1 binds to the template polynucleotide, and one or more R 3 Binding to an auxiliary, such as an auxiliary oligonucleotide. In another example, the auxiliary oligonucleotide is attached to a nucleotide sequence that is a copy of or complementary to the template polynucleotide.

[0098] Another non-limiting example of a scaffold is a compound of formula IV

[0099]

[0100] Each X is a compound of formula V:

[0101]

[0102] Where R 2 Selected from Formula VIa:

[0103] And Formula VIb: wherein p is an integer selected from 1 to 20, and R 5 Includes an auxiliary site for binding an auxiliary oligonucleotide, R 3 Select from direct key, m is an integer from 1 to 2,000, and n is an integer from 1 to 10,000, R 1 comprising a single template site for binding the template polynucleotide to the scaffold, R 4 Selected from optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Alkenyl, optionally substituted C 1 -C 20 Alkynyl, optionally substituted C 1 -C 20 Oxaalkyl, optionally substituted C 1 -C 20 Thioalkyl and optionally substituted C 1 -C 20 Azaalkyl, wherein the substitution includes C 1 -C 20 alkyl, double bond oxygen and hydroxyl groups, and R3 includes an auxiliary site for binding to an auxiliary oligonucleotide. In any of the foregoing examples, the trithiocarbonate group Optionally, a direct bond, -CH 2 -key, -S-key, -N-key or -O-key replacement.

[0104] In one example, R 1 Including amine-NHS ester binding site, amine-imidate binding site, amine-pentafluorophenyl ester binding site, amine-hydroxymethylphosphine binding site, carboxyl-carbodiimide binding site, thiol-maleimide binding site, thiol-haloacetyl binding site, thiol-pyridyl disulfide binding site, thiol-thiosulfonate binding site, thiol-vinyl sulfone binding site, aldehyde-hydrazide binding site, aldehyde-alkoxyamine binding site, aldehyde-NHS ester binding site, hydroxyl-isocyanate binding site, azide-alkyne binding site, azide-phosphine binding site, trans-cyclooctene-tetrazine binding site, norbornene-tetrazine binding site, azide-cyclooctyne binding site, azide-norbornene binding site, oxime binding site, SpyTag-SpyCatcher binding site, Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 -benzylcytosine binding site or sortase conjugate binding site. In another example, R 1 In one specific non-limiting example, R 1 These include amine groups, tetrazine groups or dibenzocyclooctene groups.

[0105] In one example, each R 5 The binding sites may include amine-NHS ester binding sites, amine-imidate binding sites, amine-pentafluorophenyl ester binding sites, amine-hydroxymethylphosphine binding sites, carboxyl-carbodiimide binding sites, thiol-maleimide binding sites, thiol-haloacetyl binding sites, thiol-pyridyl disulfide binding sites, thiol-thiosulfonate binding sites, thiol-vinyl sulfone binding sites, aldehyde-hydrazide binding sites, aldehyde-alkoxyamine binding sites, aldehyde-NHS ester binding sites, hydroxyl-isocyanate binding sites, azide-alkyne binding sites, azide-phosphine binding sites, trans-cyclooctene-tetrazine binding sites, norbornene-tetrazine binding sites, azide-cyclooctyne binding sites, azide-norbornene binding sites, oxime binding sites, SpyTag-SpyCatcher binding sites, Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2-benzylcytosine binding site or sortase conjugate binding site. In another example, each R 5 In one specific non-limiting example, each R 5 Includes an azide group.

[0106] In a specific non-limiting example, the bracket includes the following structure (for simplicity of description, only one X is fully drawn, and the structures of the other two Xs are the same as the structure of the fully drawn X):

[0107]

[0108] In a specific non-limiting example, the bracket includes the following structure (for simplicity of description, only one X is fully drawn, and the structures of the other two Xs are the same as the structure of the fully drawn X):

[0109]

[0110] Where R 6 Selected from

[0111] In another specific non-limiting example, the bracket includes the following structure (for simplicity of description, only one X is fully drawn, and the structures of the other two Xs are the same as the structure of the fully drawn X):

[0112]

[0113] In another specific non-limiting example, the bracket includes the following structure (for simplicity of description, only one X is fully drawn, and the structures of the other two Xs are the same as the structure of the fully drawn X):

[0114]

[0115] In another example, R 1 binds to the template polynucleotide, and one or more R 5 Binding to an auxiliary, such as an auxiliary oligonucleotide. In another example, the auxiliary oligonucleotide is attached to a nucleotide sequence that is a copy of or complementary to the template polynucleotide.

[0116] In another example, the scaffold core may be or may be derived from a precursor triazine molecule. A non-limiting example of a scaffold is a compound of formula IV:

[0117]

[0118] Each X is a compound of formula VIII:

[0119]

[0120] Where y is an integer from 1 to 20, R 2 Selected from Formula IXa:

[0121] And Formula IXb: wherein p is an integer selected from 1 to 20, and R 5 Includes an auxiliary site for binding an auxiliary oligonucleotide, R 3 Select from direct key, m is an integer from 1 to 2,000, and n is an integer from 1 to 10,000, R 1 comprising a single template site for binding the template polynucleotide to the scaffold, R 4 Selected from optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Alkenyl, optionally substituted C 1 -C 20 Alkynyl, optionally substituted C 1 -C 20 Oxaalkyl, optionally substituted C 1 -C 20 Thioalkyl and optionally substituted C 1 -C 20 Azaalkyl, wherein the substitution includes C 1 -C 20 alkyl, double bond oxygen and hydroxyl groups, and R 3 includes an auxiliary site for binding to an auxiliary oligonucleotide. In any of the foregoing examples, the trithiocarbonate group Optionally, a direct bond, -CH 2 -key, -S-key, -N-key or -O-key replacement.

[0122] In one example, R 1Including amine-NHS ester binding site, amine-imidate binding site, amine-pentafluorophenyl ester binding site, amine-hydroxymethylphosphine binding site, carboxyl-carbodiimide binding site, thiol-maleimide binding site, thiol-haloacetyl binding site, thiol-pyridyl disulfide binding site, thiol-thiosulfonate binding site, thiol-vinyl sulfone binding site, aldehyde-hydrazide binding site, aldehyde-alkoxyamine binding site, aldehyde-NHS ester binding site, hydroxyl-isocyanate binding site, azide-alkyne binding site, azide-phosphine binding site, trans-cyclooctene-tetrazine binding site, norbornene-tetrazine binding site, azide-cyclooctyne binding site, azide-norbornene binding site, oxime binding site, SpyTag-SpyCatcher binding site, Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 -benzylcytosine binding site or sortase conjugate binding site. In another example, R 1 In one specific non-limiting example, R 1 These include amine groups, tetrazine groups or dibenzocyclooctene groups.

[0123] In one example, each R 5 The binding sites may include amine-NHS ester binding sites, amine-imidate binding sites, amine-pentafluorophenyl ester binding sites, amine-hydroxymethylphosphine binding sites, carboxyl-carbodiimide binding sites, thiol-maleimide binding sites, thiol-haloacetyl binding sites, thiol-pyridyl disulfide binding sites, thiol-thiosulfonate binding sites, thiol-vinyl sulfone binding sites, aldehyde-hydrazide binding sites, aldehyde-alkoxyamine binding sites, aldehyde-NHS ester binding sites, hydroxyl-isocyanate binding sites, azide-alkyne binding sites, azide-phosphine binding sites, trans-cyclooctene-tetrazine binding sites, norbornene-tetrazine binding sites, azide-cyclooctyne binding sites, azide-norbornene binding sites, oxime binding sites, SpyTag-SpyCatcher binding sites, Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 -benzylcytosine binding site or sortase conjugate binding site. In another example, each R 5 In one specific non-limiting example, each R 5 Includes an azide group.

[0124] In a specific non-limiting example, the bracket includes the following structure (for simplicity of description, only one X is fully drawn, and the structures of the other two Xs are the same as the structure of the fully drawn X):

[0125]

[0126] In another specific non-limiting example, the bracket includes the following structure (for simplicity of description, only one X is fully drawn, and the structures of the other two Xs are the same as the structure of the fully drawn X):

[0127]

[0128] Where R 6 Selected from

[0129] In another specific non-limiting example, the bracket includes the following structure (for simplicity of description, only one X is fully drawn, and the structures of the other two Xs are the same as the structure of the fully drawn X):

[0130]

[0131] In another specific non-limiting example, the bracket includes the following structure (for simplicity of description, only one X is fully drawn, and the structures of the other two Xs are the same as the structure of the fully drawn X):

[0132]

[0133] In another example, R 1 Binds to the template polynucleotide, and one or more R5s bind to an auxiliary, such as an auxiliary oligonucleotide. In another example, the auxiliary oligonucleotide is attached to a nucleotide sequence that is a copy of the template polynucleotide or complementary to the template polynucleotide.

[0134] The chains can be grown from the scaffold core using a controlled radical polymerization (CRP) method. The polymer can be grown from the scaffold core by a reversible addition fragmentation chain transfer (RAFT) polymerization method, an ATRP (atom transfer radical polymerization) method, or an NMP (nitroxide mediated radical polymerization) method. In another example, the polymer can be synthesized and then attached to the scaffold core. The CRP method may include strict control of the degree of polymerization (DP) of the polymer attached to the scaffold core, thereby controlling the molecular weight of the polymer and the nanoparticle size. For example, about 100 / chain, about 150 / chain, about 200 / chain, about 250 / chain, about 300 / chain, about 350 / chain, about 400 / chain, about 450 / chain, about 500 / chain, about 550 / chain, about 600 / chain, about 650 / chain, about 700 / chain, about 750 / chain, about 800 / chain, about 850 / chain, about 900 / chain, about 950 / chain, about 1,000 / chain, about 1,050 / chain, about 1,100 / chain, about 1, In some examples, after growing a first such polymer from the scaffold core, a second such polymer can be further extended from the first polymer by a RAFT process (as a "living" RAFT polymerization process).

[0135] In another example, the scaffold may include a dendron, wherein the constituent repeating units include lysine amino acids, and wherein lysine is a branch point, and polymerization occurs by forming a peptide bond between the carboxylic acid of the amino acid of the α-amino group of the immediately upstream generation of lysine and an isopeptide bond between the ε-amino termini of the immediately upstream generation of lysine. Lysine thus acts as a branch point in the dendritic macromolecule structure. In one example, the core unit of the dendritic macromolecule may include lysine. For example, the carboxylic acid of the core unit lysine may be attached to a single template polynucleotide binding site, while the α- and ε-amino groups may branch and attach to downstream amino acids. For example, cysteine ​​may be attached to the core lysine, thereby providing a single thiol template polynucleotide binding site. In other examples, other amino acids, modified amino acids, or other structures may extend from the core lysine to provide a single template polynucleotide binding site. The end group of the most downstream branched dendron may include an auxiliary binding site. For example, an auxiliary binding site may include lysyl α- and ε-amino groups of the final generation of dendrons. As used herein, the terms downstream and upstream refer to the direction along the branched chain relative to the core unit of the dendron, upstream refers to the direction of the core unit and downstream refers to the direction of the branched end unit. The dendron may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more generations.

[0136] In one example, an upstream lysine is attached to two downstream lysines via its α- and ε-amino groups. Each such downstream lysine can likewise be attached to two further lysines via peptide and isopeptide bonds formed with its α- and ε-amino groups, thereby generating a dendron of constituent repeating units of lysine, each lysine being attached to an upstream lysine via its upstream carboxylic acid and to two downstream lysines via its amino group.

[0137] In another example, the scaffold may include a first polypeptide sequence that includes one or more lysine residues in the polypeptide. One or more such lysines may form an isopeptide bond with the next polypeptide via its epsilon amino group, and a peptide bond with an adjacent amino acid in the polypeptide via its α-amino group. Such a next polypeptide may also be or include one or more lysines, and one or more such lysines of the next polypeptide may form an isopeptide bond with an additional polypeptide via its epsilon amino group, and a peptide bond with an adjacent amino acid in the next polypeptide via its α-amino group. Such additional polypeptides may also include one or more lysines that form one or more isopeptide bonds with one or more additional polypeptides, and so on. A continuous polynucleotide with a continuous lysine branch point may also be included. In this example, the scaffold includes polypeptides that are attached to each other in branch formation and connected at lysine residues. The first polypeptide sequence may include or be attached to a single template polynucleotide binding site, and the last polypeptide (e.g., the next, additional, additional, or subsequent polypeptide that does not include a lysine that forms an isopeptide bond with a continuous polypeptide) may include an auxiliary binding site for the last polypeptide (such as the terminal amino group of the N-terminal amino acid, the epsilon amino acid of the lysine of the last polypeptide, or both).

[0138] The template polynucleotide for attachment to the scaffold can be of any suitable length, including for sequencing during the SBS process. For example, the template polynucleotide can be about 50 nucleotides in length, about 75 nucleotides in length, about 100 nucleotides in length, about 125 nucleotides in length, about 150 nucleotides in length, about 175 nucleotides in length, about 200 nucleotides in length, about 225 nucleotides in length, about 250 nucleotides in length, about 275 nucleotides in length, about 300 nucleotides in length, about 325 nucleotides in length, about 350 nucleotides in length, about 375 nucleotides in length, about 400 nucleotides in length, about 425 nucleotides in length, about 450 nucleotides in length, about 475 nucleotides in length, about 500 nucleotides in length, about 525 nucleotides in length, about 550 nucleotides in length, about 575 nucleotides in length, about 600 nucleotides in length, about 625 nucleotides in length, about 650 nucleotides in length, or about 665 nucleotides in length. Length is about 675 nucleotides, length is about 700 nucleotides, length is about 725 nucleotides, length is about 750 nucleotides, length is about 775 nucleotides, length is about 800 nucleotides, length is about 825 nucleotides, length is about 850 nucleotides, length is about 875 nucleotides, length is about 900 nucleotides, length is about 925 nucleotides, length is about 950 nucleotides, length is about 975 nucleotides, length is about 1,000 nucleotides, length is about 1,100 nucleotides, length is about 1,200 nucleotides, length is about 1,300 nucleotides, length is about 1,40 nucleotides, length is about 1,500 nucleotides, length is about 1,600 nucleotides, length is about 1,700 nucleotides, length is about 1,800 nucleotides, length is about 1,900 nucleotides, length is about 2,000 nucleotides or longer.

[0139] The attachment of a single template polynucleotide or auxiliary (e.g., auxiliary oligonucleotide, auxiliary composition or auxiliary structure) to a support can be achieved by including a part or structure complementary to each other on the support and the template polynucleotide or the auxiliary, which means that they are configured to covalently or non-covalently bind to each other to form an attachment therebetween. They can be complementary for covalent binding or complementary for non-covalent binding. The support may include a single template site complementary to the part or structure (single template site) attached to the template polynucleotide. The support may also include or be attached to other parts or structures complementary to the part or structure (auxiliary site) attached to the auxiliary. Cross-reactivity between the part or structure attached to the template polynucleotide and the part or structure of the auxiliary site should be avoided to prevent more than one template polynucleotide from being attached to the support. Cross-reactivity between the part or structure connected to the auxiliary and the part or structure of the single template site should also be avoided to prevent the auxiliary connected to the single template polynucleotide from occupying the single template site. In some examples, such cross-reactivity can be avoided by chemically blocking single template sites or auxiliary sites when an auxiliary binds to the auxiliary site or a single template polynucleotide attaches to the single template site, respectively, and then unblocking unoccupied sites to allow attachment of a single template polynucleotide or an auxiliary thereto.

[0140] A non-exclusive list of complementary binding partners is presented in Table 1:

[0141]

[0142]

[0143]

[0144]

[0145]

[0146] Any of the foregoing may be added to or included in a scaffold as disclosed herein for attachment to a template polynucleotide or an auxiliary (such as an auxiliary oligonucleotide), which may include or be modified to include complementary portions or structures of the foregoing pairs for binding to the scaffold.

[0147] Any suitable bioconjugation method for adding or forming a bond between such complementary parts or structural pairs can be used. Modified nucleotides are commercially available, having one or other examples of such complementary parts or structural pairs, and methods for including one or more of such parts or structural examples or attaching or including them to polymers, nucleotides or polynucleotides are also known. Also commercially available are bifunctional linker molecules, which have a portion or structure from a pair of complementary binding partners listed in Table 1 and a portion or structure from another pair of complementary binding partners listed in Table 1. A portion or structure of a scaffold, template polynucleotide or auxiliary or oligonucleotide or polypeptide (attached to any of the aforementioned features so as to provide a portion or structure for combining between any of such aforementioned features) can be combined with one end of such a linker, thereby causing the initial portion or structure to be effectively replaced by another portion or structure (i.e., the portion or structure present at the other end of the linker).

[0148] Modified amino acids are commercially available that have one or other of the examples of such complementary moieties or structural pairs, and methods for including one or more of such moieties or structural examples or attaching them to amino acids or polypeptides are also known. Methods for forming bonds between members of such complementary moieties or structural pairs are known. Thus, such complementary moieties or structures can be added to or included in the scaffold and template polynucleotide or the scaffold and auxiliary to form a binding site and allow attachment therebetween.

[0149] As used herein, the term "polypeptide" is intended to mean a chain of amino acids bound together by peptide bonds. The terms "protein" and "polypeptide" are used interchangeably. A polypeptide may include a sequence of multiple amino acids bound to each other by peptide bonds, and the number of amino acids may be about 2 or more, about 5 or more, about 10 or more, about 15 or more, about 20 or more, about 25 or more, about 30 or more, about 35 or more, about 40 or more, about 45 or more, about 50 or more, about 55 or more, about 60 or more, about 65 or more, about 70 or more, about 75 or more, about 80 or more, about 85 or more, about 90 or more, about 95 or more, about 100 or more, about 110 or more, about 120 or more, about 130 or more, about 140 or more, about 150 or more , about 160 or more, about 170 or more, about 180 or more, about 190 or more, about 200 or more, about 225 or more, about 250 or more, about 275 or more, about 300 or more, about 325 or more, about 350 or more, about 375 or more, about 400 or more, about 425 or more, about 450 or more, about 475 or more, about 500 or more, about 550 or more, about 600 or more, about 650 or more, about 700 or more, about 750 or more, about 800 or more, about 850 or more, about 900 or more, about 950 or more, about 1000 or more.

[0150] In some cases, a polypeptide or protein may adopt a structure or three-dimensional conformation to facilitate or permit binding to another binding partner, such as another polypeptide that also adopts a three-dimensional structure that facilitates such binding, or other non-protein binding partners. A polypeptide may also adopt a three-dimensional conformation that facilitates the performance of an enzymatic reaction on other substrate polypeptides or other molecules, or serves as a substrate for another enzymatic reaction or other reaction. A polypeptide may also adopt a three-dimensional conformation that makes one or more sites, such as the amino terminus, the carboxyl terminus, side groups of amino acids, or modifications to amino acids, accessible for binding to another molecule.

[0151] Various bioconjugation chemistries can be used to attach the template polynucleotide to the scaffold. A chemical moiety can be included in or added to such a site that has the ability to form a covalent conjugate with a complementary chemical moiety that can be attached to or included in the template polynucleotide. The template polynucleotide can then be conjugated to the scaffold, such as by covalent attachment between complementary chemical moieties.

[0152] In another example, the scaffold may include or be attached to a polypeptide sequence as a single template site that is capable of forming a covalent attachment to another polypeptide sequence or other chemical moiety. Such other polypeptide or other chemical moiety may then be included in or attached to the template polynucleotide so that the scaffold and the single template site of the template polynucleotide can covalently bind to each other. Alternatively, the template polynucleotide may have a first such polypeptide sequence, and the single template site of the scaffold may have such other polypeptide sequence or other chemical moiety that is capable of covalently binding to the polypeptide sequence of the template polynucleotide. Non-limiting examples of such pairs include the SpyTag / SpyCatcher system, the Snap-Tag / O 6 -Benzylguanine system and CLIP-labeling / O 2 -Benzylcytosine system.

[0153] Amino acid sequences of complementary SpyTag / SpyCatcher system pairs and polynucleotides encoding them are available. Examples of these sequences are provided in Table 1. Several amino acid position mutations of SpyTag sequences and SpyCatcher sequences are available for inclusion in recombinant polypeptides. The Snap tag is a functional O-6-methylguanine-DNA methyltransferase, and the CLIP tag is a modified version of the Snap tag. Nucleotide sequences encoding Snap tags, CLIP tags, and SpyCatchers are commercially available for subcloning and inclusion in engineered polypeptide sequences.

[0154] Alternatively, complementary pairs for covalent attachment on a single template site of a scaffold and a template polynucleotide may be covalently attached to each other via enzymatic formation of a covalent bond. For example, a single template site of a scaffold and a template polynucleotide may include motifs that can be covalently attached to each other via sortase-mediated coupling, such as an LPXTG amino acid sequence on one and an oligoglycine nucleophilic sequence (having, for example, 3 to 5 glycine repeats) on the other. Sorting enzyme-mediated transpeptidation may then be performed to covalently attach the scaffold and template polynucleotide at a single template site.

[0155] In another example, the scaffold may include a region for non-covalent attachment of a single template polynucleotide at a single template site. For example, the scaffold may include an oligonucleotide for hybridizing to the end of the template polynucleotide by Watson-Crick base pairing. In another example, the scaffold and the template polynucleotide may include or be attached to a complementary peptide binding site. For example, the scaffold and the template polynucleotide may include or be attached to a peptide sequence that can bind to each other as a complementary coiled coil motif pair. The coiled coil motif is a structural feature of some polypeptides, in which two or more polypeptide chains each form an alpha-helical secondary structure, and the alpha-helices are coiled together to form a tight non-covalent bond. The coiled coil sequence may include a heptad repeat, i.e., a repeating pattern of seven amino acids HPPHCPC (where H represents a hydrophobic amino acid, C generally represents a charged amino acid, and P represents a polar hydrophilic amino acid). An example of a heptad repeat is found in a leucine zipper coiled coil, in which the fourth amino acid of the heptad is generally leucine.

[0156] The scaffold may include or be attached to one amino acid sequence that forms part of a coiled-coil binding pair, and the template polynucleotide may be attached to another amino acid sequence that forms another part of the coiled-coil binding pair, the other part being complementary to the part that is or is attached to the scaffold, such that the two parts are attached to each other. For example, the scaffold may be covalently attached to one amino acid sequence that forms part of a coiled-coil binding pair, and the template polynucleotide may be attached to another amino acid sequence that forms another part of the coiled-coil binding pair, the other part being complementary to the part that is or is attached to the scaffold, such that the two parts are attached to each other.

[0157] In another example, the scaffold and template polynucleotide may each include or be attached to other complementary partners of the peptide pairs that are non-covalently bound together. Examples include biotin-avidin binding pairs. Biotin and avidin peptides (such as avidin, streptavidin and neutravidin, all of which are collectively referred to as "avidin" unless otherwise specifically stated) form strong non-covalent bonds with each other. One component of such a pair (whether a binding portion of biotin or avidin) can be part of or attached to a scaffold or template polynucleotide, wherein the complementary component is correspondingly part of or attached to a scaffold or template polynucleotide, thereby allowing non-covalent attachment between them.

[0158] Many methods can be used to include or add one or more biotin moieties to DNA molecules, template polynucleotides, scaffolds, oligonucleotide-DNA, other polypeptides, or other compositions disclosed herein for binding molecules together (such as binding template polynucleotides to scaffolds or binding auxiliary substances to scaffolds). For example, biotinylated nucleotides are commercially available for incorporation into DNA molecules by polymerases, and kits are commercially available for adding biotin moieties to polynucleotides or polypeptides. Biotin residues can also be added to amino acids or modified amino acids or nucleotides or modified nucleotides. The ligation chemistry shown in Table 1 can also be used to add biotin groups to proteins such as carboxylic acid groups, amine groups, or thiol groups. Several biotin ligases can also be used for enzymatic targeted biotinylation, such as enzymatic targeted biotinylation of polypeptides (e.g., lysine residues of the AviTag amino acid sequence GLNDIFEAQKIEWHE (SEQ ID NO: 3) included in the polypeptide). Genetically engineered ascorbate peroxidase (APEX) can also be used to modify biotin to allow biotinylation of electron-rich amino acids such as tyrosine and possibly tryptophan, cysteine, or histidine.

[0159] In another example, a polypeptide comprising the amino acid sequence DSLEFIASKLA (SEQ ID NO: 4) can be biotinylated (more N-terminal to the two S residues present in the sequence), which is a substrate for covalent attachment thereto of small molecules conjugated to coenzyme A (CoA) catalyzed by Sfp phosphopantetheinyl transferase. For example, a polypeptide comprising this sequence can be biotinylated by covalently attaching thereto using a CoA-biotin conjugate. The system can also be used to attach many other types of binding moieties or structures identified in Table 1 for forming binding sites for binding the scaffold to a DNA molecule or polypeptide or other molecule as disclosed herein. For example, CoA conjugated to any of the reactive moieties identified in Table 1 can be covalently attached to a polypeptide comprising the above sequence by S phosphopantetheinyl transferase, thereby allowing another composition comprising a complementary binding partner to bind thereto.

[0160] Other enzymes can be used to add binding moieties to polypeptides. For example, a lipoic acid ligase can add a lipoic acid molecule or a modified lipoic acid molecule comprising a binding moiety identified in Table 1 (such as an alkyne or azide group) can be covalently linked to the amine of the side group of a lysine residue in the amino acid sequence DEVLVEIETDKAVLEVPGGEEE (SEQ ID NO: 5) or GFEIDKVWYDLDA (SEQ ID NO: 6) included in the polypeptide. In another example, a scaffold, template polynucleotide or other polypeptide or DNA molecule included therein or intended to be bound thereto can include or be attached to an active serine hydrolase. A fluorophosphonate molecule is covalently linked to a serine residue in the active site of a serine hydrolase. Commercially available analogs of fluorophosphonate molecules comprising a binding moiety identified in Table 1 (such as an azide group or a desthiobiotin group) are analogs of biotin that can be bound to avidin. Thus, such groups can be covalently attached to serine hydrolases included in or attached to a polypeptide or DNA molecule used in or attached to a scaffold as disclosed herein, and such binding moieties or structures can be covalently added thereto by attaching a suitably modified fluorophosphonate molecule to create a binding site on such protein for a complementary binding partner from Table 1 (such as an azide-alkyne, azide-phosphine, azide-cyclooctyne, azide-norbornene or desthiobiotin-avidin binding).

[0161] Any of the foregoing methods of biotinylating a composition (to facilitate binding to a polypeptide comprising an avidin sequence, such as an avidin polypeptide included in or attached to another composition, or otherwise adding functional groups to a polypeptide as part of a scaffold, attached to a scaffold, as part of an auxiliary, or attached to an auxiliary or template polynucleotide for binding between a scaffold and a template polynucleotide or between a scaffold and an auxiliary) can be used to allow or facilitate binding between such components as disclosed herein.

[0162] In order to be attached to the single template site of the support, the template polynucleotide may have a complementary attachment part or structure added thereto. In one example, during the preparation of the library sample, a plurality of template polynucleotides may be prepared for sequencing. Typically, during such sample preparation, in addition to the sequence already included therein as a part of the library to be sequenced, the template polynucleotide of the library sample is modified to include a specific nucleotide sequence. Such added nucleotide sequence can provide any of a variety of functions, including for subsequent identification of the template polynucleotide or as a part of the inoculation process attached to the surface of the SBS substrate. According to the present disclosure, such preparation of the template polynucleotide may also include a complementary attachment part or structure attached thereto or included therein.

[0163] For example, the preparation of template polynucleotide may include attaching nucleotide sequence in template polynucleotide, such as extending from one of its ends, and the sequence is included in or attached to another sequence complementary to other sequences in a single template site of the support. Due to the hybridization caused by Watson-Crick base pairing, it is combined between the two. In another example, auxiliary (such as auxiliary oligonucleotide) can be modified to allow the part or structure complementary to it to be covalently attached thereto. For example, modification (such as on phosphate group, base or sugar) of nucleotide (such as auxiliary oligonucleotide) included in the auxiliary can be included to provide a site covalently attached to the auxiliary site of the support. The auxiliary site of the support can include a complementary part or structure that allows attachment to the auxiliary (such as oligonucleotide-DNA auxiliary). In one example, nucleotides are modified to include an attachment part, and the complementary part of the auxiliary binding site of the support during sample preparation is included in the polynucleotide sequence added to the template polynucleotide by the attachment part. Many modified nucleotides carrying such chemical parts can be commercially available for covalent attachment of the composition to the DNA molecule in which such modified nucleotides have been incorporated.

[0164] In another example, the template polynucleotide may be modified, such as by attachment to a polypeptide during sample preparation. Such a polypeptide may have an amino acid sequence and / or structure to be complementary to the amino acid structure of a single template site of the scaffold, such that the template polynucleotide may be attached to a single template site of the scaffold via the polypeptide to which it is attached. Examples of polypeptide pairs for covalent or non-covalent binding between a single template site of the scaffold and a template polynucleotide are provided above, and these examples include, as non-limiting examples, alpha-helical amino acid sequences having heptad repeats for forming coiled-coil attachment to each other, biotin-avidin binding pairs, SpyTag / SpyCatcher systems, LPXTG / oligoglycine nucleophilic pairs for sortase-mediated transpeptide binding. In another example, the template polynucleotide may be modified during sample preparation to include a Snap tag sequence or O 6 -benzylguanine, and a single template site of the scaffold may include the other of the two to allow for the Snap-tag / O 6 -benzylguanine system is covalently bound between the two. In another example, the template polynucleotide can be modified during sample preparation to include a CLIP-tag sequence or 2 -benzylcytosine, and a single template site of the scaffold may include the other of the two to allow for the CLIP-tag / 2 -Benzylcytosine system and CLIP-labeling / O 2 The -benzylcytosine system is covalently bound between the two.

[0165] Any of the foregoing examples can also be used to attach one or more auxiliary objects to one or more auxiliary sites on the scaffold. In order to attach to the auxiliary sites of the DNA scaffold or polypeptide scaffold, the auxiliary object (such as auxiliary oligonucleotide-DNA) may have a complementary attachment portion or structure added thereto. In one example, the nucleotide sequence may be included in the auxiliary object or attached to the auxiliary object, and may include a complementary attachment portion or structure attached thereto or included therein.

[0166] In another example, an auxiliary (such as auxiliary oligonucleotide-DNA) may include or be attached to a nucleotide sequence, such as extending from one of its ends in the case of auxiliary oligonucleotide-DNA, and the sequence is complementary to another sequence included in or attached to the auxiliary site of the support with other sequences. Watson-Crick base pairing between complementary sequences allows hybridization and binding between the two, so the auxiliary is attached to the auxiliary binding site. In another example, the auxiliary may include its covalent modification to allow a part or structure complementary to it to be covalently attached thereto. For example, modifications (such as on a phosphate group, a base or a sugar) to a nucleotide included in a template polynucleotide may be included to provide a site covalently attached to the auxiliary site of the support. The auxiliary site of the support may include a complementary part or structure that allows attachment to an auxiliary (such as an oligonucleotide-DNA auxiliary). In one example, the nucleotide is modified to include an attachment portion, and the complementary part of the auxiliary binding site of the support may be included in the polynucleotide sequence added to or included in the auxiliary (such as an auxiliary oligonucleotide-DNA) to allow them to be combined. Many modified nucleotides carrying such chemical moieties are commercially available for covalent attachment of the composition to a DNA molecule into which such modified nucleotides have been incorporated.

[0167] In another example, the auxiliary can be modified by attaching to a polypeptide. Such a polypeptide can have an amino acid sequence and structure so as to be complementary to the amino acid structure of the auxiliary site of the scaffold, so that the auxiliary can be attached to the auxiliary site of the scaffold via the polypeptide to which it is attached. Examples of polypeptide pairs for covalent or non-covalent binding between the auxiliary site and the auxiliary are provided above, and these examples include, as non-limiting examples, alpha-helical amino acid sequences with heptad repeats for forming coiled-coil attachment to each other, biotin-avidin binding pairs, SpyTag / SpyCatcher systems, LPXTG / oligoglycine nucleophilic pairs for sortase-mediated transpeptide binding. In another example, an auxiliary (such as an auxiliary oligonucleotide-DNA) can be modified to include a Snap-tag sequence or an O 6 -benzylguanine, and the auxiliary site of the scaffold may include the other of the two to allow for the Snap-tag / O 6-benzylguanine system is covalently bound between the two. In another example, the auxiliary substance may include one of the CLIP-tag sequence or O2-benzylcytosine, and the auxiliary site of the scaffold may include the other of the two to allow for covalent binding according to the CLIP-tag / O2-benzylcytosine sequence. 2 The -benzylcytosine system is covalently bound between the two.

[0168] In one example, a single template polynucleotide can be combined with a single template site of a support, and multiple auxiliary nucleotides (such as auxiliary oligonucleotide-DNA molecules) can be combined with the auxiliary sites of the support. The example of such oligonucleotide-DNA molecules can be a primer for clustering on a support. As part of a conventional clustering process, a copy of a template polynucleotide or its complement is made on the surface of a substrate. As described above, in some cases, clustering on such surfaces may disadvantageously lead to the formation of one or more polyclonal clusters. As disclosed herein, clustering can be performed such as on a support in a solution without the need for the support to be pre-attached to the surface. In other examples, the attached support with a single template polynucleotide can be attached to the surface of the substrate, and then clustering can be performed on the surface of the substrate, on the support, or on the support and on the surface of the substrate.

[0169] For clustering procedures, the template polynucleotide may be modified, such as during sample preparation, to include one or more nucleotide sequences at one or both of its 3-end and 5-end. One or more copies of the template nucleotide and a nucleotide sequence complementary to the template nucleotide may then be synthesized on a scaffold as disclosed herein, thereby forming a cluster. Clustering on such a scaffold may result in the formation of monoclonal clusters.

[0170] In one embodiment, the template polynucleotide can be combined with a single template attachment site, and its 5-end is oriented toward the support, and its 3-end is oriented away from the site combined with the support. The 3-end can include a nucleotide sequence complementary to the nucleotide sequence included in the first primer." Primer" is defined as a single-stranded nucleic acid sequence (for example, single-stranded DNA or single-stranded RNA) serving as the starting point of DNA or RNA synthesis. Primer can be any number of base lengths, and can include a variety of non-natural nucleotides. In one example, primer is a short chain, ranging from 20 to 40 bases or 10 to 20 bases. A copy of the primer complementary to the 3-end of the template polynucleotide can be further attached to the auxiliary site of the support.

[0171] A polymerization reaction may then be performed, wherein the 3-end of the template polynucleotide hybridizes to the first primer bound to the scaffold complementary thereto via Watson-Crick base pairing. The polymerase in the polymerization reaction may generate a nascent chain complement of the template polynucleotide attached to the scaffold, starting from the scaffold-attached primer hybridized to the 3-end of the template polynucleotide. The template polynucleotide and its complement may then be dehybridized.

[0172] The complement of the template polynucleotide may include a nucleotide sequence complementary to the second primer sequence at the 3-end of the complement. A copy of the second primer complementary to the 3-end of the complement of the template polynucleotide may be further attached to the auxiliary site of the scaffold. Then a second polymerization reaction may be performed, wherein the 3-end of the template polynucleotide is hybridized with the first primer bound to the scaffold complementary to it via Watson-Crick base pairing, and the 3-end of the complement of the template polynucleotide is hybridized with the second primer bound to the scaffold complementary to it via Watson-Crick base pairing. The polymerase in the second polymerization reaction may generate another nascent chain complement of the template polynucleotide attached to the scaffold, starting from the first primer attached to the scaffold hybridized with the 3-end of the template polynucleotide. And the polymerase in the second polymerization reaction may further generate a nascent chain copy of the template polynucleotide attached to the scaffold, starting from the second primer attached to the scaffold hybridized with the 3-end of the complement of the template polymerized in the previous polymerization reaction. Then the template polynucleotide and its copy and its complement may be dehybridized.

[0173] Subsequent polymerization reactions can then be performed in an iterative process. The 3-ends of the template polynucleotide bound by the scaffold and its copies are hybridized with the first primer bound by the scaffold complementary to it, and the 3-ends of the complement bound by the scaffold of the template polynucleotide are hybridized with the second primer bound by the scaffold complementary to it. The nascent chain is polymerized by a polymerase, starting at the first primer and the second primer of the scaffold bound by the template polynucleotide bound by the scaffold and its complement and its copy hybridized. After the chain is dehybridized after polymerization, a continuous polymerization reaction is performed, thereby doubling the number of copies of the template polynucleotide and its complement attached to the scaffold. In this way, the copies and complements of the template polynucleotide are amplified, wherein the amplified copies are bound to the scaffold to form clusters. As disclosed herein, this clustering process can be performed on a scaffold in a solution, which is completely different from conventional clustering, which is performed on the surface of a substrate in a conventional SBS process. Because there are only copies and complements of a single template polynucleotide gathered on the scaffold, there are monoclonal clusters on the scaffold.

[0174] In such examples, when the sequence at or attached to the 5-end of the template polynucleotide binds to a single template site, orienting the 3-end of the template polynucleotide away from the scaffold, the template polynucleotide can be hybridized with a primer sequence (referred to as a template site primer) attached to a single template site or a portion thereof and bind to a single template site of the scaffold. In one example, a template polynucleotide such as prepared by a sample preparation process may have a nucleotide sequence complementary to the template site primer at its 5-end or attach the nucleotide sequence to the end. For the 3-end of such a nucleotide sequence complementary to the template site primer, the template polynucleotide may include a nucleotide sequence corresponding to the nucleotide sequence of the above-mentioned second primer (the second primer is a scaffold-attached primer that can hybridize to the 3-end of the complement of the template polynucleotide by complementary Watson-Crick base pairing). Including such a sequence in the template polynucleotide means that the complement of the template polynucleotide synthesized during the polymerization step will have a polynucleotide sequence complementary to the sequence of such a second primer toward its 3-end. Having such a sequence towards the 3-end of the complement of the template polynucleotide enables hybridization of the 3-end of the complement to such a second primer during a subsequent polymerization reaction during clustering.

[0175] At the 3-end of template polynucleotide, away from the template polynucleotide 5-end orientation that is combined with a single template site, template polynucleotide may include a sequence that is complementary to the first primer as described above.During the first polymerization step, as described above, this type of nucleotide sequence at the template polynucleotide 3-end can hybridize with the first primer, and then nascent complement is polymerized to the template polynucleotide.It may be advantageous to terminate the polymerization of complement to the template polynucleotide between the nucleotide sequence that is positioned at its 3-end with the part of template site primer hybridization and the sequence of the second primer in the template polynucleotide.That is to say, the complement of template polynucleotide may be advantageous to have a sequence that is complementary to the second primer at its 3-end.However, if after adding the nucleotide sequence that is complementary to the sequence of the second primer to the nascent complement of template polynucleotide, do not terminate polymerization, the 3-end of the complement of template polynucleotide will not end there so.

[0176] For example, if the nucleotide sequence complementary to the template site primer is the 5-end of the sequence complementary to the second primer and is continuous with the sequence, the 3-end of the synthetic complement of the template polynucleotide may include the nucleotide sequence included in the template site primer. For example, when the complement is polymerized to the template polynucleotide, the DNA polymerase may displace the template site primer so that it hybridizes with the 5-end of the template polynucleotide, and polymerizes the addition of the nucleotide sequence corresponding thereto to the 3-end of the complement of the template polynucleotide. If the result weakens the ability of the 3-end of the complement of the template polynucleotide to hybridize with the above-mentioned second primer at the auxiliary site, then this result may be undesirable.

[0177] Therefore, in one example, it may be desirable to incorporate termination to polymerize the 3-end of the template polynucleotide to the 5-end, wherein such 5-end of the template polynucleotide is bound to a single template site by hybridization with a template site primer. For example, a linker (such as a PEG linker, an alkyl linker, or other chemical moiety) may be included to connect the nucleotide sequence hybridized with the template site primer to the 5-end of the template polynucleotide. The presence of such a linker rather than a continuous nucleotide sequence junction will prevent the polymerase from adding the nucleotide sequence corresponding to the template site primer to the 3-end of the complement of the template polynucleotide, which will instead end with a nucleotide sequence complementary to the nucleotide sequence of the second primer as may be desired.

[0178] In other examples, the template polynucleotide may have or be attached to a polynucleotide sequence at the 3-terminal of the template polynucleotide, which is complementary to a primer (referred to as a template site primer) as a part of a single template site of a scaffold or attached to the single template site. After hybridization of such a sequence at the 3-terminal of the template polynucleotide or attached to the end with the template site primer, a polymerization process can be performed, wherein the DNA polymerase polymerizes the formation of a nascent polynucleotide complementary to the template polynucleotide, starting from the template site primer. Then the complement of the scaffold attached to the template polynucleotide is dehybridized. The 3-terminal (away from the attachment site orientation of the scaffold) of the complement of the scaffold attached to the template polynucleotide may include a nucleotide sequence complementary to the above-mentioned second primer sequence (the second primer is a primer attached to the scaffold that can be hybridized to the 3-terminal of the complement of the template polynucleotide by complementary Watson-Crick base pairing). A copy of the second primer complementary to the 3-terminal of the complement of the template polynucleotide may be further attached to the auxiliary site of the scaffold. A second polymerization reaction may then be performed, wherein the 3-end of the complement of the template polynucleotide hybridizes to a second primer bound to a scaffold complementary thereto via Watson-Crick base pairing. The polymerase in the second polymerization reaction may generate a nascent chain copy of the template polynucleotide (i.e., the complement of the scaffold-bound complement of the template polynucleotide), starting from the scaffold-attached second primer hybridized to the 3-end of the complement of the template polymerized in the previous polymerization reaction. A dehybridization step may then be performed to dehybridize the scaffold-bound complement of the template polynucleotide and the copy of the template polynucleotide from each other.

[0179] The copy of the template polynucleotide may include a nucleotide sequence complementary to the above-mentioned first primer sequence at the 3-end of the copy. The copy of the first primer complementary to the 3-end of the copy of the above-mentioned template polynucleotide may be further attached to the auxiliary site of the scaffold. Then a third polymerization reaction may be performed, wherein the 3-end of the copy of the template polynucleotide is hybridized with the first primer bound to the scaffold complementary to it via Watson-Crick base pairing, and the 3-end of the complement of the template polynucleotide is hybridized with the second primer bound to the scaffold complementary to it via Watson-Crick base pairing. The polymerase in the third polymerization reaction may generate another nascent chain complement of the template polynucleotide attached to the scaffold, starting from the first primer attached to the scaffold hybridized with the 3-end of the copy of the template polynucleotide. And the polymerase in the third polymerization reaction may further generate a nascent chain copy of the template polynucleotide, starting from the second primer attached to the scaffold hybridized with the 3-end of the complement of the template polymerized in the previous polymerization reaction. Then a dehybridization step may be performed to dehybridize the copy and complement of the template polynucleotide with each other.

[0180] Subsequent polymerization reactions can then be performed in an iterative process. The 3-end of the scaffold-bound copy of the template polynucleotide is hybridized with the first primer that is complementary to the scaffold, and the 3-end of the scaffold-bound complement of the template polynucleotide is hybridized with the second primer that is complementary to the scaffold. The nascent chain is polymerized by a polymerase, starting at the first primer and the second primer that are bound to the scaffold-bound template polynucleotide and its complement and its copy hybridized with the scaffold. After polymerization, chain dehybridization is performed, and then continuous polymerization reactions are performed, followed by further dehybridization. In this way, copies and complements of the template polynucleotide are amplified, wherein the amplified copies and complements are bound to the scaffold to form clusters. As disclosed herein, this clustering process can be performed on a scaffold in a solution, which is completely different from conventional clustering, which is performed on the surface of a substrate during a conventional SBS process. Because there are only copies and complements of a single template polynucleotide that are aggregated on the scaffold, there are monoclonal clusters on the scaffold.

[0181] In one example, the end of the template polynucleotide includes or is attached to a nucleotide sequence complementary to a nucleotide sequence included in or attached to a single template site of the scaffold, referred to as a third template site primer. In one example, the complement of the template polynucleotide can be synthesized on the scaffold starting at the third template site primer.

[0182] In the example of clustering on the scaffold as disclosed herein, the template polynucleotide can be bound to a single template site of the scaffold according to any of the various covalent or non-covalent bonds disclosed herein. For example, either end of the template polynucleotide may include a portion or structure from a binding site pair such as shown in Table 1, and the complementary portion or structure of the same pair may be present at a single template site of the scaffold. Successive rounds of polymerization can then be performed much like described above. For example, the template polynucleotide can be bound to the 3 ends of the single template site of the scaffold at the 5-end of the template polynucleotide or towards the 5-end of the template polynucleotide, and can be hybridized with an oligonucleotide primer bound to the auxiliary site of the scaffold and its complement synthesized by a DNA polymerase. Then, continuous rounds of polymerization can be performed as described above, so that multiple copies of the template polynucleotide and its complement generated from the auxiliary site of the scaffold are polymerized. Because only a single template polynucleotide is bound to the scaffold, the scaffold has only a single template polynucleotide site, so such copies will constitute a monoclonal cluster on the scaffold.

[0183] In another example, the support can be attached to the surface of substrate, such as the surface of the substrate used in the SBS program.For example, the auxiliary site of support can include or be or be attached to the surface of substrate or the site of the composition attached to the surface of substrate.In one example, the surface of substrate can be combined with primer (as non-limiting example, such as a copy of the primer complementary to the first primer or the second primer as described above or both).Such complementary primers can be directly attached to the surface of substrate, or can be attached to modified surface, such as the surface attached by polymer molecules (for example, PAZAM or related polymers), wherein primers are attached to such polymers.The aforementioned first primer and the second primer can be attached to the auxiliary site of support (directly or via polymer (such as PAZAM or other PAZAM-like polymers disclosed above as non-limiting examples) or spacer or other compositions).Support or such first primer and second primer attached to support can hybridize with primers complementary thereto, such as attached to the surface of substrate, so that support is bonded to the surface of substrate.

[0184] Examples of the first primer and the second primer as described above may include primers used in existing SBS processes. Specific examples of suitable primers include P5 and / or P7 primers, which are used on the surface of commercial flow cells sold by Illumina, Inc. for use in HISEQ TM HISEQX TM MISEQ TM MISEQDX TM MINISEQ TM 、NEXTSEQ TM 、NEXTSEQDX TM 、NOVASEQ TM 、GENOME ANALYZERTM 、ISEQ TM And the portion of the template polynucleotide including the nucleotide sequence corresponding to or complementary to the first primer or the second primer as disclosed above may have, for example, a sequence corresponding to or complementary to the P5 primer (including the nucleotide sequence of AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 7)), the P7 primer (including the nucleotide sequence of CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 8)) or both according to such primer sequences as used in the above-mentioned SBS platform or other platforms.

[0185] As a non-limiting example, the substrate for the SBS process may include a substrate used in any of the aforementioned SBS platforms or other platforms. As a non-limiting example, this substrate may be a flow cell. As used herein, the term "flow cell" is intended to represent a chamber (i.e., flow channel) in which a reaction can be carried out, a container for delivering reagents to the inlet of the chamber, and an outlet for removing reagents from the chamber. In some examples, the chamber enables the detection of a reaction or signal occurring in the chamber. For example, the chamber may include one or more transparent surfaces that allow optical detection of arrays, optical marker molecules, etc. in the chamber. As used herein, "flow channel" or "flow channel area" may be an area defined between two bonding components, which may selectively receive a liquid sample. In some examples, the flow channel may be defined between a patterned support and a lid, so that it may be fluidly connected to one or more recessed portions defined in the patterned support. In other examples, the flow channel may be defined between a non-patterned support and a lid.

[0186] As used herein, the term "recessed portion" refers to a discrete concave feature in a patterned support having a surface opening that is completely surrounded by a gap region of the patterned support surface. The recessed portion can have any of a variety of shapes at the opening in its surface, including, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. The cross-section of the recessed portion taken orthogonally to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. As an example, the recessed portion can be a hole. Also as used herein, a "functionalized recessed portion" refers to a discrete concave feature to which a primer is attached (in some examples, attached to the surface of the recessed portion by a polymer (such as PAZAM or similar polymer)).

[0187] The term flow cell "support" or "substrate" refers to a support or substrate to which surface chemicals can be added. The term "patterned substrate" refers to a support in which or on which a recess is defined. The term "non-patterned substrate" refers to a substantially planar support. The substrate may also be referred to herein as a "support", "patterned support" or "non-patterned support". The support may be a wafer, a panel, a rectangular sheet, a die or any other suitable configuration. The support is typically rigid and insoluble in aqueous liquids. The support may be inert to chemicals used to modify the recesses. For example, the support may be inert to chemicals used to form a polymer coating, attach primers to a polymer coating such as one that has been deposited, and the like. Examples of suitable supports include epoxysiloxanes, glass and modified or functionalized glass, polyhedral oligomeric silsesquioxanes (POSS) and their derivatives, plastics (including acrylic, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as available from Chemours) ), cycloolefins / cycloolefin polymers (COP) (such as those available from Zeon ), polyimide, etc.), nylon, ceramic / ceramic oxide, silicon dioxide, fused silicon dioxide or silicon dioxide-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si 3 N 4 ), silicon oxide (SiO 2 ), tantalum pentoxide (TaO 5 ) or other tantalum oxide (TaO x ), Hafnium Oxide (HaO 2 ), carbon, metal, inorganic glass, etc. The support may also be glass or silicon or a silicon-based polymer (such as a POSS material), optionally with a coating of tantalum oxide or another ceramic oxide at the surface. The POSS material may be the POSS disclosed in Kejagoas et al., Microelectronic Engineering 86 (2009) 776-668, which is incorporated by reference in its entirety.

[0188] In one example, the recessed portion can be a hole, so that the patterned substrate includes an array of holes on its surface. The holes can be micropores or nanopores. The size of each hole can be characterized by its volume, hole opening area, depth and / or diameter.

[0189] Each well can have any volume capable of confining a fluid. The minimum or maximum volume can be selected, for example, to accommodate the desired throughput (e.g., multiplexing), resolution, analyte composition, or analyte reactivity for downstream use of the flow cell. For example, the volume can be at least about 1×10 -3 μm 3 , about 1×10-2 μm 3 , about 0.1μm 3 , about 1μm 3 , about 10μm 3 , about 100μm 3 Alternatively or in addition, the volume may be at most about 1×10 4 μm 3 , about 1×10 3 μm 3 , about 100μm 3 , about 10μm 3 , about 1μm 3 , about 0.1μm 3 or smaller.

[0190] The area occupied by each pore opening on the surface can be selected based on criteria similar to those described above for pore volume. For example, the area of ​​each pore opening on the surface can be at least about 1×10 -3 μm 2 , about 1×10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , about 10μm 2 , about 100μm 2 Alternatively or in addition, the area may be at most about 1×10 3 μm 2 , about 100μm 2 , about 10μm 2 , about 1μm 2 , about 0.1μm 2 , about 1×10 -2 μm 2 The area occupied by each hole opening can be greater than, less than, or in between the values ​​specified above.

[0191] Each hole may have a depth of at least about 0.1 μm, about 1 μm, about 10 μm, about 100 μm, or more. Alternatively or in addition, the depth may be at most about 1×10 3 The depth of each hole 14' may be greater than, less than, or between the values ​​specified above.

[0192] In some cases, each pore may have a diameter of at least about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 10 μm, about 100 μm, or more. Alternatively or in addition, the diameter may be at most about 1×10 3The diameter may be about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 900 nm, about 950 nm, about 1 μm, about 1.25 μm, about 1.5 μm, about 1.74 μm, about 2 μm, about 2.25 μm, about 2.5 μm, about 2.75 μm, about 3 μm, about 3.25 μm, about 3.75 μm, about 3.85 μm, about 3.95 μm, about 4.10 μm, about 4.25 μm, about 4.85 μm, about 4.95 μm, about 4.85 μm, about 4.95 μm, about 4.85 μm, about 4.95 μm, about 4.85 μm, about 4.95 μm, about 4.85 μm, about 4.95 μm, about The diameter of each hole can be greater than, less than, or between the values ​​specified above. The nanopore as used herein is intended to mean a hole having a circular opening with a maximum diameter of about 1 μm or less.

[0193] It should be understood that the ranges provided herein include the specified range and any value or sub-range within the specified range. For example, a range of about 100 nm to about 1 μm (1000 nm) should be interpreted as including not only the explicitly listed limits of about 100 nm to about 1 μm, but also single values ​​(such as about 708 nm, about 945.5 nm, etc.) and sub-ranges (such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc.). In addition, when "about" and / or "substantially" are used to describe values, they are intended to cover minor changes (up to + / - 10%) relative to the specified value.

[0194] In one example, the size of the nanoparticles can be such that the presence of the nanoparticles in a hole (such as a nanopore) occupies so much pore volume that another nanoparticle cannot occupy the hole at the same time. The size of the nanoparticles can be designed or determined with reference to the known size of the hole in the substrate surface so that it can enter a hole where there are no other nanoparticles but its entry into the hole will be blocked by the presence of another nanoparticle that previously entered the hole and is still present in the hole. The size is set to a hole that cannot accommodate more than two nanoparticles and can be beneficial to the monoclonality of the cluster in the hole. For example, in a conventional SBS process, the template polynucleotide can be introduced into a flow cell patterned with holes in a solution at the following concentration: calibrated to maximize the number of holes that the template polynucleotide will be inoculated, (i.e., such as directly or via a surface-attached polymer complementary to the nucleotide sequence of a portion of the template nucleotide and a primer attached to the hole), but low enough to minimize the formation of polyclonal clusters as much as possible.

[0195] In one example, the flow cell may include a nanoscale region that is not a recess or nanopore but a region (referred to herein as a nanopad) that is otherwise spatially isolated within which a template polynucleotide or scaffold may bind or be inoculated. In some examples, the flow cell surface includes nanopads that are separated from each other by regions in the surface where the template polynucleotide or scaffold may not bind. The nanopads may be spaced apart from each other to promote the formation of monoclonal clusters. For example, the nanopads may be separated from each other so that a cluster formed in a nanopad inoculated by a single template polynucleotide will be fully separated from another such nanopad inoculated by only one template polynucleotide. However, it may be difficult to prevent more than one template polynucleotide from inoculating the nanopad, thereby forming one or more polyclonal clusters. In an example as disclosed herein, nanoparticles may promote monoclonal clusters to be superior to polyclonal cluster formation by preventing more than one template polynucleotide from being inoculated or attached within a given nanopad. For example, the size of the nanoparticle may be such that there is not enough space on the nanopad for binding more than one nanoparticle, wherein the template polynucleotide is bound to a single template polynucleotide site of the scaffold.

[0196] In some cases, if two or more template polynucleotides with different nucleotide sequences are bound or seeded in the same wells as each other, polyclonal clusters may occur. The molecules may be distributed between the wells based on their concentrations in the applied solution based on a Poisson distribution, according to which there is a balance between minimizing the number of unoccupied wells (for increasing the efficiency of the SBS run) and minimizing the number of wells occupied by multiple different template polynucleotides. The difference between the minimum well size and the size of the template polynucleotide (e.g., the diameter of a B-DNA molecule may be about 2 nm) may result in a choice between concentrations that are available or preferred on the one hand and do not utilize that much substrate surface (such as the surface in the well), and result in the formation of undesirable or undesirably high numbers of polyclonal clusters.

[0197] As disclosed herein, the template polynucleotide can be bound to the nanoparticle, and each nanoparticle has only one template polynucleotide to bind. The size of the nanoparticle can be set to allow the nanoparticle to enter the hole of the flow cell where there is no other nanoparticle, but it is not allowed to enter the hole of the flow cell where there is another nanoparticle. Clustering (such as monoclonal clustering) can occur on the nanoparticle before the nanoparticle enters the hole, so that there is a monoclonal cluster in the hole. Alternatively, the template polynucleotide can be bound to the template site of the nanoparticle, and the nanoparticle can enter the hole and be bound therein (for example, by auxiliary sites and surface binding or the surface of the hole is modified), so that only a single nanoparticle is inoculated into the hole, and then clustering can be performed in the hole, so that there is a monoclonal cluster in the hole. In some examples, a certain degree of clustering may occur on the nanoparticle before the nanoparticle enters the hole, and further clustering may occur after the nanoparticle enters the hole. All such examples include examples in which monoclonal clusters are formed in the hole. Furthermore, adjusting the size of the nanoparticles to reduce, minimize, or in one example eliminate the presence of more than one nanoparticle in a well at one time can reduce, minimize, or in one example eliminate the formation of polyclonal clusters.

[0198] Nanoparticle size can be regulated by changing the size of support, changing the size of the auxiliary (such as polymer attached thereto) combined with auxiliary site or these two methods.The size of nanoparticle can also be changed by the amount of clustering that occurs or has not occurred on nanoparticle, for example, by changing the copy and complement of template polynucleotide on nanoparticle, the number of sites that can be combined thereon in multiple rounds of polymerization process during clustering, such sites are less likely to cause the upper limit of nanoparticle size to be lower, and such sites are more likely to cause the upper limit of nanoparticle size to be larger.The round number of polymerization during clustering can also change nanoparticle size, and the number of rounds causes the copy and complement of template polynucleotide combined with nanoparticle to be more, therefore may increase its size upper limit, and the number of rounds causes the copy and complement of template polynucleotide combined with nanoparticle to be less, therefore may reduce its size upper limit.The size of nanoparticle can be determined according to its size before clustering occurs on support or after clustering occurs on support.

[0199] As used herein, the term "nanoparticle" is intended to mean a particle having a size of up to about 1,000 nm in its largest dimension. Depending on the geometry, a dimension may refer to length, width, height, diameter, etc. Although "diameter" is often used to describe a dimension as an example herein, the nanoparticles described herein need not be spherical or round. The diameter of the nanoparticles as disclosed herein can be about 2 nm, about 5 nm, about 7 nm, about 10 nm, about 12 nm, about 15 nm, about 17 nm, about 20 nm, about 22 nm, about 25 nm, about 27 nm, about 30 nm, about 32 nm, about 35 nm, about 40 nm, about 42 nm, about 45 nm, about 47 nm, about 50 nm, about 52 nm, about 55 nm, about 57 nm, about 60 nm, about 62 nm, about 65 nm, about 67 nm, about 70 nm, about 72 nm, about 75 nm, about 77 nm, about 80 nm, about 82 nm, about 85 nm, about 87 nm, about 90 nm, about 92 nm, about 95 nm, about 97 nm, about 100 nm, about 120 nm, about 125 nm, about 126 nm, about 127 nm, about 128 nm, about 129 nm, about 130 nm, about 131 nm, about 132 nm, about 133 nm, about 134 nm, about 136 nm, about 137 nm, about 138 nm, about 139 nm, about 140 nm, about 141 nm, about 142 nm In some embodiments, the present invention relates to a nanostructured carbon foam having a molecular weight of about 100 nm, about 500 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 675 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1,000 nm. The diameter of the nanoparticles is measured by dynamic light scattering (DLS), also known as quasi-elastic light scattering, and is expressed as twice the hydrodynamic radius (Rh), which can be obtained in a DLS system or other systems that include DLS and other functions (e.g., The results were measured on a Malvern Instruments Limited).

[0200] The diameter of the nanoparticles as disclosed herein can be between about 2 nm and about 10 nm, about 5 nm and about 15 nm, about 7 nm and about 20 nm, about 10 nm and about 25 nm, about 15 nm and about 30 nm, about 20 nm and about 50 nm, about 40 nm and about 60 nm, about 50 nm and about 75 nm, about 60 nm and about 100 nm, about 70 nm and about 100 nm, about 75 nm and about 100 nm, about 80 nm and about 110 nm, about 90 nm and about 130 nm, about 100 nm and about 150 nm, about 100 nm and about 200 nm, about 150 nm and about 225 nm, about 200 nm and about 250 nm, about 200 nm and about 250 nm, about 200 nm and about 250 nm, about 200 nm and about 250 nm, about 200 nm and about 250 nm, about 200 nm and about 250 nm, about 200 nm and about 250 nm, about 200 nm and about 250 nm, about 200 nm and about 250 nm, about 200 nm and about 250 nm, about 25 ... nm to about 300 nm, about 225 nm to about 275 nm, about 250 nm to about 300 nm, about 275 nm to about 325 nm, about 300 nm to about 400 nm, about 300 nm to about 350 nm, about 325 nm to about 375 nm, about 350 nm to about 400 nm, about 375 nm to about 425 nm, about 400 nm to about 500 nm, about 400 nm to about 450 nm, about 425 nm to about 475 nm, about 450 nm to about 500 nm, about 475 nm to about 525 nm, about 500 nm to about 600 nm, about 500 nm to about 550 nm, about 525 nm to about 575 nm, about The wavelengths of the present invention are preferably from about 550 nm to about 600 nm, from about 575 nm to about 625 nm, from about 600 nm to about 700 nm, from about 600 nm to about 625 nm, from about 625 nm to about 675 nm, from about 650 nm to about 700 nm, from about 675 nm to about 725 nm, from about 700 nm to about 800 nm, from about 700 nm to about 725 nm, from about 725 nm to about 775 nm, from about 750 nm to about 800 nm, from about 775 nm to about 825 nm, from about 800 nm to about 900 nm, from about 800 nm to about 850 nm, from about 825 nm to about 875 nm, from about 850 nm to about 900 nm, from about 875 nm to about 925 nm. The wavelength of the wavelength of the present invention is in the range of about 1,000 nm to about 2,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, about 1,000 nm to about 3,000 nm, or about 1,000 nm to about 1,000 nm.

[0201] For convenience and clarity, certain terminology employed in the specification, examples, and claims is described herein.

[0202] "Acrylate groups" include salts, esters and conjugate bases of acrylic acid and its derivatives (e.g., methacrylic acid). The acrylate ion has the molecular formula CH 2 =CHCOO.

[0203] "Acrylamide monomer" is a monomer with the structure or a substituted analog thereof (e.g., methacrylamide or N-isopropylacrylamide). An example of a monomer comprising an acrylamide group and an azide group is azidoacetamidopentylacrylamide:

[0204] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is completely saturated (i.e., does not contain double bonds and triple bonds). The alkyl group may have 1 to 20 carbon atoms. Typical alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, etc. As an example, the name "C1-C4 alkyl" indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl.

[0205] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. An alkenyl group may have 2 to 20 carbon atoms. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0206] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. An alkynyl group can have 2 to 20 carbon atoms.

[0207] Alkoxy refers to groups having 1 to 20 carbon atoms - e.g. 1 to 10 carbon atoms, such as 1 to 6 carbon atoms, etc., in a straight or branched configuration attached to the parent structure through an oxygen. Examples include methoxy, ethoxy, propoxy, isopropoxy, and the like.

[0208] Oxaalkyl refers to an alkyl residue in which one or more carbons (and their associated hydrogens) have been replaced by oxygen. Examples include methoxypropoxy, 3,6,9-trioxadecanyl, and the like. The term "oxaalkyl" refers to compounds in which oxygen is bonded to its adjacent atom via a single bond (forming an ether bond); it does not refer to a double-bonded oxygen as is present in a carbonyl group. Similarly, thiaalkyl and azaalkyl refer to alkyl residues in which one or more carbons have been replaced by sulfur or nitrogen, respectively. Examples of azaalkyl include ethylaminoethyl and aminohexyl.

[0209] As used herein, "aryl" refers to an aromatic ring or ring system containing only carbon in the ring backbone (i.e., two or more fused rings sharing two adjacent carbon atoms). When aryl is a ring system, each ring in the ring system is aromatic. Aryl groups may have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

[0210] As used herein, the term "attachment" refers to a state in which two things are bound, fastened, adhered, connected or bonded to each other covalently or non-covalently (e.g., by hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions). For example, a nucleic acid can be attached to a functionalized polymer by a covalent bond or a non-covalent bond.

[0211] An "azide" or "azido" functional group refers to an -N 3 .

[0212] As used herein, "bonding region" refers to a region on a substrate to be bonded to another material, which may be, for example, a spacer layer, a cover, another substrate, etc., or a combination thereof (e.g., a spacer layer and a cover). The bond formed at the bonding region may be a chemical bond (as described above) or a mechanical bond (e.g., using fasteners, etc.).

[0213] "tert-Butyloxycarbonyl group" (Boc) refers to A "butoxycarbonyloxy group" refers to an -OCO 2 tBu group.

[0214] As used herein, "carbocyclyl" means a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system skeleton. When the carbocyclyl is a ring system, two or more rings can be joined together in a fused, bridged or spiro-connected manner. The carbocyclyl can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Therefore, the carbocyclyl includes cycloalkyl, cycloalkenyl and cycloalkynyl. The carbocyclyl group can have 3 to 20 carbon atoms. Examples of carbocyclyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl and spiro[4.4]nonanyl.

[0215] As used herein, the term "carboxylic acid" or "carboxyl" refers to -COOH.

[0216] As used herein, "cycloalkylene" means a fully saturated carbocyclic ring or ring system attached to the rest of the molecule via two points of attachment.

[0217] As used herein, "cycloalkenyl" or "cycloalkene" refers to a carbocyclic ring or ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also as used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbocyclic ring or ring system having at least one heteroatom in the ring backbone, having at least one double bond, wherein no ring in the ring system is aromatic.

[0218] As used herein, "hydroxy" refers to an -OH group.

[0219] As used herein, "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA or single-stranded RNA) that serves as the starting point for DNA or RNA synthesis. The 5' end of the primer may be modified to allow coupling reaction with the functionalized polymer layer. The primer length may be any number of base lengths and may include a variety of non-natural nucleotides. In one example, the primer is a short chain ranging from 20 to 40 bases.

[0220] As used herein, the term "optionally substituted" is used interchangeably with "unsubstituted or substituted". The term "substituted" means that one or more hydrogen atoms in a specified group are replaced by a specified group. For example, substituted alkyl, aryl, cycloalkyl, heterocyclyl, etc. means that one or more H atoms in each residue are replaced by halogen, haloalkyl, alkyl, acyl, alkoxyalkyl, hydroxy lower alkyl, carbonyl, phenyl, heteroaryl, benzenesulfonyl, hydroxy, lower alkoxy, haloalkoxy, oxaalkyl, carboxyl, alkoxycarbonyl [-C (=O) O-alkyl], alkoxycarbonylamino [HNC (=O) O-alkyl], carboxamido [-C (=O) NH 2], alkylaminocarbonyl [-C(=O)NH-alkyl], cyano, acetoxy, nitro, amino, alkylamino, dialkylamino, (alkyl)(aryl)aminoalkyl, alkylaminoalkyl (including cycloalkylaminoalkyl), dialkylaminoalkyl, dialkylaminoalkoxy, heterocyclylalkoxy, thiol, alkylthio, sulfoxide, sulfone, sulfonylamino, alkylsulfinyl, alkylsulfonyl, alkylsulfonylamino, arylsulfonyl, arylsulfonylamino, acylaminoalkyl, acylaminoalkoxy, acylamino, amidino, aryl, benzyl, heterocyclyl, heterocyclylalkyl, phenoxy, benzyloxy, heteroaryloxy, hydroxyimino, alkoxyimino, oxaalkyl, aminosulfonyl, trityl, amidino, guanidino, ureido, benzyloxyphenyl and benzyloxy substituted alkyl, aryl, cycloalkyl or heterocyclyl. "Oxo" is also included in the substituents mentioned in "optionally substituted"; those skilled in the art will understand that because oxo is a divalent group, there are cases where it is not suitable as a substituent (e.g., on a phenyl group). In one example, 1, 2, or 3 hydrogen atoms may be replaced by a specified group. In the case of alkyl and cycloalkyl groups, more than three hydrogen atoms may be replaced by fluorine; in fact, all available hydrogen atoms may be replaced by fluorine. Such compounds (e.g., perfluoroalkyl) belong to the category of "fluorinated hydrocarbons". It should be clear that the general term may cover more than one substituent, i.e., for example, "haloalkyl" or "halophenyl" refers to an alkyl or phenyl group in which at least one but possibly more than one hydrogen is replaced by a halogen. In some examples, the substituents are halogen, haloalkyl, alkyl, acyl, hydroxyalkyl, hydroxy, alkoxy, haloalkoxy, oxaalkyl, carboxyl, cyano, acetoxy, nitro, amino, alkylamino, dialkylamino, alkylthio, alkylsulfinyl, alkylsulfonyl, alkylsulfonylamino, arylsulfonyl, arylsulfonylamino, and benzyloxy.

[0221] When describing the compounds herein, the term "substituted with at least one oxygen-containing substituent" is used. An oxygen-containing substituent is a substituent that contains oxygen in addition to carbon and hydrogen; an oxygen-containing substituent may also include additional heteroatoms such as nitrogen (e.g., carboxamide or mesyl). Typical examples of oxygen-containing substituents include alkoxy, hydroxy, fluoroalkoxy, formyl, acetyl, and other C 1 To C 6 Acyl chain.

[0222] Non-limiting examples

[0223] The following examples are intended to illustrate specific embodiments of the present disclosure, but are in no way intended to limit the scope thereof.

[0224] Figure 1A diagram of a non-limiting example of a nanoparticle as disclosed herein is shown. In this non-limiting example, a single template polynucleotide site is shown as a wedge-shaped portion of the scaffold portion of the nanoparticle as disclosed. A single template polynucleotide is shown as being combined with a single template site. Also in this non-limiting example, multiple auxiliary objects are shown as extending from the auxiliary site of the scaffold. In the center diagram, the auxiliary object is shown as a polymer. In the left figure, many copies of polynucleotides complementary to the template polynucleotide and copies of the template polynucleotide are shown, wherein such copies are attached to the scaffold and extend from the scaffold. In this example, they extend from a polymer, which in turn extends from the scaffold.

[0225] In the right figure, a nanoparticle with a template polynucleotide bound at a single template site is shown in the hole of the substrate. Multiple auxiliary oligonucleotides are shown to extend from the support. Although not shown in the right figure, in this example, the auxiliary oligonucleotide extends from the polymer attached to the support. The nucleotide sequence of the auxiliary oligonucleotide is complementary to the primer attached to the surface of the hole. The auxiliary oligonucleotide is thus hybridized with the primer attached to the hole and attached to the surface of the hole. Here, due to the size of the nanoparticle relative to the size of the hole, only one nanoparticle can exist in the hole at a time. Therefore, clustering starts from a single template.

[0226] Figure 2 is an illustration of a non-limiting example of a nanoparticle scaffold according to the present disclosure. On the left, the scaffold is represented as an asymmetric scaffold carrying three polymer tails and a single template polynucleotide attached to the scaffold. On the right, an example of a molecular structure of a nanoparticle (including a 3-arm RAFT agent core) is depicted, wherein a single template attachment point and a polymer extending from the scaffold core are shown. Also shown are non-limiting examples of acrylamide monomers that can form a portion of the scaffold (including auxiliary sites depicted in this example as azide groups (e.g., matrix monomers and primer attachment points)).

[0227] Figure 3 Another non-limiting example of a scaffold polymer as disclosed herein is shown. On the right, a scaffold core with three polymer arms extending therefrom and a single template polynucleotide attachment site are shown. On the left, the chemical structure of the core and one of the polymer arms are shown (other polymer arms are omitted for purposes of clear illustration, but they will be included in the scaffold). The dibenzocyclooctene group is shown as a single template polynucleotide attachment site. Auxiliary binding sites are shown on the polymer arms shown.

[0228] Figure 4Another non-limiting example of an example synthesis scheme of a scaffold according to various aspects of the present disclosure is depicted. In this example, the amine end of the tris molecule is blocked (tert-butyl dicarbonate or Boc2O, DIPEA or N, N-diisopropylethylamine and THF or tetrahydrofuran), and a 2-(dodecylthiocarbonylthiothio)-2-methylpropionic acid (DDMAT) group is added to the hydroxyl end of the tris core. Two options for subsequent polymerization are shown. In approach 1, a standard aqueous RAFT polymerization is performed to add the monomer to the chain, and then the amine group is deprotected and a dibenzocyclooctene (DBCO) group is attached to it. In alternative approach 2, a block of the amine group is first removed with trifluoroacetic acid (TFA), and then a dibenzylcyclooctene group (DBCO-PEG1-NHS ester) is attached before a RAFT polymerization is performed to add the monomer group.

[0229] Alternative approaches for synthesizing scaffolds according to the present disclosure are as follows.

[0230]

[0231] (In this example, for simplicity of illustration, only one of the polymer arms is shown after DDMAT addition, but all three arms will have the same structure.) In this non-limiting working example, a PEG linker has been added between the template polynucleotide site (R) and the polymer arms, which include an auxiliary site, in this example an azide group.

[0232] Another approach to synthesizing scaffolds according to aspects of the present disclosure is according to the following non-limiting working examples:

[0233]

[0234] From there, the following non-limiting example of a synthetic scheme can be performed (only one of the three polymer arms is shown again for purposes of clarity of illustration, but all polymer arms will be synthesized according to the same scheme):

[0235]

[0236]

[0237] In this non-limiting example, the single template polynucleotide site is a tetrazine. The following carrying R 1 Monomers of to synthesize different kinds of scaffolds as disclosed herein (as a non-limiting example, for adding azide groups to obtain auxiliary binding sites):

[0238]

[0239] Where x = 1-11

[0240] Optionally, during the polymerization, the following may be added: 2 Monomers to synthesize different kinds of scaffolds as disclosed herein:

[0241]

[0242] Optionally, the acrylamide monomer can be pegylated according to the following scheme:

[0243]

[0244] An alternative for synthesizing a scaffold from a triazine core according to the present disclosure is according to the following non-limiting examples:

[0245]

[0246] Where X = 2-9

[0247]

[0248]

[0249] In this non-limiting example, the single template polynucleotide site is an amine extending from the top of the tetrazine core, as shown above. The following carrying R 1 Monomers of to synthesize different kinds of scaffolds as disclosed herein (as a non-limiting example, for adding azide groups to obtain auxiliary binding sites):

[0250]

[0251] Where X = 1-11

[0252] Optionally, during the polymerization, the following may be added: 2 Monomers to synthesize different kinds of scaffolds as disclosed herein:

[0253]

[0254] Optionally, the acrylamide monomer can be pegylated according to the following scheme:

[0255]

[0256] The difunctional PEGylated secondary amines for addition to the triazine scaffold core can be synthesized according to the following scheme:

[0257]

[0258] Where X = 2-9

[0259] Stoichiometric control of the components added during the initial addition of the difunctional PEGylated secondary amine to the triazine scaffold core, as well as purification methods (based on, for example, polarity differences) can be used to facilitate the production and isolation of disubstituted triazines (with two difunctional secondary amines added) rather than mono- and tri-substituted products.

[0260] Figure 5 Examples of dendrimers according to various aspects of the present disclosure are shown. In this example, a polypeptide comprising four lysines and ending with a C-terminal cysteine ​​is shown. The second lysine, the third lysine, and the fourth lysine comprise forks comprising isopeptide bonds connected to another lysine group via its epsilon amino group. The second lysine has a single lysine attached via an isopeptide bond. The third lysine is attached to a dilysine having another lysine connected thereto via an isopeptide bond to the epsilon amino group of its C-terminal lysine. The fourth lysine is attached to a trilysine having another lysine attached to its second lysine via an isopeptide bond, and a dilysine residue having another lysine attached thereto via an isopeptide bond is attached to its C-terminal lysine.

[0261] Thus, in this example of a dendron, different numbers of generations appear in the branches extending from the cysteine ​​core. In other examples, more or fewer generations may be included, and different branches may have the same number of generations as one another, different numbers of generations as one another. In other examples, additional amine species may be included, such as via peptide bonds to lysine residues, between lysyl forks, or at the ends of carrying a single template polynucleotide site.

[0262] Figure 6 A scheme for the synthesis of nanoparticles with branched lysine substituents such as in a lysyl dendrimer structured scaffold or a lysine-containing polypeptide scaffold linked together by isopeptide bonds at the ε-amino groups of the lysine substituents to form a branched polypeptide scaffold is shown. Solid phase peptide synthesis can be used, for example, in accordance with Figure 6 The amino acid sequence is synthesized together in the linear polypeptide chain of the figure above (sequential synthesis strategy by solid phase peptide synthesis (SPSS)). The amine group is blocked by fluorenylmethoxycarbonyl (Fmoc) or tert-butyloxycarbonyl (Boc). The protecting group is selectively removed in the presence of the added composition / coupling reagent. Linear chain polypeptides can be synthesized by iterative protection of the free amino group (addition of n number of monomers, where n = number of cycles), followed by removal and addition of activated amino acids (addition of n number of monomers, where n = number of cycles). Thus, a linear chain of charged amino acids including one or more lysine residues can be generated as a component of the scaffold. The composition can then be cleaved from the base resin and further modified as desired.

[0263] like Figure 6 As further depicted in the figure below, a convergent solid phase protein synthesis method can be used, in which lengths of individually formed polypeptide chains including one or more lysine residues can be added as a collection of polymers during the synthesis steps (Figure below, Convergent synthesis strategy by solid phase peptide synthesis (SPPS)). Figure 6 In some examples not depicted in FIG. 22 , amino acids or polypeptides can be added independently to a fork as branches, where the fork is a structure containing two amino groups (i.e., the N-terminus, such as the α-amino group of lysine or another amino acid, and the ε amino acid of lysine), rather than being linearly linked from a single amino group as depicted in FIG. 22 . For example, a lysine amino acid having two amino groups can be used as a fork-like attachment point to which two branches of a linear polypeptide or two individual lysine residues can be attached, according to Figure 6 Scheme of solid-phase protein synthesis depicted in Figure 1, with one branch attached to each amino group.

[0264] Figure 7 is an illustration of different methods for binding a template polynucleotide to a scaffold. A scaffold with a single template polynucleotide site is shown at the top. On the left, a template site primer is included in the single template polynucleotide site, and its end is complementary to the end of the template polynucleotide to allow the template polynucleotide to be non-covalently bound to the scaffold by Watson-Crick base pair hybridization. In the middle, the template polynucleotide and the single template polynucleotide site have complementary parts or structures, respectively, so that a covalent bond is formed between the template polynucleotide and the scaffold. On the right, a polypeptide is included in the single template site, and a polypeptide complementary thereto is attached to the end of the template polynucleotide. The non-covalent binding between the polypeptide of the single template site and the template polynucleotide binds the template polynucleotide to the scaffold.

[0265] Figure 8 An example of a template polynucleotide that binds to a single template site of a protein scaffold by hybridization with a template site primer represented by PX (GFP-oligonucleotide conjugate) is shown. Two examples of template polynucleotides of the library are shown, one is a standard library molecule having P5 and P7 sequences, wherein a region complementary to the PX template site primer (named PX') is present at the 3-terminus, or a modified version in which the PX' sequence is separated from the P5 sequence by a PEG linker. The ether chain is bound to a single template site of the scaffold. The standard library sequence can be used in a first chain extension polymerization reaction, and the PX primer is used as an initiator primer to polymerize a nascent chain complementary to the template polynucleotide.

[0266] Fig. 9 Non-covalent bonds, particularly coiled-coil peptide non-covalent bonds (in one example, K D In <1×10 -10 Examples of methods for preparing a polynucleotide that is complementary to a polynucleotide of the invention are shown in Figure 1. Examples of polynucleotides that are ...

[0267] Fig.10 A graph showing an example of a test of the number of scaffolds of a given size that can be present in a nanopore (dendrimers / nanopore) of a given nanopore surface area (SA) or diameter (D) (seeding events vs. nanopore surface area). Nanoparticles of approximately 100 nm in diameter (having a different structure than the nanoparticles disclosed herein) were seeded into nanopores of 185, 285, or 375 nm in diameter, and the number of dendrimers per nanopore was measured. From the best fit curve of the results (y=3E-0.5x-3.4874, R 2 = 0.9991) extrapolation suggests that, in this example, using a nanoparticle with a diameter of about 100 nm and a nanopore with a diameter of about 100 nm would result in the nanopore being seeded with a single nanoparticle.

[0268] Figures 11A-11C An example of using a scaffold to seed a substrate with a template polynucleotide according to various aspects of the present disclosure is shown. The diameter of the scaffold (constructed as a DNA dendrimer scaffold according to U.S. Provisional Application No. 62 / 952,799) is 50nm-150nm. The scaffold includes a single template site (Pa) for binding a template polynucleotide and multiple auxiliary sites (cPX). Fig.11A The template polynucleotide and its complement are shown, with primer sequences added to each end (P5 / cP5 and P7 / cP7). The P5-primer end of the template polynucleotide is connected to a primer (cPa) via a PEG linker. The cPa primer is complementary to a single template site (Pa) of the scaffold. Fig. 11B is a depiction of a scaffold molecule that hybridizes to a template polynucleotide via its single template site (Pa) and to its cpa primer at Fig.11A The scaffold is attached to a substrate. The substrate is attached to a primer (PX) complementary to an auxiliary site (cPX) of the scaffold. The substrate is also attached to the primer to allow the template end to hybridize thereto, thereby allowing clustering on the substrate.

[0269] Fig. 11CAn example according to the foregoing is depicted, which demonstrates the use of a scaffold with a single template site to seed a substrate with a template polynucleotide followed by clustering. A scaffold attached to a template polynucleotide according to various aspects of the present disclosure is Fig.11A and Fig. 11B . The scaffolds were combined with template polynucleotides (libraries) at the molar ratios shown, a substrate (a flow cell with nanopores for inoculation) was inoculated with them, and then clustered according to a recombinase-driven cluster amplification process (ExAmp cluster amplification). Negative controls included scaffolds without templates and templates without scaffolds. As a positive control (+ control), clustering was performed on the substrate without scaffolds using clustering after the template molecules were hybridized with primers that were not attached to the substrate by the scaffolds.

[0270] The left figure is an image of the flow cell after the clustering process according to the above conditions (2 negative controls, 5 conditions of various scaffold: template molar ratios and 1 positive control). The fluorescence under all conditions except the negative control indicates that the scaffold with a single template binding site can be inoculated with the template polynucleotide and support the clustering process. The bar graph is a quantitative measurement of the clustering results of the 8 conditions. The upper figure C1 intensity is the cycle 1 intensity as an indirect measure of cluster size or yield (intensity is proportional to cluster size or yield). The lower figure %PF is % through the filter, which is the percentage of nanopores that pass through the threshold filter, indicating the purity of the cluster formed therein (i.e., proportional to the number of nanopores with monoclonal clusters).

[0271] It should be understood that all combinations of the foregoing concepts and the additional concepts discussed in greater detail herein (assuming such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of the claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein and can be used to achieve the benefits and advantages described herein.

Claims

1. A nanoparticle, comprising: A scaffold comprising: i) a single template site selected from a covalent template binding site and a non-covalent template binding site for binding a template polynucleotide to the scaffold, and ii) a plurality of auxiliary sites selected from a covalent auxiliary oligonucleotide binding site and a non-covalent auxiliary oligonucleotide binding site for binding an auxiliary oligonucleotide to the scaffold, wherein The scaffold is a compound of formula I: Each X is a compound of formula II: Wherein R2 is selected from Formula IIIa: Where R 5 Selected from x is an integer in the range of 1-20,000, and y is an integer in the range of 1-100,000, and the ratio of x:y is 10:90 to 1:99, and wherein each R z independently H or C 1-4 Alkyl; and formula IIIb: Where R 5 Selected from y is an integer in the range of 1-2,000, and x and z are integers whose sum is in the range of 1-10,000, and the ratio of (x:y):z is (85):15 to (95):5, and wherein each R z independently H or C 1-4 alkyl, R1 comprises the single template site for binding the template polynucleotide to the scaffold, and R4 is selected from C1-C 20 Alkyl, C1-C 20 Alkenyl, C1-C 20 Alkynyl, C1-C 20 Oxyalkyl, C1-C 20 Thioalkyl and C1-C 20 Azaalkyl, and R 3 comprising said auxiliary site for binding to an auxiliary oligonucleotide; wherein the single template site comprises: i) a covalent template binding site selected from the group consisting of an amine-NHS ester binding site, an amine-imidate binding site, an amine-pentafluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, an aldehyde-NHS ester binding site, a hydroxyl-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a trans-cyclooctene-tetrazine binding site, a norbornene-tetrazine binding site; Binding site, azide-cyclooctyne binding site, azide-norbornene binding site, oxime binding site, SpyTag-SpyCatcher binding site, Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 - a benzylcytosine binding site and a sortase coupling binding site; or ii) a non-covalent template binding site comprising a polynucleotide hybridization site or a non-covalent peptide binding site selected from the group consisting of a coiled-coil binding site and an avidin-biotin binding site, and The plurality of auxiliary sites for binding the auxiliary oligonucleotide to the scaffold include: i) a covalent auxiliary oligonucleotide binding site, wherein the covalent auxiliary oligonucleotide binding site is selected from the group consisting of an amine-NHS ester binding site, an amine-imidate binding site, an amine-pentafluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, a hydroxyl-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a trans-cyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 - a benzylcytosine binding site, a sortase conjugate binding site, or any combination of two or more thereof; or ii) a non-covalent auxiliary oligonucleotide binding site, which comprises a polynucleotide hybridization site or a non-covalent peptide binding site, wherein the non-covalent peptide binding site is selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

2. The nanoparticle according to claim 1, wherein R4 is C1-C 20 The alkyl radicals are substituted with one or more of alkyl radicals, double bonded oxygen radicals and hydroxyl radicals.

3. The nanoparticle of claim 1, further comprising a single template polynucleotide bound to the single template site.

4. The nanoparticle of claim 1, further comprising a plurality of auxiliary oligonucleotides bound to the plurality of auxiliary sites.

5. The nanoparticle according to any one of claims 1 to 4, wherein the diameter of the nanoparticle is at least 10 nm.

6. A method for performing template polynucleotide binding in a sequencing method, the method comprising binding a single template polynucleotide to the single template site of the nanoparticle according to any one of claims 1 to 5.

7. A method for performing template polynucleotide binding in a sequencing method, the method comprising binding a plurality of auxiliary oligonucleotides to the plurality of auxiliary sites of the nanoparticle according to any one of claims 1 to 5.

8. The method of claim 6 or 7, further comprising synthesizing one or more scaffold-attached copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of both, wherein the scaffold-attached copies extend from the auxiliary oligonucleotide.

9. The method of claim 6 or 7, further comprising attaching the scaffold to a substrate, wherein attaching comprises hybridizing an auxiliary oligonucleotide to the oligonucleotide attached to the substrate.

10. The method of claim 9, wherein the substrate comprises a plurality of nanopores, and the oligonucleotides attached to the substrate are attached within the plurality of nanopores. The method of claim 10 , wherein no more than one scaffold is bound within any one of the nanopores.

12. The method of claim 9, further comprising synthesizing one or more substrate-attached copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of both, wherein the substrate-attached copies extend from an oligonucleotide attached to a substrate.

13. The method of claim 12, further comprising sequencing at least one of the scaffold-attached copies and the substrate-attached copies, wherein the sequencing comprises sequencing by synthesis.

14. A nanoparticle, comprising: A scaffold comprising: i) a single template site selected from a covalent template binding site and a non-covalent template binding site for binding a template polynucleotide to the scaffold, and ii) a plurality of auxiliary sites selected from a covalent auxiliary oligonucleotide binding site and a non-covalent auxiliary oligonucleotide binding site for binding an auxiliary oligonucleotide to the scaffold, wherein The scaffold is a compound of formula IV: Each X is a compound of formula V: Wherein R2 is selected from Formula VIa: And Formula VIb: wherein p is an integer selected from 1 to 20, and R5 comprises the auxiliary site for binding to the auxiliary oligonucleotide, R3 comprises the auxiliary site for binding to the auxiliary oligonucleotide and is selected from a direct bond, m is an integer from 1 to 20,000, and n is an integer from 1 to 100,000, R1 comprises the single template site for binding the template polynucleotide to the scaffold, and R4 is selected from C1-C 20 Alkyl, C1-C 20 Alkenyl, C1-C 20 Alkynyl, C1-C 20 Oxyalkyl, C1-C 20 Thioalkyl and C1-C 20 Azaalkyl; Wherein the single template site comprises: i) a covalent template binding site, wherein the covalent template binding site is selected from the group consisting of an amine-NHS ester binding site, an amine-imidate binding site, an amine-pentafluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, a hydroxyl-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a trans-cyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 - a benzylcytosine binding site and a sortase coupling binding site; or ii) a non-covalent template binding site comprising a polynucleotide hybridization site or a non-covalent peptide binding site selected from one or both of a coiled-coil binding site and an avidin-biotin binding site; and The plurality of auxiliary sites for binding the auxiliary oligonucleotide to the scaffold include: i) a covalent auxiliary oligonucleotide binding site, wherein the covalent auxiliary oligonucleotide binding site is selected from the group consisting of an amine-NHS ester binding site, an amine-imidate binding site, an amine-pentafluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, a hydroxyl-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a trans-cyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a Snap-Tag-O 6 -Benzylguanine binding site, CLIP-tag-O 2 - a benzylcytosine binding site, a sortase conjugate binding site, or any combination of two or more thereof; or ii) a non-covalent auxiliary oligonucleotide binding site, which comprises a polynucleotide hybridization site or a non-covalent peptide binding site, wherein the non-covalent peptide binding site is selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

15. The nanoparticle according to claim 14, wherein R4 is C1-C 20 The alkyl radicals are substituted with one or more of alkyl radicals, double bonded oxygen radicals and hydroxyl radicals.

16. The nanoparticle of claim 14, further comprising a single template polynucleotide bound to the single template site.

17. The nanoparticle of claim 14, further comprising a plurality of auxiliary oligonucleotides bound to the plurality of auxiliary sites.

18. The nanoparticle according to any one of claims 14 to 17, wherein the nanoparticle has a diameter of at least 10 nm.

19. A method for performing template polynucleotide binding in a sequencing method, the method comprising binding a single template polynucleotide to the single template site of the nanoparticle according to any one of claims 14 to 18.

20. A method for performing template polynucleotide binding in a sequencing method, the method comprising binding a plurality of auxiliary oligonucleotides to the plurality of auxiliary sites of the nanoparticle according to any one of claims 14 to 18.

21. The method of claim 19 or 20, further comprising synthesizing one or more scaffold-attached copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of both, wherein the scaffold-attached copies extend from the auxiliary oligonucleotide.

22. The method of claim 19 or 20, further comprising attaching the scaffold to a substrate, wherein attaching comprises hybridizing an auxiliary oligonucleotide to an oligonucleotide attached to the substrate.

23. The method of claim 22, wherein the substrate comprises a plurality of nanopores, and the oligonucleotides attached to the substrate are attached within the plurality of nanopores.

24. The method of claim 23, wherein no more than one scaffold is bound within any one of the nanopores.

25. The method of claim 22, further comprising synthesizing one or more substrate-attached copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and a copy of both, wherein the substrate-attached copies extend from an oligonucleotide attached to a substrate.

26. The method of claim 25, further comprising sequencing at least one of the scaffold-attached copies and the substrate-attached copies, wherein the sequencing comprises sequencing by synthesis.

Images