Nucleic acid delivery vector comprising a circular single-stranded polynucleotide

Abstract

The present invention relates to a delivery vector for delivering single-stranded nucleic acids. The vector is a closed circular polynucleotide comprising at least three parts, wherein two parts have sufficient complementarity to form a duplex, and an intervening sequence containing the single-stranded nucleic acid to be delivered. The duplex contains a recognition sequence for a targeted nuclease such that the single-stranded nucleic acid is released under appropriate conditions.

Description

Field of the Invention

[0001] The present invention relates to the intracellular delivery or release of single-stranded nucleic acids, in particular single-stranded donor oligonucleotides.While any type of nucleic acid is contemplated herein, single-stranded deoxyribonucleic acid (DNA) may be preferred. Background of the Invention

[0003] The most flexible nucleic acid regions are generally non-base-paired and include regions of single-stranded deoxyribonucleic acid (ssDNA) and ribonucleic acid (ssRNA) involved in vital processes within cells.

[0004] For example, single-stranded nucleic acid molecules are of particular interest to those skilled in the art of delivering nucleic acids to cells, because the nucleic acid is immediately available within the transfected cell and does not need to be "unfolded" by appropriate enzymes to expose the ssDNA portions. These portions can then be used for transcription into ssRNA, such as messenger RNA (mRNA), or for interaction with other proteins that recognize ssDNA.

[0005] Single-stranded DNA (ssDNA) is an essential intermediate in many biological processes, including DNA replication, recombination, repair, transcription and transposition. Therefore, it is also desirable to introduce ssDNA into cells in order to utilize these mechanisms and the like to produce therapeutic effects. ssDNA can also have many therapeutic uses. In eukaryotic cells, ssDNA is often exposed due to many cellular processes (including replication, transcription and recombination). Exposed ssDNA is susceptible to chemical attack and nucleic acid degradation; therefore, it must be properly protected to avoid mutations. Single-stranded DNA binding proteins (SSBs) immediately bind to ssDNA to protect it from inappropriate reactions until the relevant processes are completed. However, ssDNA that is not so protected is susceptible to chemical attack and nucleic acid degradation.

[0006] Single-stranded nucleic acid molecules are of particular interest to those skilled in the art of delivering nucleic acids to cells because the nucleic acids are immediately available within the transfected cells and do not need to be "unfolded" by suitable enzymes to expose the relevant genetic information (e.g., for transcription and translation or insertion into the genome). They are considered to be optimal delivery vectors for a variety of applications, especially gene transfer, gene editing, and biosensing.

[0007] Alternatively, the single-stranded nucleic acid may have a function related to its conformation, ie, act as an aptamer or a nucleic acid enzyme (including DNAzyme and RNAzyme).

[0008] Furthermore, in antisense applications it may be desirable to provide single-stranded nucleic acids in cells.Antisense therapy involves the use of oligonucleotides having a specific sequence that is complementary to a target sequence such as messenger RNA (mRNA).

[0009] Furthermore, for translation purposes, it may be necessary to provide a single-stranded nucleic acid in the cell, i.e., to provide mRNA to directly guide protein production in the cell. Therefore, the single-stranded nucleic acid can be RNA, particularly mRNA. Other types of RNA can also be delivered using the vector, including long non-coding RNA (lncRNA), microRNA (miRNA), Piwi-interacting RNA (piRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), trans-acting siRNA (tasiRNA), repeat-associated siRNA, enhancer RNA, antisense RNA, guide RNA, small nucleolar RNA, or small nuclear RNA.

[0010] Both ssDNA and dsDNA donor sequences can serve as effective gene editing templates. It has been found that ssDNA donor templates have unique advantages in terms of repair specificity when used for gene editing (design and specificity of long ssDNA donors for knock-in based on CRISPR; Han Li, Kyle A. Beckman, Veronica Pessino, Bo Huang, Jonathan S. Weissman, Manuel D. Leonetti bioRxiv 178905), and therefore their use is desirable.

[0011] While providing single-stranded nucleic acids to cells is desirable, this approach may have some drawbacks. The efficacy of nucleic acid therapeutics may be limited by unwanted degradation. Chemical modifications are known to improve nucleic acid stability, but the type, location, and amount of modification can have an impact, and in some cases it may be desirable to minimize the number of modifications because their use can affect the nucleic acid's ability to bind to proteins.

[0012] By their very nature, single-stranded nucleic acids degrade rapidly within cells because the free 3' and 5' ends are available for enzymatic degradation, for example by the action of nucleases, which "chew back" the ends and destroy the nucleic acid. For example, Trex1, the major 3' to 5' DNA exonuclease in mammalian cells, preferentially acts on single-stranded DNA (ssDNA) and binds tightly to it. Mutations in the human TREX1 gene can lead to Aicardi-Goutières syndrome, which is characterized by immune disorders. Modification of the nucleotides at the 3' end has been shown to help resist such degradation.

[0013] For many years, cytosolic DNA has been thought to have immunostimulatory effects, particularly on the innate immune system. DNA is typically found in the nucleus of eukaryotic cells, and the presence of DNA in non-canonical locations, including the cytoplasm and endosomes, was thought to trigger immune activation. The presence of DNA anywhere other than the nucleus was thought to trigger DNA recognition systems to detect invading pathogens and malfunctioning cell DNA genomes.

[0014] Unmethylated CpG DNA motifs, abundant in the genomes of many pathogens, are known to stimulate immune responses. Single-stranded DNA with specific signatures, including AT-rich stem-loop regions, is also known to activate immune responses.

[0015] Therefore, it is desirable to deliver single-stranded nucleic acids in a "covert" manner, that is, to deliver linear single-stranded nucleic acids in a carrier that is not easily recognized by the innate immune system and then release the linear single-stranded nucleic acids inside the cell.

[0016] The present inventors have designed a delivery vector that enables the release of single-stranded nucleic acids under appropriate conditions, such as in the nucleus or other compartments of target cells. Single-stranded nucleic acids can be delivered for any possible purpose where linear single-stranded nucleic acids are needed, such as as donors for gene editing, for intracellular translation, for modifying gene expression, for providing entities such as aptamers and enzymes that are nucleic acids, or for antisense applications. Summary of the Invention

[0017] The present invention relates to a delivery vector for delivering linear single-stranded nucleic acids to cells, preferably target cells. A delivery vector is essentially a carrier or delivery vehicle in which the single-stranded nucleic acid is placed. Intracellular processes can exploit the structure of the delivery vehicle and release the single-stranded nucleic acid. The construct can be manipulated or designed so that the release of the single-stranded nucleic acid occurs only under specific conditions or specific cell types.

[0018] The provision of delivery vehicles for linear single-stranded nucleic acids allows for the covert delivery of entities that would otherwise be rapidly degraded. Delivery can be controlled or directed.

[0019] According to one aspect, the present invention provides:

[0020] A nucleic acid delivery vector comprising a circular single-stranded polynucleotide, the vector comprising:

[0021] (a) a duplex formed by the first portion and the third portion of the polynucleotide, the portions comprising complementary sequences;

[0022] (b) a loop formed by a second portion, said portion separating said first and third portions;

[0023] wherein the duplex comprises a recognition sequence for a targeting nuclease.

[0024] The nucleic acid delivery vector is described as a single-stranded polynucleotide because under denaturing conditions, the delivery vector is a closed circular polynucleotide.

[0025] The delivery vector preferably delivers a linear single-stranded nucleic acid. The single-stranded nucleic acid is present in the second part of the delivery vector, and therefore the sequence of the second part and the linear single-stranded nucleic acid are substantially the same. The linear single-stranded nucleic acid can adopt any suitable conformation and have any suitable sequence. The linear single-stranded nucleic acid can be an enzyme, an aptamer, a donor template or an antisense nucleic acid for a nucleic acid, or any single-stranded nucleic acid discussed herein. Once released from the delivery vector, the linear single-stranded nucleic acid has free 5' and 3' ends. Depending on the nature of the nuclease, the single-stranded nucleic acid can be released while the fragments of the first and third parts are still present. This is the case with nucleases such as Cas9, and is depicted in Figure 1A and 1B The length of these fragments may be small, preferably less than 15 bases.

[0026] Targeted nuclease can be any nuclease of target specificity. The duplex of the delivery vector comprises a recognition site for the targeted nuclease. The nuclease can recognize this sequence independently, or it may need the help of a guide sequence. The effect of the nuclease on the recognition site is to cut the duplex or at least one chain thereof. The cutting can be a blunt cleavage or a staggered cut. The nuclease can be endogenous or exogenous, and if the latter, it is also provided to the cell. The nuclease can be delivered to the cell alone, or it can be delivered by including the mRNA sequence or DNA gene sequence of the nuclease in the delivery vehicle. If the latter delivery vector is provided, it actually provides its own nuclease to release single-stranded nucleic acid. The nuclease is preferably an endonuclease. The nuclease can be any entity that can appropriately cut a phosphodiester bond in a sequence-specific manner.

[0027] Delivery vectors can be used in cells. Delivery vectors can be used to provide donor templates for genome editing. Delivery vectors can be used to deliver antisense nucleic acids to cells. Delivery vectors can be used to deliver enzymes or aptamers that are nucleic acids to cells. Delivery vectors can be used to deliver any single-stranded RNA or nucleic acid hybrid to cells.

[0028] As used herein, the cell may be a mammalian cell, preferably a human cell, and preferably a human somatic cell.

[0029] According to another aspect, the present invention provides a method of providing a linear single-stranded nucleic acid to a cell, comprising using a delivery vector as described herein.

[0030] According to another aspect, the present invention provides a method of providing a linear single-stranded donor oligonucleotide or template to a cell for genome editing, comprising using a delivery vector as described herein.

[0031] The delivery vectors of the present invention are introduced into cells by using any of the methods described herein.The delivery vectors can be transfected by any suitable means, including chemical, physical, or viral means. DETAILED DESCRIPTION

[0032] The construct of the present invention is a closed circular polynucleotide comprising a single strand. The sequence of the construct is designed so that it can be divided into at least three parts, although the boundaries of these parts can be variable and vary according to the cleavage site of the nuclease. The construct is preferably a delivery vector, intended for use in delivering linear single-stranded nucleic acids. The first and third parts include some complementarity so that under appropriate or physiological conditions, these parts can base pair and form a duplex or stem structure. This duplex is the result of self-complementary sequences within the polynucleotide. The second part is between the first and third parts and includes the sequence of the linear single-stranded nucleic acid for delivery. This second part, because it is located between the two complementary sequences, will generally form a "loop" of nucleic acid, which begins and ends at the first and third parts forming the duplex. It is usually represented as a single strand because it will not intentionally include regions complementary to other sequences within the polynucleotide so that the delivery vector works as intended. However, it is well known that single-stranded nucleic acids have some secondary structures, and therefore this second part can be in any possible conformation, including one or more of a hairpin, a loop, and a pseudoknot, including parts of linear nucleic acids. As used herein, a "loop" can also be considered to be a polynucleotide portion that is not designed to form a duplex portion of a delivery vector, but this does not prevent it from self-annealing. If homology arms are present, these arms may be able to self-anneal into further duplexes. The loop is actually a "single-stranded" sequence for delivery that is captured by the duplex portion and can be processed to release the single strand. Although the term "loop" is used, it is clear that larger loops (e.g., 6 nucleotides and above) may have their own secondary structure.

[0033] For simplicity, the delivery vector is shown in the figure as a closed circular polynucleotide comprising a duplex portion and a looped out single stranded portion. Those skilled in the art will appreciate that this structure is completely simplified and that the looped out portion may include one or more secondary structures. Figure 1AA delivery vector is described, wherein the duplex is a stem, and the remaining polynucleotides are looped out from one end of the stem. The "single strand" or second portion of the delivery vector is therefore captured by the duplex or held in place by the duplex, and the duplex is formed by the first and third portions. It should be understood that although there is a loop formed between the duplexes due to the presence of the second portion of the delivery vector, the loop may have its own secondary structure and therefore will not be displayed as a single-stranded loop when inspected. The sequence of the loop (and therefore the second portion) can preferably be designed to have very little (if any) complementarity with the first and third portions of the polynucleotides. Polynucleotides are polymers, and their molecules comprise many nucleotide units. Polynucleotides (delivery vectors) can be any suitable length, for example, from 50 or 100 residues / nucleotides / bases to 10,000 residues / nucleotides / bases. Thus, a polynucleotide can be 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 residues / nucleotides / bases. A polynucleotide can be up to 10,000, 9,000, 8,000, 7,000, 6,000, 5,000, 4,000, 3,000, 2,000, or 1,000 residues / nucleotides / bases. A polynucleotide can be any number of residues / nucleotides / bases between these values.

[0034] The duplex portion can be any suitable length to accommodate the recognition sequence of the nuclease. As a minimum, the length of the duplex can be at least 4 base pairs, but as a minimum, the length of the duplex can be 5, 6, 7, 8, 9 or 10 base pairs. The duplex may indeed be longer, and in some cases may be up to 100, 250, 500, 750 or 1000 base pairs. Portions of complementary sequence can surround the nuclease recognition sequence in the duplex to help form the duplex.

[0035] Polynucleotide can comprise any nucleotide.These nucleotides can be natural, modified or artificial.Nucleotide can polymerize to form RNA, DNA, locked nucleic acid (LNA), peptide nucleic acid (PNA), morpholino nucleic acid, glycol nucleic acid (GNA), threose nucleic acid (TNA), their hybrid and mixture and any other artificial (non-natural (xeno)) nucleic acid.It may be preferred that polynucleotide is DNA or its modified form (i.e., having modification in backbone, sugar residue or core base).If modification is used, then these modifications will make not impair required binding or activity.Those skilled in the art know how to use standard assay to determine whether modification affects binding capacity or activity.

[0036] The polynucleotide is circular or continuous. Thus, there are no free 3' or 5' ends in the polynucleotide.

[0037] A polynucleotide comprises a sequence of single-stranded linear nucleic acid that one wishes to deliver to a cell.

[0038] Polynucleotides are actually delivery vehicles or vectors for linear single-stranded nucleic acids with free 3' and 5' ends. Such linear single-stranded nucleic acids can have any suitable length and any sequence. Because single-stranded nucleic acids tend to form secondary structures, although single-stranded nucleic acids are described as long chains of nucleotides, self-complementary regions are likely to anneal, thereby generating secondary structures such as hairpins, stems, loops, pseudoknots, and cruciforms.

[0039] The linear single-stranded nucleic acid used for delivery can be used for any intended purpose.

[0040] Thus, a linear single-stranded nucleic acid can be an antisense molecule, which is designed to have a sequence that base pairs with a complementary RNA strand to prevent the RNA strand from functioning in the usual way, such as being translated into protein if the RNA is messenger RNA (mRNA).

[0041] The linear single-stranded nucleic acid can be an RNA that has a function in the cell, such as mRNA, long noncoding RNA (lncRNA), microRNA (miRNA), Piwi-interacting RNA (piRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), trans-acting siRNA (tasiRNA), repeat-associated siRNA, enhancer RNA, antisense RNA, guide RNA, small nucleolar RNA or small nuclear RNA.

[0042] The linear single-stranded nucleic acid may contain sequences that form secondary structures that have functions such as enzymes or aptamers for nucleic acids.

[0043] Linear single-stranded nucleic acids can be donor templates for genome editing. This will be described in more detail below.

[0044] The linear single-stranded nucleic acid is part of the polynucleotide referred to herein as the "second portion." It is effectively confined within the delivery vehicle until conditions allow for release of the nucleic acid.

[0045] The sequence of a polynucleotide can be designed to comprise the first, second and third parts as described herein. The sequence or order of nucleotides can be designed so that there are self-complementary sequences that enable duplex formation. These self-complementary sequences are obviously on the same polynucleotide chain, and therefore base pairing is possible only when the part is aligned with one part in the 5' to 3' direction and another part in the 3' to 5' direction. It will be understood by those skilled in the art that this occurs naturally in single-stranded polynucleotide molecules.

[0046] Complementarity is achieved by different interactions between the following nucleobases: adenine (A), thymine (T) (uracil (U) in RNA), guanine (G) and cytosine (C). When referring to complementary sequences, etc., this refers to the nucleotide base pairing interactions of one nucleic acid sequence with another nucleic acid sequence, resulting in the formation of a duplex, triplex or other higher order structure. The main interactions are usually nucleotide base specific, such as A:T, A:U and G:C, through Watson-Crick and Hoogsteen type hydrogen bonds. In certain embodiments, base stacking and hydrophobic interactions may also contribute to duplex stability. The conditions for annealing of the parts to complementary or substantially complementary parts are well known in the art and are described, for example, in Nucleic Acid Hybridization, A Practical Approach, Hames and Higgins, eds., IRL Press, Washington, DC (1985) and Wetmur and Davidson, Mol.Biol.31:349, 1968. Generally, whether such annealing occurs or combines is influenced by the following factors, among other factors: the length of the portion and its complementary portion, pH, temperature, the presence of monovalent and divalent cations, the ratio of G and C nucleotides in the sequence, the viscosity of the medium, and the presence of denaturing agents. These variables affect the time required for base pairing or annealing. Therefore, preferred conditions will depend on specific applications. However, such conditions can be routinely determined by those of ordinary skill in the art without excessive experimentation. Generally, conditions are selected to allow complementary or substantially complementary portions to selectively bind or anneal with their corresponding portions, but not to any significant degree with other sequences in the polynucleotide. Therefore, suitable conditions are selected to enable the self-complementary sequences present in the first and third portions to anneal and form duplexes. Ideally, other sequences that can anneal with any one of these portions are not included in the polynucleotide to avoid undesirable duplex formation.

[0047] The sequences of the first and third portions of the polynucleotide are designed or generated so that they form a duplex under the appropriate conditions described above. For use in human or animal therapy, duplexes will form under physiological conditions. Those skilled in the art will be able to define what physiological conditions are. These are generally external or internal environmental conditions that would occur in nature for the organism or cell system, as opposed to artificial laboratory conditions. A temperature range of 20-40 degrees Celsius, 1 atmosphere of pressure, a pH of 6-8, a glucose concentration of 1-20 mM, atmospheric oxygen concentration, Earth's gravity, and electromagnetism are examples of physiological conditions for most terrestrial organisms.

[0048] The stability of the duplex is determined by its length, the number of mismatches or bulges it contains (a small number may be tolerable, especially in long duplexes), and the base composition of the two regions. The pairing between guanine and cytosine has three hydrogen bonds and is more stable than the adenine-thymine / uracil pairing, which has only two hydrogen bonds. Base stacking interactions align the π bonds of the aromatic rings of the bases in a favorable orientation, also promoting duplex formation.

[0049] Duplex is an important processing site of delivery vector.Duplex provides the part of " double-stranded " nucleic acid, and the secondary structure of the polynucleotide remainder forming delivery vector is more variable.This duplex, shown as stem in the figures, it can be any secondary structure equally, comprise hairpin (wherein first and third part is therefore continuous), stem-loop (wherein fourth part is between first and third part) or even more complex structure such as pseudoknot or cruciform part.All relevant to the present invention are there is duplex.

[0050] The sequence of the duplex is designed or generated so that the duplex contains a recognition sequence for a targeted nuclease, preferably an endonuclease. In other words, the duplex provides a site that can be targeted and cut by an appropriate entity. Therefore, the duplex not only provides a way to capture or restrict linear single-stranded nucleic acids for delivery, but also provides a way to release or deliver the linear single-stranded nucleic acid as appropriate. Therefore, the duplex contains a target sequence (also referred to as a recognition sequence) and a cleavage site designed to allow the release of the linear single-stranded nucleic acid.

[0051] The cleavage site may allow for flush cleavage of the duplex, or staggered cleavage of the duplex to have strand overhangs. The cleavage site may allow for only one strand to be cleaved. Preferably, both strands are cleaved. The cleavage of the duplex will be determined by the type of nuclease used. It will be understood by those skilled in the art that, depending on the nature of the cleavage site, fragments of the duplex may remain present at the 3' and 5' ends of the single-stranded nucleic acid molecule. In practice, such fragments may be present at the ends of the cleavage site. Figure 1A and 1B Such fragments may be advantageous because they provide an immediate "buffer" portion that can be degraded by nucleases in the cell.

[0052] The recognition sequence of the targeting nuclease can be any desired sequence, depending on the targeting nuclease.

[0053] Targeting nucleases are nucleases that recognize specific sequences, such as endonucleases (enzymes that cleave phosphodiester bonds within polynucleotide chains). This recognition is either intrinsic (i.e., they themselves recognize a specific target or recognition sequence), or this recognition is guided by a separate entity (e.g., a guide nucleic acid). The recognition sequences of intrinsic or guide nucleases can be used in the delivery vectors of the present invention.

[0054] Nucleases may have an inherent ability to recognize specific sequences; the specific sequences are referred to herein as recognition sequences. In some embodiments, the recognition sequence will be a palindromic sequence of approximately four to six nucleotides in length. Most nucleases cut the duplex unevenly, leaving complementary single-stranded ends. There are hundreds of known nucleases, each using a different recognition sequence. Nucleases are divided into three categories based on their mechanism of action: Type I, Type II, and Type III. One skilled in the art will be able to identify the appropriate nuclease and the appropriate recognition sequence that needs to be included in the duplex to allow specific cutting to occur.

[0055] Targeted nucleases or programmable site-specific nucleases include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and meganucleases (MNs). Targeting these nucleases to specific sequences requires protein engineering, but those skilled in the art will understand the requirements of protein engineering in order to generate nucleases to recognize and cut specific sequences. Such nucleases are used for gene editing.

[0056] Nucleases can also be guided to a recognition sequence. In this case, the "guide" can be any suitable nucleic acid molecule or derivative thereof, such as DNA or RNA or a hybrid thereof. Thus, the nuclease can be an RNA-guided nuclease or a DNA-guided nuclease. As technology develops, it is likely that nucleases can also be guided by artificial nucleic acid molecules. Thus, in this embodiment, the recognition sequence is complementary or substantially complementary to the guide nucleic acid, which recruits the nuclease to the correct site of action.

[0057] Alternatively, the delivery vector itself can provide one or more self-cleaving nucleases or other entities capable of cleaving within the duplex in a sequence-specific manner.

[0058] Currently, the best-known guide nuclease is Cas9 (CRISPR-associated protein 9). Cas9 is an RNA-guided DNA nuclease associated with the CRISPR (clustered regularly interspaced short palindromic repeats) adaptive immune system in Streptococcus pyogenes. As used in nature, Cas9 interrogates and cleaves foreign DNA, such as DNA from invading phages or bacterial plasmids. Cas9 performs this interrogation by checking for sites that are complementary to a 20-base pair spacer of the guide RNA. If the DNA substrate is complementary to the guide RNA, Cas9 cleaves the invading DNA. Cas9 has attracted great interest in recent years because it can cleave almost any sequence that is complementary to the guide RNA. Because Cas9's targeting specificity derives from guide RNA:DNA complementarity, engineering Cas9 to target new DNA is straightforward, simply by designing an appropriate guide. Cas9's programmable sequence specificity has been used for genome editing and gene expression control in many organisms. Natural Cas9 requires a guide RNA that contains two different RNAs that associate: CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA). However, Cas9 targeting has been simplified by engineering chimeric single guide RNA (sgRNA) or hybrid DNA / RNA guides. The Cas9 protein remains inactive without a guide RNA. In engineered CRISPR systems, the guide sequence contains single-stranded RNA or RNA / DNA that can form a T-shape containing a tetraloop and two or three stem loops. The guide sequence is engineered to have a 5' end that is complementary to the target DNA sequence, which is typically about 20 bases in length. For Cas9, guide sequences have been shown to work in the range of 17 to 24 bases in length.

[0059] The guide RNA or RNA / DNA binds to the complementary target DNA. Directly adjacent to the target DNA sequence is a protospacer adjacent motif (PAM), which is a DNA sequence of 2-6 base pairs that follows the DNA sequence targeted by the Cas9 nuclease. It is generally believed that if the target DNA sequence is not followed by a PAM sequence, Cas9 will not be able to successfully bind to or cut the target DNA sequence. A typical PAM is the sequence 5'-NGG-3', where "N" is any nucleobase, followed by two guanine ("G") nucleobases, and this binds to the Cas9 nuclease from Streptococcus pyogenes (SpCas9), while different PAMs bind to Cas9 homologous gene sequences from other bacteria. Combine5'-NGA-3' may be an efficient atypical PAM for use in human cells. Attempts have been made to engineer Cas9 to recognize different PAMs, and thus only the engineered Cas9 needs to be matched to the relevant PAM.

[0060] Therefore, when designing duplexes for targeting by Cas9 or similar nucleases, consideration needs to be given to including the target sequence and, if the target is DNA, the PAM sequence in order to provide viable recognition and cleavage sites.

[0061] Cas9 is subjected to modification and mutagenesis, and engineered Cas9 variants can be obtained. The definition of variants is included below.

[0062] Efforts to identify other guide nucleases, particularly those that can be used in CRISPR systems, are ongoing.

[0063] Some have already been identified. These include:

[0064] Cas12a: Clustered Regularly Interspaced Short Palindromic Repeats or CRISPR / Cpf1 from Prevotella and Francisella 1 (also known as Cas12a): Cpf1 is an RNA-guided nuclease of the class II CRISPR / Cas system. The Cpf1 gene is associated with the CRISPR locus and encodes a nuclease that uses a guide RNA to find and cleave viral DNA. Cpf1 is a smaller and simpler nuclease than Cas9, which overcomes some of the limitations of the CRISPR / Cas9 system. This enzyme can recognize T-rich PAMs and produce staggered double-stranded DNA cuts with 5' overhangs.

[0065] Cas13a (from the bacterium Leptotrichia shahii) is an RNA-guided enzyme system that targets RNA rather than DNA, but does not appear to require a PAM; instead, the protospacer flanking site (PFS) may be relevant.

[0066] Therefore, the duplex formed in the polynucleotide comprises the recognition sequence of the targeting nuclease.The recognition sequence can be designed to match the recognition sequence of the nuclease that can inherently (that is, by itself) recognize the sequence, or match the guide sequence of the guide nuclease.Due to in the latter case, the guide sequence can also be designed by a skilled user, which provides maximum flexibility for selecting the sequence to ensure that the sequence is uncommon or does not exist in the genome of the cell of interest such as the cell undergoing editing.If a guide nuclease is used, the recognition sequence of the targeting nuclease may also need to include PAM or PFS as the case may be.

[0067] The delivery vectors of the present invention can be used in genome editing methods, or gene editing in cells, particularly eukaryotic cells, especially mammalian cells, including human cells.

[0068] The delivery vectors of the present invention can be used to deliver single-stranded nucleic acids to cells, particularly eukaryotic cells, especially mammalian cells, including human cells.

[0069] If it is necessary to perform genome or gene editing on a cell, those skilled in the art will understand that several elements must be provided to the cell. The first is a sequence-specific nuclease to introduce a double-strand break (DSB) at a predetermined point in the DNA. The genome or gene editing then uses the cell's mechanisms to repair the break, primarily by providing the cell with exogenous donor nucleic acids for repairing the DSB. Thus, a mechanism for introducing a cleavage site is introduced, as well as the donor sequence required to repair it.

[0070] Homology-directed repair (HDR) is a homologous recombination process in which a template is used to provide the homology required for precise repair of double-strand breaks (DSBs). It is one of the natural mechanisms used for genome or gene editing.

[0071] Currently, exogenous repair (or donor) templates can be delivered to cells, most commonly in the form of synthetic single-stranded DNA donor oligonucleotides or DNA donor plasmids. However, as mentioned above, there are problems with delivering single-stranded nucleic acids into cells. There is also the problem that single-stranded nucleic acids may be delivered off-target to other cells where genome or gene editing is not desired.

[0072] The delivery vector of the present invention has significant advantages compared with the use of single-stranded linear donor templates. The delivery vector can be designed so that the same nuclease targeting genome and delivery vector are used, thereby providing a two-step system to ensure that the single-stranded template is released only in cells containing the correct genome or gene editing mechanism. Therefore, if the delivery vector is used to deliver the single-stranded nucleic acid donor template, it can utilize the same technology to release the donor template for use, and introduce DSB into the genome required for editing, thereby piggybacking on the system that has been delivered to the target cell.

[0073] Genome editing can be done in any part of the genome. The term "genome" generally refers to the entire DNA sequence of an organism. The genome contains genes: a nucleotide sequence in DNA or RNA that encodes a molecule with a function. The genome also contains regions of DNA that promote or inhibit gene activity, as well as regions that do not appear to affect protein production or function. Any one or more of these can be edited as needed. Gene editing is likely to be a major use case, as directly editing genes may have therapeutic implications for many diseases and conditions.

[0074] If the delivery vector is used for genome editing, the second part of the polynucleotide is a sequence suitable for use as a nucleic acid donor template. RNA or DNA templates are possible, but DNA is currently more preferred. Therefore, the polynucleotide is preferably DNA. If the single-stranded donor template needs to use HDR for gene editing, homology arms are generally included in the donor template. HDR relies on the presence of a donor template with sufficient homology to the cleavage site flanking regions, which are homology arms.

[0075] The important parameters to be considered for successful genome editing include homology arm length and homology arm symmetry. It is generally believed that using current technology, homology arm lengths of 30, 40 and 50 nucleotides have the best efficiency, while longer lengths such as 50 or 60 nucleotides have lower efficiency. Whether the homology arms should be symmetrical (i.e., the same length) depends on the properties of the donor template. For unmodified single-stranded donor templates, asymmetric homology arms have better efficiency, but if phosphorothioate modification is performed, symmetric homology arms seem to be more effective. Those skilled in the art of genome editing know that these parameters are optimized for the specific environment in which they operate.

[0076] Therefore, the second part of the polynucleotide can include sequences designated as homology arms, which are located on the flanks of the insertion sequence. For single nucleotide substitutions, the insertion sequence can be a single nucleotide. The insertion sequence can be a non-coding region of an entire gene or genome, and can be hundreds of nucleotides in length. Since the donor template is delivered by a delivery vector, more nucleotides can be included in the insertion sequence than previously achieved with a single-stranded donor template. Therefore, the length of the insertion sequence can be 0 nucleotides to 1000 nucleotides. If the insertion sequence is 0, this can be used to knock out a single nucleotide or a larger sequence in the target genome.

[0077] It has been shown that using a single-stranded donor template for HDR is more effective than using other types of donor templates. Such templates can be delivered to cells to insert or change short sequences (SNPs, amino acid substitutions, epitope tags, etc.) of DNA in the endogenous genomic target region. The benefit of using a synthetic donor template is that cloning is not required to generate the donor template, and modifications can be added during synthesis for different applications, such as increasing resistance to nucleases. The donor template does not necessarily include nucleotides for insertion. On the contrary, in this embodiment, genes or nucleotides are removed from the genome. The insertion sequence can be any desired sequence, ranging from a single nucleotide correcting a SNP to the entire sequence of a gene or genomic region. Since the insertion sequence is completely synthetic, this allows the sequence to be changed to achieve functional changes if necessary. Therefore, the insertion sequence can be any desired sequence required for genome editing. Those skilled in the art of genome editing will understand that targeted nucleases are not endogenous for potential target cells, and therefore must be provided to cells in any appropriate manner (hereditarily or directly) together with any relevant guide sequence. The delivery vector of the present invention can be provided to cells simultaneously or separately. Any suitable transfection technique can be used. The cells used for transfection can be isolated or ex vivo for re-implantation into an organism, or the cells used for transfection can be in vivo. The nuclease and any guide sequence can be provided on the same vector or on different vectors. The vector can be any suitable nucleic acid, including a plasmid. Possible transfection routes include lipofection, electroporation, nucleofection, microinjection, or the use of viruses. The route used will depend on the cells selected for transfection and the nature of the vector used to express the nuclease and any guide sequence.

[0078] The delivery vectors of the present invention can be used to provide antisense single-stranded nucleic acids to cells.

[0079] The delivery vector of the present invention can be used to provide enzymes or aptamers as nucleic acids to cells.

[0080] In the case where the delivery vector is not used for genome editing, the duplex sequence can be designed with a recognition sequence for an endogenous nuclease so that only the delivery vector of the invention needs to be provided to the cell. In other embodiments, the nuclease is provided to the cell as discussed above with respect to genome editing.

[0081] The delivery vectors of the present invention can be provided to any cell, including cell lines, primary cells, stem cells, and the like. Somatic cells are preferred. The cells can be derived from any organism. The delivery vectors can be transfected by any suitable means, including electroporation, lipofection, nucleofection, or microinjection. Viral gene delivery methods are also contemplated. Cells can be transfected ex vivo, in vitro, or in vivo.

[0082] The delivery vector and thus the polynucleotide are preferably synthetic molecules and are therefore produced in a cell-free manner. Many techniques for synthesizing long single-stranded nucleic acids of specific sequences are known, including enzymatic amplification of template nucleic acids, de novo synthesis, use of overlapping templates, rolling circle amplification, etc. Strand stripping of double-stranded polynucleotides may be necessary for techniques such as PCR that result in the production of duplexes.

[0083] Once a long single-stranded polynucleotide is obtained as desired, a single-stranded ligase can be used to seal the ends. This results in the production of a single-stranded circular polynucleotide. Examples of suitable ligases include CircLigase from Epicentre, USA. TM Chemical cyclization reactions can also be used. In the latter technique, cyclic oligonucleotides containing a single triazole, amide, or phosphoramidate analog of a nucleic acid backbone are used. Thus, a linear precursor can include, for example, a 5' azide and a 3'-alkyne, and a chemically included 1,4-triazole bond, resulting in a cyclic polynucleotide.

[0084] During the preparation of the delivery vector, it may be necessary to use a solid support when isolating single-stranded polynucleotides or to help anneal free ends during cyclization. Binding affinity pairs such as biotin-streptavidin can be used with commercially available supports, such as on beads. For example, the polynucleotide can be biotinylated and the streptavidin present on the beads.

[0085] Those skilled in the art will appreciate that there are a variety of synthetic techniques that can be used to synthesize a polynucleotide having a desired sequence.

[0086] Variant peptide:

[0087] Variant polypeptide comprises following sequence (or is made up of following sequence): there is a sequence of at least 40% homology with native protein.Variant sequence is at least 20, preferably at least 30, for example at least 40,60,100,200,300,400 or more continuous amino acids, or even can be at least 55%, 65%, 70%, 75%, 80%, 85%, 90% and more preferably at least 95%, 97% or 99% homology with the specific region of native protein on the whole sequence of variant.Or, variant sequence can be at least 55%, 65%, 70%, 75%, 80%, 85%, 90% and more preferably at least 95%, 97% or 99% homology with full-length native protein.Usually, variant sequence differs at least or is less than 2,5,10,20,40,50 or 60 sudden changes (each sudden change can be replacement, insertion or deletion) with the relevant region of native protein. Variant sequences used in the methods of the present invention comprise sequences that are at least 80% identical to the native protein.

[0088] Variants of native proteins also include truncations. Any truncation can be used, as long as the variant is still able to cut the target sequence as described above. Truncation is usually performed to remove sequences that are not essential for catalytic activity and / or do not affect the conformation of the folded protein, particularly the folding of the active site. Truncation can also be selected to improve the solubility of the nuclease polypeptide. Appropriate truncation can usually be identified by systematically truncating sequences of varying lengths starting from the N- or C-terminus.

[0089] The variant of native protein further includes mutant, and it has one or more, for example 2,3,4,5 to 10,10 to 20,20 to 40 or more amino acid insertions, replacements or disappearances relative to the specific region of native protein. Disappearance and insertion are preferably carried out outside the catalytic domain. Insertion is usually carried out at the N-or C-terminus of the sequence derived from the native protein, for example, for the purpose of recombinant expression. Replacement is also usually carried out in the region that is not necessary for catalytic activity and / or does not affect the conformation of folded protein. Such replacements can be carried out to improve the solubility or other characteristics of the enzyme. Although it is not usually preferred, it can also be replaced in the active site or the second scope (i.e., affecting or contacting one or more amino acid whose positions or orientations in the active site). These replacements can be carried out to improve catalytic performance.

[0090] The substitution preferably introduces one or more conservative changes that replace an amino acid with another amino acid of similar chemical structure, similar chemical properties, or similar side chain volume. The introduced amino acid can have similar polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality, or charge to the amino acid it replaces. Alternatively, a conservative change can introduce another aromatic or aliphatic amino acid to replace a pre-existing aromatic or aliphatic amino acid.

[0091] Particularly preferred variants are capable of cleaving nucleic acids as described above with comparable or identical efficiency to the native protein, or indeed with improvements in speed, efficiency, accuracy or delivery.

[0092] Attached photos

[0093] Figure 1A An exemplary delivery vector of the present invention is depicted. Shown are the first and third parts (1 and 3) that form a duplex, wherein the recognition sequence for the nuclease (4) is depicted. The second part (2), herein representing the donor template for gene editing, can include homology arms (5a and 5b) and a target sequence (6).

[0094] Figure 1B Represents Figure 1AThe same delivery vector is used, but the nuclease has cleaved the target site and the single-stranded nucleic acid is released (10). Here, it can be seen that fragments of the first and third parts (7a and 7b) remain in the single-stranded nucleic acid. These may or may not be present, depending on the nature of the nuclease and how the duplex is designed.

[0095] Figure 2 Representation of the use of a guide sequence (in this case gRNA-11) to recruit a nuclease such as Cas9 (12) to a duplex (4). Shown are two cleavage sites (13a and 13b), one for each strand of the duplex.

[0096] Figure 3 Is to use the delivery vector of the present invention (labeled as Figure 1A ) is a simplified representation of gene editing performed on single-stranded nucleic acids released by a DSB. In this case, gene editing is via HDR. Homology arms (5a and 5b) play an important role in aligning the insert (6) for inclusion into the genome (20) where the DSB has been introduced. The genome with the inserted sequence (21) is also shown.

[0097] Figure 4 A photograph of a gel prepared according to Example 1 is shown; it is divided into three sections. Gel electrophoresis is a standard laboratory procedure for separating nucleic acids by size (e.g., base pair length) for visualization and purification. Electrophoresis uses an electric field to move negatively charged nucleic acids through an agarose gel matrix toward the positive electrode. Shorter DNA fragments migrate through the gel faster than longer DNA fragments. Therefore, the approximate length of a DNA fragment can be determined by running it on an agarose gel together with a DNA ladder (a collection of DNA fragments of known lengths). However, circular nucleic acids behave differently in gels. In Section 1, a preparation of a delivery vector of the present invention is applied to the gel. The delivery vector is highlighted with an arrow. Other nucleic acids present in the preparation are raw materials or byproducts. Section 2 includes a marker ladder (M) and describes the use of the preparation applied in Section 1 when treated with an exonuclease—the delivery vector is unaffected because there are no free ends, but other fragments are degraded. The delivery vector here is designed to contain a duplex to which the guide RNA will recruit Cas9. Section 3 includes a marker ladder (M). Lane 3 relates to the preparation once the guide RNA and Cas9 have been introduced. The arrows here indicate that the single-stranded nucleic acid has been released by the action of Cas9 and has thereby opened up the circular structure.

[0098] Figure 5: It is a delivery vector diagram, showing the oligonucleotides of the vector created and used in Example 2. What is shown is the sequence of GFPgRNA and PAM, GFP to BFP single-stranded oligonucleotides and various restriction sites. The oligonucleotide length is 254 base pairs. It can be seen that gRNA and PAM sequences exist in sense and antisense arrangements to allow loopback (loopback) and annealing. Hairpin sequences are also shown.

[0099] Figure 6 It is the data generated by embodiment 2. The HEK293T-EGFP cells expressing Cas9 are losing EGFP. The histogram shows the percentage of GFP signal as the maximum count event, which is measured by flow cytometry at a specified time point after transfection in cells transfected with high (450ng) or low (45ng) BFP delivery vector ("mbDNA") transfection. The dotted line represents the threshold value of the GFP positive signal. The percentage of GFP negative events in each sample is quoted. These are figures of GFP expression relative to the maximum count percentage. Three groups of data are shown, the first column is the data of high BFP delivery vector (mbDNA), the middle column is the data of low BFP delivery vector (mbDNA), and the last column is the data without Cas9. The results of the 2nd, 3rd, 5th, 6th and 10th days after transfection are shown.

[0100] Figure 7 The data generated by Example 2 are shown. The delivery vector (mbDNA) causes Cas9-mediated EGFP to BFP conversion in HEK293T-EGFP cells. The average blue fluorescence of lysed cells was measured at the specified time point after transfection and plotted as raw intensity (non-normalized) or relative to no mbDNA control (normalized). The data of two biological replicates are shown. The results of the 2nd, 3rd, 5th and 6th days after transfection are shown).

[0101] The invention will now be demonstrated in the following examples, which do not limit the scope of the invention:

[0102] Example

[0103] Example 1:

[0104] Demonstration of processability by Cas9

[0105] One embodiment of the delivery vector of the present invention is designed to contain a duplex to which the guide RNA will recruit Cas9. The vector is produced in-house as ssDNA and ligated to seal it into Figure 1A A sample (sample 1) was taken. The vector was then incubated with 10 units of T5 exonuclease (NEB) at 37°C for 3 hours. Another sample (sample 2) was taken.

[0106] Guide RNAs were designed to target the duplex region of the vector and ordered from GenScript along with purified Cas9 protein. The sgRNA was annealed by mixing 19.5 μl of H2O, 3 μl of Cas9 reaction buffer @ 10x, and 7.5 μl of sgRNA @ 100 μM and heating to 75°C, then cooling to room temperature. Ribonucleoprotein was then prepared according to GenScript's instructions; 0.3 μl of annealed sgRNA, 0.5 μl of Cas9 protein, 4 μl of Cas9 reaction buffer @ 10x, and 27.2 μl of H2O were mixed and incubated at 37°C for 10 minutes.

[0107] Then 900 ng of vector DNA was added, the volume was brought to 40 μl with H 2 O, and the reaction was incubated for 3 hours at 37° C. A final sample (sample 3) was taken.

[0108] Samples 1, 2, and 3 were loaded onto a 0.8% agarose TBE gel stained with SafeView ( Figure 4 : Fraction 1: Sample 1, Fraction 2: Sample 2 and Fraction 3: Sample 3). The marker GeneRuler 1 kb+ DNA ladder (ThermoFisher) was also loaded and the gel was run to resolve the bands.

[0109] Sample 1 shows the closed carrier (by Figure 4 Sample 2 shows a strong band for the closed vector, indicating resistance to the exonuclease, while the open vector and byproduct bands are reduced to a smear at the bottom of the gel. Sample 3 shows a band for the vector that was successfully cleaved by Cas9—the open linear portion can now run faster and farther on the gel than when it was restricted to the uncleaved circular form ( Figure 4 as indicated by the arrow in section 3).

[0110] sequence:

[0111] In the delivery vector, the target site for the nuclease and the PAM sequence in the duplex are: GTCACCAATCCTGTCCCTAGTGG (SEQ ID No. 1)

[0112] The sgRNA guide sequence is:

[0113] gucaccaauccugucccuagGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU(SEQ ID No. 2)

[0114] Example 2:

[0115] Nucleic acid vector preparation

[0116] sequence:

[0117] In the delivery vector, the nuclease target site and PAM sequence in the duplex are:

[0118] GCTGAAGCACTGCACGCCGTAGG(SEQ ID No.3)

[0119] In the delivery vector, the sequence of the HDR template (with edited bases indicated in lowercase and underlined) is:

[0120] ACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGA g C c ACGG g GTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCC(SEQID NO.4)

[0121] The EGFP sequence on the genome (with edited bases indicated in lowercase and underlined) is:

[0122] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGA c C t ACGG cGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAG(SEQ ID NO.5)

[0123] The sgRNA guiding sequence is:

[0124] gcugaagcacugcacgccguGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC(SEQ ID No.6)

[0125] SEQ ID No.7 is the sequence of the Cas9 / sgRNA plasmid (not shown here).

[0126] Ordered from Biolegio (Nijmegen, the Netherlands) as Figure 5Depicted delivery vector with a stem designed to target EGFP (EGFP is a green fluorescent protein derived from the jellyfish Aequoreavictoria) and edit EGFP into BFP (blue fluorescent protein) ("BFP mbDNA"), and a control vector oligonucleotide lacking the target sequence. In the following reaction, the oligonucleotides were allowed to loop back and anneal to form a 'lasso'-like structure:

[0127] 8 μl oligonucleotide (100 μM) (7.5 μg / μl)

[0128] 9 μl ddH2O

[0129] Incubate at 98 °C for 10 min and then cool to 16 °C at a rate of 0.06 °C per second.

[0130] Ligate the annealed oligonucleotides to seal the nick in the vector backbone:

[0131] 17 μl annealed vector

[0132] 2 μl N buffer (10x)

[0133] -300mM Tris pH 8.9

[0134] -300mM(NH4)2SO4

[0135] -5mM MgSO4

[0136] ·2μl ATP (10mM) (NEB, Ipswich, US)

[0137] 1 μl T4 DNA ligase (400,000 U / ml) (NEB, Ipswich, US)

[0138] Incubate at 16°C for 7 hours

[0139] To remove any unligated single-stranded DNA, digest the reaction with T5 exonuclease:

[0140] 20 μl ligation vector

[0141] 2 μl N buffer (10x – same as above)

[0142] 2 μl T5 exonuclease (10,000 U / ml) (NEB, Ipswich, US)

[0143] 16 μl ddH2O

[0144] Incubate at 37 °C for 12 h

[0145] The annealed, ligated, and T5-digested vectors were column purified using a PCR purification kit (Macherey-Nagel, Dueren, Germany).

[0146] Demonstration of Cas9's gene editing capabilities

[0147] A HEK293T cell line stably expressing a single copy of EGFP (HEK293T-EGFP) was obtained (a gift from Astrid Glaser). Conversion of EGFP to a blue fluorescent variant (BFP) by Cas9-mediated gene editing has been previously demonstrated in this cell line using single-stranded oligonucleotides (ssODNs) as templates (Glaser et al., Molecular Therapy, Nucleic Acids, 5(7), e334, incorporated herein by reference).

[0148] Following the manufacturer's instructions, PEIpro was used DNA was delivered to HEK293T or HEK293T-EGFP cells seeded in 6-well plates and grown in 1.5ml complete medium (DMEM+10% FBS+2mM glutamine) by chemical transfection. 1.13 μg of total DNA and 3.39 μl of PEIpro were used for each transfection in a total volume of 200 μl of serum-free DMEM (4.5 g / l glucose). 100 ng of TIVA-pUC EF1α-Scarlet-I plasmid DNA was used to monitor transfection efficiency in each reaction. In the Cas9 reaction, 250 ng of Cas9+sgRNA plasmid was added. Either 450 ng (high) or 45 ng (low) BFP or control mbDNA was used. Blank plasmid was used to make the reaction reach 1.13 μg of DNA. All transfections were performed in duplicate.

[0149] Cells were grown for the indicated periods of time before being harvested by trypsinization. Transfection efficiency (% red fluorescence) and loss of GFP intensity were monitored over time on a CytoFLEX flow cytometer (Beckman Coulter, High Wycombe, UK). Cells were lysed with RIPA buffer to release their protein content. Microplate reader (Tecan, Switzerland) measured the relative blue fluorescence intensity of lysed cells (proteins) in the sample with excitation at 360 nm and emission at 465 nm.

[0150] result:

[0151] HEK293T-EGFP cells transfected with Cas9+sgRNA plasmid and BFP mbDNA (delivery vector) showed a gradual decrease in EGFP over the course of 6 days post-transfection. On day 6, 35% to 50% of the cells had ceased expressing EGFP ( Figure 6 ), which demonstrates the gene targeting ability of Cas9 in our system. Cells transfected with a high amount (450 ng) of the BFP delivery vector lost EGFP at a slower rate than cells transfected with a low amount (45 ng) of the BFP delivery vector. This reduction in gene editing rate can be explained by a slight reduction in the efficiency of high mbDNA transfection (approximately 70% of cells with high BFP / control vector showed Scarlet-I expression 48 hours after transfection, compared to approximately 80% with low / no vector). As shown in the data at day 10 after transfection (HEK293T-EGFP cells expressing Cas9 were losing EGFP), there was no obvious further loss of EGFP after day 6. The histograms show the GFP signal as a percentage of the maximum count events, measured by flow cytometry at the indicated time points after transfection in cells transfected with high (450 ng) or low (45 ng) BFP delivery vectors. The dotted line indicates the threshold for GFP-positive signal. The percentage of GFP-negative events in each sample is quoted ( Figure 6 ), indicating that Cas9 activity could not be detected after day 6. In contrast, cells not expressing Cas9 showed no reduction in EGFP, confirming that the EGFP loss was Cas9-mediated.

[0152] Since "mbDNA" was used as the vector, it is indicated whether this included BFP delivery or a control (no BFP).

[0153] Successful homology-directed recombination (HDR) gene editing events were identified by measuring blue fluorescent protein (BFP) intensity in cell lysates on days 2-6 after the introduction of the BFP delivery vector and control vector. As early as day 2 after transfection, cells with BFP but not the control vector showed a 1.3-fold increase in BFP signal relative to the no-vector control ( Figure 7 On day 5, the BFP intensity of cells with the high BFP vector was 2-fold higher than that of the control, and by day 6, the same relative levels of BFP were detected in cells with both the low and high BFP vectors ( Figure 7 Importantly, the increase in BFP signal could not be explained by interference with EGFP signal, because cells without Cas9 (no-Cas9) and thus expressing more functional EGFP had lower BFP signal compared to cells transfected with Cas9 ( Figure 7 ).

[0154] In summary, our data demonstrate that the BFP delivery vector according to the present invention can be cleaved by Cas9 in vivo and can release a viable transgene that can be used as an HDR template in Cas9-mediated gene editing. Sequence Listing <110> Lightbio Co., Ltd. <120> Nucleic acid delivery vector comprising circular single-stranded polynucleotide <130> P32190WO1 <150> 1913898.1 <151> 2019-09-26 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> PAM sequence <400> 1 gtcaccaatc ctgtccctag tgg 23 <210> 2 <211> 100 <212> RNA <213> Artificial sequence <220> <223> sgRNA guide sequence <400> 2 gucaccaauc cugucccuag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 3 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> PAM sequence 2 <400> 3 gctgaagcac tgcacgccgt agg 23 <210> 4 <211> 140 <212> DNA <213> Artificial sequence <220> <223> HDR template <400> 4 accctgaagt tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc 60 accctgagcc acggggtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac 120 ttcttcaagt ccgccatgcc 140 <210> 5 <211> 720 <212> DNA <213> Artificial sequence <220> <223> EGFP sequence <400> 5 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtag 720 <210> 6 <211> 96 <212> RNA <213> Artificial sequence <220> <223> sgRNA guiding sequence 2 <400> 6 gcugaagcac ugcacgccgu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugc 96 <210> 7 <211> 9177 <212> DNA <213> Artificial sequence <220> <223> Cas9 / sgRNA plasmid sequence <400> 7 gaggggcctat ttcccatgat tccttcatat tgcatatac gatacaggc tgttagagag 60 aatattggaa ttaatttgac tgtaacaca agatattag tacaaatac gtgacgtaga 120 aagtaataat ttctgggta gtttgcagtt ttaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatctt gtggaagga 240 cgaaacaccg gctgaagcac tgcacgccgt gttttagagc tagaatagc aagttaaaat 300 aaggctagtc cgttatcaac tgaaaagt ggcaccgagt cggtgctttt ttgttttaga 360 gctagaaata gcaagttaaa ataaggctag tccgttttta gcgcgtgcgc caatctcgca 420 ɣaaatggc tctgaggta cccgttacat aacttacggt aaatggcccg cctggctgac 480 cgcccaacga cccccgccca ttgacgtca tagtaacgcc atagggact ttccattgac 540 gtcaatgggt ggagtattta cggtaactg cccacttggc agtacatcaa gtgtatcata 600 tgccaagtac gccccctatt gacgtcaatg acggtaatg gcccgcctgg cattgtgccc 660 agtacatgac cttatgggac ttcctactt ggcagtacat ctacgtatta gtcatcgcta 720 ttaccatggt cgaggtgagc cccacgttct gcttcactct ccccatctcc cccccctccc 780 cacccccaat tttgtattta tttatttttt aattattttg tgcagcgatg ggggcggggg 840 gggggggggg gcgcgcgcca ggcggggcgg ggcggggcga ggggcggggc ggggcgaggc 900 ggagaggtgc ggcggcagcc aatcagagcg gcgcgctccg aaagttttcct tttatggcga 960 ggcggcggcg gcggcggc tataaaaagc gaagcgcgcg gcggcggga gtcgctgcgc 1020 gctgccttcg ccccgtgcc cgctccgccg ccgcctcgcg cgcccgcc cggctctgac 1080 tgaccgcgtt actcccacag gtgagcgggc gggacggccc ttctcctccg ggctgtaatt 1140 agctgagcaa gaggtaaggg tttaagggat ggttggttgg tggggtatta atgtttaatt 1200 acctggagca cctgcctgaa atcacttttt ttcaggttgg accggtgcca ccatggacta 1260 taaggaccac gacggagact acaaggatca tgatattgat tacaaagacg atgacgataa 1320 gatggcccca aagaagaagc ggaaggtcgg tatccacgga gtcccagcag ccgacaagaa 1380 gtacagcatc ggcctggaca tcggcaccaa ctctgtgggc tgggccgtga tcaccgacga 1440 gtacaaggtg cccagcaaga aattcaaggt gctgggcaac accgaccggc acagcatcaa 1500 gaagaacctg atcggagccc tgctgttcga cagcggcgaa acagccgagg ccacccggct 1560 gaagagaacc gccagaagaa gatacaccag acggagaaac cggatctgct atctgcaaga 1620 1680 cttcctggtg gaagagata agaagcacga gcggcacccc atcttcggca acatcgtgga 1740 cgaggtggcc taccacgaga agtaccccac catctaccac ctgagaaaga aactggtgga 1800 cagcaccgac aaggccgacc tgcggctgat ctatctggcc ctggcccaca tgatcaagtt 1860 ccggggccac ttcctgatcg agggcgacct gaacccggac aacagcgacg tggacaagct 1920 gttcatccag ctggtgcaga cctacaacca gctgttcgag gaaaacccca tcaacgccag 1980 cggcgtggac gccaaggcca tcctgtctgc cagactgagc aagagcagac ggctggaaaa 2040 tctgatcgcc cagctgcccg gcgagaagaa gaatggcctg ttcggaaacc tgattgccct 2100 gagcctgggc ctgaccccca acttcaagag caacttcgac ctggccgagg atgccaaact 2160 gcagctgagc aaggacacct acgacgacga cctggacaac ctgctggccc agatcggcga 2220 ccagtacgcc gacctgtttc tggccgccaa gaacctgtcc gacgccatcc tgctgagcga 2280 catcctgaga gtgaacaccg agatcaccaa ggcccccctg agcgcctcta tgatcaagag 2340 atacgacgag caccaccagg acctgaccct gctgaaagct ctcgtgcggc agcagctgcc 2400 tgagaagtac aaagagattt tcttcgacca gagcaagaac ggctacgccg gctacattga 2460 cggcggagcc agccaggaag agttctacaa gttcatcaag cccatcctgg aaaagatgga 2520 cggcaccgag gaactgctcg tgaagctgaa cagagaggac ctgctgcgga agcagcggac 2580 cttcgacaac ggcagcatcc cccaccagat ccacctggga gagctgcacg ccattctgcg 2640 gcggcaggaa gatttttacc cattcctgaa ggacaaccgg gaaaagatcg agaagatcct 2700 gaccttccgc atcccctact acgtgggccc tctggccagg ggaaacagca gattcgcctg 2760 gatgaccaga aagagcgagg aaaccatcac cccctggaac ttcgaggaag tggtggacaa 2820 gggcgcttcc gcccagagct tcatcgagcg gatgaccaac ttcgataaga acctgcccaa 2880 cgagaaggtg ctgcccaagc acagcctgct gtacgagtac ttcaccgtgt ataacgagct 2940 gaccaaagtg aaatacgtga ccgagggaat gagaaagccc gccttcctga gcggcgagca 3000 gaaaaaggcc atcgtggacc tgctgttcaa gaccaaccgg aaagtgaccg tgaagcagct 3060 gaaagaggac tacttcaaga aaatcgagtg cttcgactcc gtggaaatct ccggcgtgga 3120 agatcggttc aacgcctccc tgggcacata ccacgatctg ctgaaaatta tcaaggacaa 3180 ggacttcctg gacaatgagg aaaacgagga cattctggaa gatatcgtgc tgaccctgac 3240 actgtttgag gacagagaga tgatcgagga acggctgaaa acctatgccc acctgttcga 3300 cgacaaagtg atgaagcagc tgaagcggcg gagatacacc ggctggggca ggctgagccg 3360 gaagctgatc aacggcatcc gggacaagca gtccggcaag acaatcctgg atttcctgaa 3420 gtccgacggc ttcgccaaca gaaacttcat gcagctgatc cacgacgaca gcctgacctt 3480 taaagaggac atccagaaag cccaggtgtc cggccagggc gatagcctgc acgagcacat 3540 tgccaatctg gccggcagcc ccgccattaa gaagggcatc ctgcagacag tgaaggtggt 3600 3660 cagagaaac cagaccaccc agaagggaca gaacaagc cgcgagagaa tgaagcggat 3720 cgaagagggc atcaaagagc tgggcagcca gatcctgaaa gaacaccccg tggaaaacac 3780 ccagctgcag aacgagaagc tgtacctgta ctacctgcag aatgggcggg atatgtacgt 3840 ggaccaggaa ctggacatca accggctgtc cgactacgat gtggaccata tcgtgcctca 3900 gagctttctg areacgact ccatcgacaa caaggtgctg accagaagcg aagaaccg 3960 gggcaagagc gacaacgtgc cctccgaga ggtcgtgaag agaatgaa actactggcg 4020 gcagctgctg aacgccaagc tgattaccca gagaaagttc gacaatctga ccaaggccga 4080 gagaggcggc ctgagcgaac tggataaggc cggcttcatc aagacagc tggtggaaac 4140 ccggcagatc aaaagcacg tggcacagat cctggactcc cggatgaaca ctaagtacga 4200 cgagaatgac aagctgatcc gggaaggaa agtgatcacc ctgaagtcca agctggtgtc 4260 cgatttccgg areatttcc agttttacaa agtgcgcgag atcaacaact accaccacgc 4320 ccacgacgcc tacctgaacg ccgtcgtggg aaccgccctg atcaaaaagt accctaagct 4380 ggaagcgag ttcgtgtacg gcgactacaa ggtgtacgac gtgcggaaga tgatcgccaa 4440 4500 ctttttcaag accgagatta ccctggccaa cggcgagatc cggaagcggc ctctgatcga 4560 gaaaacggc gaaacgggg agatcgtgtg ggataagggc cgggttttg ccaccgtgcg 4620 gaaagtgctg agcatgcccc aagtgaatat cgtgaaaaag accgaggtgc agacaggcgg 4680 cttcagcaaa gagtctatcc tgcccaagag gaacgcgat aagctgatcg ccagaaagaa 4740 ggactgggac cctaagaagt acggcggctt cgacagcccc accgtggcct attctgtgct 4800 ggtggtggcc aaagtggaaa agggcaagtc caagaaactg aagagtgtga aagagctgct 4860 ggggatcacc atcatggaaa gaagcagctt cgagaagaat cccatcgact ttctggaagc 4920 caagggctac aaaaggtga aaaaggacct gatcatcaag ctgcctaagt actccctgtt 4980 cgagctggaa aacggccgga agaatgct ggcctctgcc ggcgaactgc agaagggaa 5040 cgaactggcc ctgccctcca actatgtga cttcctgtac ctggccagcc actatgaga gctgaagggc tccccgagg atatgagca gaaacagctg tttgtggaac agcacaagca ctacctggac gagatcatcg bitecag cgagttctcc aagagagtga tcctggccga 5220. cgctaatctg gacaaagtgc tgtccgccta caacaagcac cgggataagc ccatcagaga gcaggccgag aatatcatcc acctgtttac cctgaccaat ctgggagccc ctgccgcctt 5340 caagtacttt cacaccacca tcgaccgga gaggtacacc agcaccaaag aggtgctgga cgccaccctg atccaccaga gcatcaccgg cctgtacgag acacggatcg acctgtctca 5460 gctgggaggc gacaaaaggc cggcggccac gaaaaaggcc ggccaggca aaaagaaaaa ggaattcggc agtggagagg gcagaggag tctgctaaca tgcggtgacg tcgaggaga 5580 tcctggccca atgaccgagt acaagcccac ggtgcgcctc gccacccgcg acgacgtccc 5640 cgggccgta cgcaccctcg ccgccgcgtt cgccgactac cccgccacgc gccacaccgt 5700 cgatccggac cgccacatcg agcgggtcac cgagctgcaa gaactcttcc tcacgcgcgt cgggctcgac atcggcaagg tgtgggtcgc ggacgacggc gccgcggtgg cggtctggac 5820 cacgccggag agcgtcgaag cgggggcggt gttcgccgag atcggcccgc gcatggccga 5880 gttgagcggt tcccggctgg ccgcgcagca acagatggaa ggcctcctgg cgccgcaccg 5940 gcccaaggag cccgcgtggt tcctggccac cgtcggagtc tcgcccgacc accagggcaa 6000 gggtctgggc agcgccgtcg tgctccccgg agtggaggcg gccgagcgcg ccggggtgcc 6060 cgccttcctg gagacctccg cgccccgcaa cctccccttc tacgagcggc tcggcttcac 6120 cgtcaccgcc gacgtcgagg tgcccgaagg accgcgcacc tggtgcatga cccgcaagcc 6180 cggtgcctga gaattctaac tagagctcgc tgatcagcct cgactgtgcc ttctagttgc 6240 cagccatctg ttgtttgccc ctcccccgtg ccttccttga ccctggaagg tgccactccc 6300 actgtccttt cctaataaaa tgaggaaatt gcatcgcatt gtctgagtag gtgtcattct 6360 attctggggg gtggggtggg gcaggacagc aagggggagg attgggaaga gaatagcagg 6420 catgctgggg agcggccgca ggaaccccta gtgatggagt tggccactcc ctctctgcgc 6480 gctcgctcgc tcactgaggc cgggcgacca aaggtcgccc gacgcccggg ctttgcccgg 6540 gcggcctcag tgagcgagcg agcgcgcagc tgcctgcagg ggcgcctgat gcggtatttt 6600 ctccttacgc atctgtgcgg tatttcacac cgcatacgtc aaagcaacca tagtacgcgc 6660 cctgtagcgg cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg accgctacac 6720 ttgccagcgc cttagcgccc gctcctttcg ctttcttccc ttcctttctc gccacgttcg 6780 ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt agggttccga tttagtgctt 6840 tacggcacct cgaccccaaa aaacttgatt tgggtgatgg ttcacgtagt gggccatcgc 6900 cctgatagac ggtttttcgc cctttgacgt tggagtccac gttctttaat agtggactct 6960 tgttccaaac tggaacaaca ctcaactcta tctcgggcta ttcttttgat ttataaggga 7020 ttttgccgat ttcggtctat tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga 7080 attttaacaa aatattaacg tttacaattt tatggtgcac tctcagtaca atctgctctg 7140 atgccgcata gttaagccag ccccgacacc cgccaacacc cgctgacgcg ccctgacggg 7200 cttgtctgct cccggcatcc gcttacagac aagctgtgac cgtctccggg agctgcatgt 7260 gtcagaggtt ttcaccgtca tcaccgaaac gcgcgagacg aaagggcctc gtgatacgcc 7320 tatttttata ggttaatgtc atgataataa tggtttctta gacgtcaggt ggcacttttc 7380 ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc 7440 cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg aagagtatga 7500 gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc cttcctgttt 7560 ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg ggtgcacgag 7620 tgggttacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt cgccccgaag 7680 aacgttttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgta 7740 ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat gacttggttg 7800 agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga gaattatgca 7860 gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca acgatcggag 7920 gaccgaagga gctaaccgct tttttgcaca acatggggga tcatgtaact cgccttgatc 7980 gttgggaacc ggagctgaat gaagccatac caaacgacga gcgtgacacc acgatgcctg 8040 tagcaatggc aacaacgttg cgcaaactat taactggcga actacttact ctagcttccc 8100 ggcaacaatt aatagactgg atggaggcgg ataaagttgc aggaccactt ctgcgctcgg 8160 cccttccggc tggctggttt attgctgata aatctggagc cggtgagcgt ggaagccgcg 8220 gtatcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt atctacacga 8280 cggggagtca ggcaactatg gatgaacgaa atagacagat cgctgagata ggtgcctcac 8340 tgattaagca ttggtaactg tcagaccaag tttactcata tatactttag attgatttaa 8400 aacttcattt ttaatttaaa aggatctagg tgaagatcct ttttgataat ctcatgacca 8460 aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa aagatcaaag 8520 gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac 8580 cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa 8640 ctggcttcag cagagcgcag ataccaaata ctgttcttct agtgtagccg tagttaggcc 8700 accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc ctgttaccag 8760 tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac 8820 cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc 8880 gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc 8940 ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca 9000 cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc 9060 tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg 9120 ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgt 9177

Claims

1. A closed nucleic acid delivery vector comprising a circular single-stranded polynucleotide, the vector comprising: (a) A duplex formed by a first portion and a third portion of the polynucleotide, the portions comprising complementary sequences; (b) A loop formed by a second portion, the portion separating the first and third portions; wherein the duplex is a stem, and the loop formed by the second portion loops out from one end of the stem; wherein the duplex comprises a recognition sequence for a target nuclease; and wherein the vector delivers a linear single-stranded nucleic acid, wherein the single-stranded nucleic acid is present within the second portion.

2. The nucleic acid delivery vector according to claim 1, wherein the linear single-stranded nucleic acid is any one or more of the following: an enzyme that is a nucleic acid, an aptamer, a donor template, a functional RNA.

3. The nucleic acid delivery vector according to claim 1, wherein the linear single-stranded nucleic acid has free 5' and 3' ends once released from the delivery vector.

4. The nucleic acid delivery vector according to claim 1, wherein the vector is a closed DNA or a closed RNA.

5. The nucleic acid delivery vector according to any one of claims 1 to 4, wherein the nuclease is a guide nuclease.

6. The nucleic acid delivery vector according to any one of claims 1 to 4, wherein the nuclease is a nuclease associated with gene editing.

7. The nucleic acid delivery vector according to claim 6, wherein the nuclease is Cas9.

8. The nucleic acid delivery vector according to any one of claims 1 to 4, wherein the nuclease binds to the recognition sequence without a guide.

9. The nucleic acid delivery vector according to any one of claims 1 to 4, wherein the vector is for use in cells.

10. A method of providing a linear single-stranded nucleic acid to a cell for non-therapeutic purposes, comprising using the delivery vector according to any one of claims 1 to 9.

11. A method of providing a linear single-stranded donor template for genome editing to a cell for non-therapeutic purposes, comprising using the delivery vector according to any one of claims 1 to 9.

12. The method according to claim 11, wherein the nuclease is a guide nuclease.

13. The method according to claim 12, wherein the nuclease is Cas9 or a variant thereof.

Images