Application of Wx mutant proteins and their genes in plant breeding based on gene editing technology

Abstract

The present invention discloses a rice Wx mutant protein, a mutant gene and its application, and also discloses a breeding method for creating quality-improved rice with transparent appearance and appropriately reduced amylose content by gene editing. The present invention uses gene editing technology for the first time to Wx By editing the gene with a single base, and through the screening of the offspring, new materials with T-DNA removed, transparent appearance, appropriately reduced amylose content, improved quality, and stable inheritance can be obtained in the T2 generation. Compared with breeding such as chemical mutagenesis and hybridization, gene editing directed improvement molecular breeding technology has the advantages of rapidity, accuracy, and efficiency. Combined with gene function marker genotype selection, or directly using other mature rice varieties as background materials for transformation and obtaining corresponding materials, it will greatly improve breeding efficiency and greatly accelerate the breeding process.

Description

Technical Field

[0001] The present invention belongs to the fields of crop genetic breeding, innovation of new resources for crop quality improvement, and breeding of crops with good taste, and specifically relates to the application of Wx mutant proteins and genes thereof based on gene editing technology in plant breeding. Background Art

[0002] Rice (Oryza sativa L.) is an important food crop in China and even in the world, and plays a vital role in ensuring food security.

[0003] Rice quality refers to the basic characteristics that rice must have in commodity circulation, including four main aspects: milling quality, appearance quality, cooking and taste quality, and nutritional quality. Among them, appearance quality and cooking and taste quality are particularly important. Seed endosperm is the main edible part of rice. From the perspective of chemical composition, the main component of endosperm is starch, which generally accounts for 90% or even more of the dry weight of endosperm. Therefore, the cooking and taste quality of rice depends largely on the physical and chemical properties of starch. The genes involved in the synthesis and regulation of rice endosperm starch play an extremely important role in the formation of rice quality. After a lot of research by scientific researchers, people have a deeper understanding of the genetic basis of rice cooking and taste quality traits, and the pathways of rice endosperm starch synthesis, the genes or enzymes involved have been explained in detail. Among them, the enzymes involved in starch synthesis mainly include ADP-glucose pyrophosphorylase, granule-bound starch synthase, soluble starch synthase, starch branching enzyme, starch debranching enzyme, etc.

[0004] There are two main types of starch that make up rice, namely amylose and amylopectin. Amylose is a glucose polymer connected by α-1,4-glycosidic bonds. It is a linear macromolecule with no or few branches. It is generally believed that the amylose content (AC) is a determining factor in the cooking, processing and edible quality of rice. The rice Wx gene encodes granule-bound starch synthase (GBSS), which is the main gene controlling the synthesis of amylose and directly affects the content of amylose in rice endosperm and pollen. The gene was cloned in 1990 and is located on the short arm of chromosome 6. In general japonica varieties, the gene consists of 14 exons and 13 introns, encoding a protein composed of 609 amino acids. Different allelic variations of this gene determine the amylose content of rice. To date, at least 8 Wx alleles have been published. In glutinous rice, Wx causes premature termination of transcription due to the deletion of 23bp in the second exon. In non-glutinous varieties, Wx is mainly differentiated into two alleles, Wx-a and Wx-b. Among them, the amylose content of rice carrying Wx-a is above 25%, which belongs to the high amylose type. Wx-b is mainly distributed in japonica rice varieties. The amylose content of rice carrying this gene is medium to low (15% to 18%). Compared with Wx-a, the variation of Wx-b is caused by the GT variation at the splicing site of the first intron. The mutation reduces the splicing efficiency of the pre-mRNA, resulting in a decrease in the amylose content in rice. In addition, the researchers also cloned the Wx-in allele and proved that the AC variation in the sixth exon can cause the amylose content to drop to a medium level (18% to 22%). In addition, three "soft rice genes", namely Wx-mq, Wx-mp and Wx-op, were cloned one after another (the so-called soft rice refers to rice with an AC between 8% and 12%, a shiny surface, soft and elastic texture, no hardness when cold, and excellent taste quality). Compared with Wx-b, Wx-mq has two mutations at the 4th (arginine at position 158 in the amino acid sequence mutates to histidine) and 5th (tyrosine at position 191 in the amino acid sequence mutates to histidine) exons, resulting in a drop in the amylose content to about 10%.Another allele, Wx-mp, mutated in exon 4 (arginine at position 158 in the amino acid sequence mutated to histidine), which is the same position as Wx-mq. There is no mutation in exon 5, and the amylose content of rice carrying this allele is also around 10%. Another soft rice gene is Wx-op and Wx-hp from Yunnan millet, both of which are caused by AG mutation in exon 4 (aspartic acid at position 165 in the amino acid sequence mutated to glycine). Previous researchers used the glycogen synthase of Agrobacterium tumefaciens as a model to draw a three-dimensional structure diagram of Wx-hp, and speculated that the mutation is located in the catalytic domain of starch synthase, resulting in a decrease in starch synthesis ability. In summary, we believe that artificial mutation (such as using gene editing technology) of single amino acids in the core catalytic domain of starch synthase encoded by the Wx gene, especially the related amino acids adjacent to the 33-36 (Lys-Ser-Gly-Gly) amino acid residues in the 3-D model (it is reported that the site of the 33-36 amino acid residues is the binding site with ADP-glucose during starch and glycogen synthesis), may create new mutation types and provide material support for meeting the current market's higher requirements for rice quality.

[0005] At present, the soft rice varieties in Jiangsu, Yunnan, Shanghai, etc., such as Nanjing 46, Nanjing 9108, Chujing 39, Huruan 1212, etc., have outstanding taste quality and are widely planted and loved by consumers. Many of these varieties have won the National Gold Award for the Taste Quality Evaluation of High-quality Rice Varieties. However, although the soft rice varieties have been welcomed and sought after by the market in terms of taste, they still have two major defects:

[0006] 1. The available soft rice resources are lacking and the genotype is single, so the efficiency of conventional breeding is low. Taking the soft rice varieties selected and bred in the Yangtze River Delta region as an example, the allele variant gene Wx-mp of Kanto 194 from Japan is mainly used, AC9%. The target gene is introduced into the background of excellent varieties by using this germplasm resource for soft rice variety breeding, mainly through hybridization, backcrossing, multiple crosses, ladder hybridization, etc. The target gene is introduced into the background parent. For quality traits, backcrossing is a common method, which generally requires 4-6 generations of backcrossing, plus self-pollination homozygosity, etc. It takes at least 3-5 generations to improve a single trait and play a role in production. It takes at least 6-8 years, and the breeding cycle is long, which makes it difficult to meet the market and the people's urgent demand for high-quality soft fragrant rice varieties. If we want to explore new soft rice gene resources, we currently mainly rely on chemical mutagenesis methods. As we all know, the frequency of chemical mutation is low, the initial investment is large, and it may take 2-3 years to screen and obtain a stable material. At the same time, chemical mutagenesis may cause multiple gene mutations in wild-type materials. If they are used in production, they also need to be improved through hybridization to eliminate adverse gene mutations.

[0007] 2. Most soft rice varieties have poor appearance quality. When the moisture content of rice is about 15%, most rice has a cloudy appearance and poor transparency, commonly known as semi-glutinous or stiff rice, which seriously affects its commercial quality. Rice processing plants can increase the transparency of rice by increasing the moisture content to more than 17%, but this often causes the rice to be unable to withstand storage and even mold. Therefore, it has become an urgent need for high-quality breeding to explore and utilize new soft rice gene resources and change the current status of soft rice appearance not meeting standards.

[0008] Genome editing technology is a technology that uses special nucleases to perform site-specific modification, single-base editing, directional knockout or insertion of target genes on the genome and its transcription products. At present, CRISPR / Cas9 (CRISPR-associated protein 9)-mediated genome editing technology is a relatively mature technology, developing rapidly, and widely used in crop genetic improvement. Compared with traditional breeding and targeting the defects in soft rice breeding, gene editing breeding has the following advantages:

[0009] 1. High efficiency and short cycle. Due to the high efficiency of Agrobacterium-mediated genetic transformation of japonica rice varieties, our previous experimental results show that 3-5 homozygous target alleles can be screened out of 10 T0 generation transformants, that is, phenotypes such as fragrance, dark endosperm caused by extremely low amylose content, and early heading period can be observed in the T0 generation. Since rice is a strictly self-pollinating plant, exogenous DNA fragments can be removed by self-pollination. In the T1 generation obtained by self-pollination of T0 generation single plants, generally about 5 single plants with exogenous DNA represented by hygromycin, Cas9 gene, and "SgRNA+vector skeleton" can be screened out from 100 single plants. Breeding 5 seedlings, generally each plant can harvest 500 seeds, one plant can breed 400 plants, and can breed about 20 kilograms of conventional japonica rice seeds. In other words, within three generations (~1.5 years), enough seeds can be obtained for quality analysis (even participating in various tests such as experiments and demonstrations). Compared with conventional breeding, the breeding cycle is greatly shortened. In addition, even if asexual line variation occurs during tissue culture in the T0 generation, the undesirable variation can be eliminated by hybridizing the genome-edited material with the wild type, or the asexual line variation plant can even be discarded if there are enough T0 generation transformants.

[0010] 2. It can create the expected target gene accurately, directionally and on a large scale. Conventional breeding can only screen resources with target genes from variety resources, and then improve existing varieties through hybridization and backcrossing. Generally speaking, the agronomic traits of variety resource materials are poor, so the genetic improvement cycle is longer. Genome editing technology can directly use rice varieties with excellent agronomic traits and large-scale promotion in production as background materials to edit target genes. The target is clear and the screening is efficient. In addition, given the current efficient genetic transformation technology of rice, in theory, it is possible to screen specific phenotypes (such as transparent appearance) in the above-mentioned background materials indefinitely. Compared with finding natural variation materials or chemical mutation materials that meet the phenotypic conditions, this strategy is more feasible and has obvious advantages. Taking the multi-gene editing system of heading period-related genes constructed by Jiangsu Academy of Agricultural Sciences as an example, Wuyunjing 24 and Nanjing 9108, which are widely promoted in Jiangsu, were used as genetic transformation background materials, and new materials with heading periods of more than 60 days, more than 70 days, and more than 80 days were obtained without exogenous marker genes. Compared with the wild type, the variation types are rich, the heading period is earlier and distributed in a gradient, which can expand the planting range of high-quality varieties, accelerate the improvement process of high-quality varieties, greatly save breeding costs, and highlight the vitality and creativity of gene editing molecular breeding.

[0011] 3. The single-base editing system based on CRISPR / Cas9 can further realize single-base editing. In crop breeding and production, many important agronomic traits are caused by single nucleotide polymorphisms or dominant functional gain-of-function point mutations, so the application of simple gene knockout strategies is very limited. The emergence of single-base editing systems can well solve this technical problem. At the same time, this strategy can avoid the extreme variant phenotype caused by the loss of biological function of mutant proteins caused by gene knockout, and even the inability of rice plants to grow normally, and ultimately lead to situations where they cannot be used in breeding. The "weak mutations" (individual amino acid replacements rather than premature translation termination) produced by single-base editing will not cause the complete loss of the biological function of the encoded protein, and thus will not cause major changes in the important agronomic traits of the background material, which will be more conducive to the generation of variant types that can be used in breeding and production.

[0012] In summary, by using gene editing technology, designing editing target sites for exons 3 and 4 of the Wx gene (located in the core catalytic domain of the encoded starch synthase) for single-base editing, a series of new materials with transparent appearance, reduced amylose content and gradient distribution can be efficiently created and screened. These materials and their specific genotypes can be further applied to breeding. Corresponding gene function markers can be developed. In the hybrid combination offspring prepared using these materials, genotype selection can be performed with the help of molecular marker-assisted selection to screen heterozygous and homozygous genotypes of target trait genes, thereby accelerating the homozygous process of target genes. In addition, rice varieties with excellent agronomic traits and large-scale promotion in production can be directly used as background materials to edit the target gene, and the required genotype materials can be efficiently and scaled up. For single-base mutations, enzyme target markers can be designed, but the process is relatively cumbersome. Allele-specific PCR is developed, and genotypes with high and low amylose content can be distinguished by two PCRs.

[0013] At present, if scientists want to obtain new materials or new genes for soft rice with AC reduced to 8-12% and transparent appearance, they need to use chemical or radiation mutagenesis, which is very labor-intensive and has unsatisfactory results. At the same time, conventional chemical mutagenesis and conventional transfer breeding require at least 6-8 years of breeding, which is a long breeding cycle and can hardly meet the urgent needs of the market and the people for high-quality soft fragrant rice varieties.

[0014] At the same time, there are no reports on the use of gene editing technology to perform site-directed mutagenesis on the Wx gene of rice varieties to create new soft rice alleles. Summary of the invention

[0015] Purpose of the invention: The technical problem to be solved by the present invention is to provide a rice Wx mutant protein and its nucleic acid or gene.

[0016] The technical problem that the present invention needs to solve is to provide an expression cassette, a recombinant vector or a cell.

[0017] The technical problem that the present invention also solves is to provide a primer pair for identifying the gene or nucleic acid.

[0018] The technical problem that the present invention also solves is to provide the application of rice Wx mutant protein, nucleic acid or gene, primer pair, expression cassette, recombinant vector or cell in plant quality improvement, strain / variety identification, strain / variety creation and / or breeding.

[0019] The technical problem that the present invention also solves is to provide a breeding method for creating quality-improved rice with transparent appearance and appropriately reduced amylose content using gene editing. The present invention uses gene editing technology for the first time to perform single-base editing on the Wx gene of rice varieties, create new soft rice alleles, and eliminate T-DNA exogenous sequences to obtain new materials with transparent appearance, appropriately reduced amylose content, improved quality, and stable inheritance. It generally only takes about 2 years, which is at least 2-6 years shorter than chemical mutagenesis and conventional conversion breeding. Therefore, gene editing molecular breeding has advantages that conventional breeding does not have, such as precision and high efficiency, and has broad application prospects.

[0020] Another technical problem to be solved by the present invention is to provide a method for identifying the plants obtained by the method.

[0021] Technical solution: In order to solve the above technical problems, the technical solution adopted by the present invention is as follows: rice Wx mutant protein, the amino acid sequence of the Wx mutant protein has the following mutations: the 159th amino acid corresponding to the amino acid sequence of rice Wx mutates, and / or the 178th amino acid mutates.

[0022] Specifically, the present invention reports for the first time that the amino acid at position 159 is mutated from glycine to lysine, and has quality improvement characteristics such as maintaining transparent appearance and appropriately reducing the content of amylose. The mutation of the amino acid at position 159 of the present invention can also include 19 types of mutations such as glutamic acid, aspartic acid, tryptophan, alanine, valine, leucine, isoleucine, proline, phenylalanine, tyrosine, serine, threonine, cysteine, methionine, asparagine, glutamine, arginine, histidine and stop codon. Whether other mutations or early termination of the above-mentioned amino acids affect the activity and physiological function of granular starch synthase and whether it has quality improvement characteristics remains to be further studied and confirmed.

[0023] Specifically, the present invention reports for the first time that the amino acid at position 178 mutates from threonine to isoleucine, and has quality improvement characteristics such as maintaining a transparent appearance and appropriately reducing the content of amylose. The mutation of the amino acid at position 178 of the present invention can also include 19 types of mutations such as glycine, lysine, glutamic acid, aspartic acid, tryptophan, alanine, valine, leucine, proline, phenylalanine, tyrosine, serine, cysteine, methionine, asparagine, glutamine, arginine, histidine and stop codon. Whether other mutations or early termination of the above-mentioned amino acids affect the activity and physiological function of granular starch synthase and whether it has quality improvement characteristics remains to be further studied and confirmed.

[0024] The rice Wx mutant protein of the present invention comprises:

[0025] (a) whose amino acid sequence is shown in SEQ ID NO: 2 or SEQ ID NO: 4; or

[0026] (b) A protein derived from (a) in which the amino acid sequence in (a) is substituted and / or deleted and / or one or more amino acids are added and which has granular starch synthase activity.

[0027] The present invention also includes nucleic acids or genes encoding the mutant proteins.

[0028] Wherein, the nucleic acid or gene includes:

[0029] (a) it encodes the mutant protein; or

[0030] (b) a nucleotide sequence that hybridizes under stringent conditions with the nucleotide sequence defined in (a) and encodes a protein having granular starch synthase activity; or

[0031] (c) The nucleotide sequence is shown in SEQ ID NO: 1 or SEQ ID NO: 3.

[0032] The present invention also includes a primer pair for identifying the above-mentioned gene or nucleic acid, the primer pair is Wx1 and / or Wx2 and / or Wx9 and / or Wx10, the primer pair Wx1 sequence is shown in SEQ ID NO: 19 and SEQ ID NO: 20, the primer pair Wx2 sequence is shown in SEQ ID NO: 20 and SEQ ID NO: 21, the primer pair Wx9 sequence is shown in SEQ ID NO: 20 and SEQ ID NO: 28, and the primer pair Wx10 sequence is shown in SEQ ID NO: 20 and SEQ ID NO: 29.

[0033] The present invention also includes expression cassettes, recombinant vectors or cells containing the nucleic acid or gene.

[0034] The present invention also includes the application of the rice Wx mutant protein, nucleic acid or gene, the primer pair, the expression cassette, recombinant vector or cell in plant quality improvement, strain / variety identification, strain variety creation and / or breeding.

[0035] The present invention also includes a method for obtaining a quality-improved plant with a transparent appearance and appropriately reduced amylose content, comprising the following steps:

[0036] 1) making plants contain said nucleic acid or gene; or

[0037] 2) causing the plant to express the rice Wx mutant protein.

[0038] The present invention also includes a breeding method for creating quality-improved rice with transparent appearance and appropriately reduced amylose content by gene editing, comprising the following steps:

[0039] 1) Cloning of Wx gene and design of target sites for gene editing

[0040] 2) Construction of single-base editing vector containing the target fragment;

[0041] 3) Obtaining quality-improved rice having the Wx mutant protein, or the nucleic acid or gene, which has a transparent appearance and a properly reduced amylose content.

[0042] 4) removing the exogenous DNA (T-DNA) fragments from the T1 generation plants obtained by self-pollination of the T0 generation transgenic plants with target gene mutations;

[0043] 5) The genotype of the T1 generation plants from which the T-DNA was eliminated was re-identified and homozygous mutant plants of the target gene were obtained.

[0044] Wherein, the construction method of the single base editing vector containing the target fragment in step 2) is as follows:

[0045] A) Preparation of target adapter fragments: Dissolve adapter primers in ddH2O to form a mother solution, mix and dilute complementary adapter primers, denature at high temperature, and cool to room temperature to complete annealing, thereby obtaining target adapter fragments;

[0046] B) The target linker fragment was connected to the intermediate vector: the pHUE411 intermediate vector was digested with the restriction endonuclease BsaI to obtain the pHUE411 vector digested with BsaI alone; the pHUE411 vector digested with BsaI alone, the target linker fragment, and T4 ligase were used for ligation reaction and Escherichia coli transformation, and sequencing was performed to obtain the intermediate vector plasmid containing the target linker fragment.

[0047] C) Final vector construction: The pH-nCas9-PBE binary expression vector was double-digested with restriction endonucleases PmeI and AvrII to obtain a double-digested pH-nCas9-PBE vector; an intermediate vector containing a target linker fragment was double-digested with PmeI and AvrII to obtain a sgRNA expression cassette containing a target linker fragment and a corresponding promoter; the double-digested pH-nCas9-PBE vector, sgRNA expression cassette, and T4 ligase were used for ligation reaction and Escherichia coli transformation, and sequencing was performed to obtain the final single-base editing vector containing the target fragment.

[0048] Among them, the method for obtaining the quality-improved rice with transparent appearance and appropriately reduced amylose content in step 3) is as follows: the single-base editing vector containing the target fragment obtained in step 2) is transferred into Agrobacterium EHA105 and genetically transformed to obtain T0 generation transgenic plants, and the obtained T0 generation transgenic plants are amplified with primers Wxb-PCR-F and Wxb-PCR-R and sequenced to identify the genotype, so as to obtain plants with the mutant protein, the nucleic acid or the gene.

[0049] Among them, the T-DNA fragment in step 4) includes the hygromycin phosphotransferase gene HPT and the nuclease gene nCas9. The T-DNA fragment is removed by simultaneously detecting the HPT gene and the nCas9 gene of the T1 generation plant obtained by self-pollinating the T0 generation transgenic plant with the target gene mutation, repeating the process multiple times, and screening the T1 generation single plant that does not carry these two genes as the target plant.

[0050] Among them, the HPT gene detection method uses the genomic DNA of the T1 generation plants obtained by self-pollination of the T0 generation transgenic plants with target gene mutations as a template, and hyg283-F and hyg283-R as primers for PCR amplification. At the same time, the nCas9 gene detection method uses the genomic DNA of the T1 generation plants obtained by self-pollination of the T0 generation transgenic plants with target gene mutations as a template, and nCas9-F and nCas9-R as primers for PCR amplification. When both the HPT gene and the nCas9 gene are not detected at the same time, it indicates that the T-DNA has been successfully eliminated.

[0051] Wherein, the target gene homozygous mutant plants in step 5) are obtained by using the genomic DNA of the T1 generation plants from which the T-DNA obtained in step 4) is removed as a template, and PCR amplification and sequencing are performed using Wxb-PCR-F and Wxb-PCR-R as primers to screen and obtain plants homozygous for the mutant protein, the nucleic acid or the gene.

[0052] The present invention also includes a method for identifying a plant obtained by the method, comprising the following steps:

[0053] 1) determining whether the amylose content of the plant is reduced; and / or

[0054] 2) determining whether the disintegration value of the viscosity index of the RVA spectrum of the rice plant is increased; and / or

[0055] 3) determining whether the viscosity index recovery value of the RVA spectrum of the rice plant is reduced; and / or

[0056] 4) determining whether the peak time of the viscosity index of the RVA spectrum of the rice plant is reduced; and / or

[0057] 5) Determining whether the appearance of the plant polished rice is transparent.

[0058] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0059] 1) The present invention uses single-base editing technology for the first time to edit the coding region of the Wx gene. Through the screening of the offspring, a new material with T-DNA removed, transparent appearance, appropriately reduced amylose content, improved quality, and stable inheritance can be obtained in the T2 generation. Compared with breeding such as chemical mutagenesis and hybridization, gene editing directed improvement molecular breeding technology has the advantages of rapidity, accuracy, and efficiency. Using gene function markers for genotype selection, or directly using other mature rice varieties as background materials for transformation and obtaining corresponding materials, will greatly improve breeding efficiency and greatly accelerate the breeding process.

[0060] 2) The rice material bred with the gene editing technology of the present invention has a rice amylose content ranging from 9.8±0.2% to 12.9±0.1%, which is 1.5-4.6 percentage points lower than the wild type's 14.4±0.2%. The reduction in amylose content is appropriate, the trend is obvious, and the effect is significant, which can effectively improve palatability and taste quality.

[0061] 3) The rice disintegration value (BDV) of the rice material bred by the gene editing technology of the present invention is distributed between 943cP and 1327cP, and the BDV increase is appropriate compared to the 862cP of the wild type, and the trend is obvious; the rice recovery value (CSV) of the rice material bred by the gene editing technology of the present invention is distributed between 1010cP and 1070cP, and the CSV decrease is appropriate compared to the 1250cP of the wild type, and the trend is obvious; the rice peak time (PeT) of the rice material bred by the gene editing technology of the present invention is distributed between 5.87min and 6.13min, and the PeT decreases appropriately compared to the 6.2min of the wild type, and the trend is obvious. The optimization effect of the viscosity characteristics of the rice RVA spectrum represented by the above three indicators is significant, and can effectively improve the cooking and taste quality.

[0062] 4) The rice material bred by the gene editing technology of the present invention has good appearance transparency. When the water content of the polished rice is 10.1%, it performs the same as the wild type and still presents a relatively good transparency; while the soft rice control Nanjing 9108 has already appeared cloudy and has poor transparency.

[0063] 5) Based on the base variation between the wild type and mutant at the 475-476 position of the Wx gene, the present invention has developed a gene that can specifically distinguish the wild type (the 475-476 bases of the Wx gene are GG) and the mutant (Wx m6Based on the base variation of the wild type and mutant at the 533-534th position of the Wx gene, a molecular marker Wx1 and Wx2 was developed that can specifically distinguish the wild type (the 533-534th position of the Wx gene is CC) and the mutant (Wx m10 The 533-534 bases of the gene are TT) molecular markers Wx9 and Wx10. The above molecular markers can be used for molecular marker-assisted selection breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Schematic diagram of gene structure and target sites.

[0065] Figure 2 Sequence identification of target sites of T0 plants (part) in Suken 118 background; A: wxb#9 target site; B: wxb#24 target site.

[0066] Figure 3 Target site sequence identification of T1 generation T-DNA knockout plants in Suken 118 background; A: wxb#9 target site; B: wxb#24 target site.

[0067] Figure 4 HPT gene and Cas9 gene detection results of T2 generation plants; A: HPT gene; B: Cas9 gene. M: DNAmarker 2000, the band sizes from top to bottom are 2000, 1000, 750, 500, 250, 100 respectively; Lane 1 is the 118-1-1 strain, which is marked with a red arrow; Lane 2 is the 118-3-2 strain, which is marked with a red arrow; Lane 3 is the 118-5-1 strain, which is marked with a red arrow; Lane 11 is the 118-9-15 strain, which is marked with a red arrow; Other lanes are other numbered strains in the Suken 118 background; Those marked as P are plasmid positive controls; Those marked as E are water controls.

[0068] Figure 5 Amylose content (AC) determination.

[0069] Figure 6 The overall changes of each characteristic value of RVA and the correlation analysis between disintegration value (BDV), recovery value (CSV), peak time (PeT) and AC respectively.

[0070] Figure 7 Observation of the appearance of polished rice.

[0071] Figure 8 Wild-type Wx and Wx m6 、Wx m10 Detection of mutant protease activity and correlation analysis with AC; A: enzyme activity detection; B: correlation analysis.

[0072] Fig. 9 Three-dimensional structure prediction. A: wild-type Wx protein; B: mutant Wx m6 Protein; C: wild-type Wx protein; D: mutant Wx m10 protein.

[0073] Fig.10 Development of functional markers; The DNA templates used in each lane are indicated in the figure. Lane M is DNA marker 2000, and the band sizes from top to bottom are 2000, 1000, 750, 500, 250, and 100, respectively; The primers used in the PCR corresponding to each lane are as follows: Lanes 1 and 7 are Wx-1, Lanes 2 and 8 are Wx-2, Lanes 3 and 9 are Wx-3, Lanes 4 and 10 are Wx-4, Lanes 5 and 11 are Wx-5, Lanes 6 and 12 are Wx-6, Lanes 13 and 19 are Wx-7, Lanes 14 and 20 are Wx-8, Lanes 15 and 21 are Wx-9, Lanes 16 and 22 are Wx-10, Lanes 17 and 23 are Wx-11, and Lanes 18 and 24 are Wx-12.

[0074] Fig.11 Wx1+Wx2 and Wx9+Wx10 functional markers detect varieties; A: The primer used for PCR is Wx1; B: The primer used for PCR is Wx2; C: The primer used for PCR is Wx9; D: The primer used for PCR is Wx10. Lane M is DNA marker 2000, and the band sizes from top to bottom are 2000, 1000, 750, 500, 250, and 100, respectively; lanes 1 to 19 represent Suken 118, 118-1-1 mutant, 118-3-2 mutant, 118-5-1 mutant, 118-9-15 mutant, Nipponbare, Nanjing 9108, Huanghuazhan, 9311, Huaidao 5, Changnongjing 8, Nanjing 51, Lianjing 7, Suxiu 867, Wuyunjing 27, Wuyunjing 29, Xudao 8, Xudao 9, and Yandao 16, respectively.

[0075] Fig.12 Genotype and phenotype identification of T2 plants in Jinjing 818 background; A: Genotype identification of wxb#9 target site; B: Genotype identification of wxb#24 target site; C, amylose content (AC) determination; D, BDV determination; E, CSV determination; F, PeT determination; G, polished rice appearance observation; H, protease activity detection. DETAILED DESCRIPTION

[0076] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be obtained commercially.

[0077] The background material selected by the present invention is Suken 118 (purchased from Jiangsu Suken Seed Co., Ltd.), which is a late-maturing medium-glutinous rice new variety bred by the Institute of Grain Crops of Jiangsu Academy of Agricultural Sciences. The whole growth period is about 155 days, suitable for planting in the Suzhong and Ningzhenyang hilly areas of Jiangsu Province, with excellent comprehensive agronomic traits, and has been widely promoted and applied in production, and is well received by the market. Suken 118 has a compact plant type, strong tillering ability, light green leaves, good population uniformity, good lodging resistance, good color change at maturity, an amylose content of about 14%, and a transparent rice appearance. The present invention uses a single-base gene editing technology based on CRISPR / Cas9 to perform a single-base editing of the Wx gene of Suken 118, and obtains a plurality of mutants with improved appearance, cooking and taste quality, such as transparent appearance, appropriately reduced amylose content and gradient distribution (soft rice), so as to meet the urgent needs of the market and the people for high-quality soft fragrant rice varieties.

[0078] Example 1: Obtaining genetically transformed plants

[0079] 1. Suken 118 Wx gene cloning and target site design

[0080] Referring to the CTAB method of Murray et al., the genomic DNA of Suken 118 was extracted (Murray MG, et al., Nucleic Acids Research, 1980, 8(19): 4321-4326). The genomic DNA was amplified by PCR using primers Wx-F: CCCTAGCCACCCAAGAAA (SEQ ID NO: 5) and Wx-R: CACCCAGAAGAGTACAACATCA (SEQ ID NO: 6), and the amplified product was sent to Invitrogen (Shanghai) Trading Co., Ltd. for sequencing. The sequencing results were subjected to Blast comparison analysis in the NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) database, and it was found that the sequence of the Wx gene coding region of Suken 118 was the same as that of the reference genome rice Nipponbare.

[0081] According to the Wx gene sequence of Suken 118, the target site wxb#9 was designed on the 4th exon: CGACTCCACGCTTGTAGCAA (SEQ ID NO: 7) and the target site wxb#24 was designed on the 5th exon: AAGACCGGTGAGAAGATCTA (SEQ ID NO: 8) using the CRISPR-GE website (http: / / skl.scau.edu.cn / targetdesign / ). The locations of the two target sites on the gene are shown in the figure below. Figure 1 According to previous studies (Liu LL, et al., Plant Mol Biol, 2009, 71: 609-626), the two target sites are located in the core catalytic domain of starch synthase encoding the protein, and single-base mutations within each editing window are expected to form new effective mutations, thereby obtaining rice mutants with transparent appearance and reduced amylose content to varying degrees.

[0082] 2. Construction of CRISPR / Cas9 gene editing vector

[0083] The gene editing vector was constructed according to the method reported by Zong et al. (Zong Y, et al., Nat. Biotechnol, 2017, 35, 438-440) and the following steps were performed:

[0084] (1) Target linker preparation

[0085] According to the designed target site wxb#9 and wxb#24 sequences and their respective reverse complementary sequences, after adding the adapter sequence at the 5' end, the four primers were commissioned to Nanjing Qingke Biotechnology Co., Ltd. for synthesis. The specific sequences are as follows:

[0086] wxb#9-F: 5'-ggcgCGACTCCACGCTTGTAGCAA-3' (SEQ ID NO: 9);

[0087] wxb#9-R: 5'-aaacTTGCTACAAGCGTGGAGTCG-3' (SEQ ID NO: 10);

[0088] wxb#24-F: 5'-ggcgAAGACCGGTGAGAAGATCTA-3' (SEQ ID NO: 11);

[0089] wxb#24-R: 5'-aaacTAGATCTTCTCACCGGTCTT-3' (SEQ ID NO: 12);

[0090] Dissolve the adapter primers wxb#9-F and wxb#9-R in ddH2O to a 100 μM stock solution, take 1 μl of each and add it to 98 μl ddH2O to dilute to 1 μM, denature at high temperature, move to room temperature to cool and complete annealing, and obtain the double-stranded target adapter fragment wxb#9-F / R.

[0091] Dissolve the adapter primers wxb#24-F and wxb#24-R in ddH2O to a 100 μM stock solution, take 1 μl of each and add it to 98 μl ddH2O to dilute to 1 μM, denature at high temperature, move to room temperature and cool to complete annealing to obtain the double-stranded target adapter fragment wxb#24-F / R.

[0092] (2) Target linker fragment connected to the intermediate vector

[0093] First, the intermediate vector pHUE411 (Xing HL et al., BMC Plant Biol, 2014, 14, 327) was digested with restriction endonuclease BsaI. The restriction endonuclease used was purchased from ThermoFisher. The digestion system was as follows:

[0094]

[0095] After enzyme digestion at 37°C for 1 hour, the agarose gel was electrophoresed and cut, and the vector after BsaI single enzyme digestion was recovered using the OMEGA DNA recovery kit and set aside.

[0096] Secondly, the target linker fragment prepared by natural annealing in the previous step was ligated into the pHUE411 vector digested with BsaI using T4 ligase. T4 ligase was purchased from Takara Company, Japan, and the reaction system (10 μL) was as follows:

[0097]

[0098] After a brief centrifugation, the mixture was placed in a 16°C water bath for 4 hours. The ligation product was transformed into E. coli DH5α competent cells (Beijing Tiangen) by heat shock method. 1 / 20 of the transformed cells were evenly spread on LB solid medium containing 100 mg / L ampicillin. After culturing at 37°C for 16 hours, the colonies were picked and sent to Nanjing GenScript Biotech Co., Ltd. for sequencing. The correctly inserted and sequenced plasmids obtained were named pHUE411-wxb#9-F / R and pHUE411-wxb#24-F / R, respectively.

[0099] (3) Final vector construction

[0100] The final vector pH-nCas9-PBE is a plant binary expression vector developed by the research team of Gao Caixia from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences (Zong Y, et al., Nat. Biotechnol, 2017, 35, 438-440). First, the vector was double-digested with restriction endonucleases PmeI and AvrII. The restriction endonucleases used were purchased from ThermoFisher. The enzyme digestion system is as follows:

[0101]

[0102] After enzyme digestion at 37°C for 1 hour, the agarose gel was electrophoresed and cut, and the vector after double digestion with PmeI and AvrII was recovered using the OMEGA DNA recovery kit and set aside.

[0103] Secondly, the pHUE411-wxb#9-F / R and pHUE411-wxb#24-F / R vectors obtained in the previous step were double-digested with restriction endonucleases PmeI and AvrII, respectively. The restriction endonucleases used were purchased from ThermoFisher, and the enzyme digestion system was as follows:

[0104]

[0105] After enzyme digestion at 37°C for 1 hour, agarose gel electrophoresis and gel cutting were performed, and PmeI and AvrII were double-digested using the OMEGA DNA recovery kit to obtain the sgRNA expression cassette of the OsU3-wxb#9-F / R or OsU3-wxb#24-F / R original fragment, which were recovered and set aside.

[0106] Finally, the recovered original fragments were connected to pH-nCas9-PBE after PmeI and AvrII double digestion using T4 ligase. T4 ligase was purchased from Takara Company, Japan. The reaction system (10 μL) was as follows:

[0107]

[0108]

[0109] After a brief centrifugation, the mixture was placed in a 16°C water bath for 4 hours. The ligation product was transformed into Escherichia coli DH5α competent cells (Beijing Tiangen) by heat shock method. All transformed cells were evenly spread on LB solid medium containing 50 mg / L kanamycin. After culturing at 37°C for 16 hours, the colonies were picked and sent to Nanjing GenScript Biotech Co., Ltd. for sequencing. The primer used was the sequencing common primer M13-F. The plasmids obtained with correct sequencing were named pH-nCas9-PBE-wxb#9 and pH-nCas9-PBE-wxb#24.

[0110] 3. Obtaining genetically transformed plants and identifying genotypes

[0111] The above two plasmids were respectively transferred into Agrobacterium EHA105. The rice Suken 118 (purchased from Jiangsu Suken Seed Co., Ltd.) was transformed by conventional Agrobacterium-mediated method. Eight positive T0 plants were transferred into pH-nCas9-PBE-wxb#9, and six positive T0 plants were transferred into pH-nCas9-PBE-wxb#24. In order to identify the base variation of the editing target site, the genomic DNA of the leaves of the T0 transgenic lines obtained above was extracted, and the target amplification fragment was amplified using primers Wxb-PCR-F: CAAGCAGCAGCGGTCGG (SEQ ID NO: 13) and Wxb-PCR-R: TTGAAGTATGGGTTGTTGTTGAGG (SEQ ID NO: 14) containing the target site, and the amplified product was sent to Invitrogen (Shanghai) Trading Co., Ltd. for sequencing.

[0112] The sequencing results showed that the corresponding target sites of the positive T0 plants (partially) transformed with pH-nCas9-PBE-wxb#9 were identified as follows Figure 2 As shown in A, the strain numbered B1-68 is a homozygous mutation in which GG at position 475-476 mutated to AA; the strain numbered B2-42 is a biallelic mutation in which GG at position 475-476 mutated to AA in one allele, GG at position 475-476 mutated to AA in the other allele, and G at position 478 also mutated to A; the strain numbered B6-29 is a homozygous mutation in which GG at position 475-476 mutated to AA.

[0113] The identification of the corresponding target sites of the positive T0 plants (partially) transformed with pH-nCas9-PBE-wxb#24 is shown in the figure. Figure 2 As shown in B, the strain numbered B2-21 is a biallelic mutation in which the CC mutation at position 533-534 in one allele is changed to TT, and the CC mutation at position 533-534 in the other allele is changed to GT.

[0114] Example 2: Mutant exogenous DNA (T-DNA) elimination, genotyping re-identification and screening of homozygous plants

[0115] The pH-nCas9-PBE-wxb#9 and pH-nCas9-PBE-wxb#24 vectors for directional and precise single-base editing of the Wx gene constructed by the present invention are both binary T-DNA vectors. The T-DNA involved in the present invention mainly includes the hygromycin phosphotransferase HPT gene and the nCas9 nuclease gene. For the rice genome, these two genes, as representative exogenous DNA, need to be eliminated for the following reasons: 1) The main function of the hygromycin phosphotransferase HPT gene is to serve as a screening marker in the genetic transformation process, and the corresponding encoded hygromycin protein is a type of antibiotic; 2) The main function of the nCas9 gene is to complete the site-specific cutting of the target gene target site, and continued retention in the plant may cause secondary editing; 3) Random insertion of T-DNA may also lead to unexpected gene mutations, which is not conducive to trait stability; 4) The social sensitivity to transgenic issues is relatively high, and the public acceptance of T-DNA elimination materials is relatively high.

[0116] During the transformation of Suken 118 mediated by Agrobacterium, the T-DNA sequence will be randomly inserted into the chromosome in the form of single copy or multiple copies. Since rice is a strictly self-pollinating homologous diploid plant, and the T-DNA insertion site is generally not linked to its target site, on a technical level, plants that do not carry T-DNA can be isolated and identified from the offspring produced by self-pollination of transgenic plants. Even if linked, materials that do not carry T-DNA can be screened out through genetic exchange and recombination. In order to obtain the above-mentioned plants that do not carry T-DNA, the inventors simultaneously performed PCR detection on the HPT gene and nCas9 gene of the T1 generation plants of a total of 4 strains, B1-68, B2-42, B6-29 and B2-21, identified in Example 1, and repeated 3 times to screen for the T1 generation plants that do not carry these two genes, that is, the T1 generation plants with T-DNA removed, wherein the HPT gene was PCR amplified using primers hyg283-F: TCCGGAAGTGCTTGACATT (SEQ ID NO: 15) and hyg283-R: GTCGTCCATCACAGTTTGC (SEQ ID NO: 16); the nCas9 gene was PCR amplified using primers nCas9-F: CGGCTACGCTGGGTACATC (SEQ ID NO: 17) and nCas9-R: TTCTCGTTGGGCAGGTTCTT (SEQ ID NO: 18). In addition, due to the change in mutation type caused by secondary editing during the generation process (such as T0-T1 generation in the present invention) in the presence of the nCas9 protein mentioned above, it is necessary to identify the genotype again in the T-DNA deleted individual or offspring (the method and primers used are shown in Example 1) to determine that the mutant genotype has not been edited twice and can be stably inherited. The specific implementation of each individual is as follows:

[0117] The B1-68 strain identified in Example 1 was planted in an incubator and self-pollinated to obtain T1 generation seeds. 107 seeds (T1 generation) were selected for dormancy breaking and seed soaking, then sown in seedling trays and placed in a culture room. When the seedlings grew to two leaves and one heart, leaves were taken to extract DNA, and PCR detection was performed using the Hpt gene encoding hygromycin and the nCas9 gene encoding the nCas9 nuclease (the method and primers used are shown above in this example). The experiment was repeated three times, and a total of 10 individual plants were screened that could not amplify the target fragment, which were considered to be T-DNA-knocked out plants, with a ratio of 9.35%. It was speculated that T-DNA was inserted into the rice genome in multiple copies. One of the plants was selected and named 118-1-1, and the editing of the target site of the individual plant was tracked (the genotype identification method and primers are shown in Example 1). The results are as follows. Figure 3 As shown in A, 118-1-1 is a homozygous mutation of the 475-476 base GG mutation to AA, which is consistent with the previous generation (T0), indicating that no secondary editing has occurred. The single plant was planted in an incubator and self-pollinated to obtain T2 generation seeds, which were still named 118-9-15. After the T2 generation seeds broke dormancy, they were soaked, sown and planted in an incubator to verify their T-DNA carrying status. The experiment was repeated three times and found to be the same as the previous generation, indicating that the T1-T2 generations of this strain had indeed eliminated T-DNA ( Figure 4 ); In addition, the target site editing of the single strain was tracked and found to be the same as the previous generation, indicating that the mutant genotype was stably inherited from the T0-T2 generation, that is, the 475-476th position of the Wx gene GG mutated to AA, resulting in the 159th amino acid mutation from glycine to lysine. The nucleotide sequence of the Wx gene of the 118-1-1 mutant is shown in SEQ ID NO.1, and the amino acid sequence of the Wx protein encoded by it is shown in SEQ ID NO.2. The cloned new allele was named Wx m6 .

[0118] The same method and steps were used to perform generation, T-DNA elimination and genotype re-identification, and the stable, homozygous mutant strain 118-3-2 of the T2 generation of B2-42 and the stable, homozygous mutant strain 118-5-1 of the T2 generation of B6-29 were obtained. Both 118-3-2 and 118-5-1 are T-DNA elimination strains ( Figure 4 ), the target site mutation type is a homozygous mutation of the 475-476 base GG mutation to AA ( Figure 3 A), resulting in the mutation of amino acid 159 from glycine to lysine, which is similar to the newly cloned Wx m6The genes are identical, the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the Wx protein encoded by it is shown in SEQ ID NO.2. In addition, the T2 generation stable, homozygous mutant strain 118-9-15 of B2-21 was obtained, which is also a T-DNA knockout strain ( Figure 4 ), the target site mutation type is a homozygous mutation of the 533-534 base CC mutation to TT, resulting in the 178th amino acid mutation from threonine to isoleucine. The nucleotide sequence of the Wx gene of the 118-9-15 mutant is shown in SEQ ID NO.3, and the amino acid sequence of the Wx protein encoded by it is shown in SEQ ID NO.4. The cloned new allele is named Wx m10 .

[0119] Wx identified by the present invention m6 The mutation of the 475-476th base of the gene GG to AA, and the resulting mutation of the 159th amino acid from glycine to lysine, Wx m10 The mutation of the CC to TT base at position 533-534 of the gene and the resulting mutation of the amino acid 178 from threonine to isoleucine were both reported for the first time.

[0120] At the same time, the present invention uses gene editing technology for the first time to perform single base editing on the Wx gene of rice varieties, and obtains new materials with genetic stability and T-DNA removed within 2 years, specifically: Wx gene single base editing vector construction and conventional japonica rice (Suken 118 in this embodiment) genetic transformation for 4 months, T0 generation plant genotype identification and plant growth and fruiting for 5 months, T1 generation plant T-DNA removal, homozygous genotype screening and plant growth and fruiting for 5 months, T2 generation plant T-DNA detection, homozygous genotype identification and plant growth and fruiting for 5 months, a total of only about 19 months, can finally harvest the new material with the target genotype, genetic stability, T-DNA removed and has been multiplied (i.e., T3 generation 118-1-1, 118-3-2, 118-5-1 and 118-9-15 in this embodiment). Therefore, compared with chemical mutagenesis and conventional transgenic breeding, this technology can accurately and efficiently create new soft rice alleles, and at the same time shorten the breeding period for obtaining homozygous new materials by at least 4-6 years.

[0121] Example 3 Mutant phenotype analysis

[0122] Eating and Cooking Quality (ECQ) is a direct factor affecting consumer choice, and is therefore the most important evaluation index in the composition of rice quality. Although my country has issued the national standard "Sensory Evaluation Method for Rice Cooking and Eating Quality" (GB / T15682-2008), the manual tasting method is still unable to accurately identify the quality of rice because the influence of subjective factors cannot be completely eliminated. Since starch is the main component of rice endosperm, the composition and structure of starch are the most important factors affecting rice ECQ. In this example, the seeds (T3 generation) of the four T2 generation T-DNA-knocked homozygous mutants 118-1-1, 118-3-2, 118-5-1 and 118-9-15 obtained in Example 2 were used to measure some physical and chemical indicators of starch, thereby objectively evaluating rice ECQ.

[0123] 1. Determination of amylose content

[0124] Previous studies have shown that AC is an important trait that determines the quality of rice cooking and eating. It is not only related to the stickiness and softness of rice, but also closely related to many starch physical and chemical parameters such as viscosity, gelatinization properties, and retrogradation properties. The specific method for AC determination was carried out in accordance with the standard NY147-88 issued by the Ministry of Agriculture. Four reference standard samples (AC: 1.5%, 10.6%, 16.4% and 25.6%) were purchased from the China National Rice Research Institute. The results are as follows Figure 5 As shown, 118-1-1 was 12.9±0.1%, 118-3-2 was 11.9±0.1%, 118-5-1 was 11.9±0.1%, and 118-9-15 was 9.8±0.2%. Compared with the wild type of 14.4±0.2%, the AC of 118-1-1, 118-3-2, and 118-5-1 with the same genotype decreased by 1.5-2.5%, and the AC of 118-9-15 decreased by 4.6%.

[0125] 2. Determination of viscosity of rice RVA spectrum

[0126] There is a close relationship between the RVA spectrum characteristic value of rice and the cooking and eating quality of rice. The rapid viscosity analyzer (RVA Super 4, NEWPORT SCIENTIFIC, Australia) was used for measurement, and the parameters were set according to the American Association of Cereal Chemists AACC61-01 and 61-02 operating procedures. Previous studies have shown that rice with good eating quality often has a larger disintegration value (BDV), and cold rice that is relatively unrecovered often has a smaller recovery value (CSV). In addition, the peak time PeT refers to the time it takes for the sample to reach the peak viscosity. Generally, the smaller the PeT, the better the swelling and breakage of starch granules. As shown in the results Table 1, the BDVs of 118-1-1, 118-3-2, 118-5-1 and 118-9-15 were 943 cP, 946 cP, 1128 cP, 1324 cP, respectively, which were significantly greater than the wild type of 862 cP; the CSVs of 118-1-1, 118-3-2, 118-5-1 and 118-9-15 were 1070 cP, 1049 cP, 1067 cP, 1010 cP, respectively, which were significantly less than the wild type of 1250 cP; the PeTs of 118-1-1, 118-3-2, 118-5-1 and 118-9-15 were 6.13 min, 6.07 min, 6 min, 5.87 min, respectively, which were significantly less than the wild type of 6.2 min. This data shows that compared with the wild type, the four mutants have better taste quality, the cold rice is relatively less retarded, and their starch granules have better swelling and breakage during cooking. Figure 6 As shown in A.

[0127] Further correlation analysis of the above data showed that BDV and AC showed a very significant negative correlation, CSV and AC showed a very significant positive correlation, and PeT and AC showed a very significant positive correlation ( Figure 6 B).

[0128] Table 1 RVA spectrum characteristic values

[0129]

[0130] 3. Thermodynamic properties

[0131] The gelatinization of rice is closely related to the cooking and eating quality. The gelatinization of rice with high gelatinization temperature requires a higher cooking temperature. The thermodynamic parameters measured by the DSC instrument can accurately reflect the gelatinization characteristics of rice. The thermodynamic properties of starch granules were analyzed using a differential calorimeter DSC (Q2000, TAInstruments, USA). The results are shown in Table 2. The temperatures To and Tp at each gelatinization stage are the maximum in the wild type WT, Tc is the maximum in 118-1-1, To, Tp and Tc are the minimum in 118-3-2, but the overall differences are not large; the gelatinization enthalpy ΔHgel is the largest in 118-9-15 and the smallest in WT, and the rest of the differences are not large. The above results show that the gelatinization characteristics are random among the test samples, and the gelatinization temperature of 118-1-1 is the highest, which is consistent with the PaT measured by the RVA instrument.

[0132] Table 2 Thermodynamic properties

[0133]

[0134] 4. Observation of polished rice transparency

[0135] Transparency is one of the main indicators for measuring the appearance quality of rice. The present invention uses wild Suken 118 (non-soft rice, transparent) and Nanjing 9108 (Wx mp The soft rice of the mutant genotype was cloudy) polished rice as a control to observe the appearance of the mutant polished rice. The rice was husked and roughened by a rice husker (SY88-TH, Ssangyong, South Korea), and polished by a small rice polisher (BLH-3120, Bethlehem, Taizhou) to obtain polished rice. The moisture content of the polished rice was measured by a moisture analyzer (Metteler, Switzerland) to ensure the consistency of the moisture content of the test samples. Figure 7 As shown in the figure, when the moisture content is 10.1%, the polished rice of Suken 118 is still transparent, but the polished rice of Nanjing 9108 is cloudy and has poor transparency; the four mutants behave the same as Suken 118 and are still transparent. This indicates that the rice contains two new alleles (Wx m6 , Wx m10 ) had different degrees of decrease in the amylose content of the four mutants, especially the mutant 118-9-15AC which decreased to 9.8%, but they still maintained good transparency in appearance.

[0136] Example 4 Co-isolation and preliminary functional analysis

[0137] 1. Co-segregation analysis

[0138] In order to verify that the phenotypes such as reduced AC in the mutants are caused by the mutation of the target gene, a co-segregation analysis was performed genetically. The T2 generation T-DNA-knocked homozygous mutants 118-5-1 (118-1-1, 118-3-2 and 118-5-1 have the same genotype, 118-5-1 is selected as a representative) and 118-9-15 plants obtained in Example 2 were hybridized with high-generation stable breeding material 93042 (AC is 15.6±0.2%), and after self-pollination of F1, 112 and 131 F2 plants were obtained, respectively, and the genotypes of each plant were detected. The method and primers used for genotype identification are shown in Example 1, and then the wild type and homozygous mutant genotype plants were selected for phenotypic (AC as a representative indicator) analysis, and the AC detection method is shown in Example 3.

[0139] The results showed that among the 118 F2 plants created by the cross between 118-5-1 and 93042, 35 plants with wild-type genotype were obtained, and the AC of all plants was >14%. m6 There were 23 mutant genotypes, and AC was less than 12% in all of them, indicating that Wx m6 and AC decreased phenotypes co-segregated.

[0140] Among the 131 F2 plants created by the cross between 118-9-15 and 93042, 31 plants with wild-type genotype were obtained, and all AC were >14%; 10 There were 24 mutant genotypes, and AC was less than 12% in all of them, indicating that Wx m10 and AC decreased phenotypes co-segregated.

[0141] The above results verified that phenotypes such as decreased AC in the mutant were indeed caused by mutations in the target gene.

[0142] 2. Wild-type Wx and Wx m6 、Wx m10 Detection of mutant protease activity and correlation analysis with AC

[0143] As mentioned above, rice Wx gene is the main effect gene controlling the synthesis of amylose, which encodes granular starch synthase. Generally speaking, Wx enzyme activity is positively correlated with AC, and the enzyme activity in materials with reduced AC is correspondingly reduced. In order to verify this concept, enzyme activity detection was performed according to the method of predecessors (Liu DR et al., Plant Sci, 2013, 210, 141-150). The results are as follows Figure 8 As shown in A, the wild-type Wx protease activity was the highest, at 1011.3±80.3nmol / min / g, and the enzyme activity of the mutant proteins was significantly reduced, among which Wx in 118-1-1, 118-3-2 and 118-5-1 m6The activities of Wx in 118-9-15 were 712.1±54.1, 688.3±40.0 and 913.3±63.0 nmol / min / g, respectively. m10 The activity was the lowest, which was 439.4±30.1nmol / min / g.

[0144] Further correlation analysis of the above data showed that the Wx enzyme activity in each sample was significantly positively correlated with AC ( Figure 8 B).

[0145] 3. 3D structure prediction

[0146] The wild type, Wx m6 and Wx m10 The three-dimensional structure of the mutant protein was predicted. m6 The mutation of glycine to lysine at position 159 in the mutant protein did not change the β-turn conformation at this site ( Fig. 9 AB); compared with the wild-type protein, Wx m10 The mutation of Threonine at position 178 to Isoleucine in the mutant protein did not change the random coil conformation at this site (Figure 9C-D). The above results indicate that the phenotype of decreased AC and decreased activity of mutant protease is not caused by changes in the secondary structure of the protein caused by a single amino acid mutation. It is speculated that the causes of the phenotype may be: 1) The amino acids at positions 159 and 178 are located in the core catalytic domain of starch synthase at positions 84-345, and the mutation affects the catalytic ability of the protein; 2) The amino acids at positions 159 and 178 are close to the amino acid residues at positions 33-36 (Lys-Ser-Gly-Gly), which is considered to be the binding site for ADP-glucose during starch and glycogen synthesis. The mutation may lead to a decrease in the binding ability of this binding site; 3) The amino acids at positions 159 and 178 may both be phosphorylation sites, and the mutation causes a decrease in phosphorylation ability, thereby leading to a decrease in enzyme activity.

[0147] Example 5: Application of Wx mutant protein and its gene in rice breeding

[0148] 1. Wx m6 and Wx m10 Feature flag development and application

[0149] Molecular marker-assisted selection is helpful to speed up the breeding process. m6 and Wx m10The genes are all two consecutive base mutations, and the enzyme target markers can be designed specifically, but the process is relatively cumbersome. The allele-specific PCR is developed, and the genotypes with high / low amylose content can be distinguished by two PCRs. The operation is simple and fast. m6 Base variation at position 475-476 of the gene, wild type and mutant in Wx m10 Based on the base variation at position 533-534 of the gene, six sets of primers were designed using the principle of allele-specific PCR (Table 3): m6 Genes Wx1 to Wx6, targeting wild type and Wx m10 Wx7 to Wx12 of the gene. Among them, Wx1 to Wx12 all share the downstream primer Wx-1R, and the upstream primers are Wx-1F to Wx-12F respectively. In order to further improve the specificity of the primers, base mismatches were introduced at the 3' end of some primers: the third to last base at the 3' end of the Wx-3F and Wx-4F primers was mismatched from T to G; the third to last base at the 3' end of the Wx-5F and Wx-6F primers was mismatched from T to C; the third to last base at the 3' end of the Wx-13F and Wx-14F primers was mismatched from A to G; the third to last base at the 3' end of the Wx-15F and Wx-16F primers was mismatched from A to C.

[0150] After multiple rounds of screening and optimization of PCR reaction conditions, such as Fig.10 As shown in the figure, it was found that the primer pairs Wx1 and Wx2 have good amplification efficiency and specificity, and can be used to distinguish between wild type and mutant Wx m6 Primer pairs for differentiating wild-type and heterozygous genotypes; primer pairs Wx9 and Wx10 have good amplification efficiency and specificity, and can be used to distinguish wild-type, mutant Wx m10 Genotype and heterozygous genotype primer pairs. The best PCR reaction system is: wild-type or mutant DNA template 1μL, 2×PCRTaq enzyme mix 7.5μL, upstream primer (2pM) 0.75μL, downstream primer (2pM) 0.75μL, ddH2O5μL. The PCR reaction program is 94℃5min; 94℃30s, 56℃30s, 72℃30s, 33 cycles; 72℃5min; 4℃ storage.

[0151] Table 3 Molecular markers for detecting mutant genes

[0152]

[0153] Note: Bases marked with lowercase letters are mismatched bases.

[0154] Use Wx1+Wx2 and Wx9+Wx10 markers to detect rice varieties. Fig.11 AB, it was found that in the test samples, 118-1-1, 118-3-2 and 118-5-1 could not be amplified by Wx1, but could be amplified by Wx2. The wild-type Suken 118, 118-9-15 and other japonica or indica rice varieties (Nipponbare, Nanjing 9108, Huanghuazhan, 9311, Huaidao 5, Changnongjing 8, Nanjing 51, Lianjing 7, Suxiu 867, Wuyunjing 27, Wuyunjing 29, Xudao 8, Xudao 9, Yandao 16) could be amplified by Wx1, but not by Wx2, indicating that Wx1+Wx2 can specifically detect Wx m6 The mutation of the 475-476 base of the gene from GG to AA can be used for molecular marker-assisted selection breeding.

[0155] In addition, if Fig.11 CD, 118-9-15 could not be amplified by Wx9, but could be amplified by Wx10. Wild-type Suken 118, 118-1-1, 118-3-2, 118-5-1 and other japonica or indica rice varieties could be amplified by Wx9, but not by Wx10. This indicates that Wx9+Wx10 can specifically detect Wx m10 The mutation of the 533-534 base of the gene from CC to TT can be used for molecular marker-assisted selection breeding.

[0156] In order to verify the application of Wx1+Wx2 and Wx9+Wx10 in sub-marker assisted selection breeding, 112 F2 plants created by hybridization of 118-5-1 and 93042 obtained in Example 4 were tested using Wx1+Wx2. The results showed that the genotypes detected and resolved using the marker were completely consistent with the genotypes detected using the sequencing method (see Example 1) (including 35 wild-type plants, 60 heterozygous plants and 23 homozygous Wx m6 In addition, 131 F2 plants created by hybridization of 18-9-15 and 93042 obtained in Example 4 were tested using Wx9+Wx10. The results showed that the genotypes detected and resolved using this marker were completely consistent with the genotypes detected using the sequencing method (see Example 1) (including 31 wild-type plants, 76 heterozygous plants and 24 homozygous Wx m10 The above results show that the Wx1+Wx2 and Wx9+Wx10 markers developed by the present invention can be used for precise breeding of quality improvement breeding, and the homozygous genotypes with transparent appearance, reduced AC and improved taste quality can be screened in the F2 generation, thereby enabling early generation selection.

[0157] 2. Directly use rice varieties with excellent agronomic traits as background materials for transformation

[0158] Jinjing 818 is a japonica rice variety bred by Tianjin Rice Research Institute and planted in the Beijing-Tianjin-Tangshan japonica rice area. This variety is a non-soft rice variety with an AC of about 16%. The gene editing method described in the present invention can reduce the AC of this variety and improve the taste quality without affecting the appearance quality. The actual Jinjing 818 used comes from the germplasm resource platform of Jiangsu Academy of Agricultural Sciences.

[0159] 1) The vectors, transformation methods and genotype identification methods used are shown in Example 1. Finally, 9 positive T0 generation plants transformed with pH-nCas9-PBE-wxb#9 were obtained, and 6 positive T0 generation plants transformed with pH-nCas9-PBE-wxb#24 were obtained.

[0160] 2) The method of eliminating mutant T-DNA, adding homozygous generations and re-identifying genotypes is shown in Example 2. Fig.12 AB, screened to obtain homozygous Wx m6 There were five mutant T2 lines with T-DNA deleted: 818-4-13, 818-5-8, 818-6-8, 818-10-2 and 818-4-15; homozygous Wx m10 There is one T2 generation strain with mutant type and T-DNA knocked out: 818-9-7.

[0161] 3) Mutant phenotype identification. The AC and RVA spectrum viscosity determination and polished rice transparency observation methods are shown in Example 3. Fig.12 C, the wild type AC was 14.1±0.3% at the maximum, and each mutant was significantly reduced, with 818-9-7 being the lowest at 7.6±0.1%. Fig.12 D, the minimum value of wild-type BDV is 975 cP, and each mutant has a significant increase, among which 818-9-7 has the highest value of 1540 cP. Fig.12 E, the maximum value of wild-type CSV is 1295 cP, and each mutant has significantly reduced it, among which 818-9-7 has the lowest value of 912 cP. Fig.12 F, the wild type has a maximum PeT of 6.27 min, and each mutant has a significant decrease, among which 818-9-7 has the lowest PeT of 5.6 min. Fig.12 As shown in G, when the moisture content is 13.5%, the polished rice of Jinjing 818 is still transparent, but that of Nanjing 9108 is cloudy and has poor transparency; the performance of the six mutants is the same as that of Jinjing 818, and they are still transparent.

[0162] 4) Enzyme activity detection method see Example 4. Results Fig.12As shown in H, the wild-type Wx protease activity was the highest, 788.92±16.53nmol / min / g, and the enzyme activity of the mutant protein was significantly reduced, among which Wx in 818-9-7 m10 The activity was the lowest, which was 407±30.01nmol / min / g.

[0163] The above results show that Wx m6 and Wx m10 Mutants can reproduce the target excellent traits and quickly obtain related plant materials.

[0164] The above specific examples show that by using gene editing technology to perform single base editing on the Wx gene, through the screening of the offspring, a stable genetic new material can be obtained in the T2 generation, which eliminates T-DNA, reduces AC, and improves the taste quality without affecting the appearance quality. Compared with breeding methods such as chemical mutagenesis and hybridization, the gene editing method has the advantages of rapid, accurate, and efficient molecular breeding technology. Combined with gene function marker genotype selection, or directly using other mature rice varieties as background materials for transformation and obtaining corresponding materials, it will greatly improve the breeding efficiency and greatly accelerate the breeding process (Table 4).

[0165] Table 4 Comparison of gene editing breeding methods and traditional breeding methods

[0166] Sequence Listing <110> Jiangsu Academy of Agricultural Sciences, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences <120> Application of Wx mutant proteins and their genes in plant breeding based on gene editing technology <160> 31 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1830 <212> DNA <213> Wx-m1 mutant gene (granule-bound starch synthase) <400> 1 atgtcggctc tcaccacgtc ccagctcgcc acctcggcca ccggcttcgg catcgccgac 60 aggtcggcgc cgtcgtcgct gctccgccac gggttccagg gcctcaagcc ccgcagcccc 120 gccggcggcg acgcgacgtc gctcagcgtg acgaccagcg cgcgcgcgac gcccaagcag 180 cagcggtcgg tgcagcgtgg cagccggagg ttcccctccg tcgtcgtgta cgccaccggc 240 gccggcatga acgtcgtgtt cgtcggcgcc gagatggccc cctggagcaa gaccggcggc 300 ctcggtgacg tcctcggtgg cctcccccct gccatggctg cgaatggcca cagggtcatg 360 gtgatctctc ctcggtacga ccagtacaag gacgcttggg ataccagcgt tgtggctgag 420 atcaaggttg cagacaggta cgagagggtg aggtttttcc attgctacaa gcgtaaagtc 480 gaccgtgtgt tcatcgacca tccgtcattc ctggagaagg tttggggaaa gaccggtgag 540 aagatctacg gacctgacac tggagttgat tacaaagaca accagatgcg tttcagcctt 600 ctttgccagg cagcactcga ggctcctagg atcctaaacc tcaacaacaa cccatacttc 660 aaaggaactt atggtgagga tgttgtgttc gtctgcaacg actggcacac tggcccactg 720 gcgagctacc tgaagaacaa ctaccagccc aatggcatct acaggaatgc aaaggttgct 780 ttctgcatcc acaacatctc ctaccagggc cgtttcgctt tcgaggatta ccctgagctg 840 aacctctccg agaggttcag gtcatccttc gatttcatcg acgggtatga cacgccggtg 900 gagggcagga agatcaactg gatgaaggcc ggaatcctgg aagccgacag ggtgctcacc 960 gtgagcccgt actacgccga ggagctcatc tccggcatcg ccaggggatg cgagctcgac 1020 aacatcatgc ggctcaccgg catcaccggc atcgtcaacg gcatggacgt cagcgagtgg 1080 gatcctagca aggacaagta catcaccgcc aagtacgacg caaccacggc aatcgaggcg 1140 aaggcgctga acaaggaggc gttgcaggcg gaggcgggtc ttccggtcga caggaaaatc 1200 ccactgatcg cgttcatcgg caggctggag gaacagaagg gccctgacgt catggccgcc 1260 gccatcccgg agctcatgca ggaggacgtc cagatcgttc ttctgggtac tggaaagaag 1320 aagttcgaga agctgctcaa gagcatggag gagaagtatc cgggcaaggt gagggccgtg 1380 gtgaagttca acgcgccgct tgctcatctc atcatggccg gagccgacgt gctcgccgtc 1440 cccagccgct tcgagccctg tggactcatc cagctgcagg ggatgagata cggaacgccc 1500 tgtgcttgcg cgtccaccgg tgggctcgtg gacacggtca tcgaaggcaa gactggtttc 1560 cacatgggcc gtctcagcgt cgactgcaag gtggtggagc caagcgacgt gaagaaggtg 1620 gcggccaccc tgaagcgcgc catcaaggtc gtcggcacgc cggcgtacga ggagatggtc 1680 aggaactgca tgaaccagga cctctcctgg aaggggcctg cgaagaactg ggagaatgtg 1740 ctcctgggcc tgggcgtcgc cggcagcgcg ccggggatcg aaggcgacga gatcgcgccg 1800 ctcgccaagg agaacgtggc tgctccttga 1830 <210> 2 <211> 609 <212> PRT <213> Wx-m1 mutant protein (granule-bound starch synthase) <400> 2 Met Ser Ala Leu Thr Thr Ser Gln Leu Ala Thr Ser Ala Thr Gly Phe 1 5 10 15 Gly Ile Ala Asp Arg Ser Ala Pro Ser Ser Leu Leu Arg His Gly Phe 20 25 30 Gln Gly Leu Lys Pro Arg Ser Pro Ala Gly Gly Asp Ala Thr Ser Leu 35 40 45 Ser Val Thr Thr Ser Ala Arg Ala Thr Pro Lys Gln Gln Arg Ser Val 50 55 60 Gln Arg Gly Ser Arg Arg Phe Pro Ser Val Val Val Tyr Ala Thr Gly 65 70 75 80 Ala Gly Met Asn Val Val Phe Val Gly Ala Glu Met Ala Pro Trp Ser 85 90 95 Lys Thr Gly Gly Leu Gly Asp Val Leu Gly Gly Leu Pro Pro Ala Met 100 105 110 Ala Ala Asn Gly His Arg Val Met Val Ile Ser Pro Arg Tyr Asp Gln 115 120 125 Tyr Lys Asp Ala Trp Asp Thr Ser Val Val Ala Glu Ile Lys Val Ala 130 135 140 Asp Arg Tyr Glu Arg Val Arg Phe Phe His Cys Tyr Lys Arg Lys Val 145 150 155 160 Asp Arg Val Phe Ile Asp His Pro Ser Phe Leu Glu Lys Val Trp Gly 165 170 175 Lys Thr Gly Glu Lys Ile Tyr Gly Pro Asp Thr Gly Val Asp Tyr Lys 180 185 190 Asp Asn Gln Met Arg Phe Ser Leu Leu Cys Gln Ala Ala Leu Glu Ala 195 200 205 Pro Arg Ile Leu Asn Leu Asn Asn Asn Pro Tyr Phe Lys Gly Thr Tyr 210 215 220 Gly Glu Asp Val Val Phe Val Cys Asn Asp Trp His Thr Gly Pro Leu 225 230 235 240 Ala Ser Tyr Leu Lys Asn Asn Tyr Gln Pro Asn Gly Ile Tyr Arg Asn 245 250 255 Ala Lys Val Ala Phe Cys Ile His Asn Ile Ser Tyr Gln Gly Arg Phe 260 265 270 Ala Phe Glu Asp Tyr Pro Glu Leu Asn Leu Ser Glu Arg Phe Arg Ser 275 280 285 Ser Phe Asp Phe Ile Asp Gly Tyr Asp Thr Pro Val Glu Gly Arg Lys 290 295 300 Ile Asn Trp Met Lys Ala Gly Ile Leu Glu Ala Asp Arg Val Leu Thr 305 310 315 320 Val Ser Pro Tyr Tyr Ala Glu Glu Leu Ile Ser Gly Ile Ala Arg Gly 325 330 335 Cys Glu Leu Asp Asn Ile Met Arg Leu Thr Gly Ile Thr Gly Ile Val 340 345 350 Asn Gly Met Asp Val Ser Glu Trp Asp Pro Ser Lys Asp Lys Tyr Ile 355 360 365 Thr Ala Lys Tyr Asp Ala Thr Thr Ala Ile Glu Ala Lys Ala Leu Asn 370 375 380 Lys Glu Ala Leu Gln Ala Glu Ala Gly Leu Pro Val Asp Arg Lys Ile 385 390 395 400 Pro Leu Ile Ala Phe Ile Gly Arg Leu Glu Glu Gln Lys Gly Pro Asp 405 410 415 Val Met Ala Ala Ala Ile Pro Glu Leu Met Gln Glu Asp Val Gln Ile 420 425 430 Val Leu Leu Gly Thr Gly Lys Lys Lys Phe Glu Lys Leu Leu Lys Ser 435 440 445 Met Glu Glu Lys Tyr Pro Gly Lys Val Arg Ala Val Val Lys Phe Asn 450 455 460 Ala Pro Leu Ala His Leu Ile Met Ala Gly Ala Asp Val Leu Ala Val 465 470 475 480 Pro Ser Arg Phe Glu Pro Cys Gly Leu Ile Gln Leu Gln Gly Met Arg 485 490 495 Tyr Gly Thr Pro Cys Ala Cys Ala Ser Thr Gly Gly Leu Val Asp Thr 500 505 510 Val Ile Glu Gly Lys Thr Gly Phe His Met Gly Arg Leu Ser Val Asp 515 520 525 Cys Lys Val Val Glu Pro Ser Asp Val Lys Lys Val Ala Ala Thr Leu 530 535 540 Lys Arg Ala Ile Lys Val Val Gly Thr Pro Ala Tyr Glu Glu Met Val 545 550 555 560 Arg Asn Cys Met Asn Gln Asp Leu Ser Trp Lys Gly Pro Ala Lys Asn 565 570 575 Trp Glu Asn Val Leu Leu Gly Leu Gly Val Ala Gly Ser Ala Pro Gly 580 585 590 Ile Glu Gly Asp Glu Ile Ala Pro Leu Ala Lys Glu Asn Val Ala Ala 595 600 605 Pro <210> 3 <211> 1830 <212> DNA <213> Wx-m2 mutant gene (granule-bound starch synthase) <400> 3 atgtcggctc tcaccacgtc ccagctcgcc acctcggcca ccggcttcgg catcgccgac 60 aggtcggcgc cgtcgtcgct gctccgccac gggttccagg gcctcaagcc ccgcagcccc 120 gccggcggcg acgcgacgtc gctcagcgtg acgaccagcg cgcgcgcgac gcccaagcag 180 cagcggtcgg tgcagcgtgg cagccggagg ttcccctccg tcgtcgtgta cgccaccggc 240 gccggcatga acgtcgtgtt cgtcggcgcc gagatggccc cctggagcaa gaccggcggc 300 ctcggtgacg tcctcggtgg cctcccccct gccatggctg cgaatggcca cagggtcatg 360 gtgatctctc ctcggtacga ccagtacaag gacgcttggg ataccagcgt tgtggctgag 420 atcaaggttg cagacaggta cgagagggtg aggtttttcc attgctacaa gcgtggagtc 480 gaccgtgtgt tcatcgacca tccgtcattc ctggagaagg tttggggaaa gattggtgag 540 aagatctacg gacctgacac tggagttgat tacaaagaca accagatgcg tttcagcctt 600 ctttgccagg cagcactcga ggctcctagg atcctaaacc tcaacaacaa cccatacttc 660 aaaggaactt atggtgagga tgttgtgttc gtctgcaacg actggcacac tggcccactg 720 gcgagctacc tgaagaacaa ctaccagccc aatggcatct acaggaatgc aaaggttgct 780 ttctgcatcc acaacatctc ctaccagggc cgtttcgctt tcgaggatta ccctgagctg 840 aacctctccg agaggttcag gtcatccttc gatttcatcg acgggtatga cacgccggtg 900 gagggcagga agatcaactg gatgaaggcc ggaatcctgg aagccgacag ggtgctcacc 960 gtgagcccgt actacgccga ggagctcatc tccggcatcg ccaggggatg cgagctcgac 1020 aacatcatgc ggctcaccgg catcaccggc atcgtcaacg gcatggacgt cagcgagtgg 1080 gatcctagca aggagagaga catcaccgcc aagtacgacg caaccacggc aatcgaggcg 1140 aaggcgctga acaaggaggc gttgcaggcg gaggcgggtc ttccggtcga caggaaaatc 1200 ccactgatcg cgttcatcgg caggctggag gaagaagg gccctgacgt catggccgcc 1260 gccatcccgg agctcatgca ggaggacgtc cagatcgttc ttctgggtac tggaaag 1320 aagttcgaga agctgctcaa gagcatggag gagaggatc cgggcaaggt gagggccgtg 1380 gtgaagttca acgcgccgct tgctcatctc atcatggccg gagccgacgt gctcgccgtc 1440 cccagccgct tcgagccctg tggactcatc cagctgcagg ggatgagata cggaacgcccc 1500 tgtgcttgcg cgtccaccgg tgggctcgtg gacacggtca tcgaaggcaa gactggtttc 1560 cacatgggcc gtctcagcgt cgactgcaag gtggtggagc caagcgacgt gaagaaggtg 1620 gcggccaccc tgaagcgcgc catcaaggtc gtcggcacgc cggcgtacga ggagatggtc 1680 1740 ctcctgggcc tgggcgtcgc cggcagcgcg ccggggatcg aaggcgacga gatcgcgccg 1800 ctcgccaagg agaacgtggc tgctccttga 1830 <210> 4 <211> 609 <212> PRT <213> Wx-m2 mutant protein (granule-bound starch synthase) <400> 4 Met Ser Ala Leu Thr Thr Ser Gln Leu Ala Thr Ser Ala Thr Gly Phe 1 5 10 15 Gly Ile Ala Asp Arg Ser Ala Pro Ser Ser Leu Leu Arg His Gly Phe 20 25 30 Gln Gly Leu Lys Pro Arg Ser Pro Ala Gly Gly Asp Ala Thr Ser Leu 35 40 45 Ser Val Thr Thr Ser Ala Arg Ala Thr Pro Lys Gln Gln Arg Ser Val 50 55 60 Gln Arg Gly Ser Arg Arg Phe Pro Ser Val Val Val Tyr Ala Thr Gly 65 70 75 80 Ala Gly Met Asn Val Val Phe Val Gly Ala Glu Met Ala Pro Trp Ser 85 90 95 Lys Thr Gly Gly Leu Gly Asp Val Leu Gly Gly Leu Pro Pro Ala Met 100 105 110 Ala Ala Asn Gly His Arg Val Met Val Ile Ser Pro Arg Tyr Asp Gln 115 120 125 Tyr Lys Asp Ala Trp Asp Thr Ser Val Val Ala Glu Ile Lys Val Ala 130 135 140 Asp Arg Tyr Glu Arg Val Arg Phe Phe His Cys Tyr Lys Arg Gly Val 145 150 155 160 Asp Arg Val Phe Ile Asp His Pro Ser Phe Leu Glu Lys Val Trp Gly 165 170 175 Lys Ile Gly Glu Lys Ile Tyr Gly Pro Asp Thr Gly Val Asp Tyr Lys 180 185 190 Asp Asn Gln Met Arg Phe Ser Leu Leu Cys Gln Ala Ala Leu Glu Ala 195 200 205 Pro Arg Ile Leu Asn Leu Asn Asn Asn Pro Tyr Phe Lys Gly Thr Tyr 210 215 220 Gly Glu Asp Val Val Phe Val Cys Asn Asp Trp His Thr Gly Pro Leu 225 230 235 240 Ala Ser Tyr Leu Lys Asn Asn Tyr Gln Pro Asn Gly Ile Tyr Arg Asn 245 250 255 Ala Lys Val Ala Phe Cys Ile His Asn Ile Ser Tyr Gln Gly Arg Phe 260 265 270 Ala Phe Glu Asp Tyr Pro Glu Leu Asn Leu Ser Glu Arg Phe Arg Ser 275 280 285 Ser Phe Asp Phe Ile Asp Gly Tyr Asp Thr Pro Val Glu Gly Arg Lys 290 295 300 Ile Asn Trp Met Lys Ala Gly Ile Leu Glu Ala Asp Arg Val Leu Thr 305 310 315 320 Val Ser Pro Tyr Tyr Ala Glu Glu Leu Ile Ser Gly Ile Ala Arg Gly 325 330 335 Cys Glu Leu Asp Asn Ile Met Arg Leu Thr Gly Ile Thr Gly Ile Val 340 345 350 Asn Gly Met Asp Val Ser Glu Trp Asp Pro Ser Lys Asp Lys Tyr Ile 355 360 365 Thr Ala Lys Tyr Asp Ala Thr Thr Ala Ile Glu Ala Lys Ala Leu Asn 370 375 380 Lys Glu Ala Leu Gln Ala Glu Ala Gly Leu Pro Val Asp Arg Lys Ile 385 390 395 400 Pro Leu Ile Ala Phe Ile Gly Arg Leu Glu Glu Gln Lys Gly Pro Asp 405 410 415 Val Met Ala Ala Ala Ile Pro Glu Leu Met Gln Glu Asp Val Gln Ile 420 425 430 Val Leu Leu Gly Thr Gly Lys Lys Lys Phe Glu Lys Leu Leu Lys Ser 435 440 445 Met Glu Glu Lys Tyr Pro Gly Lys Val Arg Ala Val Val Lys Phe Asn 450 455 460 Ala Pro Leu Ala His Leu Ile Met Ala Gly Ala Asp Val Leu Ala Val 465 470 475 480 Pro Ser Arg Phe Glu Pro Cys Gly Leu Ile Gln Leu Gln Gly Met Arg 485 490 495 Tyr Gly Thr Pro Cys Ala Cys Ala Ser Thr Gly Gly Leu Val Asp Thr 500 505 510 Val Ile Glu Gly Lys Thr Gly Phe His Met Gly Arg Leu Ser Val Asp 515 520 525 Cys Lys Val Val Glu Pro Ser Asp Val Lys Lys Val Ala Ala Thr Leu 530 535 540 Lys Arg Ala Ile Lys Val Val Gly Thr Pro Ala Tyr Glu Glu Met Val 545 550 555 560 Arg Asn Cys Met Asn Gln Asp Leu Ser Trp Lys Gly Pro Ala Lys Asn 565 570 575 Trp Glu Asn Val Leu Leu Gly Leu Gly Val Ala Gly Ser Ala Pro Gly 580,585,590 Ile Glu Gly Asp Glu Ile Wing Pro Leu Wing Lys Glu Asn Val Wing Wing 595,600,605 Pro <210> 5 <211> 18 <212> DNA <213> Wx-F(Artificial Sequence) <400> 5 ccctagccac 18 <210> 6 <211> 22 <212> DNA <213> Wx-F(Artificial Sequence) <400> 6 Caccagaag dates back to ca. 22 <210> 7 <211> 20 <212> DNA <213> wxb#9(Artificial Sequence) <400> 7 cgactccacg cttgtagcaa 20 <210> 8 <211> 20 <212> DNA <213> wxb#24(Artificial Sequence) <400> 8 aagaccggtg aagagatcta 20 <210> 9 <211> 24 <212> DNA <213> wxb#9-F(Artificial Sequence) <400> 9 ggcgcgactc cacgcttgta gcaa 24 <210> 10 <211> 24 <212> DNA <213> wxb#9-R(Artificial Sequence) <400> 10 aaacttgcta caagcgtgga gtcg 24 <210> 11 <211> 24 <212> DNA <213> wxb#24-F(Artificial Sequence) <400> 11 ggcgaagacc ggtgagaaga tcta 24 <210> 12 <211> 24 <212> DNA <213> wxb#24-R(Artificial Sequence) <400> 12 aaactagatc ttctcaccgg tctt 24 <210> 13 <211> 17 <212> DNA <213> Wxb-PCR-F(Artificial Sequence) <400> 13 caagcagcag cggtcgg 17 <210> 14 <211> 24 <212> DNA <213> Wxb-PCR-R(Artificial Sequence) <400> 14 ttgaagtatg ggttgttgtt gagg 24 <210> 15 <211> 19 <212> DNA <213> hyg283-F(Artificial Sequence) <400> 15 tccggaagtg cttgacatt 19 <210> 16 <211> 19 <212> DNA <213> hyg283-R(Artificial Sequence) <400> 16 gtcgtccatc acagtttgc 19 <210> 17 <211> 19 <212> DNA <213> nCas9-F(Artificial Sequence) <400> 17 cggctacgct gggtacatc 19 <210> 18 <211> 20 <212> DNA <213> nCas9-R(Artificial Sequence) <400> 18 ttctcgttgg gcaggttctt 20 <210> 19 <211> 20 <212> DNA <213> Wx-1F(Artificial Sequence) <400> 19 ttccattgct acaagcgtgg 20 <210> 20 <211> 21 <212> DNA <213> Wx-1R(Artificial Sequence) <400> 20 tcatcatgga ttccttcgaa g 21 <210> 21 <211> 20 <212> DNA <213> Wx-2F(Artificial Sequence) <400> 21 ttccattgct acaagcgtaa 20 <210> 22 <211> 20 <212> DNA <213> Wx-3F(Artificial Sequence) <400> 22 ttccattgct acaagcgggg 20 <210> 23 <211> 20 <212> DNA <213> Wx-4F(Artificial Sequence) <400> 23 ttccattgct acaagcggaa 20 <210> 24 <211> 20 <212> DNA <213> Wx-5F(Artificial Sequence) <400> 24 ttccattgct acaagcgcgg 20 <210> 25 <211> 20 <212> DNA <213> Wx-6F(Artificial Sequence) <400> 25 ttccattgct acaagcgcaa 20 <210> 26 <211> 22 <212> DNA <213> Wx-7F(Artificial Sequence) <400> 26 atttcaggtt tggggaaaga cc 22 <210> 27 <211> 22 <212> DNA <213> Wx-8F(Artificial Sequence) <400> 27 atttcaggtt tggggaaaga tt 22 <210> 28 <211> 22 <212> DNA <213> Wx-9F(Artificial Sequence) <400> 28 atttcaggtt tggggaaagg cc 22 <210> 29 <211> 22 <212> DNA <213> Wx-10F(Artificial Sequence) <400> 29 atttcaggtt tggggaaagg tt 22 <210> 30 <211> 22 <212> DNA <213> Wx-11F(Artificial Sequence) <400> 30 atttcaggtt tggggaaagc cc 22 <210> 31 <211> 22 <212> DNA <213> Wx-12F(Artificial Sequence) <400> 31 atttcaggtt tggggaaagc tt 22

Claims

1. A rice Wx mutant protein, characterized in that: The amino acid sequence of the Wx mutant protein has the following mutation: the 178th amino acid corresponding to the amino acid sequence of rice Wx is mutated, and the amino acid sequence of the Wx mutant protein is shown in SEQ ID NO:

4.

2. The rice Wx mutant protein according to claim 1, characterized in that The amino acid sequence of the Wx mutant protein also has the following mutation: the 159th amino acid corresponding to the amino acid sequence of the rice Wx mutant protein is mutated from glycine to lysine.

3. A nucleic acid or gene encoding the mutant protein according to any one of claims 1 to 2.

4. A nucleic acid or gene encoding the mutant protein according to claim 1, wherein the nucleotide sequence is shown in SEQ ID NO:

3.

5. A primer pair for identifying the gene or nucleic acid according to claim 3 or 4, characterized in that: The primer pair is Wx9 and Wx10, the sequence of the primer pair Wx9 is shown in SEQ ID NO:20 and SEQ ID NO:28, and the sequence of the primer pair Wx10 is shown in SEQ ID NO:20 and SEQ ID NO:

29.

6. An expression cassette or recombinant vector comprising the nucleic acid or gene according to claim 3 or 4.

7. Use of the rice Wx mutant protein according to claim 1 or 2, the nucleic acid or gene according to claim 3 or 4, the primer pair according to claim 5, the expression cassette or recombinant vector according to claim 6 in obtaining rice strains with transparent appearance and reduced amylose content and / or variety breeding.

8. A method for obtaining a quality-improved plant having a transparent appearance and a suitably reduced amylose content, characterized in that: The steps include: 1) Making a plant contain the nucleic acid or gene according to claim 3 or 4; or 2) Making a plant express the rice Wx mutant protein according to claim 1 or 2; the plant is rice.

9. A method for breeding improved rice with transparent appearance and appropriately reduced amylose content by gene editing, characterized in that: The following steps are involved: 1) Wx Gene cloning and target site design for gene editing; 2) Construction of single-base editing vector containing the target fragment; 3) Obtaining T0 generation plants of quality-improved rice having the mutant protein according to claim 1 or 2, the nucleic acid or gene according to claim 3 or 4, which are transparent in appearance and have a properly reduced amylose content; 4) Eliminate the T-DNA fragment of the T1 generation plants obtained by self-pollination of the T0 generation transgenic plants with target gene mutations; 5) The genotype of the T1 generation plants with T-DNA deleted is re-identified to obtain plants with homozygous mutations of the target gene; When the 178th amino acid of the amino acid sequence of rice Wx mutates, the nucleotide sequence of the target site for gene editing in step 1) is as shown in SEQ ID NO:8; when the 178th amino acid and the 159th amino acid of the amino acid sequence of rice Wx mutate at the same time, the nucleotide sequence of the target site for gene editing in step 1) is as shown in SEQ ID NO:7 and SEQ ID NO:

8.

10. The breeding method according to claim 9, characterized in that: The method for constructing the single-base editing vector containing the target fragment in step 2) is as follows: A) Preparation of target adapter fragments: Dissolve adapter primers in ddH2O to form a master solution, mix and dilute complementary adapter primers, denature at high temperature, and cool to room temperature to complete annealing, thereby obtaining target adapter fragments; B) Connecting the target adapter fragment to the intermediate vector: The pHUE411 intermediate vector and the restriction endonuclease BsaI were used for digestion to obtain the pHUE411 vector digested with BsaI alone; the pHUE411 vector digested with BsaI alone, the target adapter fragment, and T4 ligase were used for ligation reaction and E. coli transformation, and sequencing was performed to obtain the intermediate vector plasmid containing the target adapter fragment; C) Final vector construction: The pH-nCas9-PBE binary expression vector was double-digested with restriction endonucleases PmeI and AvrII to obtain a double-digested pH-nCas9-PBE vector; an intermediate vector plasmid containing a target linker fragment was double-digested with PmeI and AvrII to obtain a sgRNA expression cassette containing a target linker fragment and a corresponding promoter; the double-digested pH-nCas9-PBE vector, sgRNA expression cassette, and T4 ligase were used for ligation reaction and Escherichia coli transformation. After sequencing, the final single-base editing vector containing the target fragment was obtained.

11. The breeding method according to claim 9, characterized in that: The obtaining method of step 3) is as follows: the single-base editing vector containing the target fragment obtained in step 2) is transferred into Agrobacterium EHA105 and genetically transformed to obtain T0 generation transgenic plants, and the obtained T0 generation transgenic plants are amplified with primers Wxb-PCR-F and Wxb-PCR-R and sequenced to identify the genotype, thereby obtaining plants having the mutant protein according to claim 1 or 2, and the nucleic acid or gene according to claim 3 or 4; the Wxb-PCR-F sequence is shown in SEQ ID NO: 13, and the Wxb-PCR-R sequence is shown in SEQ ID NO:

14.

12. The breeding method according to claim 9, characterized in that: The T-DNA fragment in step 4) includes the hygromycin phosphotransferase gene HPT and nuclease genes nCas9 .

13. The breeding method according to claim 9, characterized in that: The T-DNA fragment of step 4) is removed by self-pollinating the T0 transgenic plants with the target gene mutation to obtain the T1 plants. HPT Genes and nCas9 The genes are tested simultaneously and repeatedly, and the T1 generation plants that do not carry these two genes are screened out as target plants.

14. The breeding method according to claim 13, characterized in that: HPT The gene detection method uses the genomic DNA of the T1 generation plants obtained by self-pollination of the T0 generation transgenic plants with target gene mutations as a template, and hyg283-F and hyg283-R as primers for PCR amplification. nCas9 The gene detection method uses the genomic DNA of the T1 generation plants obtained by self-pollination of the T0 generation transgenic plants with target gene mutations as a template, and uses nCas9-F and nCas9-R as primers for PCR amplification. HPT Genes and nCas9 gene, indicating that T-DNA was successfully removed, the hyg283-F sequence is shown in SEQ ID NO: 15, the hyg283-R sequence is shown in SEQ ID NO: 16, the nCas9-F sequence is shown in SEQ ID NO: 17, and the nCas9-R sequence is shown in SEQ ID NO:

18.

15. The breeding method according to claim 9, characterized in that: The target gene homozygous mutant plant of step 5) is obtained by using the genomic DNA of the T1 generation plant from which the T-DNA obtained in step 4) is removed as a template, and PCR amplification and sequencing are performed using Wxb-PCR-F and Wxb-PCR-R as primers to screen and obtain homozygous plants having the mutant protein according to claim 1 or 2, and the nucleic acid or gene according to claim 3 or 4; the Wxb-PCR-F sequence is shown in SEQ ID NO: 13, and the Wxb-PCR-R sequence is shown in SEQ ID NO:

14.

16. A method for identifying a plant obtained by the method according to claim 8, characterized in that: The following steps are involved: 1) determining whether the amylose content of the plant is reduced; and / or 2) determining whether the disintegration value of the viscosity index of the RVA spectrum of the rice plant is increased; and / or 3) determining whether the recovery value of the viscosity index of the RVA spectrum of the rice plant is reduced; and / or 4) determining whether the peak time of the viscosity index of the RVA spectrum of the rice plant is reduced; and / or 5) Determining whether the appearance of the plant polished rice is transparent.

Images