Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

55results about How to "Reduce amylose content" patented technology

High-performance historic site repair material and preparation method thereof

InactiveCN104119055AGood compatibilityReduce amylose contentMaterials scienceConstruction aggregate
The invention provides a high-performance historic site repair material and a preparation method thereof. The repair material comprises the following raw materials: 191-287 parts of sticky rice pulp, 115-185 parts of lime, 0-4 parts of brown granulated sugar, 344-398 parts of fine aggregates, 204-268 parts of complex mineral admixture, 11-12 parts of reinforcing agent, and 0-19 parts of mineral pigment. The invention further provides a preparation method of the repair material. The preparation method comprises the following steps: weighing all the raw material according to weight, and forcibly stirring evenly to obtain the repair material. Amylopectin in the sticky rice pulp is a highly branched macromolecule, the setting and hardening processes of the lime and the pozzolanic reaction of the complex mineral admixture are influenced, the strength development of the material is similar to biomineralization process, and a microstructure formed in the process endows the repair material with higher strength and toughness. Furthermore, the material has good compatibility with materials of a historic site body.
Owner:WUHAN UNIV

Nutritious noodle rich in glutinous wheat flour

InactiveCN103330135AHigh total starch contentReduce amylose contentFood preparationAdditive ingredientTriticum turgidum
The invention discloses a nutritious noodle rich in glutinous wheat flour, and more specifically relates to a product of grain processing. The nutritious noodle comprises, by mass, 47 to 87% of common wheat flour and 10 to 50% of glutinous wheat flour as main ingredients, 0.2 to 1.5% of konjac fine powder and sodium alginate as auxiliary ingredients, and 0.3 to 1.5% of salt as an ingredient. The nutritious noodle is prepared by following steps: purified water in proportional quantity is added in a mixture of the ingredients above, wherein the mass ratio of the ingredients to purified water is 100:32-35; the mixture is kneaded into dough, and then is cured, rolled and pressed, cut into strips and shaped, and dried, so as to obtain the ultrathin nutritious noodle with a thickness of 0.5 to 0.6mm. The innovation of the main ingredients and the ratio of the nutrients are reasonable; the noodle is rich in nutrient, has excellent viscoelasticity, soft and tenacity mouthfeels, and is easy to cook; broken rate is low; and it only takes 1.5 to 2.5min to cook the noodle.
Owner:HUBEI BAIDIAN IND

Method for reducing rice amylose content through gene editing and special sgRNA

The present invention discloses a method for reducing rice amylose content through gene editing and a special sgRNA, and belongs to the field of biotechnology. The method comprises the following steps: expression of a Waxy gene in rice is inhibited; and the Waxy gene is the gene encoding Waxy protein. A CRISPR / Cas9 technology is utilized to edit the rice Waxy gene on site. By causing frameshift mutations and knocking out the rice Waxy gene, a new generation of rice germplasm with significantly reduced amylose content is obtained. Compared with a wild type, the obtained Waxy site-edited strainis significantly lowered in amylose content.
Owner:YUAN LONGPING HIGH TECH AGRI CO LTD +2

Molecular marker of rice amylose content micro-control gene SSIVb and application thereof

The invention discloses a molecular marker SSIVb-m of a rice amylose content micro-control gene SSIVb. According to the molecular marker SSIVb-m, paddy is taken as a species, primers of the molecular marker are selected from a primer pair shown in a drawing, the nucleotide sequence of the molecular marker is 5'-3', the forward sequence of the SSIVb-m is ATTTTCCTCAGTAGTAAGCAAGAGTT, and the reverse sequence of the SSIVb-m is AAAACATTGCTCCAAAACAGC. The invention further simultaneously discloses application of the molecular marker SSIVb-m, wherein the molecular marker SSIVb-m is applied to the assay of paddy rice amylose content and / or the assisted selective breeding of descendants thereof. When the descendants of Nipponbare and Teqing are screened, single plants with banding patterns consistent with those of Nipponbare are selected from the descendants and are applied to breeding improvement.
Owner:CHINA NAT RICE RES INST

Method for identifying rice Wx-mw gene and application of rice Wx-mw gene in high-quality rice breeding

The invention relates to a method for identifying a rice Wx-mw gene and application of the rice Wx-mw gene in high-quality rice breeding. The invention discloses application of the second base of the first intron of a Wx-mw allele and the base of the sixth exon 62bp of the Wx-mw allele in identifying the rice Wx-mw gene as molecular markers. Four labeled primers are respectively designed according to splice site mutation of the first intron and a mutated site on the sixth exon, and the designed four labeled primers are respectively added to a same PCR (polymerase chain reaction) system so as to amplify various rice DNAs. To distinguish Wx-mw from Wx-a and Wx-in, the Wx-mw is introduced into a target variety through auxiliary selection by virtue of the two four-primer molecular markers and in coordination with conventional crossing and back-crossing; and the method is suitable for breeding a novel rice variety which is relatively low in amylose content and excellent in eating quality.
Owner:YANGZHOU UNIV

Wx mutant protein based on gene editing technology and application of gene of Wx mutant protein in plant breeding

The invention discloses a rice Wx mutant protein, a mutant gene and an application of the mutant protein and the mutant gene. The invention further discloses a breeding method for creating quality-improved rice which is transparent in appearance and properly reduced in amylose content by utilizing gene editing. According to the invention, a gene editing technology is used for carrying out single base editing on the Wx gene for the first time, and a new material without T-DNA, transparent in appearance, properly reduced in amylose content, improved in quality and stable in inheritance can be obtained in a T2 generation by screening offspring. Compared with breeding such as chemical mutagenesis and hybridization transformation, a gene editing directional improved molecular breeding technology has the advantages of quickness, accuracy, high efficiency and the like, gene function marker genotype selection is combined, or other mature rice varieties are directly used as background materialsfor conversion to obtain corresponding materials, so that the breeding efficiency can be greatly improved, and the breeding process is greatly accelerated.
Owner:JIANGSU ACAD OF AGRI SCI +1

Pericarpium citri reticulatae mooncake and preparation method thereof

The invention belongs to the field of food and particularly relates to a pericarpium citri reticulatae mooncake and a preparation method thereof. The pericarpium citri reticulatae mooncake comprises a mooncake wrapper and stuffing. The mooncake wrapper is prepared from wheat flour, arrowroot starch, waxy highland barley starch, syrup, vegetable fat, sodium bicarbonate and egg white. The stuffing is prepared from pericarpium citri reticulatae powder, red bean paste or red bean particles, syrup and vegetable fat. In the preparation process, the pericarpium citri reticulatae mooncake is easy to form, good in figurability, easy to demould after being baked, low in sugar and calorie, mellow in mouthfeel, delicious, capable of tonifying spleen and helping and promoting digestion and beneficial to health, and mooncake oil leaking and cracking phenomena cannot occur in the storing process.
Owner:广东橘香斋大健康产业股份有限公司

Selective breeding method of hybrid rice of late blooming season long-grained rice restoring line and subspecies

The present invention relates to selective breeding method of hybrid rice. The late blooming season wide affiliation long-grained rice restoring line CH59 which excellent agronomic character is selectively bred through hybridizing and generation adding the restoring line G230 as female parent and the restoring line Chuanhui-58 as female parent, the blooming season characteristic identification on the F2 group, eliminating the plants with early blooming season, further blooming season characteristic identification, agronomic character screening, resistance and rice quality identification, fertility restoring capacity determination and affinity identification. By using japonica rice sterile line Chuanjiang 16A and Chuanjiang 12A as female parent and the restoring line CH59 as male parent, the hybrid rice Chuanyou 59 and Chuanyou 259 are bred.
Owner:CHINA NAT RICE RES INST

Method of reducing content of amylase in hybrid rice

The invention discloses a method of reducing the content of amylase in hybrid rice and belongs to the technical field of rice genetic breeding. In the method, an original hybrid rice combination: one of a parent of a non-glutinous sterile line / a non-glutinous restorer is modified into a glutinous parent. The hybrid rice is prepared through a hybridization method of a glutinous sterile line / non-glutinous restorer or a non-glutinous sterile line / a glutinous restorer to obtain a hybrid rice variety in which the content of the amylase is lower than that of the original hybrid rice. In the invention, by means of a genetic effect and a genetic dosage effect of a glutinous gene wx, a near-isogenic line combination is reduced in the content of the amylase. In addition, a growth period, a plant and leaf form, panicle traits, floral organ traits, yield traits, disease resistant performance, adaptability and the like of the near-isogenic line combination are free of significant different when the near-isogenic line combination is compared with the original hybrid rice combination. Through quality analysis and taste evaluation, a new hybrid rice variety being appropriate in the content of the amylase and having the taste and the quality which are suitable for people in different region, thereby achieving an object of genetically improving a poor taste and a poor quality due to a high amylase content in the hybrid rice in the prior art.
Owner:FUJIAN AGRI & FORESTRY UNIV

High-temperature-resistant rice plant growth regulator and using method and application thereof

The invention discloses a high-temperature resistant rice plant growth regulator and a using method and application thereof, belonging to the field of promoting plant growth. The effective componentsof the regulator comprise abscisic acid and sucrose, and when in use, the concentration of the abscisic acid is 1-100 mu mol / L, and the sucrose accounts for 0.1-2.5% of the total mass of the regulator. According to the invention, based on the influence of the interaction of natural plant hormone abscisic acid and natural carbohydrate sucrose on the grain growth of rice after flowering, the optimalapplication concentration is screened, so that the high-temperature damage to the rice is remarkably reduced, the rice yield is remarkably increased, and the rice quality is remarkably improved.
Owner:CHINA NAT RICE RES INST

Method and system of rice-oenanthe javanica-cherax quadricarinatus integrated planting and breeding

The invention discloses a method and system of rice-oenanthe javanica-cherax quadricarinatus integrated planting and breeding. The method includes digging an annular trench in a dam between rice fields, wherein floating beds, microporous oxygenation devices and a temporary rearing tank separated by a net are arranged in the annular trench and the dam is provided with an anti-escape device; planting rice in the rice fields and performing rice planting management; cultivating oenanthe javanica in the floating beds, and performing oenanthe javanica cultivating management; and breeding cherax quadricarinatus in the annular trench, and performing cherax quadricarinatus breeding management. As the cherax quadricarinatus is bred in the annular trench of the rice field and the oenanthe javanica iscultivated on the water surface of the annular trench through the floating beds, the land utilization rate can be increased; a symbiotic system of rice, aquatic vegetables and shrimps can be established; and through mutualistic symbiosis, rice fertilizer input can be reduced, pesticides are not needed, so that high-quality and ecological rice can be produced, therefore, food safety can be guaranteed, and agricultural efficiency, farmer income increasing and rural beautification can be realized.
Owner:ZHEJIANG JIAXING AGRI SCI ACADEMY INST +1

Strain 1LN2 for preventing and treating rice sheath blight disease and application of strain 1LN2

The invention discloses a strain 1LN2 for preventing and treating a rice sheath blight disease. The classification and nomenclature of the strain 1LN2 are pseudomonas sp., and the strain 1LN2 is preserved with the preservation number CGMCC No.11361 in China General Microbiological Culture Collection Center on September 10, 2015. The invention further discloses a biocontrol agent prepared from the strain 1LN2 for preventing and treating the rice sheath blight disease. The invention further discloses application of the biocontrol agent to prevention and treatment of the rice sheath blight disease. The biocontrol agent used in a greenhouse is capable of preventing and treating the rice sheath blight disease to a certain extent, greenhouse control effect is up to 60.25%, and field control effect after field experiment treatment is performed for one month is up to 50.31%; a 1LN2 strain preparation is capable of increasing protein content of rice, decreasing amylose content, improving gel consistency and increasing rice yield to a certain degree, and the yield increase rate obtained through the 1LN2 strain preparation reaches 7.1% compared with that obtained through a conventional chemical agent.
Owner:江苏省安丰生物源农药工程中心有限公司

Molecular marker for rice amylose content micro-control genes AGPL3 and application of molecular marker

The invention discloses a molecular marker AGPL3-m for rice amylose content micro-control genes AGPL3. The molecular marker is characterized in that paddy rice is used as a species, primers of the molecular marker are selectively primer pairs, nucleotide sequences are 5'->3', the molecular marker AGPL3-m in a forward direction is shown as GAAGATAGACGACACAGGAAGAGT, and the molecular marker AGPL3-m in a reverse direction is shown as ACTGAAATTGAGGTTTGGCAT. The invention further discloses application of the molecular marker AGPL3-m. The molecular marker AGPL3-m can be used for identifying rice amylose contents of the paddy rice and / or assisting in selectively breeding progenies of the paddy rice. Single plants, with banding patterns consistent with Nipponbare banding patterns, of the progenies are selected for breeding when the progenies are progenies of Nipponbare indica rice.
Owner:ZHEJIANG NORMAL UNIVERSITY

Paddy rice breeding method

The invention belongs to the technical field of paddy rice breeding and discloses a paddy rice breeding method. According to the paddy rice breeding method, an imported foreign material is hybridizedwith a local variety; after different generations of separation and selection are carried out, properties are listed as follows: a combination (1): IR71121-35-1-1-1-2 / V13 hybridized F4 has the plant height of 80 cm, the quantity of total grains per ear is 246.7 and the fruiting rate is 73.4 percent; a combination (2): IR64446-2 / Dianjingyou No. 5 hybridized F5 has the plant height of 90 cm, the quantity of total grains per ear is 189.0 and the fruiting rate is 93.5 percent; a combination (3): Taebongbyeo / Undong 31 / / Yujing No. 8 hybridized F3 has the plant height of 90 cm, the quantity of totalgrains per ear is 203.0 and the fruiting rate is 91.0 percent. The paddy rice breeding method provides abundant paddy rice breeding resources for scientific researches and variety improvement of riceculture; the intra-regional and inter-regional genetic diversity is further expanded and a new leap of the production of paddy rice is realized.
Owner:玉溪市农业科学院

Molecular marker for rice amylose content micro-control genes SSIII-1 and application of molecular marker

The invention discloses a molecular marker SSIII-1-m for rice amylose content micro-control genes SSIII-1. The molecular marker is characterized in that paddy rice is used as a species, primers of the molecular marker are selectively primer pairs, nucleotide sequences are 5'->3', the molecular marker SSIII-1-m in a forward direction is shown as AAGAAGGGAAGGGAGTCAGC, and the molecular marker SSIII-1-m in a reverse direction is shown as GCCATCTCCATTGCCAGC. The invention further discloses application of the molecular marker SSIII-1-m. The molecular marker SSIII-1-m can be used for identifying rice amylose contents of the paddy rice and / or assisting in selectively breeding progenies of the paddy rice. Single plants, with banding patterns consistent with Nipponbare banding patterns, of the progenies are selected for breeding when the progenies are progenies of Nipponbare indica rice.
Owner:ZHEJIANG NORMAL UNIVERSITY

Gluten-free instant hand-pulled noodles and preparation method and formula thereof

The invention provides gluten-free instant hand-pulled noodles and a preparation method and a formula thereof and relates to the field of food deep processing. The gluten-free instant hand-pulled noodles are mainly prepared from cereals such as Chinese Northeast non-glutinous polished rice, Chinese Northeast non-glutinous unpolished rice, Chinese Northeast black rice and millet with manufactured goods which are rich in nutrition and have health care effect serving as minor ingredients by means of technologies of flour milling, flour mixing, standing for a while, primary extrusion, secondary extrusion, aging treatment, variable-temperature drying, ventilative cooling, bagging, inspection, sealing packing, boxing and the like. The obtained hand-pulled noodles are chewy, refreshing and slippery, avoid being mixed with soup, breakage and adhesion during cooking and are good in taste and sweet after taste. What is more important is that the noodles are smooth and pleasing in appearance and oily before being cooked and can completely reach the international highest safety index of gluten content not exceeding 5-10PPM, thereby being more nutritional and safer. Moreover, production efficiency is improved greatly, energy consumption and pollution discharge are reduced, and more environment friendliness and lower carbon are achieved.
Owner:大连弘润莲花食品有限公司

Rice conditioning process and instant rice production method

The invention belongs to the technical field of food processing and discloses a rice conditioning process and an instant rice production method. On the basis of an instant high-temperature fluidization technique, rice conditioning pretreatment is realized; by a rice water refilling technique, preparation of conditioning liquid of soft rice flour and edible oil compound rice water is realized; by adoption of a rapid cooling film-forming technique, surface water retaining film increasing is realized so as to enhance water retention capacity, viscoelasticity and glossiness of rice. The productionmethod mainly includes steps of rice washing and draining, conditioning, cooking, aseptic packaging and quick cooling for film forming. By the rice conditioning process and the instant rice production method, industrial continuous production can be realized, and produced instant rice is glutinous without adhesion and great in taste after storage for 60 days.
Owner:JIANGNAN UNIV

Molecular marker for rice grain amylose content micro-control gene ISA and application thereof

The invention discloses molecular marker ISA-m for rice grain amylose content micro-control gene ISA, using rice as a species. A molecular marker primer is selected from following primer pairs, wherein nucleotide sequence is 5'->3', ISA-m forward: ATAGATGCTAATGTGATGTGGC; ISA-m reverse: TGGTATAGGCACAACCGTAGA. The molecular ISA-m is useful in rice grain amylose content identification and / or rice grain amylose progeny assisted breeding.
Owner:浙江禾天下种业股份有限公司

Selective breeding method of hybrid rice of late-blooming indica rice widely compatible restoring lines and subspecies

InactiveCN100493343CWide affinityGood rice qualityPlant genotype modificationAngiosperms/flowering plantsAgricultural sciencePhenotypic trait
The present invention relates to selective breeding method of hybrid rice. The late blooming season wide affiliation long-grained rice restoring line CH59 which excellent agronomic character is selectively bred through hybridizing and generation adding the restoring line G230 as female parent and the restoring line Chuanhui-58 as female parent, the blooming season characteristic identification on the F2 group, eliminating the plants with early blooming season, further blooming season characteristic identification, agronomic character screening, resistance and rice quality identification, fertility restoring capacity determination and affinity identification. By using japonica rice sterile line Chuanjiang 16A and Chuanjiang 12A as female parent and the restoring line CH59 as male parent, the hybrid rice Chuanyou 59 and Chuanyou 259 are bred.
Owner:CHINA NAT RICE RES INST

Processing process of blackberry-flavored breakfast biscuits

PendingCN110393201AReduce digestionReduce the rate of digestion and hydrolysisDough treatmentDough extruding machinesDigestionFermentation
The invention discloses a processing process of blackberry-flavored breakfast biscuits. The processing process includes the following steps: firstly, all raw materials are weighed in parts by weight;secondly, wheat flour, palm oil and bean dreg powder are evenly mixed, pure water and half of blackberry juice are added, concocting is conducted to form a dough, honey is added, then table salt and carbon baking soda are added, stirring is conducted until the dough is even and fine, fermentation is conducted for 2-3 h, and a fermented dough is obtained; thirdly, forming is conducted by a biscuitcompression forming device; and fourthly, baking is conducted. The bean dreg powder replaces part of the wheat flour, thus digestion of the biscuits can be delayed, aging of starch is delayed, and theshelf life of the biscuits is prolonged; the even blackberry taste is obtained by blending the blackberry juice, and the biscuits have the nutrients from blackberries; through the specially-made biscuit compression forming device, the wanted complete biscuit shape can be obtained, and the density degree and the taste of the biscuits can be controlled; and the breakfast biscuits which are rich innutrition, beneficial to intestinal health and long in shelf life are obtained.
Owner:ANHUI DINGKANG FOOD

Low-migration hydrophobic starch-based nano-composite film and preparation method thereof

InactiveCN107722313AReduce rateReduced diffusion coefficient for long-term migrationAmylaseOrganic solvent
The invention relates to a low-migration hydrophobic starch-based nano-composite film. A preparation method of the composite film includes the steps: S1 dispersing starch into an organic solvent, stirring and activating the starch and then adding anhydride to prepare hydrophobic esterified starch; S2 dispersing the hydrophobic esterified starch and organically modified montmorillonite Dellite 72Tinto the organic solvent to form turbid liquid, adding plasticizers, uniformly stirring the plasticizers and the turbid liquid, pouring mixture into a mould, and drying the mixture to obtain the hydrophobic starch-based nano-composite film. In the S1, the content of amylase in the starch is 0.5-82%, and the esterification degree of the hydrophobic esterified starch is larger than 2.3. In the S2, the weight ratio of the hydrophobic esterified starch to the organically modified montmorillonite Dellite 72T is 100:(1-6). By regulating interaction of the hydrophobic esterified starch, the organically modified montmorillonite and the plasticizers and regulating a formed aggregation structure, the whole migration initial release rate and the long-term migration diffusion coefficient of the plasticizers in the prepared composite film are remarkably reduced, and migration of the plasticizers is effectively slowed down.
Owner:DONGGUAN UNIV OF TECH

Molecular marker of rice amylose content micro-control gene AGPL1 and application

The invention discloses a molecular marker AGPL1-m of a rice amylose content micro-control gene AGPL1. Rice is used as a species, a molecular marker primer is selected from the following primer pairs, wherein a nucleotide sequence is 5'->3', the forward AGPL1-m is TCTGCGAGCCTTGTTATCCA, and the reverse AGPL1-m is TGCCAGGGAGAAATGGAGAA. The molecular marker AGPL1-m is used for identification of paddy rice amylose content and / or assistant selective breeding their offspring.
Owner:CHINA NAT RICE RES INST

Method for cultivating soft rice by using transcriptional activation factor sample effector nuclease technology

InactiveCN110387371AReduce amylose contentHydrolasesFermentationGenomic DNABiological activation
The invention discloses a method for cultivating soft rice by using a transcriptional activation factor sample effector nuclease technology. The method for cultivating the soft rice by using the transcriptional activation factor sample effector nuclease technology comprises the specific steps that according to gene sequence analysis, two segments of specific nucleotide sequences are screened out from a rice starch synthase GBSSI genomic DNA, transcriptional activation factor effector recognition modules of two segments of target site sequences are separately established, and the transcriptional activation factor effector recognition modules are connected with an FokI II nuclease expression unit in series. A plant expression vertor SFokIAB[TN12ab] of the target GBSSI gene TALEN is obtained,and then the expression vector is converted to rice through agrobacterium-mediated transformation. By using the method for cultivating the soft rice by using the transcriptional activation factor sample effector nuclease technology, content of amylose in the rice can be significantly reduced, and thus the superior soft rice is obtained.
Owner:SHANGHAI ACAD OF AGRI SCI

Molecular marker and application of rice amylose content micro-controlling gene agps2a

The invention discloses a molecular marker AGPS2a-m of a rice amylose content micro-control gene AGPS2a. According to the molecular marker AGPS2a-m, paddy is taken as a species, primers of the molecular marker are selected from a primer pair shown in a drawing, the nucleotide sequence of the molecular marker is 5'-3', the forward sequence of the AGPS2a-m is TCTTCTTTTAGATCTTAAATTTCAGA, and the reverse sequence of the AGPS2a-m is CACATCAAAGTTGTAGTTTTGTGA. The molecular marker AGPS2a-m can be applied to the assay of paddy rice amylose content and / or the assisted selective breeding of descendants thereof; for the descendants of Nipponbare and Teqing, single plants with banding patterns consistent with those of Nipponbare are selected from the descendants and are applied to breeding improvement.
Owner:CHINA NAT RICE RES INST

Molecular marker and application of micro-control gene ssivb of rice amylose content

The invention discloses a molecular marker SSIVb-m of a rice amylose content micro-control gene SSIVb. According to the molecular marker SSIVb-m, paddy is taken as a species, primers of the molecular marker are selected from a primer pair shown in a drawing, the nucleotide sequence of the molecular marker is 5'-3', the forward sequence of the SSIVb-m is ATTTTCCTCAGTAGTAAGCAAGAGTT, and the reverse sequence of the SSIVb-m is AAAACATTGCTCCAAAACAGC. The invention further simultaneously discloses application of the molecular marker SSIVb-m, wherein the molecular marker SSIVb-m is applied to the assay of paddy rice amylose content and / or the assisted selective breeding of descendants thereof. When the descendants of Nipponbare and Teqing are screened, single plants with banding patterns consistent with those of Nipponbare are selected from the descendants and are applied to breeding improvement.
Owner:CHINA NAT RICE RES INST

Allogenic substance mixture for improving quality of rice suffering from low-temperature chilling damage at tillering phase and application of allogenic substance mixture

InactiveCN110150288AImprove qualityGood lifting effectBiocidePlant growth regulatorsGamma-Aminobutyric acidSalicylic acid
The invention discloses an allogenic substance mixture for improving the quality of rice suffering from low-temperature chilling damage at a tillering phase and application of the allogenic substancemixture and belongs to the technical field of rice planting. The allogenic substance mixture consists of proline, gamma-aminobutyric acid, salicylic acid and water, wherein concentrations of the components in the mixture are as follows: 3.24-4.86g / L of proline, 0.21-0.32g / L of gamma-aminobutyric acid, and 0.14-0.28g / L of salicylic acid. The invention furthermore provides application of the allogenic substance mixture for improving the quality of the rice suffering from low-temperature chilling damage at the tillering phase. By adopting the allogenic substance mixture, the quality of the rice suffering from low-temperature chilling damage at the tillering phase can be improved, influence of low-temperature chilling damage upon the quality of the rice at the tillering phase can be alleviated, the problem that the quality of the rice suffering from low-temperature chilling damage at the tillering phase is degraded can be solved, and the allogenic substance mixture is applicable to rice planting in cold regions.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

A kind of transgenic rice with good eating quality and breeding method

The invention discloses a method for reducing apparent amylose content of rice and improving the starch viscosity so as to improve the eating quality of the rice, and belongs to the technical field of organisms. The method is achieved by disturbing soluble starch synthase SSSIIb gene expression in paddy; a ribonucleic acid (RNA) interference carrier of the SSSIIb gene is built; and the transgenic rice of disturbing the SSSIIb gene is obtained by an agrobacterium mediated method. The polymerase chain reaction (PCR) experiment shows that a target gene is integrated into rice genome; and homozygous transgenic rice is obtained in a breeding manner. The amylose content in rice endosperm of the transgenic rice is obviously reduced in comparison with the unconverted parent Nipponbare. A rapid viscosity tester analysis shows that the starch viscosity of the transgenic rice is reduced; the gelatinization temperature is reduced; and the eating characteristics of the rice are obviously improved.
Owner:YANGZHOU UNIV

Molecular marker and application of rice amylose content micro-controlling gene agpl3

The invention discloses a molecular marker AGPL3-m for rice amylose content micro-control genes AGPL3. The molecular marker is characterized in that paddy rice is used as a species, primers of the molecular marker are selectively primer pairs, nucleotide sequences are 5'->3', the molecular marker AGPL3-m in a forward direction is shown as GAAGATAGACGACACAGGAAGAGT, and the molecular marker AGPL3-m in a reverse direction is shown as ACTGAAATTGAGGTTTGGCAT. The invention further discloses application of the molecular marker AGPL3-m. The molecular marker AGPL3-m can be used for identifying rice amylose contents of the paddy rice and / or assisting in selectively breeding progenies of the paddy rice. Single plants, with banding patterns consistent with Nipponbare banding patterns, of the progenies are selected for breeding when the progenies are progenies of Nipponbare indica rice.
Owner:ZHEJIANG NORMAL UNIVERSITY

Method for screening rice plants with excellent eating taste features

The invention discloses a method for screening rice plants with excellent eating taste features, and relates to the technical field of rice breeding. Unhusked rice is husked to obtain brown rice; thebrown rice is divided into two halves; the germless ends are used for determination; the germ-containing ends are used for germination and seedling growth; the germless ends with similar sizes are putinto an ELISA plate; the germ-containing ends are put to the corresponding positions of the other ELISA plate; a KOH solution is added; the ELISA plates are coated by preservation films and are put into a constant-temperature box; the ELISA plates are taken out; the rice scattering degree is observed; the pasting temperature value is judged; alkali liquid in the holes are dried through suction; aI2-KI solution is added; the materials are fast and uniformly stirred; the color is observed; the darker color indicates the higher straight chain starch content; the rice grains with great rice grain alkali spreading value and low straight chain starch content are selected; the other group of corresponding germ-containing end half rice is selected out; the germination breeding can be performed.The method provided by the invention can be used for conveniently, fast and efficiently screening out high-quality individuals; the screening efficiency on low-generation segregated large groups can be improved; the breeding time is greatly shortened.
Owner:SHANGHAI ACAD OF AGRI SCI