85 results about "Cherax quadricarinatus" patented technology

The invention provides a controllable synchronous brooding breeding method of cherax quadricarinatus, which comprises the following steps of: preparing a breeding pool; adjusting and controlling the water quality of the breeding pool; selecting parent shrimps; intensively culturing the parent shrimps; controlling overwintering temperature of the parent shrimps; controlling the brooding rate of the parent shrimps by manually adjusting the temperature and illumination conditions; producing seedlings; culturing shrimp larva, and the like. According to the invention, by modifying the breeding pool, controlling the water quality, selecting the parent shrimps, adjusting the illumination and the temperature and controlling the gonad development of the parent shrimps, the spawning time of the parent shrimp group is promoted to be centralized and synchronous relatively, and the problem of uneven culturing specifications of seedlings in the large-scale production is effectively solved.

The present invention is technology of cultivating hybrid fresh water crayfish in rice and lotus field. The technology includes selecting rice and lotus field, sterilizing, applying basal fertilizer, transplanting rice or lotus, raising young crayfish, filtering to avoid escape and field management. The present invention has simple method, high crayfish yield, low cost and other advantages.

The invention discloses a cherax quadricarinatus breeding method. The method comprises the following steps of pond selection, pond disinfection, breeding water treatment, compound bacteria culture, shrimp fry stocking, feed feeding and pond management. According to the breeding method, by reasonably arranging a shelter, breeding compound bacteria, adding EM bacteria and traditional Chinese medicine powder into feed and the like, breeding is conducted under the condition of not using hormones or antibiotics, the method has the advantages of being ecological, environmentally friendly, less in investment, low in cost and convenient to manage, and the cherax quadricarinatus obtained through breeding is high in survival rate, high in growth speed, healthy and strong in physique, high in diseaseresistance and high in stress resistance.

The invention discloses a cherax quadricarinatus compound feed for enhancing immunity. The cherax quadricarinatus compound feed comprises the following components in percentage by mass: 6-9% of fish meal, 22-26% of soybean meal, 5-7% of blood powder, 15-20% of peanut bran, 3-5% of beer yeast, 9-11% of cane sugar, 9-11% of corn starch, 0.5-1.5% of shell powder, 0.1-0.2% of sodium chloride, 1.0-3.0%of composite vitamins, 0.5-1.5% of composite minerals, 0.5-1.5% of choline chloride, 1.0-2.0% of calcium dihydrogen phosphate, 1.0-2.0% of an immunopotentiating agent, 1.0-2.0% of sodium alginate, 2.5-3.2% of soybean oil, 2.5-3.2% of peanut oil and the balance of cellulose. The cherax quadricarinatus compound feed disclosed by the invention is comprehensive and balanced in nutrients, and can meetgrowth and immunity requirements of cherax quadricarinatus for various nutrients, wherein the composite vitamins, the composite mineral substances and the immunopotentiating agent which are added canmeet nutritional requirements of the cherax quadricarinatus, and the immunity and the stress resistant capacity of the cherax quadricarinatus can be notably improved; and in addition, animal proteinsuch as fish meal is replaced with vegetable protein such as the soybean meal, the peanut bran and the like, so that the breeding cost can be reduced.

The invention discloses an isolated breeding technique for cherax quadricarinatus eggs. The breeding technique includes the steps: disinfecting ovigerous shrimps; separating the ovigerous shrimps; classifying the separated oval shrimps; implanting the oval shrimps; hatching the oval shrimps. The isolated breeding technique solves the problems of low survival rate and poor quality of artificial breeding, the hatching rate of the shrimp eggs can be increased by more than 70%-75%, the demand of the market for shrimp seed offspring can be effectively met, capital investment cost is reduced, and the isolated breeding technique is easy to popularize.

The invention discloses a shrimp seed breeding and rearing method for cherax quadricarinatus. The method comprises steps as follows: (1), preparation of a breeding pool; (2), selection of parent shrimps; (3), culture of the parent shrimps; (4), pairing of the parent shrimps; (5), culture of fertilized eggs; (6), hatching management; and (7), nursing of the parent shrimps. The a shrimp seed breeding and rearing method for the cherax quadricarinatus is provided by construction of a culture pool, a mating pool, a hatching pool and a nursing pool, so that in the seed breeding stage, the egg mass rate of the cherax quadricarinatus reaches 70% or higher, the survival rate of the shrimp seeds reaches 80% or higher, the shrimp seed yield is 200% or higher of that in the prior art, and the method has remarkable economic benefits.

The invention discloses a system for breeding young cherax quadricarinatus in a pond covered by a greenhouse, comprising a big pond, an elevated water tank, a plurality of incubators, an insulating greenhouse and an oxygen-enriching machine, wherein a pond separating ridge is arranged in the middle of the pond, a small pond is formed between the pond separating ridge and a first short-edge slope of the big pond, the first short-edge slope is cut to form a production platform, the incubators are placed on the production platform, water inlet pipes of the plurality of incubators are connected with water outlet pipes of the elevated water tank in parallel, oxygen enriching pipes of the plurality of incubators are connected with an oxygen delivering pipe of the oxygen enriching machine in parallel, and the insulating greenhouse covers above the small pond. The system disclosed by the invention has the advantages of lower cost, capability of realizing direct circulation of pond water body in the pond, the water tank and the incubators in a better manner and keeping temperature and ecological environment of the water body in the pond at the same time, and greatly increased survival rate of the young cherax quadricarinatus and better value for popularization and application are achieved; and the cherax quadricarinatus can complete the overwintering and incubating processes in the pond, without processes of transporting the young cherax quadricarinatus for a long distance and accommodating the young cherax quadricarinatus in a new water body.

The invention discloses a method for breeding cherax quadricarinatus. The method includes the steps of preparation of a breeding pond, putting of cherax quadricarinatus seeds, breeding management andbreeding pond management, people pay attention to preparation work of the breeding pond before putting of the cherax quadricarinatus seeds and water quality optimization, and an external environment suitable for growth of cherax quadricarinatus is created; in addition, people pay attention to selecting and using of cherax quadricarinatus fodder. In the method, the fodder which is prepared from fish meal, barley pest powder, earthworm powder, shrimp shell meal, bean pulp, peanut meal, corn flour, wheat flour, soybean phospholipids, bone meal, lysine, methionine, multi-vitamins, composite mineral substances and other substances is selected and used, and is comprehensive in nutrient, has a remarkable promotion effect on growth of cherax quadricarinatus, the cost for breeding is low, breedingbenefits are remarkable, and the method is suitable for application and popularization of breeding of cherax quadricarinatus.

The invention provides a molecular marker C69483 for rapidly identifying hereditary characters of cherax quadricarinatus and application of the molecular marker C69483. The nucleotide sequence of themolecular marker C69483 is as shown in SEQ ID No. 1, and the nucleotide sequence of a primer pair for detecting the molecular marker C69483 is a forward sequence C69483F: TCACTACGAGCCACTTCAATTTG and areverse sequence C69483R: CTGGATTTATGTGAGAGAGAGAGAGGAGG. The molecular marker C69483 provided by the invention is not influenced by the tissue specificity of the cherax quadricarinatus and the environment, and is simple to use; the molecular marker not only can quickly and efficiently identify the genetic sex of the cherax quadricarinatus, but also can promote the establishment of an all-female or high-female breeding technology of the cherax quadricarinatus, and has a wide application prospect.

The invention discloses a method and system of rice-oenanthe javanica-cherax quadricarinatus integrated planting and breeding. The method includes digging an annular trench in a dam between rice fields, wherein floating beds, microporous oxygenation devices and a temporary rearing tank separated by a net are arranged in the annular trench and the dam is provided with an anti-escape device; planting rice in the rice fields and performing rice planting management; cultivating oenanthe javanica in the floating beds, and performing oenanthe javanica cultivating management; and breeding cherax quadricarinatus in the annular trench, and performing cherax quadricarinatus breeding management. As the cherax quadricarinatus is bred in the annular trench of the rice field and the oenanthe javanica iscultivated on the water surface of the annular trench through the floating beds, the land utilization rate can be increased; a symbiotic system of rice, aquatic vegetables and shrimps can be established; and through mutualistic symbiosis, rice fertilizer input can be reduced, pesticides are not needed, so that high-quality and ecological rice can be produced, therefore, food safety can be guaranteed, and agricultural efficiency, farmer income increasing and rural beautification can be realized.

The invention relates to the field of agricultural culture, and provides a cherax quadricarinatus imitative ecological artificial scaled incubation culture technology. The technology is particularly applicable to domestic gannan area climate culture, and fills the blanks in China. According to the technology, the complete ecological imitating incubation culture of the cherax quadricarinatus, particularly chrtax quadricarinatus is realized. Along with the lobster fertilization, before the stocking of lobster seeds into a pond, the sizes of stones, silts and water plants in an incubation pond are continuously changed for adapting to the growth of lobster seeds; the temperature and the diet are synchronously and scientifically managed; particularly through the unique design of the pond, the bottom layer is underground water, the top layer is flowing spring water, and the middle is water with proper water temperature; three kinds of different ecological environments provide the complete growth environment for the lobster; through the culture by the technical scheme, the cherax quadricarinatus can be cultured to be heavier than 0.8kg.

The invention provides a molecular marker C98284 for rapidly identifying hereditary sex of cherax quadricarinatus and application of the molecular marker C98284. The nucleotide sequence of the molecular marker C98284 is shown as SEQ ID No.1, the nucleotide sequence of a primer pair for detecting the molecular marker C98284 is a forward sequence C98284F: TAACACCGAGCACCGACATTT, and a reverse sequence C98284R: TTGTTCACGCTACAGTGTTCCG. The molecular marker C98284 provided by the invention is not influenced by the tissue specificity and environment of the cherax quadricarinatus, and is simple to use; the molecular marker not only can quickly and efficiently identify the genetic sex of the cherax quadricarinatus, but also can promote the establishment of a cherax quadricarinatus all-female or high-female fry breeding technology, and has a wide application prospect.

The invention relates to the field of lobster culture and discloses an Australian cherax quadricarinatus in-vitro hatching method. After fertilized ova are obtained, the fertilized ova are cleaned and then are put into an in-vitro hatching plate to perform artificial hatching. The in-vitro hatching plate is provided with a front-arranged filter bucket matched with a water body, an ozone disinfection machine, a heating tube, an oxygen-enriching machine and a separation net, the fertilized ova are put on the separation net, bubble stones are arranged at the bottom of the in-vitro hatching plate to make a water flow so as to keep the fertilized ova slightly moving, the ozone disinfection machine controls regular disinfection in a time system mode, and the fertilized ova can be hatched into juvenile cherax quadricarinatus after about 40-50 days. By means of the Australian cherax quadricarinatus in-vitro hatching method, the infection rate of the fertilized ova can be reduced to be below 10%, the survival rate of hatching can be 90% or above, the survival rate of fertilized ovum hatching is greatly improved, the young prawn yield can be effectively improved, and remarkable economic benefits are produced.

The invention discloses reference genes for fluorescence quantitative detection of seven tissues of cherax quadricarinatus, screening method and application thereof, and belongs to the technical fieldof molecular biology. The invention comprises reference genes GAPDH and GST, which are used for fluorescence quantitative detection of seven tissues of cherax quadricarinatus; special primers for amplifying the reference genes, nucleotide sequence (shown as SEQ ID NO.1) of a forward primer F1 and nucleotide sequence (shown as SEQ ID NO.2) of a reverse primer R1 for amplifying the GAPDH gene, nucleotide sequence (shown as SEQ ID NO.3) of a forward primer F2 and nucleotide sequence (shown as SEQ ID NO.4) of a reverse primer R2 for amplifying the GST gene. According to the invention, appropriateand stable reference genes are screened out for research on gene expression of different tissues of the cherax quadricarinatus, which is conducive to accurately analyze the gene expression rule of the cherax quadricarinatus in experiments with different purposes, and provides a necessary molecular basis for subsequent research on the molecular mechanism of the cherax quadricarinatus.

The invention discloses a cherax quadricarinatus circulating water breeding system and method. The circulating water breeding system comprises a high-position water storage pond, a subsurface flow-vertical upward flow composite artificial wetland, a water quality restoration pond, a chlorella expanding culture bucket, a composite effective bacteria expanding culture bucket, a parallel breeding pond, a drainage channel, a water lifting inspection well and a water lifting pump which are all positioned in a heat-insulating greenhouse, the high-position water storage pond, the subsurface flow-vertical upward flow composite artificial wetland, the water quality restoration pond, the parallel breeding pond, the water drainage channel and the water lifting inspection well are sequentially communicated, the water lifting pump is used for lifting supernate in the water lifting inspection well to the high-position water storage pond, and the chlorella expanding culture bucket and the composite effective bacteria expanding culture bucket are communicated with the water quality restoration pond and controlled to be open and closed through valves. By the system, shrimp seed breeding rate is increased, shrimp seeds are synchronous in specification, supply of high-quality shrimp seeds is increased greatly, and development of cherax quadricarinatus breeding industry is promoted.

The invention discloses a functional biological feed for intensified breeding of cherax quadricarinatus, belongs to the technical field of breeding of the cherax quadricarinatus, and solves the problems of low stress, low immunity and low quality of the cherax quadricarinatus, which cannot be solved by a conventional feed. The functional biological feed comprises the following components in percentage by mass: 15-25% of imported fish meal, 6-10% of fermented peanut meal, 10-16% of fermented soybean meal, 3-5% of yeast cream, 4-8% of shrimp shell powder, 15-25% of high gluten flour, 8-15% of corn flour, 2-4% of calcium dihydrogen phosphate, 2-5% of soybean phospholipid, 2-4% of fish oil, 1-3% of soybean oil, 2% of a vitamin mineral premix and 2% of a functional additive. The invention further discloses a preparation method of the feed. The functional biological feed disclosed by the invention specially overcomes the defects that the stress and the immunity are reduced and the quality isreduced, which are possibly caused by an intensified breeding mode of the cherax quadricarinatus in a greenhouse or a workshop and the like, and has the effects of being balanced in nutrients, and capable of promoting growth, improving meat quality flavor, increasing the survival rate, reducing water pollution and the like.

The invention discloses a method for screening and breeding high-egg-carrying-amount cherax quadricarinatus parents, and belongs to the technical field of cherax quadricarinatus parent screening. Themethod comprises the following steps that (1) primary screening of the parents is carried out; (2) parent screening is carried out by taking a first abdominal segment width / full length as an index instead of an egg laying amount index; (3) enhanced cultivation and ripening of the parents are carried out; (4) mating and breeding of the parents are carried out; (5) egg-carrying shrimps are cultivated; (6) egg-carrying performance of the parents is evaluated; (7) young shrimps are cultivated indoors; and (8) offspring seeds are put into a pond. According to the method, the morphological characters related to the egg laying amount are used as breeding indexes, the egg laying amount characters of cherax quadricarinatus are indirectly selected, and the specification proportion of male and femaleparent shrimps and the matching number are adjusted, so that the problem that the egg laying amount cannot be measured in advance, egg-carrying parent shrimps are not suitable for excessive operation, the egg carrying rate is low and the like in actual production is solved, a technical scheme is provided for establishing a high-yield parent group of the cherax quadricarinatus, and a foundation islaid for realizing large-scale culture of the cherax quadricarinatus.

The invention belongs to the technical field of aquaculture, and discloses an in-vitro hatching method for cherax quadricarinatus embryos. The method comprises the steps that 1, ovigerous cherax quadricarinatus with the embryos in the mid-development stage and in orange yellow is obtained; 2, the embryos are slightly stripped along pleopods by using a comb, disinfected by using a disinfectant and washed with sterile water; 3, the washed embryos are hatched, the hatching water temperature is controlled to be 29-30 DEG C, water is replaced every 2-3 days, and dead embryos or dead shrimps are removed in time; 4, after being hatched, the embryos continue to be bred, when it is found that part of shrimp egg yolk sacs disappear, feeding is started, and feeding is carried out once every day until all the shrimp egg yolk sacs disappear to obtain shrimp seeds. The method greatly improves the egg carrying and hatching effects of parent cherax quadricarinatus, the hatching synchronism rate is relatively high, and a reference is provided for exploration and establishment of a breeding technology of the cherax quadricarinatus SPF seeds.

The invention discloses a young cherax quadricarinatus screening device and a use method, and belongs to the technical field of cherax quadricarinatus industrial aquaculture. The device comprises a screening device body, a water flow control device and an inducing device, the screening device body comprises a temporary aquaculture tank, a primary screening tank, a secondary screening tank, a primary screening plate, a secondary screening plate, a first escape-proof plate and a second escape-proof plate, the temporary aquaculture tank and a water drainage tank is separated through the first escape-proof plate, the temporary aquaculture tank and the primary screening tank is separated through the primary screening plate, the primary screening tank and the secondary screening tank is separated through the secondary screening plate, the secondary screening tank and a water inlet tank is separated through the second escape-proof plate, the inducing device comprises a light source and a bait, and the water flow control device controls water to flow into the temporary aquaculture tank from the secondary screening tank. According to the device, cherax quadricarinatus seeds with different specifications are captivated, and the survival rate of the cherax quadricarinatus seeds can be greatly increased.

The invention belongs to the technical field of aquaculture, and discloses an ecological comprehensive breeding method of cherax quadricarinatus-ctenopharyngodon idellus-hydrilla verticillata; the preparation before dropping fries mainly comprises pond selection, pond clearing, water grass transplanting, water inflow testing, net cage setting and the like; young shrimps dropping and management; ctenopharyngodon idellus stocking; aquaculture management mainly comprises scientific bait casting, water quality management, anti-escape, anti-enemy harm and the like; fishing harvest of cherax quadricarinatus and ctenopharyngodon idellus. The hydrilla verticillata can provide a shelter and natural botanical bait for cherax quadricarinatus, and in addition, can purify water, increase dissolved oxygen and lower water temperature so as to create a good ecological environment. In the early stage of breeding, ctenopharyngodon idellus feed on artificial feed, and residual bait feces sink to the bottom of water and can be eaten by cherax quadricarinatus, the bottom of a net cage becomes a food intake and sheltering place for cherax quadricarinatus, the fertility of the pond can be improved, and the survival rate and growth rate of cherax quadricarinatus are conducive to being improved; in the late stage of breeding, ctenopharyngodon idellus mainly feed on hydrilla verticillata, the comprehensive utilization of aquatic plants is realized, and the adverse effects caused by the overgrowth of the aquatic plants are avoided.

The invention discloses a spawning and separation method for cherax quadricarinatus. The method specifically comprises the following steps of S1, preparation of hatching water, wherein tap water is filtered by 70-80-mesh nylon sieve cloth after being fully aerated; S2, mating of parent shrimps, wherein female and male shrimps which develop well, have no parasites on the body surfaces and are samein color are selected and enter a mating pond; S3, separation of the parent shrimps and eggs, wherein after the parent shrimps spawn, the parent shrimps and the eggs are flushed by adopting water flowwith the flow speed of 2 m / s, and the parent shrimps and the eggs are separated; S4, disinfection of the shrimp eggs, wherein the shrimp eggs prepared in S3 are placed in a sodium chloride solution and soaked for 5-10 minutes; S5, preservation of the shrimp eggs, wherein the eggs and the parent shrimps are placed in a storage bucket, the storage bucket is internally provided with a partition plate with fine holes uniformly distributed in the surface, and the partition plate divides the storage bucket into two spaces for storing the parent shrimps and the shrimp eggs respectively. By means ofthe method, the uniformity of shrimp spawning is ensured, and the shrimp spawning and hatching efficiency is improved; the shrimps are effectively sterilized in the spawning process by means of the method, and the survival rate and hatching rate of the shrimp eggs are increased.

The invention discloses a breeding method of young cherax quadricarinatus. The method comprises the following steps of 1, construction of a young cherax quadricarinatus breeding pond; 2, parent selection; 3, mating of breeding cherax quadricarinatus; 4, breeding of fertilized eggs; 5, breeding of young cherax quadricarinatus. By means of the breeding method of young cherax quadricarinatus, an optimal cherax quadricarinatus egg breeding environment is selected, the oogenesis rate of female cherax quadricarinatus is high, the hatching rate of young cherax quadricarinatus is high, the hatching quantity of young cherax quadricarinatus for single female cherax quadricarinatus reaches 200-300 at a time, young cherax quadricarinatus is reasonably fed, and the yield of young cherax quadricarinatusis effectively increased; meanwhile, a net cage device is arranged in the young cherax quadricarinatus breeding pond, the situation that parents eat young cherax quadricarinatus is effectively prevented, the survival rate of young cherax quadricarinatus is increased, and the economic benefit is obvious.

The invention discloses a cherax quadricarinatus industrial early-breeding method and system. The method is characterized by including: setting small net cages for temporary rearing by adopting tandemgreenhouse ponds, so that cherax quadricarinatus can effectively adapt to water quality conditions of a local water source before entering a heating greenhouse; slightly and naturally increasing thetemperature in an early stage, and performing male and female partitioned breeding in the same pond after entering the greenhouse; when preset control conditions are reached, opening a partition device to enable complete mating of male and female cherax quadricarinatus and oogenesis; after mating of 70-80% of female cherax quadricarinatus is completed, taking out 80% of male cherax quadricarinatus, breeding in a special pond, and waiting for next mating; after separation of well developed juvenile cherax quadricarinatus from maternal bodies, falling from bottom holes, driving through a retaining plate, and bringing out along with water flow. Outer tandem greenhouses are used for drainage, water storage and purification and available for planting of water purification plants; in mass emergence in spring, effective utilization in pond large-scale fry culture areas can be realized, a culture site is expanded, and energy consumption is reduced. Compared with traditional greenhouse artificial breeding, the method and the system have the advantage that emergence time is 1 month ahead of time.

The invention belongs to the technical field of aquaculture, and discloses a cherax quadricarinatus rice self-breeding method. The method comprises the steps of selecting a rice field suitable for rice and shrimp comprehensive breeding, wherein the rice field is provided with a 2-4 m wide and 0.8-1.2 m deep shrimp ditch; arranging an enclosure culture ditch, adopting an anti-escape net at the periphery, building an anti-escape facility, and isolating the enclosure culture ditch by means of the anti-escape net on the basis that the area ratio is 2:1-3:1; performing parent shrimp stocking, wherein female shrimp and male shrimp are stocked at the isolation region; performing offspring seed self-breeding, removing a sandbag and isolating the anti-escape net during the parent fish self-breedingperiod, and performing mating self-breeding on parent fish, wherein produced shrimp seeds penetrate through the anti-escape net and enter the rice field for natural growth. The culture parent shrimpis used for performing self-breeding, no shrimp seed needs to be purchased, the production cost is effectively lowered, and the rice field comprehensive breeding benefits are improved; the shrimp seedobtained after self-breeding penetrates through the anti-escape net for natural growth, damage to the shrimp seed during transportation and moving is avoided, and the shrimp seed survival rate is effectively increased.

The invention discloses a cherax quadricarinatus quality improvement feed, belongs to the technical field of breeding of cherax quadricarinatus, and solves the problem that through a conventional feed, the meat quality of the cherax quadricarinatus cannot be improved. The cherax quadricarinatus quality improvement feed comprises the following components in percentage by mass: 20-30% of imported fish meal, 15-25% of fresh fish slurry, 5-10% of euphausia superba powder, 3-5% of scallop powder, 15-25% of fermented soybean meal, 5-10% of a yeast extract, 5-10% of a seaweed extract, 2-3% of soybeanphospholipid, 0.5-1% of calcium dihydrogen phosphate, 10-20% of high gluten flour, 0.5-2% of multiple vitamins and multiple minerals, 3-5% of fish oil, 3-5% of an olive oil compound, 1-2% of composite probiotics and 1-2% of a traditional Chinese medicine extraction solution. The invention further discloses a preparation method of the feed. The prepared feed is fed in proportion of 30% instead ofa conventional feed every day at the breeding middle and later periods of the cherax quadricarinatus, so that the cherax quadricarinatus is bright in body color, compact in meat quality and fresh anddelicious in flavor, and the commodity value of the cherax quadricarinatus is greatly increased.

The invention discloses an ecological breeding method for cherax quadricarinatus and stone snails in a rice field. The method is composed of the steps of selection of a suitable rice field, timely planting of rice, stocking of young cherax quadricarinatus and young stone snails, feed feeding, daily management and harvest and overcomes the defect that comprehensive planting and breeding benefits ofthe rice field are low. Conditions are provided for simultaneous polyculture of the cherax quadricarinatus and the stone snails in the same rice planting field, the comprehensive planting and breeding potential of the rice field can be fully excavated, the process is simple and practical, operation is easy to understand, and the comprehensive planting and breeding benefits of the rice field can be improved by 30% or above.

The invention discloses a cherax quadricarinatus compound feed and a preparation method thereof. The cherax quadricarinatus compound feed comprises 14%-23% of soybean meal, 8%-11% of peanut bran, 6%-10% of corn protein powder, 5%-9% of rapeseed meal, 5%-10% of cuttlefish powder, 4%-8% of blood powder, 4%-7% of shrimp shell powder, 3%-6% of beer yeast, 1%-3% of earthworm powder, 3%-6% of sucrose, 6%-9% of corn starch, 6%-9% of high gluten flour, 0.1%-0.2% of sodium chloride, 1.0%-2.0% of compound vitamin, 0.5%-1.5% of compound mineral substance, 0.5%-1.5% of choline chloride, 1.0%-2.0% of calcium dihydrogen phosphate, 0.2%-0.6% of lysine, 0.2%-0.8% of methionine, 0.9%-1.95% of sodium carboxymethyl cellulose, 1.0%-2.0% of immunopotentiator, 1.0%-3.0% of phagostimulant, 0.05%-0.1% of compound enzyme, 2.0%-3.0% of soybean oil and 2.0%-3.0% of peanut oil. Comprehensive and balanced nutrition can be achieved.

The invention discloses an ecological alternate culture method of cherax quadricarinatus and procambarus clarkii. The ecological alternate culture method comprises the steps that disinfection and pond drying are conducted 1-2 months before culturing, and water starts to enter 20-30 days before fry putting; 15-20 days before the fries are put, aquatic plants are transplanted, and pond cleaning medicine is used for killing wild trash fishes; procambarus clarkii larvae are put in when the aquatic plants start to take roots, and 100-300 kg / mu of snails are put in March to April to serve as basic bait; after the middle ten days of April, procambarus clarkii with the specification of 35 g or above is caught to be marketed, and procambarus clarkii with the specification of 25 g or above is caught to be marketed in May; after the water temperature is stabilized at 20 DEG C or above, cherax quadricarinatus seeds are put in; after June, more than 25 g of procambarus clarkii is continuously caught for sale; and more than 45 g of cherax quadricarinatus starts to be caught in August for sale. A culturing and separation mode is adopted, the situation that large and small shrimps kill each other is avoided, the problem of self-reproduction and self-breeding germplasm degeneration can also be avoided, the culturing effect is quite remarkable, and good application prospects are achieved.

The invention relate to an in-vitro hatching device for cherax quadricarinatus, which comprises a hatching tank, a water storage tank and a water storage barrel, wherein the hatching tank and the water storage tank are of rectangular parallelepiped structures; the hatching tank comprises a top frame, two opposite side walls and a plurality of cross bars which are arranged between the two side walls at parallel intervals; a plurality of hatching boxes are erected between every two cross bars, and the box body of each hatching box is a net structure; the hatching tank and the water storage tankare nested, and the depth of the hatching tank is smaller than that of the water storage tank; the low part of the hatching box is immersed in a water body in the water storage tank; a water dischargeopening is arranged at the bottom of one end of the water storage tank and communicated with the water storage barrel; and the bottom of the water storage barrel is provided with a water outlet, andthe water outlet supplies water into the water storage tank from the other end opposite to the water discharge opening of the water storage tank through a first water pump. The in-vitro hatching device can effectively carry out basic disease control, gene control, quantity control in a hatching process and has a high hatching rate.