41 results about "GAPDH Gene" patented technology

The invention relates to a prenatal gene screening method for Down's syndrome by using nucleated erythrocyte and a kit thereof. The method is that a kit which comprises a nucleated erythrocyte purification reagent, primers and a bichrome Taqman fluorescent probe which are synthesized by the specific sequence DSCR section sequence of chromosome 21 and the GAPDH gene sequence on chromosome 16, and an amplification buffering action reagent of PCR action. The invention realizes that through the following steps: (a) the purification of fetus NRBC and the extraction of DNA; (b) the synthesis of the primers and the bichrome Taqman fluorescent probe respectively by using the specific sequence DSCR section sequence of chromosome 21 and the GAPDH gene sequence on chromosome 16; (c) the co-amplification of two pairs of the primers to obtain the curve of fluorescence quantitative PCR by the bichrome fluorescence quantitative PCR reaction in the amplification buffering reaction system. The invention has simple and convenient operation and high testing throughput, and belongs to a non-invasive prenatal diagnostic method.

The invention relates to a probe and kit for detecting SEPT9 gene methylation and discloses an optimized probe for detecting SEPT9 gene methylation. 2-3 deoxyinosine nucleotide bases (I) are introduced at a specific position on the methylation probe so that the methylation probe can be fully combined with a methylated sample DNA and the existence of a non-methylated site in a combination zone can be tolerated. Therefore, the detection efficiency of SEPT9 gene methylation is effectively increased. The probe can be applied to the kit for detecting SEPT9 gene methylation in combination with SEPT9 and GAPDH gene amplification primers.

The invention discloses a gene chip for detecting human papillomavirus (HPV), comprising a solid carrier and a human papillomavirus detecting probes fixed on the solid carrier. The detecting probes comprise nucleotide sequences in SEQ ID No.9-37, and the 27 types of HVP subtype specific probes in the invention correspondingly comprise 22 kinds of high-risk and mediate-risk HPV, and 5 kinds of low-risk HPV and two kinds of high-risk HPV integration (HPV16 / HPV18). The invention also discloses a detecting kit for detecting various subtypes of HPV in a sample with high speed and high flux, and the kit comprises the gene chip, a primer sequence for detection, a human GAPDH gene, special HPV lysing solution, PCR reaction liquid and a color reagent, wherein the detecting probe fixed on the gene chip has the nucleotide sequence in the SEQ ID No.9-37; the primer sequence for detection is used for amplifying the DNA sequence of the HPV in a clinical sample, and the human GAPDH gene is used for amplifying the clinical sample. The HPV detection has important significance for the clinical diagnosis of HPV as well as the early prevention, the diagnosis, the treatment and the postoperation tracking of cervical cancer.

The invention relates to a paeonia ostii reference gene under drought stress, and a special primer and application thereof. The reference gene is a TATA box binding protein TBP gene, an actin ACT1 gene, an actin ACT2 gene, a glyceraldehyde-3-phosphate dehydrogenase GAPDH gene, an eukaryote translation initiation factor eIF1 gene, a eukaryote translation initiation factor eIF2 gene, a tubulin alpha-TUB gene, a tubulin beta-TUB gene, an RNA polymerase II RNA Pol II gene or an RNA polymerase II transcription factor RP II gene. The nucleotide sequence of the gene is disclosed as the sequence table. The invention aims to provide a gene which can be stably expressed in the paeonia ostii gene expression profile under drought stress, and the gene is used as a paeonia ostii drought stress referencegene.

The present invention relates to a streptococcus adhesion antigen GAPDH and a preparation method thereof. The GAPDH is an rGAPDH, which has high conservative property and sequence homology, consists of 319 amino acid residues, and has a molecular weight of 32.4kDa. The rGAPDH is encoded by a gapdh gene; and a forward primer and a reverse primer of the gapdh gene respectively have one restriction enzyme cutting site at 5' and 3'. The preparation method of the GAPDH comprises the following steps of: PCR amplification, connection to a carrier, transformation and induction, and purification. The rGAPDH and an SEZ (Streptococcus zooepidemicus) rehabilitation pig serum show good immune responses; the rGAPDH can protect SEZ infected mice with limitation; and the mice immunized by the rGAPDH show high level of antibody titer in serum. An anti-GAPDH antibody can induce high level of bactericidal capability; a gapdh gene has a transcription level in SEZ infected mice much higher than that of culture in vitro; and the rGAPDH can significantly weaken cell adhesion ability of the SEZ, and greatly reduce cell infection ability of the SEZ.

The invention relates to a primer composite for identifying human induced pluripotent stem cell pluripotent genes, a kit and a detection method. The primer group comprises a primer group A, a primer group B and a confidential reference primer, wherein the primer group A comprises one or several kinds of primer pairs for amplifying human inducted pluripotent stem cell endogenous genes Oct4, Sox2 and Nanog; the primer group B comprises one or several kinds of primer pairs for amplifying Oct4, Sox2 and Nanog general genes; the confidential reference primer is a primer for amplifying a GAPDH gene.Concretely, RNA (ribonucleic acid) is extracted from the pluripotent stem cells; a real-time PCR(polymerase chain reaction) technology is used by the detection method and the kit for performing quantitative determination on the pluripotent gene so as to identify the endogenous and exogenetic pluripotent gene expression differences. By using the identification method provided by the invention, theoperation is simple; the cost is low; the accuracy and the sensitivity are high.

The invention discloses a reaction reagent box of double color fluorescence batching polymerase chain. Firstly, according to the distinguished DSCR sector sequence of the 21 chromosome and the GAPDH gene sequence of the 16 chromosome, the distinguished primer and the double color Taqman probe are separately synthesized, and then, the synthesis of the new chains are guided separately and simultaneously by the two pairs of primers through 45 PCR circulations in the identical expanded cushioning reacting system, and the altogether expanding of the two pairs of primers is realized. The signal changing situation of the fluorescence obtained because of the degrading of the Taqman probe in the expanding process is inspected when expanding the PCR, and the curve diagrams are obtained, and the Ct value of each gene is obtained. And therefore, the copy number ratio can be calculated, and the ploidy of the 21 chromosomes can be judged according to the ratio of the two gene copy number.

The invention discloses a screening method of reference genes in a skin tissue of sheep, which relates to the technical field of biological engineering. The screening method comprises the steps that: a method of the reference genes is confirmed; a given amount of RNA (ribonucleic acid) extract is taken and diluted by 2-10 times by ddH2O (double-distilled water); a 50 nanograms / microlitre RNA sample is taken to serve as a template, and a cDNA (complementary deoxyribonucleic acid) synthetic reagent kit is adopted for conducting inverse transcription to synthesize cDNA; the cDNA synthesized through the inverse transcription serves as a template, and six reference genes serve as primers; and finally, pairing variation analysis of normalized factors Vn / n+1 of the six reference genes are calculated based on a geNorm program, so as to decide the amount of the optimum reference genes. The screening method solves the problem that no screening method for GAPDH (reduced glyceraldehyde-phosphate dehydrogenase) genes in the skin tissue of a Chinese merino (Xinjiang type) serving as the reference genes is not available at present. Through the combination of the specificity of the SYBR Green I with double chain DNA to generate fluorescence, a real-time fluorescent quantitative PCR (polymerase chain reaction) detection method of the SYBR Green I for the GAPDH genes in the skin tissue of the Chinese merino (Sinkiang type) is established.

The invention provides a detection primer combination and kit for a GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene. The primer combination is designed in the sequence shown as SEQ ID No.1 as a target sequence and comprises F3, B3, FIP, BIP, LF and LB. When the primer combination is applied to an LAMP (loop mediated isothermal amplification) detection kit, results show that nonspecific amplification in primers and nonspecific binding amplification between the primers and a template are avoided for the primer combination, An LAMP amplified internal reference quality control system for a humanized sample is established successfully, and preliminary foundation is laid for widespread clinical use of the LAMP method in future.

The invention relates to a kit for detecting effectiveness of oxaliplatin to colorectal cancer. The kit comprises a pair of amplification primer sequences for detecting MAP4K1 gene copy number, a pair of amplification primer sequences for detecting PIK3CA gene copy number and a pair of primer sequences for detecting reference gene GAPDH gene copy number. Through the kit designed in the invention, effectiveness of oxaliplatin to colorectal cancer can be detected rapidly and effectively, and whether a patient to be detected is suitable to use oxaliplatin as a first-line chemotherapy drug is evaluated. The kit provided by the invention provides effective reference for clinical medication.

The invention provides a sisal hemp gene sequences ACT and GAPDH which are used as sisal hemp reference genes, further provides specific primers of the sisal hemp ACT and GAPDH as reference genes, establishes a qRT-PCR (Quantitative Reverse Transcription-Polymerase Chain Reaction) method based on an SYBR Green fluorescent dye technique, and provides stable and reliable reference genes and technique methods for gene expression analysis under adverse situations such as tobacco phytophthora infection, low temperature stress, salt stress and injury treatment on sisal hemp through real-time fluorescent quantitative PCR.

The invention discloses a molecular detection method of panonychus citri Mc Gregor response abamectin stress protein encoding gene. The molecular detection method comprises the following steps: firstly, extracting total RNA (Ribonucleic Acid) of panonychus citri Mc Gregor treated by abamectin, and then transcribing the RNA into cDNA (complementary Deoxyribonucleic Acid); secondly, carrying out real-time quantitative detection on RPSA, EEF2, ATPsyn-alpha, FAH, V-ATPsyn-B, CALR, sHsp, CarE-B, Actin, CRY, Fer, Vg, ATPsyn-D, TPX, TCP-1-eta and GAPDH genes by using a qPCR (quantitative Polymerase Chain Reaction) method, wherein upstream and downstream sequences of qPCR detecting primer pairs of 16 genes are shown as SEQ ID No: 1 to 32; thirdly, analyzing qPCR results to obtain expression results of the 16 genes treated by the abamectin with different concentrations at different time periods.

The invention relates to a kit for detecting effectiveness of oxaliplatin to colorectal cancer. The kit comprises a pair of amplification primer sequences for detecting MAP4K1 gene copy number, a pair of amplification primer sequences for detecting PIK3CA gene copy number and a pair of primer sequences for detecting reference gene GAPDH gene copy number. Through the kit designed in the invention, effectiveness of oxaliplatin to colorectal cancer can be detected rapidly and effectively, and whether a patient to be detected is suitable to use oxaliplatin as a first-line chemotherapy drug is evaluated. The kit provided by the invention provides effective reference for clinical medication.

The invention discloses a fluorescent quantitative PCR detection kit of tumor multidrug resistance gene and detection method thereof, wherein the kit comprises MDR1, MRP1, LRP and inner control GAPDH gene standard, sense / anti-sense primers for detecting the MDR1, MRP1, LRP and inner control GAPDH gene standard and fluorescent probes; the detection method of the kit comprises: extracting the cell total RNA of the sample to be detected, performing the reverse transcription of the RNA into cDNA, performing the fluorescent quantitative PCR of the MDR1, MRP1, LRP and inner control GAPDH gene standard, calculating the initial replication number of the MDR1, MRP1, LRP gene of the sample to be detected. The fluorescent quantitative PCR detection kit of tumor multidrug resistance gene and detection method can accurately, sensitively and specially detect the MDR1, MRP1, LRP gene at the same time and guide the tumor chemotherapeutic drugs, with features of quick and simple operation, easy standardization, low detection cost, suitable for the dynamic monitor of the multidrug resistance of the tumor patient.

The invention provides a mouse ovarian stem cell transplanting and tracking method. Survival rate of transplanted cells is prolonged by applying sodium hyaluronate gel; aiming at limitation of existing cell tracking methods, a primer is designed according to human and mouse GAPDH gene nonhomologous sequences, and PCR (polymerase chain reaction) technology is applied for transplanted cell in-vivo tracking; a simple, convenient and sensitive method for tracking retention of ovarian local stem cells is provided, thereby having great actual application value.

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter DNA which induces cell death, and a screening method for an apoptosis-suppressing agent using it. According to this invention, an apoptosis-suppressing agent can be screened by measuring the promoter activity of the GAPDH gene which discovers specifically the GAPDH protein which guides cell death in cell death process using the host cell in which the transformation was carried out by the vector incorporating the GAPDH promoter DNA.

The invention relates to a swine cholera attenuated salmonella recombinant strain for expressing a haemophilus parasuis GAPDH gene. A balanced lethal vector system of a salmonella choleraesuis C500 delta asd deletion strain is utilized, an important immunogenicity gene GAPDH of haemophilus parasuis is connected with pYA3493 vectors in host bacteria, and correspondingly an HPS-Sal recombinant vaccine strain is constructed, wherein the recombinant strain lacks an asd gene on a salmonella choleraesuis genome and contains a recombinant plasmid pYA-GAPDH capable of expressing the asd gene and the GAPDH gene of haemophilus parasuis in the strain. It is shown by detection that the recombinant strain has a good expression effect. It is indicated that outer membrane protein GAPDH can be used as basic protein for researching clinical detection, epidemiological investigation and immunodetection of haemophilus parasuis in the later period, and because of the particularity of vectors and receptor bacteria, a basic idea is provided for creation of bivalent vaccines of swine cholera and haemophilus parasuis.

The invention discloses a targeting vector construction method for site-directed integration of an exogenous gene into a GAPDH gene and its application. The targeting vector takes the GAPDH gene termination codon upstream and downstream sequences as left and right homologous arms, a left homologous arm, a 2A sequence, an exogenous gene sequence and a right homologous arm are sequentially connected, and are subjected to reverse insertion into a multiple cloning site of an eukaryotic expression vector. The targeting vector is co-transfected into a porcine eukaryotic cell with a CRISPR / Cas9 cleavage vector containing sgRNA specifically targeting downstream of the porcine GAPDH gene, and the exogenous gene can be site-integrated downstream of the GAPDH gene. The target site provided by the invention can broaden the range of integration sites of the exogenous gene in the pig genome, and can lay a foundation for preparing the efficient and stable expression of the exogenous gene in the pig genome.

The invention discloses a kit for rapidly detecting Ebola virus and aims to provide the kit which is simple in application method and can be used for rapidly detecting the Ebola virus. Technical points are that the kit is prepared by the following steps sequentially: (1) designing a reverse transcription primer, an amplification primer and a probe in a conserved region of a Nucleoprotein gene; (2) designing the reverse transcription primer and the probe which are used simultaneously in the conserved region of a GAPDH gene; (3) preparing an RT-TaqMan kit. The kit belongs to the technical field of gene detection.

The invention discloses a special kit for detecting mRNA of a gene Bmi-1 in blood plasma of patients with cervical cancer, which has the advantages of stable result, reliable analysis and the like. The special kit comprises primers of the mRNAs of the gene Bmi-1, a gene GAPDH, a gene EEF1A1, which are shown by SEQUENCE LISTING. The invention also discloses a method for detecting the expression of the mRNA of the gene Bmi-1 in blood plasma of the patients with cervical cancer, which has the advantages of simple, convenient and easy operation and the like. The method comprises the following step: (1) extracting total RNA of sample blood plasma; (2) performing reverse transcription-polymerase chain reaction (RT-PCR) amplification; (3) drawing a standard curve, calculating slope, and calculating amplification efficiency E according to a formula (E=10(-1 / slope)-1; and (4) calculating, namely selecting sample and calibrating sample detection holes, obtaining a sample threshold and a calculating sample threshold by using random software of real-time fluorescence quantitative PCR apparatus, obtaining a calibration initial copy number Q of the gene according to a formula (Q=(E+1)-deltaCq), and obtaining the relative expression of the target gene Bmi-1 by comparing the geometrical average of the Q values of the sample target gene and the geometrical average of the Q values of an internal reference gene.

The invention discloses a method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells; comprising the steps: first, extracting glial cells; second, culturing the cells; third, treating with a drug; fourth, extracting mRNA; fifth, reacting: pre-denaturing at 95 DEG C for 30 s, denaturing at 95 DEG C for 20 S, annealing at 60 DEG C for 15 s, extending at 72 DEG C for 15 s, and amplifying by 40 loops; sixth, calculating: using mRNA expression of GAPDH gene as an internal reference for a sample, and calculating expression level of relative mRNA of a target gene in in various samples through a relative quantitation method (2- CT). Sequences of a primer include: GAPDH: F: 5' TCCCTCAAGATTGTCAGCAA3'; R: 5' AGATCCACAACGGATACATT3'; GDNF: F: 5' GACTTGGGTTTGGGCTACGA3'; R: 5' TGGTAAACCAGGCTGTCGTC3'. Through a treatment process of the invention, the expression level of the detected glial cell 2^- CT is higher; meanwhile, through variance comparison, the method of the invention enables more stable expression level of 2^- CT.

The invention discloses a method for preparing GAPDH (reduced glyceradehyde-phosphate dehydrogenase) transgenic cotton. GAPDH proteins are as shown in a formula (1) or (2), wherein the formula (1) represents proteins as shown in SEQ ID No.2; (2) the formula (2) represents proteins which are obtained by substitution and / or deletion and / or addition of one or a few of amino acid residues of an amino acid sequence as shown in the SEQ ID No.2. According to the invention, the GAPDH transgenic cotton is obtained for the first time, a foundation is established for cultivation of saline-alkaline tolerance cotton variety and improvement of saline-alkaline tolerance capacity of the cotton, and economic and social benefits are achieved.

The invention discloses a two-color fluorescent quantitative co-amplification polymerase chain reaction kit. Firstly, the specific primers and two-color Taqman probes are respectively synthesized according to the specific DSCR segment sequence of No. 21 chromosome and the GAPDH gene sequence on No. 16 chromosome, and then In the same amplification buffer reaction system, after 45 PCR cycles, the two pairs of primers are simultaneously guided to synthesize new strands, and the co-amplification of the two pairs of primers is realized. During the PCR amplification, the intensity change of the fluorescent signal obtained due to the degradation of the Taqman probe was detected during the amplification process, and the respective amplification curves were obtained, and then the Ct value of each gene was obtained. Thereby calculating their copy number ratio, and then further judging the ploidy of chromosome 21 according to the ratio of the copy numbers of the two genes.

The invention discloses a special kit for detecting mRNA of a gene Bmi-1 in blood plasma of patients with cervical cancer, which has the advantages of stable result, reliable analysis and the like. The special kit comprises primers of the mRNAs of the gene Bmi-1, a gene GAPDH, a gene EEF1A1, which are shown by SEQUENCE LISTING. The invention also discloses a method for detecting the expression ofthe mRNA of the gene Bmi-1 in blood plasma of the patients with cervical cancer, which has the advantages of simple, convenient and easy operation and the like. The method comprises the following step: (1) extracting total RNA of sample blood plasma; (2) performing reverse transcription-polymerase chain reaction (RT-PCR) amplification; (3) drawing a standard curve, calculating slope, and calculating amplification efficiency E according to a formula (E=10(-1 / slope)-1; and (4) calculating, namely selecting sample and calibrating sample detection holes, obtaining a sample threshold and a calculating sample threshold by using random software of real-time fluorescence quantitative PCR apparatus, obtaining a calibration initial copy number Q of the gene according to a formula (Q=(E+1)-deltaCq),and obtaining the relative expression of the target gene Bmi-1 by comparing the geometrical average of the Q values of the sample target gene and the geometrical average of the Q values of an internal reference gene.

The invention relates to a lung adenocarcinoma prognosis prediction method and device based on lipid metabolism genes, and the method comprises the following steps: obtaining a to-be-detected sample, and detecting the RNA expression level of a plurality of genes of the to-be-detected sample, the plurality of genes including a GAPDH gene, a GNPNAT1 gene, an HTATIP2 gene, an MFI2 gene, a PKP2 gene, an RGS20 gene and a CHRDL1 gene; and calculating the prognosis risk score of the lung adenocarcinoma according to the detected RNA expression levels of the plurality of genes. Compared with the prior art, the method has the advantages that the obtained 7-gene model has high robustness, and stable prediction efficiency can be exerted in data sets of different platforms; the method has good AUC in a training set and a verification set, and is a model independent of clinical features.

The invention discloses a gene chip for detecting human papillomavirus (HPV), comprising a solid carrier and a human papillomavirus detecting probes fixed on the solid carrier. The detecting probes comprise nucleotide sequences in SEQ ID No.9-37, and the 27 types of HVP subtype specific probes in the invention correspondingly comprise 22 kinds of high-risk and mediate-risk HPV, and 5 kinds of low-risk HPV and two kinds of high-risk HPV integration (HPV16 / HPV18). The invention also discloses a detecting kit for detecting various subtypes of HPV in a sample with high speed and high flux, and the kit comprises the gene chip, a primer sequence for detection, a human GAPDH gene, special HPV lysing solution, PCR reaction liquid and a color reagent, wherein the detecting probe fixed on the gene chip has the nucleotide sequence in the SEQ ID No.9-37; the primer sequence for detection is used for amplifying the DNA sequence of the HPV in a clinical sample, and the human GAPDH gene is used for amplifying the clinical sample. The HPV detection has important significance for the clinical diagnosis of HPV as well as the early prevention, the diagnosis, the treatment and the postoperation tracking of cervical cancer.

The invention discloses a method for preparing GAPDH (reduced glyceradehyde-phosphate dehydrogenase) transgenic cotton. GAPDH proteins are as shown in a formula (1) or (2), wherein the formula (1) represents proteins as shown in SEQ ID No.2; (2) the formula (2) represents proteins which are obtained by substitution and / or deletion and / or addition of one or a few of amino acid residues of an amino acid sequence as shown in the SEQ ID No.2. According to the invention, the GAPDH transgenic cotton is obtained for the first time, a foundation is established for cultivation of saline-alkaline tolerance cotton variety and improvement of saline-alkaline tolerance capacity of the cotton, and economic and social benefits are achieved.

The invention belongs to the field of biological genes, and discloses a specific primer combination used for detecting the gene expression of fine-wool sheep skin follicles. The specific primer combination comprises a specific primer of sheep EphrinA3 gene and a specific primer of GAPDH gene; and the nucleotide sequence of the specific primer of the sheep EphrinA3 gene is represented by SEQ ID NO.1, the nucleotide sequence of the specific primer of the GAPDH gene is represented by SEQ ID NO.2, and the designed primers have no specific amplification. A fluorescent quantitative PCR method used in the invention is a high-sensitivity simple and quick detection method, is simple to operate, and can be used to SYBR green dye method detection without using a fluorescent probe; and a fluorescent quantitative PCR relative quantification method is used to compare with housekeeping gene having a stable expression level in order to reflect the expression levels of the target genes, so the study of the EphrinA3 expression level can be well assisted.