Probe for detecting SEPT9 gene methylation and application of probe

A methylation and probe technology, applied in the field of probes for detecting methylation of the SEPT9 gene, can solve the problems of low binding efficiency between conventional probes and template DNA, affecting sensitivity, and inability to combine probes and template DNA

Inactive Publication Date: 2015-08-12
GENE TECH SHANGHAI COMPANY
View PDF4 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When the SEPT9 gene in tumor cells is in a partially methylated state, the binding efficiency of conventional probes to template DNA is low, which affects the sensitivity of detection
In extreme cases, there is a non-methylated site in the detection segment, which may cause the probe to fail to bind to the template DNA, resulting in false negative results
Conventionally designed methylation probes are not suitable for detecting partially methylated samples of the SEPT9 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe for detecting SEPT9 gene methylation and application of probe
  • Probe for detecting SEPT9 gene methylation and application of probe
  • Probe for detecting SEPT9 gene methylation and application of probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1, the methylation level detection example of SEPT9 gene

[0053] In this embodiment, fluorescent PCR technology was used to test the detection status of the SEPT9 gene methylation probe on samples with different methylation levels.

[0054] The sequence to be tested in the promoter region of the V2 splice body of the SEPT9 gene is as follows:

[0055] TCTGCACTGCAGGAGCGCGGGCGCGGCGCCCCAGCCAGCGCGCAGGGCCCGGGCCCCGCCGGGGGCGCTTCCTCGCCGCTGCCCTCCGCGCGACCCGCTGCCCACCAGCCATCATG CAGCTGGATGGGATCATTTCGGACTTCGAAGGTGGGTGCTGGGCTGGCTGCTGCGGCCGCGGACGTGCTGGAGAGGACCCTGCGGGTGGGCCTGGCGCGGGACGGGGGTG (SEQ ID NO: 1)

[0056] The boxed section contains 5 CpG methylation sites, which are the probe binding sites in this example.

[0057] The above SEPT9 gene sequence was subjected to bisulfite or Na 2 S 2 o 5 The processed sequence is as follows:

[0058] TTTGTATTGTAGGAGYGYGGGYGYGGYGTTTTAGTTAGYGYGTAGGGTTYGGGTTTYGTYGGGGGYGTTTTTYGTYGTTGTTTTTYGYGYGATTYGTTGTTTATTAGTTATTATG TAGTTGGAT...

Embodiment 2

[0082] Example 2. Application of the SEPT9 gene methylation detection kit in the detection of colorectal cancer samples

[0083] Methylation of SEPT9 gene promoter is a specific molecular marker for early diagnosis of colorectal cancer. Normally, the SEPT9 gene is methylated in the tumor tissue or blood samples of colorectal cancer patients, while the SEPT9 gene is unmethylated in normal tissues or blood samples. Using the SEPT9 methylation probe of the present invention, combined with the fluorescent PCR detection method, a methylation detection kit for the SEPT9 gene can be developed, which can quickly and sensitively detect the methylation state of the SEPT9 gene in the sample. A control reagent for GAPDH gene amplification can also be added to the kit for internal control of the reaction tube to make the detection result more accurate and reliable.

[0084] 1. PCR primers and probes in the SEPT9 gene methylation detection kit

[0085] (A) The primers and probes used for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a probe and kit for detecting SEPT9 gene methylation and discloses an optimized probe for detecting SEPT9 gene methylation. 2-3 deoxyinosine nucleotide bases (I) are introduced at a specific position on the methylation probe so that the methylation probe can be fully combined with a methylated sample DNA and the existence of a non-methylated site in a combination zone can be tolerated. Therefore, the detection efficiency of SEPT9 gene methylation is effectively increased. The probe can be applied to the kit for detecting SEPT9 gene methylation in combination with SEPT9 and GAPDH gene amplification primers.

Description

technical field [0001] The invention belongs to the field of gene detection, and more specifically, the invention relates to a probe for detecting SEPT9 gene methylation and application thereof. Background technique [0002] DNA methylation is one of the ways of gene epigenetic modification, which may exist in all higher organisms. DNA methylation shuts down the activity of certain genes, while demethylation induces reactivation and expression of genes. In mammals, DNA methylation only occurs on CpG cytosine, and under the action of DNA methyltransferases (DNMTs), the cytosine at the 5' end of the CpG dinucleotide is converted into 5' methylcytosine ( m C). This DNA modification does not change the gene sequence, but it can regulate gene expression. DNA methylation is the most well-studied epigenetic mechanism, which plays an important role in the maintenance of normal cell function, modification of chromatin structure, X chromosome inactivation, genomic imprinting, embr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor王东梁旺李宾
OwnerGENE TECH SHANGHAI COMPANY