Probe for detecting SEPT9 gene methylation and application of probe
A methylation and probe technology, applied in the field of probes for detecting methylation of the SEPT9 gene, can solve the problems of low binding efficiency between conventional probes and template DNA, affecting sensitivity, and inability to combine probes and template DNA
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Embodiment 1, the methylation level detection example of SEPT9 gene
[0053] In this embodiment, fluorescent PCR technology was used to test the detection status of the SEPT9 gene methylation probe on samples with different methylation levels.
[0054] The sequence to be tested in the promoter region of the V2 splice body of the SEPT9 gene is as follows:
[0055] TCTGCACTGCAGGAGCGCGGGCGCGGCGCCCCAGCCAGCGCGCAGGGCCCGGGCCCCGCCGGGGGCGCTTCCTCGCCGCTGCCCTCCGCGCGACCCGCTGCCCACCAGCCATCATG CAGCTGGATGGGATCATTTCGGACTTCGAAGGTGGGTGCTGGGCTGGCTGCTGCGGCCGCGGACGTGCTGGAGAGGACCCTGCGGGTGGGCCTGGCGCGGGACGGGGGTG (SEQ ID NO: 1)
[0056] The boxed section contains 5 CpG methylation sites, which are the probe binding sites in this example.
[0057] The above SEPT9 gene sequence was subjected to bisulfite or Na 2 S 2 o 5 The processed sequence is as follows:
[0058] TTTGTATTGTAGGAGYGYGGGYGYGGYGTTTTAGTTAGYGYGTAGGGTTYGGGTTTYGTYGGGGGYGTTTTTYGTYGTTGTTTTTYGYGYGATTYGTTGTTTATTAGTTATTATG TAGTTGGAT...
Embodiment 2
[0082] Example 2. Application of the SEPT9 gene methylation detection kit in the detection of colorectal cancer samples
[0083] Methylation of SEPT9 gene promoter is a specific molecular marker for early diagnosis of colorectal cancer. Normally, the SEPT9 gene is methylated in the tumor tissue or blood samples of colorectal cancer patients, while the SEPT9 gene is unmethylated in normal tissues or blood samples. Using the SEPT9 methylation probe of the present invention, combined with the fluorescent PCR detection method, a methylation detection kit for the SEPT9 gene can be developed, which can quickly and sensitively detect the methylation state of the SEPT9 gene in the sample. A control reagent for GAPDH gene amplification can also be added to the kit for internal control of the reaction tube to make the detection result more accurate and reliable.
[0084] 1. PCR primers and probes in the SEPT9 gene methylation detection kit
[0085] (A) The primers and probes used for ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 