45 results about "Glial cell line-derived neurotrophic factor" patented technology

A method of treating Parkinson's disease in humans is disclosed, wherein glial cell-line derive neurotrophic factor (GDNF) is chronically administered directly to one or both putamen of a human in need of treatment thereof via convection-enhanced infusion using at least one implantable pump and at least one catheter. In one aspect of the present invention the GDNF is infused directly into one or both putamen through one or more indwelling intraparenchymal mutltiport brain catheters connected to one or moreimplantable pumps wherein the flow rate is pulsed.

The present invention relates to glial cell line-derived neurotrophic factor (GDNF), a potent neurotrophin that exhibits a broad spectrum of biological activities on a variety of cell types from both the central and peripheral nervous systems. The present invention involves the cloning and characterization of receptors for GDNF. Nucleic acid and amino acid sequences are described for GDNFR protein products. A hydrophobic domain with the features of a signal peptide is found at the amino terminus, while a second hydrophobic domain at the carboxy terminus is involved in the linkage of the receptor to the cell membrane. The lack of a transmembrane domain and cytoplasmic region indicates that GDNFR requires one or more accessory molecules in order to mediate transmembrane signaling. GDNFR mRNA is widely distributed in both nervous system and non-neural tissues, consistent with the similar distribution found for GDNF.

The invention discloses an expression structure method for constructing Glial cell line-Derived Neurotrophic Factor (GDNF) fusing penetrating peptides, the purification of an expressed protein product and the significance thereof, which is mainly characterized in that (1) GDNF parent is a human source mature type; (2) the N-tail end of the GDNF is fused with PEP-1 penetrating peptides comprising the 21 amino acid; and the expression product of the constructed penetrating peptides GDNF fusing the gene expression plasmid has the membrane penetrating function and biological function of GDNF and can be clinically applied in the treatment of the related diseases.

The invention relates to a biotechnology and especially relates to a construction method of a glial cell line-derived neurotrophic factor gene-modified embryo neural stem cell. The construction method comprises the following steps of 1, plasmid transformation, 2, plasmid digestion purification, 3, target gene and vector cloning, 4, recombinant plasmid packaging, 5, recombinant plasmid identification, 6, virus titer determination, 7, stem cell culture, 8, virus infection of the stem cells, 9, transgenic stem cell identification, 10, transgenic stem cell target-protein content determination, and 11, transgenic stem cell biological-activity detection. The glial cell line-derived neurotrophic factor gene-modified embryo neural stem cell has strong effects of promoting survival of dopaminergic neurons and retains characteristics of the original neural stem cell. The glial cell line-derived neurotrophic factor gene-modified embryo neural stem cell has good effects of treating motor neuron damage diseases and neuronal degeneration diseases.

The invention discloses a spinal cord fusion agent and a preparation method and use thereof. The spinal cord fusion agent disclosed by the invention is prepared from polyethylene glycol, bone mesenchymal stem cells, Schwann cells, glial cell lined derived neurotrophic factor (GDNF), salvianolic acid and nano graphene. Studies show that the use of the spinal cord fusion agent of the invention enables rapid reconnection of divided white matter fiber tracts and gray matter staple fibers to reconstitute spinal integrity and electrical conduction and is capable of recovering motion and sensory functions below the lesion level in a short period of time, thereby effectively reducing the incidence of paraplegia and complications thereof, and no relevant products exist at home and abroad. The spinal cord fusion agent disclosed by the invention can have a wide application prospect clinically.

The present invention provides a method for inducing neural differentiation comprising treating a bone marrow stem cell with a neurotrophic factor and/or dibutyryl cAMP (dbcAMP), wherein the neurotrophic factor comprises glial cell line-derived neurotrophic factor (GDNF) or pituitary adenylate cyclase-activating polypeptide (PACAP).

The invention discloses a recovery liquid and a recovery method for cryopreserved epidermal stem cells. According to the key point of the technical scheme, the recovery liquid is prepared from the following components in parts by weight: 20-25 parts of carbohydrates, 0.06-0.08 part of epidermal growth factors, 0.06-0.08 part of alkaline fibroblast growth factors, 0.01-0.02 part of polylysine, 0.01-0.02 part of glial cell line derived neurotrophic factors, 0.1-0.25 part of trypsin and 10-15 parts of fetal calf serum. According to the technical scheme, good recovery effect of the epidermal stem cells is achieved, and the growth environment of the epidermal stem cells is relatively proper.

The present invention relates to an in vitro method for identifying a molecule, which interferes with the interaction between a glial cell-line derived neurotrophic factor family ligand (GFL) and a heparan sulfate proteoglycan (HSPG), by screening a library of molecules against a matrix anchored complex comprising at least one immobilized glial cell-line derived neurotrophic factor family ligand (GFL) and at least one heparan sulfate proteoglycan (HSPG), wherein the interfering molecule is isolated based on its capacity to replace a glial cell-line derived neurotrophic factor family ligand (GFL) in said anchored complex. The invention also relates to a complex for identifying such a molecule. The invention also relates to methods for preventing or delaying a neurodegenerative process as well as to method for prophylactic treatment or treatment of a disorder in the nervous system.

The invention provides a nerve graft and a nerve graft system using the same, and relates to the technical field of medical engineering. The nerve graft provided by the invention comprises a sensory nerve bundle passage, a moving nerve bundle passage and a mixed nerve bundle passage; all nerve bundle passages are matched with the nerve bundles of the corresponding sections of normal nerve, and are respectively filled with NGF (nerve growth factor), GDNF (glial cell-line derived neurotrophic factor), and NGF and GDNF. The nerve graft provided by the invention is matched with the nerve section to be restored in appearance; the inside nerve bundle passage trend is also precisely matched with the nerve bundle to be restored. Secondly, different nerve nutrition factors are respectively loaded in the nerve graft; the promotion and the direction guide can be performed for the nerve bundles with different functions; the matching rate of the nerve graft and the receptor nerve can be improved; the classified guidance on different nerve bundles can be realized; the nerve restoration effect is improved. In addition, the invention also provides the nerve graft system using the nerve graft so as to treat complicated nerve defect diseases and patients.

The invention discloses a gene capable of enhancing the anti-inflammatory capability of human adipose-derived stem cells (AMSCs) and application of the gene. A nucleotide sequence of the gene is shownas SEQ ID NO: 1. The invention further provides the application of the gene capable of enhancing the anti-inflammatory capability of the human adipose-derived stem cells to a preparation process of amedicine for treating kidney diseases. The gene is a glial cell line-derived neurotrophic factor GDNF. The GDNF modified AMSCs can be used for optimizing the effects of treating kidney fibrosis and delaying a renal failure progress of pure adipose-derived stem cells. According to the gene disclosed by the invention, related researches of the kidney diseases are carried out by applying the GDNF modified AMSCs for the first time, a stem cell therapy method is optimized and a novel thought of traditional cell therapy is explored.

The present invention relates to Glial Cell Line-Derived Neurotrophic Factor (GDNF) protein and gene and is, in particular, directed to a novel splice variant of GDNF protein, which is encoded by a novel splice variant pre-(γ)pro-GDNF, and secreted under biological regulation.

The invention relates to a method for studying migration, proliferation and differentiation of brain endogenous neural stem cells. The method comprises the following steps: (1) performing double-labeled immunofluorescent staining on an animal brain section by 5-bromndeoxyuridine and doublecortin, 5-bromndeoxyuridine and neuronal nuclei antigen as well as 5-bromndeoxyuridine and glial cell line-derived neurotrophic factor, and single-labeled immunofluorescent staining by sialyl neural cell adhesion molecules; and (2) carrying out statistic analysis on data and drawing by GraphPad Prism6.0 software, and performing one-way variance analysis on single-factor multi-group data of the 5-bromndeoxyuridine positive cells, wherein the animal brain section is subjected to the following treatment: stereotactically injecting a 6-hydroxydopamine solution into a corpus striatum of the right side of the brain, injecting a PSA (prostate-specific antigen) specificity lyase stock solution into the lateral ventricle, and then injecting a 5-bromndeoxyuridine solution in the abdominal cavity. An effective method for studying migration influence of the brain endogenous neural stem cells is provided.

The invention relates to a cytological method for assaying the activity of an rhGDNF (recombinant human Glial cell line-Derived Neurotrophic Factor). The method comprises the following steps of: constructing expression plasmid pcDNA3.1-hGFR alpha 1, and then preparing an HEK293 cell which stably expresses hGFR alpha 1; constructing expression plasmid pcDNA3.1-hRET, and then preparing an HEK293 cell capable of simultaneously expressing hGFR alpha 1, hRET and a luciferase reporting system; adding the rhGDNF to be assayed into the HEK293 cell capable of simultaneously expressing hGFR alpha 1, hRET and the luciferase reporting system, and assaying fluorescence intensity F1 after culturing; meanwhile, arranging a blank control group in which the rhGDNF is not added, and assaying fluorescence intensity F2 after culturing; and comparing F1 with F2. The method has the advantages that the activity of the rhGDNF can be effectively assayed and the assayed result is accurate and reliable.

The invention discloses a lentiviral vector for expressing the glial cell line-derived neurotrophic factor and applications thereof, which belong to the field of medical biotechnology. The preservation number of the lentiviral vector is CGMCC No.2086. The invention has the advantages: the lentiviral vector constructed by the invention has two promoter structures and can simultaneously express GDNF gene and hygromycin resistance gene, the lentiviral vector supernatant packaged by the transient transfeetion method can carry out high-efficiency transfection on the neural stem cells which divide relatively slowly, thus leading the GDNF gene to be integrated to the target cell genom and be stably expressed for a long time; the neural stem cells after transfection can remove the neural stem cells which are not successful for transfection by the screening of the hygromycin so as to obtain the uniform over-expression GDNF cell system; and the neural stem cells which carry out gene modification by the lentiviral vector can still keep the intrinsical biological characteristics.

The invention relates to a fusion protein of a midbrain astrocyte-derived neurotrophic factor for preventing and treating obesity, and belongs to the technical field of biological medicines. The invention provides a fusion protein of a midbrain astrocyte-derived neurotrophic factor. The fusion protein at least contains the following two fragments: an amino acid sequence of the midbrain astrocyte-derived neurotrophic factor and an amino acid sequence of an immune globulin Fc fragment. The fusion protein is good in stability and long in half-life period, can be used for treating obesity, diabetes mellitus and other metabolic diseases, and has a good application prospect.

A medicinal composition is administered orally twice a day to a patient to ameliorate the symptoms related to Parkinson's disease. The medicinal composition includes mixing a quantity of ibogaine, a quantity of vitamin supplements and a quantity of manufacturing additives into a heterogeneous medicinal mixture. The quantity of ibogaine, formulated as ibogaine HCl, other non-toxic salts of ibogaine (an alkaloid of the family apocynaceae), or noribogaine, its active metabolite, is an active ingredient to regulate endogenous glial cell line-derived neurotrophic factor (GDNF). The quantity of vitamin supplements promotes the general health and neurological functions. The quantity of manufacturing additives bonds the quantity of ibogaine and the quantity of vitamin supplements together, as well as, provides anti-adherent properties to prevent the medicinal mixture from adhering to manufacturing equipment.

The invention relates to a real-time fluorescence quantitative PCR (polymerase chain reaction) special primer and method for detecting GDNF (glial cell line-derived neurotrophic factor) splice variants 2,4. The sequences of the primer are shown in SEQIDNO.1 and SEQIDNO.2. The fluorescence quantitative PCR method is implemented by taking a brain tissue cDNA (complementary deoxyribonucleic acid) sample as a template, setting a template-free control, and groping and optimizing condition parameters of a quantitative reaction system by using the primer, so that a reliable and sensitive quantitative detection method for splice variants is developed. According to the invention, the expression levels of a GDNF splice variant 2 (GenecodeNO.: NM_001190469.1) and a splice variant 4 (GenecodeNO.: NM_199231.2) can be detected; the primer and method disclosed by the invention have the advantages of strong specificity and high repeatability.

The invention discloses a method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells; comprising the steps: first, extracting glial cells; second, culturing the cells; third, treating with a drug; fourth, extracting mRNA; fifth, reacting: pre-denaturing at 95 DEG C for 30 s, denaturing at 95 DEG C for 20 S, annealing at 60 DEG C for 15 s, extending at 72 DEG C for 15 s, and amplifying by 40 loops; sixth, calculating: using mRNA expression of GAPDH gene as an internal reference for a sample, and calculating expression level of relative mRNA of a target gene in in various samples through a relative quantitation method (2- CT). Sequences of a primer include: GAPDH: F: 5' TCCCTCAAGATTGTCAGCAA3'; R: 5' AGATCCACAACGGATACATT3'; GDNF: F: 5' GACTTGGGTTTGGGCTACGA3'; R: 5' TGGTAAACCAGGCTGTCGTC3'. Through a treatment process of the invention, the expression level of the detected glial cell 2^- CT is higher; meanwhile, through variance comparison, the method of the invention enables more stable expression level of 2^- CT.