Method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells

A technology for glioma cells and detection methods, which is applied in the field of GDNF gene promoter detection in glioma cells, can solve the problem of low stereotypes and achieve the effects of ensuring survival rate and activity, stable expression, and multiple adherent areas

Inactive Publication Date: 2016-10-26
WENZHOU CENT HOSPITAL
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Through the development of existing technology, the expression of GDNF gene mRNA and the state of acetylation modification of histone H3K9 in its promoter region Ⅰ, the mRNA of GDNF gene has an important relationship with gene carcinogenesis, and the method of detecting mRNA of GDNF gene is also recorded in the prior art , but the methods in the prior art are too much affected by the outside world, so the detected uncertainty is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0047] Step 1: Extract glioma cells: take glioma samples within 48 hours, cut them into pieces and wash them with water, add 0.25% trypsin solution and digest them at 37°C for 5 minutes; collect cells and culture them in DMEM containing 10% fetal bovine serum / F12 culture medium, change the medium twice a week; after 7-9 days of primary culture, place the culture bottle on a constant temperature shaker at 37°C, 200rpm, and shake for 20h to purify to remove microglia and oligodendrocytes;

[0048] The positive cells identified by GFAP immunofluorescence were regarded as mature cells, and those in the logarithmic growth phase of the fourth passage were used as glioma cell lines;

[0049] In the first step, after the sample is shredded, it is cleaned once with 75% alcohol, then soaked in the cleaning solution for 15 minutes, and then rinsed at least three times with the cleaning solution. The cleaning solution includes the following components by weight:

[0050] 800~1000 parts o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells; comprising the steps: first, extracting glial cells; second, culturing the cells; third, treating with a drug; fourth, extracting mRNA; fifth, reacting: pre-denaturing at 95 DEG C for 30 s, denaturing at 95 DEG C for 20 S, annealing at 60 DEG C for 15 s, extending at 72 DEG C for 15 s, and amplifying by 40 loops; sixth, calculating: using mRNA expression of GAPDH gene as an internal reference for a sample, and calculating expression level of relative mRNA of a target gene in in various samples through a relative quantitation method (2- CT). Sequences of a primer include: GAPDH: F: 5' TCCCTCAAGATTGTCAGCAA3'; R: 5' AGATCCACAACGGATACATT3'; GDNF: F: 5' GACTTGGGTTTGGGCTACGA3'; R: 5' TGGTAAACCAGGCTGTCGTC3'. Through a treatment process of the invention, the expression level of the detected glial cell 2^- CT is higher; meanwhile, through variance comparison, the method of the invention enables more stable expression level of 2^- CT.

Description

technical field [0001] The invention relates to a medical detection method, in particular to a detection method of GDNF gene promoter in glioma cells. Background technique [0002] Glial lineage-derived neurotrophic factor (GDNF) is an important growth-promoting factor of glioma primary glioma cells, and its transcription is abnormally elevated in primary glioma tissues and various glioma cell lines. At present, there have been many studies on the mechanism of high transcription of genes on the malignant proliferation and migration of glioma cells, but there are few reports on the mechanism of high transcription. The previous research of our research group found that the high transcription of gdnf gene has nothing to do with gene mutation, speculating that epigenetic modification based on non-DNA sequence changes may be involved in its high transcription regulation process. Recent studies have shown that post-translational histone acetylation plays an important role in regu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q2545/101
Inventor 陈茂华孙军陆川陈献东巴华君蔡建勇
Owner WENZHOU CENT HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap