Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

LAMP (loop mediated isothermal amplification) detection primer combination and kit for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene

A gene detection and primer combination technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of sample nucleic acid extraction failure, poor stability, and amplification failure.

Inactive Publication Date: 2017-10-24
曹国君
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, in recent years, the practical application of LAMP technology in the laboratory is relatively limited, and the progress is relatively slow. Based on the previous research, our research group found that there are two important reasons that limit its wide application, specifically: (1) the current lamp system It is difficult to achieve high-throughput detection in the true sense, and needs to be further improved; (2) Although the LAMP system does not need to increase or decrease the temperature during the detection process, it can greatly speed up the reaction speed and achieve efficient and rapid detection. However, compared with the traditional real-time PCR method Compared with the LAMP system, the stability of the LAMP system is poor, and there will often be amplification failures caused by sample nucleic acid extraction failures or excessive PCR inhibitors in the samples, resulting in false negative results. Therefore, in order to avoid false negatives, improve The reliability of the test results requires the introduction of an internal control amplification system to effectively monitor the process of sample processing and testing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (loop mediated isothermal amplification) detection primer combination and kit for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene
  • LAMP (loop mediated isothermal amplification) detection primer combination and kit for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 Establishment of GAPDH-LAMP detection system

[0022] (1) With a highly conserved target sequence on the human GAPDH gene, primers are designed, the target sequence is 185bp long, specifically:

[0023] GAACCAGCACCGATCACCTCCCATCGGGCCAATCTCAGTCCCTCCCCCCTACGTCGGGGCCCACACGCTCGGTGCGTGCCCAGTTGAACCAGGCGGCTGCGGAAAAAAAAAAGCGGGGAGAAAGTAGGGCCCGGCTACTAGCGGTTTTACGGGCGCACGTAGCTCAGGCCTCAAGACCTTGGGC (SEQ ID No. 1)

[0024] The primer sequences are shown in Table 1.

[0025] Table 1

[0026]

[0027] (2) The kit used includes the amplification reaction system. The total volume of the amplification reaction system is 25 μL, which includes 12.5 μL of 2× reaction buffer (RM), primer F3: 1 μL (final concentration: 0.2 μmol / L) , primer B3: 1 μL (final concentration 0.2 μmol / L), primer FIP: 0.5 μL (final concentration 1.6 μmol / L), primer BIP: 1 μL (final concentration 1.6 μmol / L), primer LF: 1 μL (final concentration 0.8 μmol / L) / L), primer LB: 1 μL (final concentration 0.8...

Embodiment 2

[0029] Example 2 LAMP detection of GAPDH gene

[0030] Construct the TA cloning plasmid containing the target sequence (SEQ ID No.1), and prepare duplicate samples of gradient concentration, the specific concentration is 10 3 copies / ml, 10 4 copies / ml, 10 5 copies / ml, 10 6 copies / ml, 10 7 copies / ml, 10 8 copies / ml, detected with the GAPDH-LAMP reaction system established in Example 1, all can be detected, the results are as follows figure 1 shown. Among them, A1: human peripheral blood genomic DNA as a template, A2: 10 8 Copies / ml of plasmid samples, A3: 10 7 Copies / ml of plasmid samples, A4: 10 6 Copies / ml of plasmid samples, A5: 10 5 Copies / ml of plasmid samples, A6: 10 4 Copies / ml of plasmid samples, A7:10 3Copies / ml plasmid sample, A8: Negative control sample. After 60 minutes of amplification, the systems of A1-A7 samples all turned green and cloudy, showing a positive result; A8 was a negative control, and after 60 minutes of amplification, there was no cha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection primer combination and kit for a GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene. The primer combination is designed in the sequence shown as SEQ ID No.1 as a target sequence and comprises F3, B3, FIP, BIP, LF and LB. When the primer combination is applied to an LAMP (loop mediated isothermal amplification) detection kit, results show that nonspecific amplification in primers and nonspecific binding amplification between the primers and a template are avoided for the primer combination, An LAMP amplified internal reference quality control system for a humanized sample is established successfully, and preliminary foundation is laid for widespread clinical use of the LAMP method in future.

Description

technical field [0001] The invention relates to a primer combination and a kit for GAPDH gene detection, belonging to the field of biotechnology. Background technique [0002] GAPDH or G3PDH is the English abbreviation of glyceraldehyde-3-phosphate dehydrogenase (glyceraldehyde-3-phosphatedehydrogenase). The enzyme is an enzyme in the glycolysis reaction, consisting of four subunits of 30-40kDa, with a molecular weight of 146kDa. The enzyme gene is a housekeeping gene, which is expressed at a high level in almost all tissues, and the protein expression in the same kind of cells or tissues is generally constant, and is not affected by the partial recognition sites contained, phorbol lipids, etc. Therefore, it is widely used as a standardized internal reference for PCR, extraction of total RNA, poly(A)+RNA, Western blot and other experimental operations. [0003] With the development of laboratory medicine, some molecular biology techniques, such as PCR and strand displaceme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6844C12Q1/6876C12Q2600/166C12Q2531/119C12Q2545/101
Inventor 邢志芳曹国君
Owner 曹国君
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products