LAMP (loop mediated isothermal amplification) detection primer combination and kit for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene
A gene detection and primer combination technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of sample nucleic acid extraction failure, poor stability, and amplification failure.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 Establishment of GAPDH-LAMP detection system
[0022] (1) With a highly conserved target sequence on the human GAPDH gene, primers are designed, the target sequence is 185bp long, specifically:
[0023] GAACCAGCACCGATCACCTCCCATCGGGCCAATCTCAGTCCCTCCCCCCTACGTCGGGGCCCACACGCTCGGTGCGTGCCCAGTTGAACCAGGCGGCTGCGGAAAAAAAAAAGCGGGGAGAAAGTAGGGCCCGGCTACTAGCGGTTTTACGGGCGCACGTAGCTCAGGCCTCAAGACCTTGGGC (SEQ ID No. 1)
[0024] The primer sequences are shown in Table 1.
[0025] Table 1
[0026]
[0027] (2) The kit used includes the amplification reaction system. The total volume of the amplification reaction system is 25 μL, which includes 12.5 μL of 2× reaction buffer (RM), primer F3: 1 μL (final concentration: 0.2 μmol / L) , primer B3: 1 μL (final concentration 0.2 μmol / L), primer FIP: 0.5 μL (final concentration 1.6 μmol / L), primer BIP: 1 μL (final concentration 1.6 μmol / L), primer LF: 1 μL (final concentration 0.8 μmol / L) / L), primer LB: 1 μL (final concentration 0.8...
Embodiment 2
[0029] Example 2 LAMP detection of GAPDH gene
[0030] Construct the TA cloning plasmid containing the target sequence (SEQ ID No.1), and prepare duplicate samples of gradient concentration, the specific concentration is 10 3 copies / ml, 10 4 copies / ml, 10 5 copies / ml, 10 6 copies / ml, 10 7 copies / ml, 10 8 copies / ml, detected with the GAPDH-LAMP reaction system established in Example 1, all can be detected, the results are as follows figure 1 shown. Among them, A1: human peripheral blood genomic DNA as a template, A2: 10 8 Copies / ml of plasmid samples, A3: 10 7 Copies / ml of plasmid samples, A4: 10 6 Copies / ml of plasmid samples, A5: 10 5 Copies / ml of plasmid samples, A6: 10 4 Copies / ml of plasmid samples, A7:10 3Copies / ml plasmid sample, A8: Negative control sample. After 60 minutes of amplification, the systems of A1-A7 samples all turned green and cloudy, showing a positive result; A8 was a negative control, and after 60 minutes of amplification, there was no cha...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com