Double color fluorescent quantitative co-amplified polymerase chain reaction detection kit
A two-color fluorescence, polymerase technology, used in fluorescence/phosphorescence, microbial assay/inspection, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0012] 1. Design of primers and probes
[0013] The primers for DSCR were designed according to the sequence of DSCR1 [gi:7768679] in genebank as follows:
[0014] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';
[0015] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';
[0016] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCTTGTTC[TAMRA]-3';
[0017] The amplification product is 96bp, and its position in the gene is as follows:
[0018] cacgcgacga ggacgcattc caaatcatac tcacgggagg aatcttttac 34812197
[0019] tgtggaggtg gctggtcacg acttcttcgg aggtggcagc cgagatcggg 34812147
[0020] gtggc cag aagagaat 34812097
[0021] t aatgctgcac accagtt 34812047
[0022] The primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed according to the genebank [gi:32891804] as follows:
[0023] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';
[0024] Downstream primer GAPDR: 5'-cagctctca...
Embodiment 2
[0039] 1. Design of primers and probes
[0040] The primers for DSCR were designed according to the sequence of DSCR1 [gi:7768679] in genebank as follows:
[0041] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';
[0042] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';
[0043] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCTTGTTC[TAMRA]-3';
[0044] The primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed according to the genebank [gi:32891804] as follows:
[0045] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';
[0046] Downstream primer GAPDR: 5'-cagctctcataccatgagtcct-3';
[0047] TaqMan probe GAPDTM: 5'-[HEX]ctgcaccaccaactgcttagc[TAMRA]-3';
[0048] The positions of primer probes and amplification products in the gene are the same as those in Example 1.
[0049] 2. Two-color fluorescence quantitative PCR reaction
[0050] Mix 50ul reaction system, containing 15pmol o...
Embodiment 3
[0056] 1. Design of primers and probes
[0057] The primers for DSCR were designed according to the sequence of DSCR1 [gi:7768679] in genebank as follows:
[0058] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';
[0059] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';
[0060] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCTTGTTC[TAMRA]-3';
[0061] The primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed according to the genebank [gi:32891804] as follows:
[0062] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';
[0063] Downstream primer GAPDR: 5'-cagctctcataccatgagtcct-3';
[0064] TaqMan probe GAPDTM: 5'-[HEX]ctgcaccaccaactgcttagc[TAMRA]-3';
[0065] The positions of primer probes and amplification products in the gene are the same as those in Example 1.
[0066] 2. Two-color fluorescence quantitative PCR reaction
[0067] Mix 50ul reaction system, containing 15pmol o...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More