Double color fluorescent quantitative co-amplified polymerase chain reaction detection kit

A two-color fluorescence, polymerase technology, used in fluorescence/phosphorescence, microbial assay/inspection, biochemical equipment and methods, etc.

Active Publication Date: 2008-01-16
SHANDONG YADA PHARMA
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The results of a large number of population surveys around the world show that the incidence rate between races is almost the same. There are 3 chromosomes 21 in each somatic cell of Down syndrome, while other autosomes are 2. Lymphoblasts or amniotic fluid exfoliated cells are cultured in vitro and Chromosome preparation observation is a routine method for laboratory testing. Although this method is highly accurate, it is complex and time-consuming, and cannot be automated and high-throughput.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0012] 1. Design of primers and probes

[0013] The primers for DSCR were designed according to the sequence of DSCR1 [gi:7768679] in genebank as follows:

[0014] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';

[0015] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';

[0016] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCTTGTTC[TAMRA]-3';

[0017] The amplification product is 96bp, and its position in the gene is as follows:

[0018] cacgcgacga ggacgcattc caaatcatac tcacgggagg aatcttttac 34812197

[0019] tgtggaggtg gctggtcacg acttcttcgg aggtggcagc cgagatcggg 34812147

[0020] gtggc cag aagagaat 34812097

[0021] t aatgctgcac accagtt 34812047

[0022] The primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed according to the genebank [gi:32891804] as follows:

[0023] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';

[0024] Downstream primer GAPDR: 5'-cagctctca...

Embodiment 2

[0039] 1. Design of primers and probes

[0040] The primers for DSCR were designed according to the sequence of DSCR1 [gi:7768679] in genebank as follows:

[0041] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';

[0042] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';

[0043] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCTTGTTC[TAMRA]-3';

[0044] The primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed according to the genebank [gi:32891804] as follows:

[0045] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';

[0046] Downstream primer GAPDR: 5'-cagctctcataccatgagtcct-3';

[0047] TaqMan probe GAPDTM: 5'-[HEX]ctgcaccaccaactgcttagc[TAMRA]-3';

[0048] The positions of primer probes and amplification products in the gene are the same as those in Example 1.

[0049] 2. Two-color fluorescence quantitative PCR reaction

[0050] Mix 50ul reaction system, containing 15pmol o...

Embodiment 3

[0056] 1. Design of primers and probes

[0057] The primers for DSCR were designed according to the sequence of DSCR1 [gi:7768679] in genebank as follows:

[0058] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';

[0059] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';

[0060] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCTTGTTC[TAMRA]-3';

[0061] The primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed according to the genebank [gi:32891804] as follows:

[0062] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';

[0063] Downstream primer GAPDR: 5'-cagctctcataccatgagtcct-3';

[0064] TaqMan probe GAPDTM: 5'-[HEX]ctgcaccaccaactgcttagc[TAMRA]-3';

[0065] The positions of primer probes and amplification products in the gene are the same as those in Example 1.

[0066] 2. Two-color fluorescence quantitative PCR reaction

[0067] Mix 50ul reaction system, containing 15pmol o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reaction reagent box of double color fluorescence batching polymerase chain. Firstly, according to the distinguished DSCR sector sequence of the 21 chromosome and the GAPDH gene sequence of the 16 chromosome, the distinguished primer and the double color Taqman probe are separately synthesized, and then, the synthesis of the new chains are guided separately and simultaneously by the two pairs of primers through 45 PCR circulations in the identical expanded cushioning reacting system, and the altogether expanding of the two pairs of primers is realized. The signal changing situation of the fluorescence obtained because of the degrading of the Taqman probe in the expanding process is inspected when expanding the PCR, and the curve diagrams are obtained, and the Ct value of each gene is obtained. And therefore, the copy number ratio can be calculated, and the ploidy of the 21 chromosomes can be judged according to the ratio of the two gene copy number.

Description

technical field [0001] The invention relates to a double-color fluorescence quantitative co-amplification polymerase chain reaction detection kit, in particular to a double-color fluorescence quantitative polymerase chain reaction in vitro co-amplification PCR kit for chromosome 21 ploidy detection, which belongs to molecular biology Detection and diagnosis field. Background technique [0002] Down syndrome (Down Syndrome, DS), also known as congenital folly, is one of the most common chromosomal abnormality syndromes in live-born fetuses, with an incidence of about 1 / 600-1 / 800. The signs of DS are very diverse, usually involving abnormalities of multiple tissues and organs, but the most prominent and severe clinical manifestation is mental retardation. The main clinical features of the disease are: severe mental retardation, and the phenotype of mental retardation gradually becomes obvious with age, motor development and sexual development are retarded, and there is basica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N21/64C12Q1/68
CPCC12Q1/6851C12Q1/6876
Inventor夏庆杰杨林
OwnerSHANDONG YADA PHARMA