Double color fluorescent quantitative co-amplified polymerase chain reaction detection kit

A two-color fluorescence, co-amplification technology, applied in the direction of fluorescence/phosphorescence, material excitation analysis, etc., can solve the problems of time-consuming, inability to realize automation and high-throughput detection, technical complexity, etc.

Active Publication Date: 2009-09-02
SHANDONG YADA PHARMA
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The results of a large number of population surveys around the world show that the incidence rate between races is almost the same. There are 3 chromosomes 21 in each somatic cell of Down syndrome, while other autosomes are 2. Lymphoblasts or amniotic fluid exfoliated cells are cultured in vitro and Chromosome preparation observation is a routine method for laboratory testing. Although this method is highly accurate, it is complex and time-consuming, and cannot be automated and high-throughput.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0012] 1. Design of primers and probes

[0013] According to the sequence of DSCR1[gi:7768679] in genebank, the primers of DSCR were designed as follows:

[0014] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';

[0015] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';

[0016] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCCTTGTTC[TAMRA]-3';

[0017] The amplified product is 96bp, and its position in the gene is as follows:

[0018] cacgcgacga ggacgcattc caaatcatac tcacgggagg aatcttttac 34812197

[0019] tgtggaggtg gctggtcacg acttcttcgg aggtggcagc cgagatcggg 34812147

[0020] gtggc cag aagagaat 34812097

[0021] t aatgctgcacaccagtt 34812047

[0022] According to [gi: 32891804] in genebank, primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed as follows:

[0023] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';

[0024] Downstream primer GAPDR: 5'-cagctctcataccatga...

Embodiment 2

[0039] 1. Design of primers and probes

[0040] According to the sequence of DSCR1[gi:7768679] in genebank, the primers of DSCR were designed as follows:

[0041] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';

[0042] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';

[0043] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCCTTGTTC[TAMRA]-3';

[0044] According to [gi: 32891804] in genebank, primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed as follows:

[0045] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';

[0046] Downstream primer GAPDR: 5'-cagctctcataccatgagtcct-3';

[0047] TaqMan probe GAPDTM: 5'-[HEX]ctgcaccaccaactgcttagc[TAMRA]-3';

[0048] The positions of the primer probe and the amplification product in the gene are the same as in Example 1.

[0049] 2. Two-color fluorescent quantitative PCR reaction

[0050] Mix 50ul reaction system, containing 15pmol each ...

Embodiment 3

[0056] 1. Design of primers and probes

[0057] According to the sequence of DSCR1[gi:7768679] in genebank, the primers of DSCR were designed as follows:

[0058] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';

[0059] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';

[0060] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCCTTGTTC[TAMRA]-3';

[0061] According to [gi: 32891804] in genebank, primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed as follows:

[0062] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';

[0063] Downstream primer GAPDR: 5'-cagctctcataccatgagtcct-3';

[0064] TaqMan probe GAPDTM: 5'-[HEX]ctgcaccaccaactgcttagc[TAMRA]-3';

[0065] The positions of the primer probe and the amplification product in the gene are the same as in Example 1.

[0066] 2. Two-color fluorescent quantitative PCR reaction

[0067] Mix 50ul reaction system, containing 15pmol of ea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a two-color fluorescent quantitative co-amplification polymerase chain reaction kit. Firstly, the specific primers and two-color Taqman probes are respectively synthesized according to the specific DSCR segment sequence of No. 21 chromosome and the GAPDH gene sequence on No. 16 chromosome, and then In the same amplification buffer reaction system, after 45 PCR cycles, the two pairs of primers are simultaneously guided to synthesize new strands, and the co-amplification of the two pairs of primers is realized. During the PCR amplification, the intensity change of the fluorescent signal obtained due to the degradation of the Taqman probe was detected during the amplification process, and the respective amplification curves were obtained, and then the Ct value of each gene was obtained. Thereby calculating their copy number ratio, and then further judging the ploidy of chromosome 21 according to the ratio of the copy numbers of the two genes.

Description

technical field [0001] The invention relates to a two-color fluorescent quantitative co-amplification polymerase chain reaction detection kit, in particular to a two-color fluorescent quantitative polymerase chain reaction in vitro co-amplification PCR kit for chromosome 21 ploidy detection, which belongs to molecular biology The field of detection and diagnosis. Background technique [0002] Down syndrome (Down Syndrome, DS), also known as congenital stupidity, is one of the most common chromosomal abnormal syndromes in live births, with an incidence rate of about 1 / 600-1 / 800. The signs of DS are very diverse, usually involving abnormalities of various tissues and organs, but its most prominent and severe clinical manifestation is mental retardation. The main clinical features of the disease are: severe mental retardation, and the phenotype of mental retardation gradually becomes more obvious with age, motor development and sexual development are delayed, and there is basi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N21/64C12Q1/68
CPCC12Q1/6851C12Q1/6876
Inventor夏庆杰杨林
OwnerSHANDONG YADA PHARMA