Double color fluorescent quantitative co-amplified polymerase chain reaction detection kit
A two-color fluorescence, co-amplification technology, applied in the direction of fluorescence/phosphorescence, material excitation analysis, etc., can solve the problems of time-consuming, inability to realize automation and high-throughput detection, technical complexity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0012] 1. Design of primers and probes
[0013] According to the sequence of DSCR1[gi:7768679] in genebank, the primers of DSCR were designed as follows:
[0014] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';
[0015] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';
[0016] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCCTTGTTC[TAMRA]-3';
[0017] The amplified product is 96bp, and its position in the gene is as follows:
[0018] cacgcgacga ggacgcattc caaatcatac tcacgggagg aatcttttac 34812197
[0019] tgtggaggtg gctggtcacg acttcttcgg aggtggcagc cgagatcggg 34812147
[0020] gtggc cag aagagaat 34812097
[0021] t aatgctgcacaccagtt 34812047
[0022] According to [gi: 32891804] in genebank, primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed as follows:
[0023] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';
[0024] Downstream primer GAPDR: 5'-cagctctcataccatga...
Embodiment 2
[0039] 1. Design of primers and probes
[0040] According to the sequence of DSCR1[gi:7768679] in genebank, the primers of DSCR were designed as follows:
[0041] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';
[0042] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';
[0043] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCCTTGTTC[TAMRA]-3';
[0044] According to [gi: 32891804] in genebank, primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed as follows:
[0045] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';
[0046] Downstream primer GAPDR: 5'-cagctctcataccatgagtcct-3';
[0047] TaqMan probe GAPDTM: 5'-[HEX]ctgcaccaccaactgcttagc[TAMRA]-3';
[0048] The positions of the primer probe and the amplification product in the gene are the same as in Example 1.
[0049] 2. Two-color fluorescent quantitative PCR reaction
[0050] Mix 50ul reaction system, containing 15pmol each ...
Embodiment 3
[0056] 1. Design of primers and probes
[0057] According to the sequence of DSCR1[gi:7768679] in genebank, the primers of DSCR were designed as follows:
[0058] Upstream primer DSCRF: 5'-CAGAAATCCCAGTTCATGTTGCT-3';
[0059] Downstream primer DSCRR: 5'-CATTCCCGGGTGCCATGAACAGT-3';
[0060] TaqMan probe DSCRTM: 5'-[FAM]CAAGGCCGTGTCCCCCTTGTTC[TAMRA]-3';
[0061] According to [gi: 32891804] in genebank, primers for the internal control GAPDH [glyceraldehyde 3-phosphatedehydrogenase, glyceraldehyde triphosphate dehydrogenase] were designed as follows:
[0062] Upstream primer GAPDF: 5'-ctccctctttctttgcagcaat-3';
[0063] Downstream primer GAPDR: 5'-cagctctcataccatgagtcct-3';
[0064] TaqMan probe GAPDTM: 5'-[HEX]ctgcaccaccaactgcttagc[TAMRA]-3';
[0065] The positions of the primer probe and the amplification product in the gene are the same as in Example 1.
[0066] 2. Two-color fluorescent quantitative PCR reaction
[0067] Mix 50ul reaction system, containing 15pmol of ea...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com