Molecular marker C69483 for rapidly identifying hereditary sex of cherax quadricarinatus and application of molecular marker C69483

Abstract

The invention provides a molecular marker C69483 for rapidly identifying hereditary characters of cherax quadricarinatus and application of the molecular marker C69483. The nucleotide sequence of themolecular marker C69483 is as shown in SEQ ID No. 1, and the nucleotide sequence of a primer pair for detecting the molecular marker C69483 is a forward sequence C69483F: TCACTACGAGCCACTTCAATTTG and areverse sequence C69483R: CTGGATTTATGTGAGAGAGAGAGAGGAGG. The molecular marker C69483 provided by the invention is not influenced by the tissue specificity of the cherax quadricarinatus and the environment, and is simple to use; the molecular marker not only can quickly and efficiently identify the genetic sex of the cherax quadricarinatus, but also can promote the establishment of an all-female or high-female breeding technology of the cherax quadricarinatus, and has a wide application prospect.

Description

technical field [0001] The invention belongs to the technical field of DNA molecular markers, and in particular relates to a molecular marker C69483 for quickly identifying the genetic sex of crayfish and its application. Background technique [0002] Red-clawed crayfish (Cherax quadricarinatus) belongs to the phylum Arthropoda, Crustacea, Decapod order, and Crayfish family. It is one of the most valuable freshwater economic shrimp species in the world. Red-clawed crayfish has the breeding advantages of large individual, miscellaneous food habits, fast growth, few diseases and strong adaptability. Because of its high ratio of edible parts, delicious meat and high nutritional value, red claw shrimp is widely welcomed in Europe and the United States, and its market prospect is relatively broad. During the breeding process, male shrimps fight fiercely due to snatching mating rights, resulting in high mortality. If efficient parthenoculture can be realized, the breeding efficie...

AI Technical Summary

Problems solved by technology

At present, there is no research or report on the sex molecular markers of red crayfish. Therefore, the development of molecular markers related to the sex identification of red crayfish can realize parthenogenesis of red crayfish and improve the economic benefits of farmers. It is of great significance to the cultivation and breeding of red claw crayfish

Images