24 results about "Parthenogenesis" patented technology

The invention discloses application of a gene CsPOD7 in cucumber haploid breeding, and belongs to the technical field of molecular breeding. According to the invention, a parthenogenesis haploid induction gene CsPOD7 is cloned from cucumber, the CsPOD7 is knocked out through a CRISPR-Cas9 gene editing technology, and a cspod7 mutant is used as a male parent to be hybridized with other cucumber materials as a female parent, so that parthenogenesis haploid can be generated. The invention is the first application of the gene CsPOD7 in developing a parthenogenesis haploid induction line in dicotyledon, realizes the application of the haploid induction line based on the gene CsPOD7 in cucumber genetic breeding, accelerates the cucumber breeding process, and has huge potential application value and market prospect.

The invention discloses a method for cultivating kelp seedlings through diploid female gametophyte parthenogenesis, and belongs to the field of aquatic product engineering genetic breeding. And hybridizing the female and male single cell cloning lines of the induced protonema to obtain the tetraploid sporophyte. And the tetraploid sporophyte is mature and releases zoospores, diploid gametophytes are germinated and formed, and then male and female separation is performed to obtain diploid female gametophyte clone lines in batches. Under the culture condition provided by the invention, parthenogenesis of a diploid female gametophyte clone line is utilized for seedling culture. The diploid female gametophyte begins to ovulate after 6-7 days, and the ovulation time of the diploid female gametophyte is obviously earlier than that of haploid gametophyte in the same period and under the same condition. The 12-day ovulation rate reaches 86.5%, the 24-day sporophyte conversion rate reaches 98.3%, and most sporophyte forms are normal. In the seedling raising period, parthenogenesis seedling raising of the diploid female gametophyte is completed. The diploid female gametophyte can be used as a brand-new kelp germplasm material to be applied to kelp seedling cultivation.

Methods for improving parthenogenesis efficiency by DWT1 and BABY BOOM transcription factors in plants are provided. A rice embryo trigger transcription factor BABY BOOM1 can initiate embryogenesis when expressed in the unfertilized egg cell through a process called parthenogenesis (Khanday et al., 2019. Nature 565: 91-95). The parthenogenesis efficiency by BABY BBOM1 itself is 10-29%. This invention describes methods of high frequency of parthenogenesis by simultaneous expression of BABY BOOM and DWT1 transcription factors. When BABY BOOM1 and DWT1 are expressed together through egg cell-specific promoters, parthenogenesis efficiencies of up to 90% are achieved. These high parthenogenesis efficiencies are a prerequisite for field applications of synthetic apomixis in crop plants.

This invention discloses a gene for inducing parthenogenesis in dicotyledonous plants. ZbRWP Its applications, specifically, the parthenogenesis-inducing gene in dicotyledonous plants. ZbRWP This invention is the first to discover and verify its application in cultivating haploid or haploid induction lines of dicotyledonous plants or improving haploid induction ability. RWP This gene family possesses parthenogenetic haploid induction function in dicotyledonous plants, filling a gap in the list of parthenogenetic haploid induction genes in dicotyledonous plants. This invention lays an important foundation for broadening the application of haploid breeding technology in dicotyledonous plants and elucidating the biological mechanism of parthenogenetic haploid formation. Given the widespread use of haploid breeding technology in the current breeding industry, this invention has broad application prospects in the field of bio-breeding.

The application discloses a dicotyledon parthenogenesis induction gene BoRWP and application thereof, in particular a dicotyledon parthenogenesis induction gene BoRWP application in cultivating dicotyledon haploid or haploid induction line or improving haploid induction capacity, the application firstly discovers and verifies that RWP a gene family has parthenogenesis haploid induction function in dicotyledon, and fills the blank of dicotyledon parthenogenesis haploid induction gene. The application lays an important foundation for widening application of haploid breeding technology on dicotyledon and revealing biological mechanism of parthenogenesis haploid generation. In view of the wide use of haploid breeding technology in the current breeding industry, the application has wide application space and prospect in the field of biological breeding.

The invention provides a kelp sex specific molecular marker and application thereof, wherein the nucleotide sequence of a male marker fragment is SEQ ID NO: 1, and the nucleotide sequence of a female marker fragment is SEQ ID NO: 2. A gene sequence fragment obtained by screening is from a conserved homologous gene in a sex determining region of brown algae. The screened sex identification marker primer sequence is from a region with the highest similarity in a homologous gene coding sequence, the sex of the kelp gametophyte can be rapidly identified only through a pair of degenerate primers, the efficiency is high, the accuracy is high, and the interspecific universality is high. The method is suitable for identification of male and female mixed samples, distinguishing of parthenogenesis source and sexual reproduction source kelp sporophytes and sex identification of gametophytes of other species of kelp, and important support is provided for efficient management and research and utilization of a kelp gametophyte germplasm bank.

The invention provides a method to produce a mutant gene, wherein said gen comprises a modified promoter and wherein said gene is capable of inducing the parthenogenesis phenotype to a plant. The invention further provides said mutant gene, isolated nucleic acid molecule, construct or vector comprising the same. Also, the invention provides for a method to produce a parthenogenetic plant comprising the mutant gene, and the parthenogenetic plant thus obtained.

The invention discloses a dicotyledonous parthenogenesis induction gene RWP and application thereof, and particularly relates to application of the dicotyledonous parthenogenesis induction gene RWP in cultivation of dicotyledonous haploid or haploid induction lines or improvement of haploid induction capability. The invention discovers and verifies that the RWP gene family has the parthenogenesis haploid induction function in the dicotyledon for the first time, and fills the blank of the dicotyledon parthenogenesis haploid induction gene. The invention lays an important foundation for widening the application of haploid breeding technology on dicotyledonous plants and revealing the biological mechanism of parthenogenesis haploid production. In view of the universality of haploid breeding technology utilization in the current breeding industry, the invention has wide application space and prospect in the field of biological breeding.

Methods and compositions disclosed herein relate to genes involved in plant production and methods of using the same.

Provided are a parthenogenetic haploid induction gene DMP and an application thereof. The parthenogenetic haploid induction genes AtDMP8 and AtDMP9 are cloned from Arabidopsis thaliana. Experiments have shown that mutations of AtDMP8 and AtDMP9 can produce parthenogenetic haploid inducibility, to enable dicotyledonous crops to be induced to produce haploids via parthenogenetic means. The present invention was further verified in tomatoes, and it was also found in tomatoes that the mutation of SlDMP can produce parthenogenetic haploid inducibility. The invention lays an important foundation for broadening the application of haploid breeding technology on dicotyledonous plants and revealing the biological mechanism of parthenogenetic haploid production. Given the universality of the utilization of haploid breeding technology in the current breeding industry, the invention has very wide application space and market prospects.

The present invention provides the nucleotide and amino acid sequences of parthenogenesis genes in the genus Taraxacum and their (functional) homologues, fragments and variants thereof, which provide parthenogenesis as part of apomixis. Also provided are parthenogenetic plants and methods for preparing them, as well as molecular markers and methods for using them.

The application provides a method for genetic reactivation of individual Procyprinus palpebrosus, comprising the following steps: S1, taking the gonadal tissue of Procyprinus palpebrosus, washing, cutting, adding L-15 culture medium containing double antibodies and DPBS buffer solution to centrifuge the gonadal tissue; S2, water-bathing the gonadal tissue to obtain recovered gonadal tissue; S3, digesting the recovered gonadal tissue, filtering, centrifuging and purifying to obtain germ stem cells; S4, injecting morpholino to obtain rare gobi-ocypris rarus with deleted primordial germ cells; S5, transplanting the germ stem cells into the body of the rare gobi-ocypris rarus juvenile to culture, and obtaining the gametes of Procyprinus palpebrosus; and S6, fertilizing the generated gametes of Procyprinus palpebrosus to obtain the individual Procyprinus palpebrosus. The application successfully obtains the sperm of Procyprinus palpebrosus by using the cryopreserved gonadal tissue and the technology of parthenogenesis, and provides a feasible way for the individual genetic reactivation of rare and endangered fish species.

This invention provides a sex-specific molecular marker for kelp and its application, wherein the nucleotide sequence of the male marker fragment is SEQ ID NO:1, and the nucleotide sequence of the female marker fragment is SEQ ID NO:2. The gene sequence fragments obtained by this invention are derived from conserved homologous genes in the sex-determining regions of brown algae. The primer sequences for the selected sex identification markers are derived from the regions with the highest similarity in the coding sequences of the homologous genes. This method enables rapid identification of the sex of kelp gametophytes using only a pair of degenerate primers, offering high efficiency, high accuracy, and high interspecies compatibility. This method is applicable to the identification of mixed male and female samples, the differentiation of kelp sporophytes from parthenogenesis and sexual reproduction, and the sex identification of gametophytes in other species of the Laminariales order, providing important support for the efficient management and research utilization of kelp gametophyte germplasm banks.

The present invention discloses a method for cultivating double haploid of fragrant green vegetable by inducing parthenogenesis through distant hybridization. Using non-heading Chinese cabbage 'Fragrant Green Vegetable' as the female parent and broad bean 'Japanese Big White Skin' as the male parent, artificial pollination hybridization is carried out, and brassinolide solution is sprayed to induce parthenogenesis, so as to cultivate the double haploid of fragrant green vegetable. As long as artificial cross-pollination is carried out and combined with the application of brassinolide solution, the double haploid of fragrant green vegetable can be obtained, which can accelerate the rate of cultivating high-quality germplasm resources of fragrant green vegetable.

This invention discloses a gene for inducing parthenogenesis in dicotyledonous plants. RWP Its applications, specifically, the parthenogenesis-inducing gene in dicotyledonous plants. RWP This invention is the first to discover and verify its application in cultivating haploid or haploid induction lines of dicotyledonous plants or improving haploid induction ability. RWP This gene family possesses parthenogenetic haploid induction function in dicotyledonous plants, filling a gap in the list of parthenogenetic haploid induction genes in dicotyledonous plants. This invention lays an important foundation for broadening the application of haploid breeding technology in dicotyledonous plants and elucidating the biological mechanism of parthenogenetic haploid formation. Given the widespread use of haploid breeding technology in the current breeding industry, this invention has broad application prospects in the field of bio-breeding.

The invention provides a novel method for realizing apomixis of plants. By removing egg cell expression inhibition factors of endogenous parthenogenesis genes (including BBM1, BBM4, CPRO1, CPRO2, WUS and the like) of rice and combining with a MiMe strategy, a novel apomixis method which only depends on gene editing is realized. According to the method, a gene editing means is adopted completely, an egg cell ectopic expression technology is not involved, apomixis is achieved by removing an egg cell expression inhibition factor of a rice endogenous parthenogenesis gene, the purpose of not involved transgenosis is achieved, and production and application of an artificial apomixis technology in crops are achieved.

The present invention discloses a method for cultivating kelp seedlings using parthenogenesis of diploid female gametophytes, belonging to the field of genetic breeding in aquatic engineering. Female and male single-cell clones of induced conchoderma are hybridized to obtain tetraploid sporophytes. The tetraploid sporophytes mature and release zoospores, which germinate to form diploid gametophytes. Male and female gametophytes are then separated and batches of diploid female gametophyte clones are obtained. Under the culture conditions provided by the present invention, seedlings are cultivated using parthenogenesis of the diploid female gametophyte clones. These diploid female gametophytes begin to ovulate within 6 to 7 days, significantly earlier than the ovulation time of haploid gametophytes under the same conditions during the same period. The ovulation rate reaches 86.5% on day 12, and the sporophyte conversion rate reaches 98.3% on day 24. Most of the sporophytes have normal morphology. During the seedling cultivation period, the diploid female gametophytes complete parthenogenesis. The diploid female gametophytes can be used as a new kelp germplasm material for kelp seedling cultivation.

This invention discloses a method for altering the reproductive pattern of *Trichogramma pseudooligophthalmus*. The method includes treating *Trichogramma pseudooligophthalmus* that is fully engaged in parthenogenesis with a rifampicin-honey aqueous solution at a concentration of 0.1-0.5 mg / ml. After treatment, the *Trichogramma pseudooligophthalmus* is used to parasitize brown planthopper eggs to obtain male F1 generation *Trichogramma pseudooligophthalmus*. This invention provides a model for exploring the reproductive methods of *Wolbachia* in hymenoptera, lays the foundation for further exploration of the reproductive patterns of *Trichogramma pseudooligophthalmus*, and also provides a model for the removal of endosymbiotic bacteria in other arthropods.

The present invention belongs to the fields of biotechnology and plant breeding. Specifically disclosed are a gene having parthenogenesis-inducing ability in plants, and the use thereof in plant breeding such as induction of haploid formation and apomixis. By means of regulating the expression of a gene that encodes a protein having parthenogenesis-inducing ability, the transition of egg cells into the embryonic development fate is effectively realized, thereby inducing parthenogenesis. The gene and a corresponding induction method therefor can be applied to related plant breeding processes such as the production of haploids and synthetic apomixis.

The invention belongs to the technical field of crop breeding, and particularly relates to a preparation method and application of a parthenogenesis haploid induction line. According to the parthenogenesis female parent haploid induction gene GEX3 and the application thereof, female parent haploid induction without hybridization is achieved in monocotyledonous and dicotyledonous plants such as arabidopsis thaliana, tomatoes, soybeans and rice by editing a male parent expression gene GEX3, the process is simple, and the induction rate is high.

The invention belongs to the field of biotechnology and plant breeding, and particularly discloses a gene with parthenogenesis induction capacity in plants and application of the gene in plant breeding such as haploid formation induction and apomixis induction. According to the present invention, the expression of the gene coding the protein with the parthenogenesis induction ability is regulated, such that the change from the egg cell to the embryonic development fate is effectively achieved so as to induce parthenogenesis; the gene and the corresponding induction method thereof can be applied to related plant breeding processes such as haploid production and apomixis synthesis.

The present invention discloses a molecular marker for the genetic sex of disease-resistant grass carp. Its DNA sequence is shown in Figure 1. The present invention provides two pairs of primers for identifying the genetic sex of males and females: Primer pair 1 comprises: forward primer 1: GCATACGGACAGTACAGGTGAAG; reverse primer 1: GAAACACAAGATGGTGCCAAATA; and primer pair 2 comprises: forward primer 2: TCAGTGACTGGGAGACTTGGATA; reverse primer 2: AATTTTCCTCTGAGCTTCACACC. The present invention has the following advantages over existing technologies: 1. The method for screening male-specific fragments is simple and widely applicable; 2. It provides an efficient technical approach for the parthenogenesis of disease-resistant grass carp; and 3. It can produce an all-female, disease-resistant grass carp population with multiple excellent traits, significantly improving aquaculture efficiency.

The present invention provides a method of generating a mutated gene, wherein the gene comprises a modified promoter and wherein the gene is capable of inducing a parthenocarpic phenotype in a plant. The present invention also provides the mutated gene, an isolated nucleic acid molecule, a construct or vector comprising the same. Furthermore, the present invention provides a method of producing a parthenocarpic plant comprising the mutated gene, and a parthenocarpic plant obtained thereby. The mutated gene is based on the PAR gene of Taraxacum officinale having SEQ ID NO: 5 and orthologs thereof.