Supercharge Your Innovation With Domain-Expert AI Agents!

Molecular marker and application of rice amylose content micro-controlling gene agpl3

A technology of amylose content and molecular markers, applied in the field of agricultural biotechnology engineering, can solve problems such as poor accuracy, and achieve the effect of overcoming long time periods and reducing amylose content

Active Publication Date: 2019-05-07
ZHEJIANG NORMAL UNIVERSITY
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the effects of one cause and multiple effects, multiple causes and one effect, regulatory genes, and modified genes among genes, there are often large differences between individual phenotypes and genotypes, so the accuracy of individual selection through field phenotypic traits is poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker and application of rice amylose content micro-controlling gene agpl3
  • Molecular marker and application of rice amylose content micro-controlling gene agpl3
  • Molecular marker and application of rice amylose content micro-controlling gene agpl3

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1. Using the Indel marker AGPL3-m to identify polymorphisms in the japonica rice Nipponbare with low amylose content and the indica rice Teqing with high amylose content

[0062] The specific method is as follows: select the rice materials Nipponbare and Teqing, cross the Nipponbare and Teqing to obtain its F1, and use the primer AGPL3-m to identify its polymorphism ( figure 1 ).

[0063] 1. DNA extraction

[0064] 1) Prepare DNA extraction buffer:

[0065] Add 1 volume of DNA extraction solution (0.35M sorbitol; 0.1M Tris, pH8.2; 0.005MEDTA; the rest is water), 1 volume of nuclear lysis solution (0.2M Tris, pH7.5; 0.05M EDTA; 2M NaCl; 0.055MCTAB; the rest is water) and 0.4 volume of 5% (mass concentration) sarkosyl solution (i.e. the aqueous solution of sodium lauryl-N-methylglycinate); finally add sodium bisulfite to prepare DNA extraction buffer solution; the final concentration of sodium bisulfite in DNA extraction buffer was 0.02M.

[0066] The preparat...

Embodiment 2

[0085] Example 2. Using the Indel molecular marker AGPL3-m to identify sequence differences between the japonica rice Nipponbare with low amylose content and the indica rice Teqing with high amylose content

[0086] The specific method is: use the Indel molecular marker AGPL3-m to perform PCR amplification on the genomic DNA of Nipponbare and Teqing, entrust Shanghai Yingjun Biotechnology Co., Ltd. to sequence the amplified products, and compare the differences in their sequences ( figure 2 ).

[0087] 1. DNA extraction

[0088] 1) Prepare DNA extraction buffer:

[0089] With embodiment 1.

[0090] 2), the paddy rice blade of above-mentioned Nipponbare and special green is carried out as follows respectively:

[0091] With embodiment 1.

[0092] 3) PCR amplification

[0093] With embodiment 1.

[0094] 4) Recovery of PCR products

[0095] The recovery of PCR products was carried out by using the PCR product recovery kit (spin column type, catalog number: DP1403) develo...

Embodiment 3

[0097] Example 3. Using the Indel marker AGPL3-m to carry out assisted selection breeding for low amylose content

[0098] The specific method is: the gene donor parent Nipponbare with low amylose content, and the indica rice variety Teqing with high amylose content are sequentially crossed, backcrossed and selfed, and the resulting progeny are assisted by the selection of the molecular marker AGPL3-m, and selected to separate Individual plants with the same band type as the Japan Sunshine band type in the population were used for breeding improvement.

[0099] 1. DNA extraction

[0100] 1) Prepare DNA extraction buffer:

[0101] With embodiment 1.

[0102] 2), above-mentioned Nipponbare, Teqing, and the rice blades of the gained offspring are respectively processed as follows:

[0103] With embodiment 1.

[0104] 2. Indel marker detection

[0105] 1), PCR amplification

[0106] With embodiment 1.

[0107] 2), electrophoresis detection

[0108] With embodiment 1.

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker AGPL3-m for rice amylose content micro-control genes AGPL3. The molecular marker is characterized in that paddy rice is used as a species, primers of the molecular marker are selectively primer pairs, nucleotide sequences are 5'->3', the molecular marker AGPL3-m in a forward direction is shown as GAAGATAGACGACACAGGAAGAGT, and the molecular marker AGPL3-m in a reverse direction is shown as ACTGAAATTGAGGTTTGGCAT. The invention further discloses application of the molecular marker AGPL3-m. The molecular marker AGPL3-m can be used for identifying rice amylose contents of the paddy rice and / or assisting in selectively breeding progenies of the paddy rice. Single plants, with banding patterns consistent with Nipponbare banding patterns, of the progenies are selected for breeding when the progenies are progenies of Nipponbare indica rice.

Description

technical field [0001] The invention belongs to agricultural biotechnology engineering, and particularly relates to a molecular marker related to rice amylose content regulation gene AGPL3 and its application. Background technique [0002] High yield and high quality have always been the long-term goal of rice breeding. After long-term efforts, especially the use of hybrid rice technology, my country has achieved universally recognized achievements in rice production. However, in the past, how to solve people's food and clothing problems has always been the first priority, so the focus of rice breeding work is mostly concentrated on the cultivation of new high-yield varieties of rice, resulting in a serious lag in the breeding of high-quality rice, especially some high-yield hybrid rice General deviations in quality. [0003] Another main reason for the slow progress in rice quality improvement is the complexity of rice quality inheritance and the limitations of traditiona...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 饶玉春徐江民曾大力钱前胡瑚倩马路肖飒清
Owner ZHEJIANG NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More