Molecular marker and application of micro-control gene ssivb of rice amylose content

A technology of amylose content and molecular markers, applied in the field of agricultural biotechnology engineering, can solve the problems of poor accuracy and achieve the effect of overcoming the long time period

Active Publication Date: 2015-10-28
CHINA NAT RICE RES INST
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the effects of one cause and multiple effects, multiple causes and one effect, regulatory genes, and modified genes among genes, there are often large differences between individual phenotypes and genotypes, so the accuracy of individual selection through field phenotypic traits is poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker and application of micro-control gene ssivb of rice amylose content
  • Molecular marker and application of micro-control gene ssivb of rice amylose content
  • Molecular marker and application of micro-control gene ssivb of rice amylose content

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1. Using the Indel marker SSIVb-m to identify polymorphisms in the japonica rice Nipponbare with low amylose content and the indica rice Teqing with high amylose content

[0057] The specific method is as follows: select the rice materials Nipponbare and Teqing from the germplasm resource bank of the China Rice Research Institute, and use Nipponbare and Teqing to obtain the F1, and use the primer SSIVb-m to identify its polymorphism ( figure 1 ).

[0058] 1. DNA extraction

[0059] 1) Prepare DNA extraction buffer:

[0060] Add 1 volume of DNA extraction solution (0.35M sorbitol; 0.1M Tris, pH8.2; 0.005M EDTA; the rest is water), 1 volume of nuclear lysis solution (0.2M Tris, pH7.5; 0.05M EDTA ; 2M NaCl; 0.055M CTAB; the rest is water) and 0.4 volume of 5% (mass concentration) sarkosyl solution (that is, the aqueous solution of sodium lauryl-N-methylglycinate); finally add sodium bisulfite to prepare DNA Extraction buffer; final concentration of sodium bisulf...

Embodiment 2

[0080] Example 2. Using the Indel molecular marker SSIVb-m to identify sequence differences between the japonica rice Nipponbare with low amylose content and the indica rice Teqing with high amylose content

[0081] The specific method is: use the Indel molecular marker SSIVb-m to perform PCR amplification on the genomic DNA of Nipponbare and Teqing, entrust Shanghai Yingjun Biotechnology Co., Ltd. to sequence the amplified products, and compare the differences in their sequences ( figure 2 ).

[0082] 1. DNA extraction

[0083] 1) Prepare DNA extraction buffer:

[0084] With embodiment 1.

[0085] 2), the rice leaves of the above-mentioned Nipponbare and Teqing were respectively treated as follows:

[0086] With embodiment 1.

[0087] 3) PCR amplification

[0088] With embodiment 1.

[0089] 4) Recovery of PCR products

[0090] The recovery of PCR products was carried out by using the PCR product recovery kit (centrifugal column type, catalog number: DP1403) developed...

Embodiment 3

[0092] Example 3. Using the Indel marker SSIVb-m to carry out assisted selection breeding for low amylose content

[0093] The specific method is: the gene donor parent Nipponbare with low amylose content is crossed, backcrossed and self-crossed with Teqing, an indica rice variety with high amylose content, and the segregation population is selected by the assisted selection of the resulting offspring combined with the molecular marker SSIVb-m The individual plants with the same middle zone type and the Japanese sunny zone type are used for breeding and improvement.

[0094] 1. DNA extraction

[0095] 1) Prepare DNA extraction buffer:

[0096] With embodiment 1.

[0097] 2), the paddy leaves of the above-mentioned Nipponbare, Teqing, and the resulting offspring were respectively treated as follows:

[0098] With embodiment 1.

[0099] 2. Indel marker detection

[0100] 1), PCR amplification

[0101] With embodiment 1.

[0102] 2), electrophoresis detection

[0103] Wit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker SSIVb-m of a rice amylose content micro-control gene SSIVb. According to the molecular marker SSIVb-m, paddy is taken as a species, primers of the molecular marker are selected from a primer pair shown in a drawing, the nucleotide sequence of the molecular marker is 5'-3', the forward sequence of the SSIVb-m is ATTTTCCTCAGTAGTAAGCAAGAGTT, and the reverse sequence of the SSIVb-m is AAAACATTGCTCCAAAACAGC. The invention further simultaneously discloses application of the molecular marker SSIVb-m, wherein the molecular marker SSIVb-m is applied to the assay of paddy rice amylose content and / or the assisted selective breeding of descendants thereof. When the descendants of Nipponbare and Teqing are screened, single plants with banding patterns consistent with those of Nipponbare are selected from the descendants and are applied to breeding improvement.

Description

technical field [0001] The invention belongs to agricultural biotechnology engineering, and particularly relates to a molecular marker SSIVb-m related to rice amylose content regulation gene SSIVb and a method for obtaining the same. Background technique [0002] High yield and high quality have always been the long-term goal of rice breeding. After long-term efforts, especially the use of hybrid rice technology, my country has achieved universally recognized achievements in rice production. However, in the past, how to solve people's food and clothing problems has always been the first priority, so the focus of rice breeding work is mostly concentrated on the cultivation of new high-yield varieties of rice, resulting in a serious lag in the breeding of high-quality rice, especially some high-yield hybrid rice General deviations in quality. [0003] Another main reason for the slow progress in rice quality improvement is the complexity of rice quality inheritance and the l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor曾大力钱前李家洋田志喜杨窑龙张光恒郭龙彪高振宇朱丽胡江董国军胡兴民颜美仙
OwnerCHINA NAT RICE RES INST